SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-40c9a66f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -942.424679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.424679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.931780 (E_RNA) where: Base-Base interactions energy: -704.766 where: short stacking energy: -338.686 Base-Backbone interact. energy: 5.542 local terms energy: -395.708044 where: bonds (distance) C4'-P energy: -90.120 bonds (distance) P-C4' energy: -86.553 flat angles C4'-P-C4' energy: -88.315 flat angles P-C4'-P energy: -48.216 tors. eta vs tors. theta energy: -82.504 Dist. restrs. and SS energy: 115.757 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -763.911097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.911097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.378765 (E_RNA) where: Base-Base interactions energy: -562.606 where: short stacking energy: -283.418 Base-Backbone interact. energy: -0.911 local terms energy: -367.862668 where: bonds (distance) C4'-P energy: -85.767 bonds (distance) P-C4' energy: -90.552 flat angles C4'-P-C4' energy: -87.733 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -67.317 Dist. restrs. and SS energy: 130.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1021.759205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.759205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.096235 (E_RNA) where: Base-Base interactions energy: -744.113 where: short stacking energy: -321.431 Base-Backbone interact. energy: -1.122 local terms energy: -382.860745 where: bonds (distance) C4'-P energy: -82.968 bonds (distance) P-C4' energy: -84.277 flat angles C4'-P-C4' energy: -86.296 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -74.252 Dist. restrs. and SS energy: 69.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1143.816791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.816791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.011950 (E_RNA) where: Base-Base interactions energy: -849.288 where: short stacking energy: -362.345 Base-Backbone interact. energy: 0.467 local terms energy: -376.190629 where: bonds (distance) C4'-P energy: -75.970 bonds (distance) P-C4' energy: -80.390 flat angles C4'-P-C4' energy: -92.523 flat angles P-C4'-P energy: -48.293 tors. eta vs tors. theta energy: -79.014 Dist. restrs. and SS energy: 44.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -959.406718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.406718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.573247 (E_RNA) where: Base-Base interactions energy: -701.170 where: short stacking energy: -292.773 Base-Backbone interact. energy: -0.611 local terms energy: -357.792064 where: bonds (distance) C4'-P energy: -82.004 bonds (distance) P-C4' energy: -86.498 flat angles C4'-P-C4' energy: -75.058 flat angles P-C4'-P energy: -48.234 tors. eta vs tors. theta energy: -65.999 Dist. restrs. and SS energy: 63.417 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -830.519889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.519889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.588220 (E_RNA) where: Base-Base interactions energy: -587.651 where: short stacking energy: -250.886 Base-Backbone interact. energy: 0.146 local terms energy: -343.083926 where: bonds (distance) C4'-P energy: -78.035 bonds (distance) P-C4' energy: -85.640 flat angles C4'-P-C4' energy: -67.732 flat angles P-C4'-P energy: -56.409 tors. eta vs tors. theta energy: -55.268 Dist. restrs. and SS energy: 63.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -795.384900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.384900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.979442 (E_RNA) where: Base-Base interactions energy: -622.390 where: short stacking energy: -281.645 Base-Backbone interact. energy: -1.915 local terms energy: -321.673884 where: bonds (distance) C4'-P energy: -70.826 bonds (distance) P-C4' energy: -83.034 flat angles C4'-P-C4' energy: -78.020 flat angles P-C4'-P energy: -23.539 tors. eta vs tors. theta energy: -66.254 Dist. restrs. and SS energy: 113.845 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -806.874339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.874339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.366854 (E_RNA) where: Base-Base interactions energy: -617.485 where: short stacking energy: -250.218 Base-Backbone interact. energy: 1.181 local terms energy: -298.063707 where: bonds (distance) C4'-P energy: -74.177 bonds (distance) P-C4' energy: -65.043 flat angles C4'-P-C4' energy: -56.925 flat angles P-C4'-P energy: -51.683 tors. eta vs tors. theta energy: -50.235 Dist. restrs. and SS energy: 70.743 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -789.982367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.982367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.006648 (E_RNA) where: Base-Base interactions energy: -567.006 where: short stacking energy: -252.460 Base-Backbone interact. energy: -1.564 local terms energy: -305.436563 where: bonds (distance) C4'-P energy: -81.847 bonds (distance) P-C4' energy: -79.212 flat angles C4'-P-C4' energy: -57.190 flat angles P-C4'-P energy: -35.753 tors. eta vs tors. theta energy: -51.435 Dist. restrs. and SS energy: 47.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -812.038704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.038704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.122381 (E_RNA) where: Base-Base interactions energy: -582.071 where: short stacking energy: -238.267 Base-Backbone interact. energy: -1.819 local terms energy: -313.232753 where: bonds (distance) C4'-P energy: -60.002 bonds (distance) P-C4' energy: -73.807 flat angles C4'-P-C4' energy: -78.279 flat angles P-C4'-P energy: -46.183 tors. eta vs tors. theta energy: -54.962 Dist. restrs. and SS energy: 48.334 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1129.355488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.355488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.459639 (E_RNA) where: Base-Base interactions energy: -786.230 where: short stacking energy: -348.679 Base-Backbone interact. energy: -3.708 local terms energy: -425.521660 where: bonds (distance) C4'-P energy: -87.818 bonds (distance) P-C4' energy: -90.185 flat angles C4'-P-C4' energy: -100.426 flat angles P-C4'-P energy: -58.988 tors. eta vs tors. theta energy: -88.104 Dist. restrs. and SS energy: 49.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1244.623799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.623799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.297907 (E_RNA) where: Base-Base interactions energy: -926.094 where: short stacking energy: -369.587 Base-Backbone interact. energy: -1.506 local terms energy: -385.697836 where: bonds (distance) C4'-P energy: -79.202 bonds (distance) P-C4' energy: -96.117 flat angles C4'-P-C4' energy: -84.255 flat angles P-C4'-P energy: -53.278 tors. eta vs tors. theta energy: -72.846 Dist. restrs. and SS energy: 31.924 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1085.898049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.898049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.290618 (E_RNA) where: Base-Base interactions energy: -802.171 where: short stacking energy: -307.823 Base-Backbone interact. energy: -0.534 local terms energy: -351.585368 where: bonds (distance) C4'-P energy: -95.110 bonds (distance) P-C4' energy: -82.809 flat angles C4'-P-C4' energy: -72.719 flat angles P-C4'-P energy: -33.219 tors. eta vs tors. theta energy: -67.729 Dist. restrs. and SS energy: 31.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1267.613586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.613586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.267954 (E_RNA) where: Base-Base interactions energy: -918.549 where: short stacking energy: -370.349 Base-Backbone interact. energy: -1.073 local terms energy: -409.645336 where: bonds (distance) C4'-P energy: -85.424 bonds (distance) P-C4' energy: -85.051 flat angles C4'-P-C4' energy: -84.280 flat angles P-C4'-P energy: -61.472 tors. eta vs tors. theta energy: -93.418 Dist. restrs. and SS energy: 24.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1083.635692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.635692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.357267 (E_RNA) where: Base-Base interactions energy: -772.514 where: short stacking energy: -304.507 Base-Backbone interact. energy: -2.664 local terms energy: -380.179430 where: bonds (distance) C4'-P energy: -71.586 bonds (distance) P-C4' energy: -88.324 flat angles C4'-P-C4' energy: -96.097 flat angles P-C4'-P energy: -60.416 tors. eta vs tors. theta energy: -63.757 Dist. restrs. and SS energy: 34.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1107.821370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.821370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.974861 (E_RNA) where: Base-Base interactions energy: -802.661 where: short stacking energy: -328.185 Base-Backbone interact. energy: 0.747 local terms energy: -369.060462 where: bonds (distance) C4'-P energy: -91.292 bonds (distance) P-C4' energy: -70.932 flat angles C4'-P-C4' energy: -70.089 flat angles P-C4'-P energy: -50.974 tors. eta vs tors. theta energy: -85.773 Dist. restrs. and SS energy: 26.403 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -994.966860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.966860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.779293 (E_RNA) where: Base-Base interactions energy: -734.511 where: short stacking energy: -317.206 Base-Backbone interact. energy: -2.520 local terms energy: -324.748238 where: bonds (distance) C4'-P energy: -67.528 bonds (distance) P-C4' energy: -69.939 flat angles C4'-P-C4' energy: -72.363 flat angles P-C4'-P energy: -51.615 tors. eta vs tors. theta energy: -63.304 Dist. restrs. and SS energy: 30.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -1011.085545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.085545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.905474 (E_RNA) where: Base-Base interactions energy: -728.884 where: short stacking energy: -312.450 Base-Backbone interact. energy: -2.702 local terms energy: -352.319042 where: bonds (distance) C4'-P energy: -83.261 bonds (distance) P-C4' energy: -67.498 flat angles C4'-P-C4' energy: -74.617 flat angles P-C4'-P energy: -39.230 tors. eta vs tors. theta energy: -87.713 Dist. restrs. and SS energy: 36.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -1067.847790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.847790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.267662 (E_RNA) where: Base-Base interactions energy: -767.980 where: short stacking energy: -308.442 Base-Backbone interact. energy: -0.543 local terms energy: -355.744554 where: bonds (distance) C4'-P energy: -77.627 bonds (distance) P-C4' energy: -75.262 flat angles C4'-P-C4' energy: -83.580 flat angles P-C4'-P energy: -45.903 tors. eta vs tors. theta energy: -73.372 Dist. restrs. and SS energy: 19.670 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -1045.009204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.009204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.410720 (E_RNA) where: Base-Base interactions energy: -790.563 where: short stacking energy: -316.334 Base-Backbone interact. energy: 2.538 local terms energy: -317.385466 where: bonds (distance) C4'-P energy: -68.369 bonds (distance) P-C4' energy: -73.964 flat angles C4'-P-C4' energy: -79.185 flat angles P-C4'-P energy: -25.419 tors. eta vs tors. theta energy: -70.448 Dist. restrs. and SS energy: 23.652 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1347.051083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.051083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.271850 (E_RNA) where: Base-Base interactions energy: -986.947 where: short stacking energy: -387.352 Base-Backbone interact. energy: -0.507 local terms energy: -413.816937 where: bonds (distance) C4'-P energy: -83.226 bonds (distance) P-C4' energy: -88.371 flat angles C4'-P-C4' energy: -94.322 flat angles P-C4'-P energy: -53.740 tors. eta vs tors. theta energy: -94.158 Dist. restrs. and SS energy: 17.471 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1209.523942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.523942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.465513 (E_RNA) where: Base-Base interactions energy: -843.849 where: short stacking energy: -377.675 Base-Backbone interact. energy: -1.548 local terms energy: -436.068369 where: bonds (distance) C4'-P energy: -88.227 bonds (distance) P-C4' energy: -89.560 flat angles C4'-P-C4' energy: -102.532 flat angles P-C4'-P energy: -55.216 tors. eta vs tors. theta energy: -100.534 Dist. restrs. and SS energy: 35.192 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1370.553453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.553453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.581177 (E_RNA) where: Base-Base interactions energy: -973.328 where: short stacking energy: -388.387 Base-Backbone interact. energy: -2.116 local terms energy: -452.137318 where: bonds (distance) C4'-P energy: -80.434 bonds (distance) P-C4' energy: -92.977 flat angles C4'-P-C4' energy: -100.482 flat angles P-C4'-P energy: -69.382 tors. eta vs tors. theta energy: -108.862 Dist. restrs. and SS energy: 20.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1103.824086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.824086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.472670 (E_RNA) where: Base-Base interactions energy: -792.721 where: short stacking energy: -320.390 Base-Backbone interact. energy: -2.250 local terms energy: -378.501781 where: bonds (distance) C4'-P energy: -77.136 bonds (distance) P-C4' energy: -98.065 flat angles C4'-P-C4' energy: -89.233 flat angles P-C4'-P energy: -46.747 tors. eta vs tors. theta energy: -67.321 Dist. restrs. and SS energy: 32.899 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1243.871903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.871903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.961408 (E_RNA) where: Base-Base interactions energy: -891.049 where: short stacking energy: -387.307 Base-Backbone interact. energy: -2.163 local terms energy: -407.749222 where: bonds (distance) C4'-P energy: -90.988 bonds (distance) P-C4' energy: -78.893 flat angles C4'-P-C4' energy: -90.801 flat angles P-C4'-P energy: -41.631 tors. eta vs tors. theta energy: -105.435 Dist. restrs. and SS energy: 20.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1192.948983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.948983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.758237 (E_RNA) where: Base-Base interactions energy: -844.279 where: short stacking energy: -361.757 Base-Backbone interact. energy: -2.808 local terms energy: -408.671753 where: bonds (distance) C4'-P energy: -76.742 bonds (distance) P-C4' energy: -93.264 flat angles C4'-P-C4' energy: -102.612 flat angles P-C4'-P energy: -55.839 tors. eta vs tors. theta energy: -80.215 Dist. restrs. and SS energy: 26.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -1216.469215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.469215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.010711 (E_RNA) where: Base-Base interactions energy: -889.287 where: short stacking energy: -356.056 Base-Backbone interact. energy: -2.219 local terms energy: -378.504930 where: bonds (distance) C4'-P energy: -75.338 bonds (distance) P-C4' energy: -77.543 flat angles C4'-P-C4' energy: -78.005 flat angles P-C4'-P energy: -55.364 tors. eta vs tors. theta energy: -92.255 Dist. restrs. and SS energy: 16.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -1041.869784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.869784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.500359 (E_RNA) where: Base-Base interactions energy: -745.862 where: short stacking energy: -296.047 Base-Backbone interact. energy: -1.593 local terms energy: -357.045374 where: bonds (distance) C4'-P energy: -84.750 bonds (distance) P-C4' energy: -78.296 flat angles C4'-P-C4' energy: -69.616 flat angles P-C4'-P energy: -51.551 tors. eta vs tors. theta energy: -72.832 Dist. restrs. and SS energy: 25.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -1095.605784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.605784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.698022 (E_RNA) where: Base-Base interactions energy: -796.773 where: short stacking energy: -317.881 Base-Backbone interact. energy: -0.925 local terms energy: -346.999894 where: bonds (distance) C4'-P energy: -59.685 bonds (distance) P-C4' energy: -78.205 flat angles C4'-P-C4' energy: -79.163 flat angles P-C4'-P energy: -49.865 tors. eta vs tors. theta energy: -80.082 Dist. restrs. and SS energy: 12.342 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -1089.475397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.475397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.353035 (E_RNA) where: Base-Base interactions energy: -810.029 where: short stacking energy: -319.482 Base-Backbone interact. energy: -0.185 local terms energy: -337.139091 where: bonds (distance) C4'-P energy: -65.739 bonds (distance) P-C4' energy: -81.419 flat angles C4'-P-C4' energy: -74.662 flat angles P-C4'-P energy: -42.215 tors. eta vs tors. theta energy: -73.104 Dist. restrs. and SS energy: 21.128 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1357.656277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.656277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.157143 (E_RNA) where: Base-Base interactions energy: -984.693 where: short stacking energy: -387.273 Base-Backbone interact. energy: -0.002 local terms energy: -425.462174 where: bonds (distance) C4'-P energy: -87.839 bonds (distance) P-C4' energy: -94.610 flat angles C4'-P-C4' energy: -93.162 flat angles P-C4'-P energy: -61.353 tors. eta vs tors. theta energy: -88.498 Dist. restrs. and SS energy: 15.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1451.638909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.638909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.840530 (E_RNA) where: Base-Base interactions energy: -1056.744 where: short stacking energy: -442.516 Base-Backbone interact. energy: -0.920 local terms energy: -450.176303 where: bonds (distance) C4'-P energy: -89.850 bonds (distance) P-C4' energy: -100.405 flat angles C4'-P-C4' energy: -100.433 flat angles P-C4'-P energy: -55.443 tors. eta vs tors. theta energy: -104.044 Dist. restrs. and SS energy: 19.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1273.285412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.285412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.902101 (E_RNA) where: Base-Base interactions energy: -939.203 where: short stacking energy: -379.302 Base-Backbone interact. energy: 0.639 local terms energy: -397.338434 where: bonds (distance) C4'-P energy: -76.695 bonds (distance) P-C4' energy: -81.457 flat angles C4'-P-C4' energy: -94.513 flat angles P-C4'-P energy: -52.637 tors. eta vs tors. theta energy: -92.036 Dist. restrs. and SS energy: 25.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1371.476655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.476655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.961701 (E_RNA) where: Base-Base interactions energy: -986.258 where: short stacking energy: -418.472 Base-Backbone interact. energy: -2.538 local terms energy: -433.165234 where: bonds (distance) C4'-P energy: -86.976 bonds (distance) P-C4' energy: -81.603 flat angles C4'-P-C4' energy: -88.527 flat angles P-C4'-P energy: -65.088 tors. eta vs tors. theta energy: -110.971 Dist. restrs. and SS energy: 13.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1115.609361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.609361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.244300 (E_RNA) where: Base-Base interactions energy: -809.004 where: short stacking energy: -329.841 Base-Backbone interact. energy: -2.195 local terms energy: -374.045558 where: bonds (distance) C4'-P energy: -82.698 bonds (distance) P-C4' energy: -90.429 flat angles C4'-P-C4' energy: -73.558 flat angles P-C4'-P energy: -59.441 tors. eta vs tors. theta energy: -67.919 Dist. restrs. and SS energy: 32.885 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1262.049828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.049828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.168939 (E_RNA) where: Base-Base interactions energy: -913.232 where: short stacking energy: -370.837 Base-Backbone interact. energy: 0.173 local terms energy: -401.109236 where: bonds (distance) C4'-P energy: -83.877 bonds (distance) P-C4' energy: -85.134 flat angles C4'-P-C4' energy: -89.316 flat angles P-C4'-P energy: -47.727 tors. eta vs tors. theta energy: -95.055 Dist. restrs. and SS energy: 15.369 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -1217.173064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.173064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.988643 (E_RNA) where: Base-Base interactions energy: -883.734 where: short stacking energy: -385.585 Base-Backbone interact. energy: 0.876 local terms energy: -387.130361 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -83.038 flat angles C4'-P-C4' energy: -71.770 flat angles P-C4'-P energy: -51.467 tors. eta vs tors. theta energy: -101.773 Dist. restrs. and SS energy: 16.066 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -1189.569476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.569476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.182841 (E_RNA) where: Base-Base interactions energy: -850.757 where: short stacking energy: -329.102 Base-Backbone interact. energy: 0.811 local terms energy: -393.236799 where: bonds (distance) C4'-P energy: -72.220 bonds (distance) P-C4' energy: -82.691 flat angles C4'-P-C4' energy: -92.560 flat angles P-C4'-P energy: -65.142 tors. eta vs tors. theta energy: -80.624 Dist. restrs. and SS energy: 16.863 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -1082.194123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.194123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.138895 (E_RNA) where: Base-Base interactions energy: -796.072 where: short stacking energy: -321.149 Base-Backbone interact. energy: 4.698 local terms energy: -344.764713 where: bonds (distance) C4'-P energy: -65.221 bonds (distance) P-C4' energy: -85.861 flat angles C4'-P-C4' energy: -74.504 flat angles P-C4'-P energy: -46.596 tors. eta vs tors. theta energy: -72.582 Dist. restrs. and SS energy: 17.195 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -1109.915918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.915918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.773958 (E_RNA) where: Base-Base interactions energy: -829.059 where: short stacking energy: -333.880 Base-Backbone interact. energy: -0.139 local terms energy: -337.575876 where: bonds (distance) C4'-P energy: -65.296 bonds (distance) P-C4' energy: -71.878 flat angles C4'-P-C4' energy: -77.691 flat angles P-C4'-P energy: -53.002 tors. eta vs tors. theta energy: -69.709 Dist. restrs. and SS energy: 20.108 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1505.527453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.527453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.729259 (E_RNA) where: Base-Base interactions energy: -1088.661 where: short stacking energy: -456.628 Base-Backbone interact. energy: -2.082 local terms energy: -468.986101 where: bonds (distance) C4'-P energy: -88.112 bonds (distance) P-C4' energy: -94.814 flat angles C4'-P-C4' energy: -100.469 flat angles P-C4'-P energy: -66.625 tors. eta vs tors. theta energy: -118.966 Dist. restrs. and SS energy: 17.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1334.248255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.248255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.000669 (E_RNA) where: Base-Base interactions energy: -970.658 where: short stacking energy: -400.077 Base-Backbone interact. energy: -0.577 local terms energy: -420.765116 where: bonds (distance) C4'-P energy: -81.507 bonds (distance) P-C4' energy: -92.728 flat angles C4'-P-C4' energy: -99.258 flat angles P-C4'-P energy: -49.297 tors. eta vs tors. theta energy: -97.975 Dist. restrs. and SS energy: 21.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1424.869628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.869628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.064842 (E_RNA) where: Base-Base interactions energy: -1008.538 where: short stacking energy: -399.820 Base-Backbone interact. energy: -2.810 local terms energy: -466.717130 where: bonds (distance) C4'-P energy: -96.589 bonds (distance) P-C4' energy: -99.161 flat angles C4'-P-C4' energy: -97.882 flat angles P-C4'-P energy: -64.686 tors. eta vs tors. theta energy: -108.399 Dist. restrs. and SS energy: 16.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1342.340279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.340279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.861030 (E_RNA) where: Base-Base interactions energy: -979.104 where: short stacking energy: -423.868 Base-Backbone interact. energy: -2.489 local terms energy: -417.268018 where: bonds (distance) C4'-P energy: -81.163 bonds (distance) P-C4' energy: -83.883 flat angles C4'-P-C4' energy: -93.812 flat angles P-C4'-P energy: -59.318 tors. eta vs tors. theta energy: -99.091 Dist. restrs. and SS energy: 19.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1345.738365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.738365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.476946 (E_RNA) where: Base-Base interactions energy: -981.247 where: short stacking energy: -389.143 Base-Backbone interact. energy: -0.245 local terms energy: -414.985598 where: bonds (distance) C4'-P energy: -77.985 bonds (distance) P-C4' energy: -82.198 flat angles C4'-P-C4' energy: -86.785 flat angles P-C4'-P energy: -57.520 tors. eta vs tors. theta energy: -110.498 Dist. restrs. and SS energy: 13.989 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1125.843648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.843648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.674795 (E_RNA) where: Base-Base interactions energy: -835.620 where: short stacking energy: -343.761 Base-Backbone interact. energy: -2.096 local terms energy: -338.958552 where: bonds (distance) C4'-P energy: -56.587 bonds (distance) P-C4' energy: -84.064 flat angles C4'-P-C4' energy: -65.287 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -77.953 Dist. restrs. and SS energy: 14.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1334.628822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.628822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.809022 (E_RNA) where: Base-Base interactions energy: -965.949 where: short stacking energy: -401.222 Base-Backbone interact. energy: -1.089 local terms energy: -412.770956 where: bonds (distance) C4'-P energy: -72.822 bonds (distance) P-C4' energy: -80.153 flat angles C4'-P-C4' energy: -91.962 flat angles P-C4'-P energy: -55.707 tors. eta vs tors. theta energy: -112.127 Dist. restrs. and SS energy: 8.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -1235.149164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.149164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.157653 (E_RNA) where: Base-Base interactions energy: -910.160 where: short stacking energy: -358.031 Base-Backbone interact. energy: -0.991 local terms energy: -370.005889 where: bonds (distance) C4'-P energy: -72.461 bonds (distance) P-C4' energy: -72.855 flat angles C4'-P-C4' energy: -79.107 flat angles P-C4'-P energy: -58.558 tors. eta vs tors. theta energy: -87.025 Dist. restrs. and SS energy: 9.258 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -1203.559887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.559887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.120554 (E_RNA) where: Base-Base interactions energy: -882.137 where: short stacking energy: -361.188 Base-Backbone interact. energy: -1.640 local terms energy: -367.343686 where: bonds (distance) C4'-P energy: -81.478 bonds (distance) P-C4' energy: -82.066 flat angles C4'-P-C4' energy: -77.527 flat angles P-C4'-P energy: -46.436 tors. eta vs tors. theta energy: -79.837 Dist. restrs. and SS energy: 10.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -1081.115892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.115892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.438304 (E_RNA) where: Base-Base interactions energy: -827.203 where: short stacking energy: -321.599 Base-Backbone interact. energy: 1.528 local terms energy: -300.763763 where: bonds (distance) C4'-P energy: -81.081 bonds (distance) P-C4' energy: -60.705 flat angles C4'-P-C4' energy: -62.052 flat angles P-C4'-P energy: -25.254 tors. eta vs tors. theta energy: -71.671 Dist. restrs. and SS energy: 8.572 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1537.666990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.666990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.606365 (E_RNA) where: Base-Base interactions energy: -1113.049 where: short stacking energy: -447.734 Base-Backbone interact. energy: -3.023 local terms energy: -474.534038 where: bonds (distance) C4'-P energy: -90.843 bonds (distance) P-C4' energy: -99.533 flat angles C4'-P-C4' energy: -94.591 flat angles P-C4'-P energy: -64.112 tors. eta vs tors. theta energy: -125.455 Dist. restrs. and SS energy: 16.189 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1462.532908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.532908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.755528 (E_RNA) where: Base-Base interactions energy: -1059.682 where: short stacking energy: -439.710 Base-Backbone interact. energy: -0.623 local terms energy: -458.450196 where: bonds (distance) C4'-P energy: -92.916 bonds (distance) P-C4' energy: -80.357 flat angles C4'-P-C4' energy: -98.795 flat angles P-C4'-P energy: -70.823 tors. eta vs tors. theta energy: -115.559 Dist. restrs. and SS energy: 19.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1315.978057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.978057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.763391 (E_RNA) where: Base-Base interactions energy: -970.080 where: short stacking energy: -393.956 Base-Backbone interact. energy: -3.035 local terms energy: -403.648609 where: bonds (distance) C4'-P energy: -80.754 bonds (distance) P-C4' energy: -83.484 flat angles C4'-P-C4' energy: -90.051 flat angles P-C4'-P energy: -54.622 tors. eta vs tors. theta energy: -94.738 Dist. restrs. and SS energy: 24.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1451.065134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.065134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.541643 (E_RNA) where: Base-Base interactions energy: -1054.003 where: short stacking energy: -414.130 Base-Backbone interact. energy: -2.764 local terms energy: -439.774584 where: bonds (distance) C4'-P energy: -83.971 bonds (distance) P-C4' energy: -96.141 flat angles C4'-P-C4' energy: -89.371 flat angles P-C4'-P energy: -59.719 tors. eta vs tors. theta energy: -110.573 Dist. restrs. and SS energy: 8.727 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1352.182042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.182042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.325947 (E_RNA) where: Base-Base interactions energy: -998.377 where: short stacking energy: -423.655 Base-Backbone interact. energy: 0.604 local terms energy: -401.552866 where: bonds (distance) C4'-P energy: -78.652 bonds (distance) P-C4' energy: -80.948 flat angles C4'-P-C4' energy: -82.917 flat angles P-C4'-P energy: -56.682 tors. eta vs tors. theta energy: -102.354 Dist. restrs. and SS energy: 10.394 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1384.287461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.287461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.412122 (E_RNA) where: Base-Base interactions energy: -1000.248 where: short stacking energy: -418.933 Base-Backbone interact. energy: -1.708 local terms energy: -424.456242 where: bonds (distance) C4'-P energy: -78.113 bonds (distance) P-C4' energy: -82.018 flat angles C4'-P-C4' energy: -84.131 flat angles P-C4'-P energy: -61.451 tors. eta vs tors. theta energy: -118.744 Dist. restrs. and SS energy: 5.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1180.029782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.029782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.802402 (E_RNA) where: Base-Base interactions energy: -859.202 where: short stacking energy: -346.844 Base-Backbone interact. energy: 2.954 local terms energy: -374.553675 where: bonds (distance) C4'-P energy: -77.640 bonds (distance) P-C4' energy: -81.480 flat angles C4'-P-C4' energy: -79.477 flat angles P-C4'-P energy: -49.770 tors. eta vs tors. theta energy: -86.187 Dist. restrs. and SS energy: 14.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -1301.874719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.874719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.888287 (E_RNA) where: Base-Base interactions energy: -989.574 where: short stacking energy: -394.780 Base-Backbone interact. energy: -3.666 local terms energy: -349.648882 where: bonds (distance) C4'-P energy: -58.857 bonds (distance) P-C4' energy: -77.756 flat angles C4'-P-C4' energy: -76.916 flat angles P-C4'-P energy: -38.038 tors. eta vs tors. theta energy: -98.082 Dist. restrs. and SS energy: 4.264 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -1241.546801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.546801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.864101 (E_RNA) where: Base-Base interactions energy: -923.335 where: short stacking energy: -373.652 Base-Backbone interact. energy: 0.472 local terms energy: -363.000339 where: bonds (distance) C4'-P energy: -77.093 bonds (distance) P-C4' energy: -79.611 flat angles C4'-P-C4' energy: -83.296 flat angles P-C4'-P energy: -28.075 tors. eta vs tors. theta energy: -94.925 Dist. restrs. and SS energy: 7.567 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -1086.912746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.912746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.464906 (E_RNA) where: Base-Base interactions energy: -782.511 where: short stacking energy: -325.627 Base-Backbone interact. energy: 0.369 local terms energy: -350.322752 where: bonds (distance) C4'-P energy: -53.594 bonds (distance) P-C4' energy: -85.278 flat angles C4'-P-C4' energy: -89.837 flat angles P-C4'-P energy: -30.553 tors. eta vs tors. theta energy: -91.060 Dist. restrs. and SS energy: 8.802 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1507.996927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.996927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.808394 (E_RNA) where: Base-Base interactions energy: -1087.516 where: short stacking energy: -462.586 Base-Backbone interact. energy: 0.896 local terms energy: -475.188154 where: bonds (distance) C4'-P energy: -97.974 bonds (distance) P-C4' energy: -83.069 flat angles C4'-P-C4' energy: -100.789 flat angles P-C4'-P energy: -62.456 tors. eta vs tors. theta energy: -130.901 Dist. restrs. and SS energy: 17.061 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1489.594345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.594345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.976261 (E_RNA) where: Base-Base interactions energy: -1068.107 where: short stacking energy: -439.790 Base-Backbone interact. energy: -1.060 local terms energy: -478.809262 where: bonds (distance) C4'-P energy: -103.420 bonds (distance) P-C4' energy: -92.352 flat angles C4'-P-C4' energy: -88.851 flat angles P-C4'-P energy: -77.718 tors. eta vs tors. theta energy: -116.468 Dist. restrs. and SS energy: 21.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1472.228664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.228664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.024235 (E_RNA) where: Base-Base interactions energy: -1086.477 where: short stacking energy: -450.476 Base-Backbone interact. energy: -1.060 local terms energy: -436.486665 where: bonds (distance) C4'-P energy: -72.713 bonds (distance) P-C4' energy: -92.466 flat angles C4'-P-C4' energy: -98.078 flat angles P-C4'-P energy: -57.890 tors. eta vs tors. theta energy: -115.339 Dist. restrs. and SS energy: 15.046 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1300.553942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.553942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.577940 (E_RNA) where: Base-Base interactions energy: -973.700 where: short stacking energy: -401.827 Base-Backbone interact. energy: -2.003 local terms energy: -387.875062 where: bonds (distance) C4'-P energy: -71.263 bonds (distance) P-C4' energy: -78.572 flat angles C4'-P-C4' energy: -90.172 flat angles P-C4'-P energy: -54.270 tors. eta vs tors. theta energy: -93.598 Dist. restrs. and SS energy: 26.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1388.757015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.757015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.666554 (E_RNA) where: Base-Base interactions energy: -1019.137 where: short stacking energy: -392.637 Base-Backbone interact. energy: -1.477 local terms energy: -410.052745 where: bonds (distance) C4'-P energy: -70.000 bonds (distance) P-C4' energy: -84.121 flat angles C4'-P-C4' energy: -90.687 flat angles P-C4'-P energy: -58.040 tors. eta vs tors. theta energy: -107.205 Dist. restrs. and SS energy: 5.160 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1409.760934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.760934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.538522 (E_RNA) where: Base-Base interactions energy: -1039.301 where: short stacking energy: -425.183 Base-Backbone interact. energy: -1.127 local terms energy: -407.110291 where: bonds (distance) C4'-P energy: -66.503 bonds (distance) P-C4' energy: -75.221 flat angles C4'-P-C4' energy: -99.357 flat angles P-C4'-P energy: -55.012 tors. eta vs tors. theta energy: -111.018 Dist. restrs. and SS energy: 1.028 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1358.513144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.513144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.005971 (E_RNA) where: Base-Base interactions energy: -975.614 where: short stacking energy: -401.170 Base-Backbone interact. energy: 0.956 local terms energy: -424.348235 where: bonds (distance) C4'-P energy: -71.319 bonds (distance) P-C4' energy: -87.826 flat angles C4'-P-C4' energy: -87.800 flat angles P-C4'-P energy: -68.083 tors. eta vs tors. theta energy: -109.320 Dist. restrs. and SS energy: 3.743 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -1214.079299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.079299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.280232 (E_RNA) where: Base-Base interactions energy: -881.416 where: short stacking energy: -357.920 Base-Backbone interact. energy: 1.074 local terms energy: -383.938677 where: bonds (distance) C4'-P energy: -73.312 bonds (distance) P-C4' energy: -72.682 flat angles C4'-P-C4' energy: -85.408 flat angles P-C4'-P energy: -60.909 tors. eta vs tors. theta energy: -91.628 Dist. restrs. and SS energy: 13.451 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -1289.269430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.269430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.390124 (E_RNA) where: Base-Base interactions energy: -940.773 where: short stacking energy: -369.230 Base-Backbone interact. energy: 3.686 local terms energy: -391.302709 where: bonds (distance) C4'-P energy: -72.320 bonds (distance) P-C4' energy: -75.380 flat angles C4'-P-C4' energy: -93.408 flat angles P-C4'-P energy: -59.510 tors. eta vs tors. theta energy: -90.684 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -1091.135097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.135097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.605616 (E_RNA) where: Base-Base interactions energy: -813.674 where: short stacking energy: -327.688 Base-Backbone interact. energy: -0.782 local terms energy: -339.149282 where: bonds (distance) C4'-P energy: -67.163 bonds (distance) P-C4' energy: -68.249 flat angles C4'-P-C4' energy: -75.245 flat angles P-C4'-P energy: -51.040 tors. eta vs tors. theta energy: -77.452 Dist. restrs. and SS energy: 25.721 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1540.497711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.497711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.167604 (E_RNA) where: Base-Base interactions energy: -1123.976 where: short stacking energy: -444.091 Base-Backbone interact. energy: -2.596 local terms energy: -462.595136 where: bonds (distance) C4'-P energy: -87.596 bonds (distance) P-C4' energy: -92.566 flat angles C4'-P-C4' energy: -97.932 flat angles P-C4'-P energy: -65.042 tors. eta vs tors. theta energy: -119.459 Dist. restrs. and SS energy: 11.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1536.706413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.706413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.250012 (E_RNA) where: Base-Base interactions energy: -1114.981 where: short stacking energy: -456.049 Base-Backbone interact. energy: -3.285 local terms energy: -463.984149 where: bonds (distance) C4'-P energy: -86.682 bonds (distance) P-C4' energy: -90.276 flat angles C4'-P-C4' energy: -105.589 flat angles P-C4'-P energy: -60.366 tors. eta vs tors. theta energy: -121.071 Dist. restrs. and SS energy: 8.794 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1485.658732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.658732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.220139 (E_RNA) where: Base-Base interactions energy: -1078.608 where: short stacking energy: -460.407 Base-Backbone interact. energy: -0.746 local terms energy: -456.866721 where: bonds (distance) C4'-P energy: -78.541 bonds (distance) P-C4' energy: -83.773 flat angles C4'-P-C4' energy: -99.562 flat angles P-C4'-P energy: -67.655 tors. eta vs tors. theta energy: -127.336 Dist. restrs. and SS energy: 13.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1446.522501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.522501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.746606 (E_RNA) where: Base-Base interactions energy: -1053.088 where: short stacking energy: -437.837 Base-Backbone interact. energy: -1.564 local terms energy: -434.094798 where: bonds (distance) C4'-P energy: -82.548 bonds (distance) P-C4' energy: -83.580 flat angles C4'-P-C4' energy: -96.145 flat angles P-C4'-P energy: -55.686 tors. eta vs tors. theta energy: -116.135 Dist. restrs. and SS energy: 5.474 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1294.758493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.758493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.223049 (E_RNA) where: Base-Base interactions energy: -921.981 where: short stacking energy: -383.820 Base-Backbone interact. energy: 2.250 local terms energy: -432.492490 where: bonds (distance) C4'-P energy: -83.921 bonds (distance) P-C4' energy: -78.220 flat angles C4'-P-C4' energy: -95.602 flat angles P-C4'-P energy: -68.838 tors. eta vs tors. theta energy: -105.912 Dist. restrs. and SS energy: 20.715 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1439.716427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.716427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.703742 (E_RNA) where: Base-Base interactions energy: -1061.104 where: short stacking energy: -434.568 Base-Backbone interact. energy: -0.442 local terms energy: -416.157794 where: bonds (distance) C4'-P energy: -65.884 bonds (distance) P-C4' energy: -81.477 flat angles C4'-P-C4' energy: -112.509 flat angles P-C4'-P energy: -47.084 tors. eta vs tors. theta energy: -109.204 Dist. restrs. and SS energy: 1.237 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1346.401592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.401592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.501138 (E_RNA) where: Base-Base interactions energy: -979.700 where: short stacking energy: -388.391 Base-Backbone interact. energy: -1.640 local terms energy: -408.161455 where: bonds (distance) C4'-P energy: -73.018 bonds (distance) P-C4' energy: -87.909 flat angles C4'-P-C4' energy: -89.300 flat angles P-C4'-P energy: -63.677 tors. eta vs tors. theta energy: -94.258 Dist. restrs. and SS energy: 6.350 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1338.287862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.287862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.942004 (E_RNA) where: Base-Base interactions energy: -1000.365 where: short stacking energy: -409.574 Base-Backbone interact. energy: -0.177 local terms energy: -375.400343 where: bonds (distance) C4'-P energy: -73.531 bonds (distance) P-C4' energy: -69.788 flat angles C4'-P-C4' energy: -68.740 flat angles P-C4'-P energy: -61.209 tors. eta vs tors. theta energy: -102.133 Dist. restrs. and SS energy: 0.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -1236.587223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.587223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.661992 (E_RNA) where: Base-Base interactions energy: -897.590 where: short stacking energy: -356.502 Base-Backbone interact. energy: -0.405 local terms energy: -384.667142 where: bonds (distance) C4'-P energy: -73.365 bonds (distance) P-C4' energy: -80.422 flat angles C4'-P-C4' energy: -75.980 flat angles P-C4'-P energy: -63.321 tors. eta vs tors. theta energy: -91.580 Dist. restrs. and SS energy: 9.325 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -1127.709314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.709314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.069230 (E_RNA) where: Base-Base interactions energy: -824.093 where: short stacking energy: -312.546 Base-Backbone interact. energy: 3.147 local terms energy: -352.122327 where: bonds (distance) C4'-P energy: -75.323 bonds (distance) P-C4' energy: -78.905 flat angles C4'-P-C4' energy: -67.825 flat angles P-C4'-P energy: -56.030 tors. eta vs tors. theta energy: -74.038 Dist. restrs. and SS energy: 8.610 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1561.901317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.901317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.417017 (E_RNA) where: Base-Base interactions energy: -1147.100 where: short stacking energy: -463.486 Base-Backbone interact. energy: -0.370 local terms energy: -463.947259 where: bonds (distance) C4'-P energy: -84.026 bonds (distance) P-C4' energy: -91.948 flat angles C4'-P-C4' energy: -101.559 flat angles P-C4'-P energy: -68.398 tors. eta vs tors. theta energy: -118.016 Dist. restrs. and SS energy: 12.766 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1534.053431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.053431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.291665 (E_RNA) where: Base-Base interactions energy: -1097.781 where: short stacking energy: -458.704 Base-Backbone interact. energy: -1.519 local terms energy: -478.991550 where: bonds (distance) C4'-P energy: -95.829 bonds (distance) P-C4' energy: -84.881 flat angles C4'-P-C4' energy: -114.745 flat angles P-C4'-P energy: -62.057 tors. eta vs tors. theta energy: -121.480 Dist. restrs. and SS energy: 7.488 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1502.659488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.659488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.516495 (E_RNA) where: Base-Base interactions energy: -1091.168 where: short stacking energy: -453.811 Base-Backbone interact. energy: -0.545 local terms energy: -459.803506 where: bonds (distance) C4'-P energy: -80.853 bonds (distance) P-C4' energy: -87.248 flat angles C4'-P-C4' energy: -101.807 flat angles P-C4'-P energy: -71.787 tors. eta vs tors. theta energy: -118.109 Dist. restrs. and SS energy: 12.107 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1459.038989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.038989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.288572 (E_RNA) where: Base-Base interactions energy: -1053.502 where: short stacking energy: -422.502 Base-Backbone interact. energy: -2.497 local terms energy: -441.289118 where: bonds (distance) C4'-P energy: -86.530 bonds (distance) P-C4' energy: -85.629 flat angles C4'-P-C4' energy: -101.360 flat angles P-C4'-P energy: -61.936 tors. eta vs tors. theta energy: -105.834 Dist. restrs. and SS energy: 1.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1443.322196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.322196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.392663 (E_RNA) where: Base-Base interactions energy: -1049.720 where: short stacking energy: -439.141 Base-Backbone interact. energy: 0.062 local terms energy: -431.734972 where: bonds (distance) C4'-P energy: -67.690 bonds (distance) P-C4' energy: -74.793 flat angles C4'-P-C4' energy: -100.575 flat angles P-C4'-P energy: -65.625 tors. eta vs tors. theta energy: -123.051 Dist. restrs. and SS energy: 1.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1353.818515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.818515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.715369 (E_RNA) where: Base-Base interactions energy: -985.365 where: short stacking energy: -399.494 Base-Backbone interact. energy: -1.441 local terms energy: -416.909277 where: bonds (distance) C4'-P energy: -95.118 bonds (distance) P-C4' energy: -85.520 flat angles C4'-P-C4' energy: -89.811 flat angles P-C4'-P energy: -51.605 tors. eta vs tors. theta energy: -94.856 Dist. restrs. and SS energy: 13.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1380.086287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.086287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.916750 (E_RNA) where: Base-Base interactions energy: -1021.799 where: short stacking energy: -420.205 Base-Backbone interact. energy: -2.439 local terms energy: -398.678791 where: bonds (distance) C4'-P energy: -69.678 bonds (distance) P-C4' energy: -77.979 flat angles C4'-P-C4' energy: -79.376 flat angles P-C4'-P energy: -65.040 tors. eta vs tors. theta energy: -106.605 Dist. restrs. and SS energy: 6.080 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -1367.139176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.139176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.847181 (E_RNA) where: Base-Base interactions energy: -988.607 where: short stacking energy: -413.960 Base-Backbone interact. energy: 0.277 local terms energy: -418.516685 where: bonds (distance) C4'-P energy: -67.422 bonds (distance) P-C4' energy: -89.393 flat angles C4'-P-C4' energy: -93.161 flat angles P-C4'-P energy: -55.007 tors. eta vs tors. theta energy: -113.533 Dist. restrs. and SS energy: 2.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1242.627764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.627764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.940678 (E_RNA) where: Base-Base interactions energy: -897.355 where: short stacking energy: -369.438 Base-Backbone interact. energy: -4.616 local terms energy: -396.969617 where: bonds (distance) C4'-P energy: -71.475 bonds (distance) P-C4' energy: -74.749 flat angles C4'-P-C4' energy: -104.673 flat angles P-C4'-P energy: -57.885 tors. eta vs tors. theta energy: -88.188 Dist. restrs. and SS energy: 19.563 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -1173.412895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.412895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.303923 (E_RNA) where: Base-Base interactions energy: -882.633 where: short stacking energy: -349.146 Base-Backbone interact. energy: -1.607 local terms energy: -334.063943 where: bonds (distance) C4'-P energy: -68.614 bonds (distance) P-C4' energy: -65.480 flat angles C4'-P-C4' energy: -61.988 flat angles P-C4'-P energy: -51.847 tors. eta vs tors. theta energy: -86.134 Dist. restrs. and SS energy: 8.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1583.060751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.060751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.051092 (E_RNA) where: Base-Base interactions energy: -1141.704 where: short stacking energy: -483.165 Base-Backbone interact. energy: -1.314 local terms energy: -489.032654 where: bonds (distance) C4'-P energy: -82.514 bonds (distance) P-C4' energy: -102.061 flat angles C4'-P-C4' energy: -106.963 flat angles P-C4'-P energy: -70.630 tors. eta vs tors. theta energy: -126.865 Dist. restrs. and SS energy: 12.240 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1553.968682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1553.968682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.478611 (E_RNA) where: Base-Base interactions energy: -1120.667 where: short stacking energy: -458.631 Base-Backbone interact. energy: -0.495 local terms energy: -478.316519 where: bonds (distance) C4'-P energy: -99.250 bonds (distance) P-C4' energy: -85.035 flat angles C4'-P-C4' energy: -105.588 flat angles P-C4'-P energy: -67.918 tors. eta vs tors. theta energy: -120.526 Dist. restrs. and SS energy: 8.760 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1500.113003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.113003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.162964 (E_RNA) where: Base-Base interactions energy: -1093.089 where: short stacking energy: -459.220 Base-Backbone interact. energy: 2.611 local terms energy: -460.684100 where: bonds (distance) C4'-P energy: -80.944 bonds (distance) P-C4' energy: -89.267 flat angles C4'-P-C4' energy: -102.751 flat angles P-C4'-P energy: -65.478 tors. eta vs tors. theta energy: -122.245 Dist. restrs. and SS energy: 14.300 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1480.556109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.556109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.509853 (E_RNA) where: Base-Base interactions energy: -1075.067 where: short stacking energy: -437.371 Base-Backbone interact. energy: -0.758 local terms energy: -442.684602 where: bonds (distance) C4'-P energy: -85.872 bonds (distance) P-C4' energy: -91.406 flat angles C4'-P-C4' energy: -81.376 flat angles P-C4'-P energy: -66.693 tors. eta vs tors. theta energy: -117.338 Dist. restrs. and SS energy: 1.204 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1457.963161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.963161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.798095 (E_RNA) where: Base-Base interactions energy: -1058.793 where: short stacking energy: -431.689 Base-Backbone interact. energy: -2.285 local terms energy: -435.720095 where: bonds (distance) C4'-P energy: -83.271 bonds (distance) P-C4' energy: -78.420 flat angles C4'-P-C4' energy: -94.563 flat angles P-C4'-P energy: -60.553 tors. eta vs tors. theta energy: -118.913 Dist. restrs. and SS energy: 2.085 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1400.767358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.767358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.330457 (E_RNA) where: Base-Base interactions energy: -1035.611 where: short stacking energy: -408.759 Base-Backbone interact. energy: 0.400 local terms energy: -404.118811 where: bonds (distance) C4'-P energy: -85.381 bonds (distance) P-C4' energy: -58.583 flat angles C4'-P-C4' energy: -98.107 flat angles P-C4'-P energy: -64.072 tors. eta vs tors. theta energy: -97.976 Dist. restrs. and SS energy: 1.813 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1344.233789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.233789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.183643 (E_RNA) where: Base-Base interactions energy: -1009.047 where: short stacking energy: -402.492 Base-Backbone interact. energy: -1.672 local terms energy: -381.464656 where: bonds (distance) C4'-P energy: -63.245 bonds (distance) P-C4' energy: -67.698 flat angles C4'-P-C4' energy: -85.142 flat angles P-C4'-P energy: -59.246 tors. eta vs tors. theta energy: -106.134 Dist. restrs. and SS energy: 11.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1336.040741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.040741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.706281 (E_RNA) where: Base-Base interactions energy: -974.222 where: short stacking energy: -389.684 Base-Backbone interact. energy: -1.040 local terms energy: -400.444830 where: bonds (distance) C4'-P energy: -88.409 bonds (distance) P-C4' energy: -80.944 flat angles C4'-P-C4' energy: -88.270 flat angles P-C4'-P energy: -46.823 tors. eta vs tors. theta energy: -95.999 Dist. restrs. and SS energy: 2.916 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -1246.882609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.882609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.963777 (E_RNA) where: Base-Base interactions energy: -950.575 where: short stacking energy: -386.086 Base-Backbone interact. energy: 4.060 local terms energy: -356.448043 where: bonds (distance) C4'-P energy: -64.465 bonds (distance) P-C4' energy: -71.305 flat angles C4'-P-C4' energy: -73.520 flat angles P-C4'-P energy: -48.428 tors. eta vs tors. theta energy: -98.730 Dist. restrs. and SS energy: 19.331 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -1177.012807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.012807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.252827 (E_RNA) where: Base-Base interactions energy: -888.556 where: short stacking energy: -354.810 Base-Backbone interact. energy: -1.364 local terms energy: -333.333137 where: bonds (distance) C4'-P energy: -60.667 bonds (distance) P-C4' energy: -64.829 flat angles C4'-P-C4' energy: -68.931 flat angles P-C4'-P energy: -51.206 tors. eta vs tors. theta energy: -87.700 Dist. restrs. and SS energy: 9.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1621.257881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.257881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.887852 (E_RNA) where: Base-Base interactions energy: -1194.450 where: short stacking energy: -494.942 Base-Backbone interact. energy: -0.596 local terms energy: -473.840970 where: bonds (distance) C4'-P energy: -91.666 bonds (distance) P-C4' energy: -93.286 flat angles C4'-P-C4' energy: -94.537 flat angles P-C4'-P energy: -67.177 tors. eta vs tors. theta energy: -127.175 Dist. restrs. and SS energy: 10.880 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1537.541227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.541227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.700753 (E_RNA) where: Base-Base interactions energy: -1103.757 where: short stacking energy: -458.504 Base-Backbone interact. energy: -0.670 local terms energy: -485.274358 where: bonds (distance) C4'-P energy: -99.353 bonds (distance) P-C4' energy: -89.770 flat angles C4'-P-C4' energy: -98.233 flat angles P-C4'-P energy: -71.457 tors. eta vs tors. theta energy: -126.461 Dist. restrs. and SS energy: 15.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1503.121179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.121179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.132209 (E_RNA) where: Base-Base interactions energy: -1085.638 where: short stacking energy: -448.771 Base-Backbone interact. energy: -1.933 local terms energy: -462.560869 where: bonds (distance) C4'-P energy: -87.113 bonds (distance) P-C4' energy: -86.015 flat angles C4'-P-C4' energy: -97.312 flat angles P-C4'-P energy: -67.612 tors. eta vs tors. theta energy: -124.509 Dist. restrs. and SS energy: 10.261 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1507.300726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.300726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1545.865058 (E_RNA) where: Base-Base interactions energy: -1087.301 where: short stacking energy: -447.403 Base-Backbone interact. energy: 1.543 local terms energy: -460.106649 where: bonds (distance) C4'-P energy: -79.614 bonds (distance) P-C4' energy: -89.234 flat angles C4'-P-C4' energy: -95.707 flat angles P-C4'-P energy: -71.886 tors. eta vs tors. theta energy: -123.666 Dist. restrs. and SS energy: 1.814 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1460.415695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.415695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1499.122967 (E_RNA) where: Base-Base interactions energy: -1070.159 where: short stacking energy: -439.883 Base-Backbone interact. energy: 4.413 local terms energy: -433.377263 where: bonds (distance) C4'-P energy: -86.203 bonds (distance) P-C4' energy: -82.024 flat angles C4'-P-C4' energy: -91.360 flat angles P-C4'-P energy: -60.804 tors. eta vs tors. theta energy: -112.988 Dist. restrs. and SS energy: 1.957 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1468.113031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.113031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.706289 (E_RNA) where: Base-Base interactions energy: -1088.605 where: short stacking energy: -453.872 Base-Backbone interact. energy: -0.682 local terms energy: -417.418879 where: bonds (distance) C4'-P energy: -67.028 bonds (distance) P-C4' energy: -72.036 flat angles C4'-P-C4' energy: -95.831 flat angles P-C4'-P energy: -70.733 tors. eta vs tors. theta energy: -111.790 Dist. restrs. and SS energy: 1.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1387.637215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.637215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.821372 (E_RNA) where: Base-Base interactions energy: -1010.810 where: short stacking energy: -424.556 Base-Backbone interact. energy: 0.853 local terms energy: -415.864428 where: bonds (distance) C4'-P energy: -86.480 bonds (distance) P-C4' energy: -65.264 flat angles C4'-P-C4' energy: -95.730 flat angles P-C4'-P energy: -57.833 tors. eta vs tors. theta energy: -110.558 Dist. restrs. and SS energy: 1.434 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1275.689300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.689300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.173073 (E_RNA) where: Base-Base interactions energy: -921.271 where: short stacking energy: -379.282 Base-Backbone interact. energy: 1.337 local terms energy: -402.239119 where: bonds (distance) C4'-P energy: -80.236 bonds (distance) P-C4' energy: -83.386 flat angles C4'-P-C4' energy: -76.829 flat angles P-C4'-P energy: -64.277 tors. eta vs tors. theta energy: -97.511 Dist. restrs. and SS energy: 9.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1245.848796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1245.848796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.856533 (E_RNA) where: Base-Base interactions energy: -927.683 where: short stacking energy: -364.600 Base-Backbone interact. energy: 7.713 local terms energy: -368.886489 where: bonds (distance) C4'-P energy: -78.959 bonds (distance) P-C4' energy: -73.129 flat angles C4'-P-C4' energy: -65.769 flat angles P-C4'-P energy: -61.086 tors. eta vs tors. theta energy: -89.944 Dist. restrs. and SS energy: 6.258 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -1271.848165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.848165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1318.840034 (E_RNA) where: Base-Base interactions energy: -935.457 where: short stacking energy: -397.460 Base-Backbone interact. energy: -1.713 local terms energy: -381.669746 where: bonds (distance) C4'-P energy: -67.694 bonds (distance) P-C4' energy: -65.975 flat angles C4'-P-C4' energy: -82.643 flat angles P-C4'-P energy: -55.923 tors. eta vs tors. theta energy: -109.434 Dist. restrs. and SS energy: 10.242 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1620.732976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.732976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.421647 (E_RNA) where: Base-Base interactions energy: -1187.629 where: short stacking energy: -490.025 Base-Backbone interact. energy: -0.260 local terms energy: -479.532029 where: bonds (distance) C4'-P energy: -90.945 bonds (distance) P-C4' energy: -86.887 flat angles C4'-P-C4' energy: -108.356 flat angles P-C4'-P energy: -60.034 tors. eta vs tors. theta energy: -133.310 Dist. restrs. and SS energy: 9.939 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1568.356785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.356785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.013632 (E_RNA) where: Base-Base interactions energy: -1131.619 where: short stacking energy: -473.432 Base-Backbone interact. energy: -1.384 local terms energy: -486.010147 where: bonds (distance) C4'-P energy: -90.037 bonds (distance) P-C4' energy: -100.182 flat angles C4'-P-C4' energy: -103.312 flat angles P-C4'-P energy: -63.680 tors. eta vs tors. theta energy: -128.799 Dist. restrs. and SS energy: 13.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1503.759268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.759268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.869195 (E_RNA) where: Base-Base interactions energy: -1089.711 where: short stacking energy: -448.796 Base-Backbone interact. energy: -3.375 local terms energy: -454.783184 where: bonds (distance) C4'-P energy: -78.202 bonds (distance) P-C4' energy: -83.541 flat angles C4'-P-C4' energy: -106.714 flat angles P-C4'-P energy: -63.898 tors. eta vs tors. theta energy: -122.428 Dist. restrs. and SS energy: 7.360 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1508.588740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.588740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.635921 (E_RNA) where: Base-Base interactions energy: -1086.970 where: short stacking energy: -458.739 Base-Backbone interact. energy: -3.358 local terms energy: -456.307420 where: bonds (distance) C4'-P energy: -84.097 bonds (distance) P-C4' energy: -97.298 flat angles C4'-P-C4' energy: -87.979 flat angles P-C4'-P energy: -66.925 tors. eta vs tors. theta energy: -120.008 Dist. restrs. and SS energy: 1.297 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1475.853667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.853667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.874221 (E_RNA) where: Base-Base interactions energy: -1083.950 where: short stacking energy: -445.790 Base-Backbone interact. energy: -1.707 local terms energy: -428.217461 where: bonds (distance) C4'-P energy: -88.568 bonds (distance) P-C4' energy: -75.798 flat angles C4'-P-C4' energy: -88.484 flat angles P-C4'-P energy: -60.263 tors. eta vs tors. theta energy: -115.105 Dist. restrs. and SS energy: 1.271 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1484.380320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.380320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.955341 (E_RNA) where: Base-Base interactions energy: -1095.436 where: short stacking energy: -440.241 Base-Backbone interact. energy: -2.199 local terms energy: -424.320014 where: bonds (distance) C4'-P energy: -66.181 bonds (distance) P-C4' energy: -70.003 flat angles C4'-P-C4' energy: -96.072 flat angles P-C4'-P energy: -66.600 tors. eta vs tors. theta energy: -125.464 Dist. restrs. and SS energy: 0.825 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1381.621759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.621759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.038980 (E_RNA) where: Base-Base interactions energy: -1009.971 where: short stacking energy: -406.431 Base-Backbone interact. energy: -1.177 local terms energy: -408.890366 where: bonds (distance) C4'-P energy: -71.207 bonds (distance) P-C4' energy: -80.032 flat angles C4'-P-C4' energy: -89.258 flat angles P-C4'-P energy: -58.610 tors. eta vs tors. theta energy: -109.783 Dist. restrs. and SS energy: 1.667 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1279.258664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.258664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.252071 (E_RNA) where: Base-Base interactions energy: -927.572 where: short stacking energy: -377.301 Base-Backbone interact. energy: -0.978 local terms energy: -400.701229 where: bonds (distance) C4'-P energy: -68.793 bonds (distance) P-C4' energy: -80.307 flat angles C4'-P-C4' energy: -79.431 flat angles P-C4'-P energy: -65.833 tors. eta vs tors. theta energy: -106.337 Dist. restrs. and SS energy: 13.243 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -1315.101253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.101253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.495541 (E_RNA) where: Base-Base interactions energy: -962.132 where: short stacking energy: -392.229 Base-Backbone interact. energy: 0.841 local terms energy: -393.205114 where: bonds (distance) C4'-P energy: -67.758 bonds (distance) P-C4' energy: -92.289 flat angles C4'-P-C4' energy: -83.066 flat angles P-C4'-P energy: -47.817 tors. eta vs tors. theta energy: -102.274 Dist. restrs. and SS energy: 2.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -1249.513772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.513772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.963572 (E_RNA) where: Base-Base interactions energy: -915.213 where: short stacking energy: -362.130 Base-Backbone interact. energy: 3.255 local terms energy: -382.005574 where: bonds (distance) C4'-P energy: -74.092 bonds (distance) P-C4' energy: -80.685 flat angles C4'-P-C4' energy: -82.616 flat angles P-C4'-P energy: -48.595 tors. eta vs tors. theta energy: -96.018 Dist. restrs. and SS energy: 7.700 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1634.028817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.028817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.502671 (E_RNA) where: Base-Base interactions energy: -1197.274 where: short stacking energy: -495.297 Base-Backbone interact. energy: 1.903 local terms energy: -483.131672 where: bonds (distance) C4'-P energy: -91.857 bonds (distance) P-C4' energy: -92.914 flat angles C4'-P-C4' energy: -114.370 flat angles P-C4'-P energy: -54.210 tors. eta vs tors. theta energy: -129.780 Dist. restrs. and SS energy: 7.724 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1554.818869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.818869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.286089 (E_RNA) where: Base-Base interactions energy: -1135.855 where: short stacking energy: -478.227 Base-Backbone interact. energy: -0.094 local terms energy: -465.337382 where: bonds (distance) C4'-P energy: -81.212 bonds (distance) P-C4' energy: -96.285 flat angles C4'-P-C4' energy: -104.946 flat angles P-C4'-P energy: -57.986 tors. eta vs tors. theta energy: -124.908 Dist. restrs. and SS energy: 9.717 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1565.692892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.692892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.953801 (E_RNA) where: Base-Base interactions energy: -1134.588 where: short stacking energy: -484.539 Base-Backbone interact. energy: -1.364 local terms energy: -469.002537 where: bonds (distance) C4'-P energy: -100.084 bonds (distance) P-C4' energy: -82.236 flat angles C4'-P-C4' energy: -94.324 flat angles P-C4'-P energy: -58.905 tors. eta vs tors. theta energy: -133.453 Dist. restrs. and SS energy: 2.511 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1509.793447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.793447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.752340 (E_RNA) where: Base-Base interactions energy: -1114.442 where: short stacking energy: -460.636 Base-Backbone interact. energy: -1.753 local terms energy: -438.557092 where: bonds (distance) C4'-P energy: -70.723 bonds (distance) P-C4' energy: -82.521 flat angles C4'-P-C4' energy: -94.440 flat angles P-C4'-P energy: -63.497 tors. eta vs tors. theta energy: -127.376 Dist. restrs. and SS energy: 8.209 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1470.395688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.395688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.822640 (E_RNA) where: Base-Base interactions energy: -1077.862 where: short stacking energy: -431.075 Base-Backbone interact. energy: -0.524 local terms energy: -430.436410 where: bonds (distance) C4'-P energy: -79.495 bonds (distance) P-C4' energy: -91.413 flat angles C4'-P-C4' energy: -90.447 flat angles P-C4'-P energy: -58.336 tors. eta vs tors. theta energy: -110.746 Dist. restrs. and SS energy: 1.677 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1453.944519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.944519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.279318 (E_RNA) where: Base-Base interactions energy: -1075.154 where: short stacking energy: -433.709 Base-Backbone interact. energy: -2.762 local terms energy: -414.363176 where: bonds (distance) C4'-P energy: -60.065 bonds (distance) P-C4' energy: -76.674 flat angles C4'-P-C4' energy: -100.587 flat angles P-C4'-P energy: -59.033 tors. eta vs tors. theta energy: -118.004 Dist. restrs. and SS energy: 1.585 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1416.305975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.305975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.168538 (E_RNA) where: Base-Base interactions energy: -1039.024 where: short stacking energy: -417.760 Base-Backbone interact. energy: 2.664 local terms energy: -417.808372 where: bonds (distance) C4'-P energy: -82.576 bonds (distance) P-C4' energy: -70.468 flat angles C4'-P-C4' energy: -83.321 flat angles P-C4'-P energy: -66.341 tors. eta vs tors. theta energy: -115.104 Dist. restrs. and SS energy: 1.113 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1245.819274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1245.819274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.710191 (E_RNA) where: Base-Base interactions energy: -903.287 where: short stacking energy: -359.131 Base-Backbone interact. energy: 1.223 local terms energy: -398.646251 where: bonds (distance) C4'-P energy: -85.237 bonds (distance) P-C4' energy: -64.556 flat angles C4'-P-C4' energy: -90.687 flat angles P-C4'-P energy: -61.134 tors. eta vs tors. theta energy: -97.033 Dist. restrs. and SS energy: 18.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1308.088637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.088637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.552175 (E_RNA) where: Base-Base interactions energy: -968.161 where: short stacking energy: -387.597 Base-Backbone interact. energy: 0.377 local terms energy: -378.768256 where: bonds (distance) C4'-P energy: -70.868 bonds (distance) P-C4' energy: -69.531 flat angles C4'-P-C4' energy: -91.523 flat angles P-C4'-P energy: -47.105 tors. eta vs tors. theta energy: -99.741 Dist. restrs. and SS energy: 1.714 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -1240.272581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.272581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.298623 (E_RNA) where: Base-Base interactions energy: -912.018 where: short stacking energy: -353.868 Base-Backbone interact. energy: -0.426 local terms energy: -373.854723 where: bonds (distance) C4'-P energy: -70.632 bonds (distance) P-C4' energy: -77.302 flat angles C4'-P-C4' energy: -80.246 flat angles P-C4'-P energy: -47.087 tors. eta vs tors. theta energy: -98.589 Dist. restrs. and SS energy: 9.276 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1643.957529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.957529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.526255 (E_RNA) where: Base-Base interactions energy: -1197.365 where: short stacking energy: -479.474 Base-Backbone interact. energy: -0.486 local terms energy: -490.674484 where: bonds (distance) C4'-P energy: -86.361 bonds (distance) P-C4' energy: -95.073 flat angles C4'-P-C4' energy: -99.913 flat angles P-C4'-P energy: -69.063 tors. eta vs tors. theta energy: -140.264 Dist. restrs. and SS energy: 7.819 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1588.473315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.473315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.191440 (E_RNA) where: Base-Base interactions energy: -1161.901 where: short stacking energy: -474.764 Base-Backbone interact. energy: -1.428 local terms energy: -470.861804 where: bonds (distance) C4'-P energy: -88.830 bonds (distance) P-C4' energy: -96.122 flat angles C4'-P-C4' energy: -101.972 flat angles P-C4'-P energy: -54.581 tors. eta vs tors. theta energy: -129.356 Dist. restrs. and SS energy: 8.968 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1584.781032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.781032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.454268 (E_RNA) where: Base-Base interactions energy: -1129.666 where: short stacking energy: -496.595 Base-Backbone interact. energy: -2.093 local terms energy: -490.696019 where: bonds (distance) C4'-P energy: -90.288 bonds (distance) P-C4' energy: -89.258 flat angles C4'-P-C4' energy: -100.366 flat angles P-C4'-P energy: -64.507 tors. eta vs tors. theta energy: -146.277 Dist. restrs. and SS energy: 0.923 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1497.678986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.678986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.945950 (E_RNA) where: Base-Base interactions energy: -1088.794 where: short stacking energy: -456.533 Base-Backbone interact. energy: -2.555 local terms energy: -449.596597 where: bonds (distance) C4'-P energy: -74.024 bonds (distance) P-C4' energy: -82.831 flat angles C4'-P-C4' energy: -103.562 flat angles P-C4'-P energy: -62.174 tors. eta vs tors. theta energy: -127.005 Dist. restrs. and SS energy: 6.517 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1475.725027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.725027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.732673 (E_RNA) where: Base-Base interactions energy: -1061.915 where: short stacking energy: -424.315 Base-Backbone interact. energy: -2.134 local terms energy: -449.683397 where: bonds (distance) C4'-P energy: -83.189 bonds (distance) P-C4' energy: -85.987 flat angles C4'-P-C4' energy: -91.581 flat angles P-C4'-P energy: -69.221 tors. eta vs tors. theta energy: -119.705 Dist. restrs. and SS energy: 1.258 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1435.566342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.566342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.814801 (E_RNA) where: Base-Base interactions energy: -1033.666 where: short stacking energy: -424.242 Base-Backbone interact. energy: 1.096 local terms energy: -441.245389 where: bonds (distance) C4'-P energy: -79.534 bonds (distance) P-C4' energy: -80.407 flat angles C4'-P-C4' energy: -95.276 flat angles P-C4'-P energy: -67.530 tors. eta vs tors. theta energy: -118.498 Dist. restrs. and SS energy: 1.498 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1433.247121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.247121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.328647 (E_RNA) where: Base-Base interactions energy: -1045.955 where: short stacking energy: -425.156 Base-Backbone interact. energy: -1.801 local terms energy: -424.573536 where: bonds (distance) C4'-P energy: -78.309 bonds (distance) P-C4' energy: -65.525 flat angles C4'-P-C4' energy: -92.618 flat angles P-C4'-P energy: -69.992 tors. eta vs tors. theta energy: -118.129 Dist. restrs. and SS energy: 2.332 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1369.799042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.799042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.777880 (E_RNA) where: Base-Base interactions energy: -991.811 where: short stacking energy: -403.288 Base-Backbone interact. energy: -0.714 local terms energy: -415.253491 where: bonds (distance) C4'-P energy: -71.855 bonds (distance) P-C4' energy: -77.134 flat angles C4'-P-C4' energy: -98.740 flat angles P-C4'-P energy: -61.066 tors. eta vs tors. theta energy: -106.459 Dist. restrs. and SS energy: 1.229 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -1214.588565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.588565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.728015 (E_RNA) where: Base-Base interactions energy: -891.047 where: short stacking energy: -364.663 Base-Backbone interact. energy: -1.019 local terms energy: -380.662076 where: bonds (distance) C4'-P energy: -71.060 bonds (distance) P-C4' energy: -70.324 flat angles C4'-P-C4' energy: -84.625 flat angles P-C4'-P energy: -57.004 tors. eta vs tors. theta energy: -97.650 Dist. restrs. and SS energy: 21.389 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -1276.796075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.796075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.723038 (E_RNA) where: Base-Base interactions energy: -965.893 where: short stacking energy: -386.288 Base-Backbone interact. energy: -0.048 local terms energy: -354.781732 where: bonds (distance) C4'-P energy: -65.107 bonds (distance) P-C4' energy: -62.637 flat angles C4'-P-C4' energy: -85.474 flat angles P-C4'-P energy: -38.856 tors. eta vs tors. theta energy: -102.707 Dist. restrs. and SS energy: 7.177 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1624.059540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.059540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.452019 (E_RNA) where: Base-Base interactions energy: -1176.210 where: short stacking energy: -501.164 Base-Backbone interact. energy: -2.324 local terms energy: -490.918162 where: bonds (distance) C4'-P energy: -89.865 bonds (distance) P-C4' energy: -87.811 flat angles C4'-P-C4' energy: -102.917 flat angles P-C4'-P energy: -75.843 tors. eta vs tors. theta energy: -134.481 Dist. restrs. and SS energy: 8.642 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1631.942288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.942288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.757608 (E_RNA) where: Base-Base interactions energy: -1200.937 where: short stacking energy: -480.750 Base-Backbone interact. energy: -1.424 local terms energy: -473.396480 where: bonds (distance) C4'-P energy: -81.649 bonds (distance) P-C4' energy: -99.408 flat angles C4'-P-C4' energy: -105.419 flat angles P-C4'-P energy: -58.898 tors. eta vs tors. theta energy: -128.022 Dist. restrs. and SS energy: 7.065 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1556.736360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.736360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.857486 (E_RNA) where: Base-Base interactions energy: -1101.126 where: short stacking energy: -474.170 Base-Backbone interact. energy: -1.346 local terms energy: -493.385408 where: bonds (distance) C4'-P energy: -78.975 bonds (distance) P-C4' energy: -90.520 flat angles C4'-P-C4' energy: -106.181 flat angles P-C4'-P energy: -76.992 tors. eta vs tors. theta energy: -140.717 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1514.214240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.214240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.167086 (E_RNA) where: Base-Base interactions energy: -1085.077 where: short stacking energy: -450.117 Base-Backbone interact. energy: -0.360 local terms energy: -473.729652 where: bonds (distance) C4'-P energy: -95.953 bonds (distance) P-C4' energy: -81.971 flat angles C4'-P-C4' energy: -105.388 flat angles P-C4'-P energy: -62.357 tors. eta vs tors. theta energy: -128.060 Dist. restrs. and SS energy: 8.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1473.259944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.259944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.736732 (E_RNA) where: Base-Base interactions energy: -1085.508 where: short stacking energy: -443.590 Base-Backbone interact. energy: -1.351 local terms energy: -423.877254 where: bonds (distance) C4'-P energy: -74.466 bonds (distance) P-C4' energy: -76.240 flat angles C4'-P-C4' energy: -89.930 flat angles P-C4'-P energy: -63.977 tors. eta vs tors. theta energy: -119.264 Dist. restrs. and SS energy: 0.727 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1410.783322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.783322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.895085 (E_RNA) where: Base-Base interactions energy: -1006.820 where: short stacking energy: -410.851 Base-Backbone interact. energy: -1.673 local terms energy: -440.402103 where: bonds (distance) C4'-P energy: -86.594 bonds (distance) P-C4' energy: -75.040 flat angles C4'-P-C4' energy: -93.978 flat angles P-C4'-P energy: -59.968 tors. eta vs tors. theta energy: -124.822 Dist. restrs. and SS energy: 1.362 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1441.831561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.831561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.121285 (E_RNA) where: Base-Base interactions energy: -1035.219 where: short stacking energy: -424.678 Base-Backbone interact. energy: -1.006 local terms energy: -444.896196 where: bonds (distance) C4'-P energy: -77.132 bonds (distance) P-C4' energy: -86.833 flat angles C4'-P-C4' energy: -99.750 flat angles P-C4'-P energy: -65.757 tors. eta vs tors. theta energy: -115.424 Dist. restrs. and SS energy: 2.540 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1391.335308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.335308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.430213 (E_RNA) where: Base-Base interactions energy: -999.876 where: short stacking energy: -416.804 Base-Backbone interact. energy: -1.257 local terms energy: -429.297254 where: bonds (distance) C4'-P energy: -83.196 bonds (distance) P-C4' energy: -73.138 flat angles C4'-P-C4' energy: -96.563 flat angles P-C4'-P energy: -68.771 tors. eta vs tors. theta energy: -107.630 Dist. restrs. and SS energy: 2.345 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -1309.910121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.910121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.662165 (E_RNA) where: Base-Base interactions energy: -973.085 where: short stacking energy: -397.542 Base-Backbone interact. energy: 2.574 local terms energy: -387.150658 where: bonds (distance) C4'-P energy: -80.881 bonds (distance) P-C4' energy: -73.039 flat angles C4'-P-C4' energy: -88.374 flat angles P-C4'-P energy: -41.626 tors. eta vs tors. theta energy: -103.230 Dist. restrs. and SS energy: 11.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -1194.645258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.645258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.466653 (E_RNA) where: Base-Base interactions energy: -875.047 where: short stacking energy: -350.487 Base-Backbone interact. energy: 3.663 local terms energy: -382.082082 where: bonds (distance) C4'-P energy: -73.581 bonds (distance) P-C4' energy: -77.582 flat angles C4'-P-C4' energy: -81.709 flat angles P-C4'-P energy: -47.858 tors. eta vs tors. theta energy: -101.353 Dist. restrs. and SS energy: 22.071 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1627.718075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1627.718075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.572657 (E_RNA) where: Base-Base interactions energy: -1196.607 where: short stacking energy: -477.706 Base-Backbone interact. energy: -2.156 local terms energy: -474.809570 where: bonds (distance) C4'-P energy: -82.946 bonds (distance) P-C4' energy: -93.795 flat angles C4'-P-C4' energy: -98.480 flat angles P-C4'-P energy: -67.572 tors. eta vs tors. theta energy: -132.016 Dist. restrs. and SS energy: 9.105 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1607.289475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.289475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.120193 (E_RNA) where: Base-Base interactions energy: -1185.473 where: short stacking energy: -478.813 Base-Backbone interact. energy: -0.820 local terms energy: -463.827166 where: bonds (distance) C4'-P energy: -89.416 bonds (distance) P-C4' energy: -83.559 flat angles C4'-P-C4' energy: -97.477 flat angles P-C4'-P energy: -65.830 tors. eta vs tors. theta energy: -127.544 Dist. restrs. and SS energy: 6.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1565.156498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.156498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.850033 (E_RNA) where: Base-Base interactions energy: -1120.258 where: short stacking energy: -477.484 Base-Backbone interact. energy: -0.790 local terms energy: -481.802449 where: bonds (distance) C4'-P energy: -79.085 bonds (distance) P-C4' energy: -80.810 flat angles C4'-P-C4' energy: -107.633 flat angles P-C4'-P energy: -76.970 tors. eta vs tors. theta energy: -137.305 Dist. restrs. and SS energy: 0.944 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1571.722730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.722730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.059753 (E_RNA) where: Base-Base interactions energy: -1154.970 where: short stacking energy: -476.334 Base-Backbone interact. energy: -0.459 local terms energy: -453.630127 where: bonds (distance) C4'-P energy: -81.945 bonds (distance) P-C4' energy: -79.637 flat angles C4'-P-C4' energy: -106.415 flat angles P-C4'-P energy: -55.021 tors. eta vs tors. theta energy: -130.612 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1452.614568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.614568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.957043 (E_RNA) where: Base-Base interactions energy: -1053.104 where: short stacking energy: -437.334 Base-Backbone interact. energy: 1.040 local terms energy: -449.893362 where: bonds (distance) C4'-P energy: -76.580 bonds (distance) P-C4' energy: -91.349 flat angles C4'-P-C4' energy: -98.460 flat angles P-C4'-P energy: -58.387 tors. eta vs tors. theta energy: -125.118 Dist. restrs. and SS energy: 12.592 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1499.489913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.489913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.190523 (E_RNA) where: Base-Base interactions energy: -1088.869 where: short stacking energy: -454.997 Base-Backbone interact. energy: -2.148 local terms energy: -446.173704 where: bonds (distance) C4'-P energy: -68.688 bonds (distance) P-C4' energy: -93.178 flat angles C4'-P-C4' energy: -89.742 flat angles P-C4'-P energy: -67.020 tors. eta vs tors. theta energy: -127.545 Dist. restrs. and SS energy: 0.951 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1418.741544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.741544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.069607 (E_RNA) where: Base-Base interactions energy: -1042.915 where: short stacking energy: -438.946 Base-Backbone interact. energy: -0.641 local terms energy: -413.512897 where: bonds (distance) C4'-P energy: -85.666 bonds (distance) P-C4' energy: -64.232 flat angles C4'-P-C4' energy: -99.051 flat angles P-C4'-P energy: -45.254 tors. eta vs tors. theta energy: -119.311 Dist. restrs. and SS energy: 1.578 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1388.599729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.599729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.740053 (E_RNA) where: Base-Base interactions energy: -1018.381 where: short stacking energy: -428.287 Base-Backbone interact. energy: -1.562 local terms energy: -406.797676 where: bonds (distance) C4'-P energy: -66.898 bonds (distance) P-C4' energy: -81.405 flat angles C4'-P-C4' energy: -91.054 flat angles P-C4'-P energy: -46.242 tors. eta vs tors. theta energy: -121.199 Dist. restrs. and SS energy: 1.390 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -1300.790576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.790576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.542149 (E_RNA) where: Base-Base interactions energy: -959.156 where: short stacking energy: -371.352 Base-Backbone interact. energy: 1.800 local terms energy: -389.185930 where: bonds (distance) C4'-P energy: -67.833 bonds (distance) P-C4' energy: -87.767 flat angles C4'-P-C4' energy: -78.375 flat angles P-C4'-P energy: -52.358 tors. eta vs tors. theta energy: -102.852 Dist. restrs. and SS energy: 9.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -1211.892335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.892335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.874189 (E_RNA) where: Base-Base interactions energy: -914.590 where: short stacking energy: -372.025 Base-Backbone interact. energy: -0.754 local terms energy: -343.530438 where: bonds (distance) C4'-P energy: -38.448 bonds (distance) P-C4' energy: -70.332 flat angles C4'-P-C4' energy: -84.532 flat angles P-C4'-P energy: -52.405 tors. eta vs tors. theta energy: -97.813 Dist. restrs. and SS energy: 10.232 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1657.899858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.899858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.402455 (E_RNA) where: Base-Base interactions energy: -1183.675 where: short stacking energy: -483.418 Base-Backbone interact. energy: -2.883 local terms energy: -513.844410 where: bonds (distance) C4'-P energy: -93.126 bonds (distance) P-C4' energy: -96.482 flat angles C4'-P-C4' energy: -102.863 flat angles P-C4'-P energy: -74.522 tors. eta vs tors. theta energy: -146.851 Dist. restrs. and SS energy: 5.753 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1608.859952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.859952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.001549 (E_RNA) where: Base-Base interactions energy: -1157.473 where: short stacking energy: -477.414 Base-Backbone interact. energy: -1.130 local terms energy: -491.398697 where: bonds (distance) C4'-P energy: -83.236 bonds (distance) P-C4' energy: -98.245 flat angles C4'-P-C4' energy: -102.035 flat angles P-C4'-P energy: -66.435 tors. eta vs tors. theta energy: -141.448 Dist. restrs. and SS energy: 4.392 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1589.214241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.214241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.802821 (E_RNA) where: Base-Base interactions energy: -1165.283 where: short stacking energy: -487.565 Base-Backbone interact. energy: 0.441 local terms energy: -461.961033 where: bonds (distance) C4'-P energy: -84.324 bonds (distance) P-C4' energy: -76.211 flat angles C4'-P-C4' energy: -104.147 flat angles P-C4'-P energy: -61.180 tors. eta vs tors. theta energy: -136.099 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1519.155996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.155996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.958147 (E_RNA) where: Base-Base interactions energy: -1099.620 where: short stacking energy: -459.745 Base-Backbone interact. energy: -1.564 local terms energy: -455.774318 where: bonds (distance) C4'-P energy: -73.799 bonds (distance) P-C4' energy: -92.957 flat angles C4'-P-C4' energy: -97.520 flat angles P-C4'-P energy: -63.658 tors. eta vs tors. theta energy: -127.841 Dist. restrs. and SS energy: 1.052 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1464.786558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.786558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.035124 (E_RNA) where: Base-Base interactions energy: -1068.421 where: short stacking energy: -416.111 Base-Backbone interact. energy: -1.899 local terms energy: -439.714845 where: bonds (distance) C4'-P energy: -91.782 bonds (distance) P-C4' energy: -78.505 flat angles C4'-P-C4' energy: -89.562 flat angles P-C4'-P energy: -70.960 tors. eta vs tors. theta energy: -108.906 Dist. restrs. and SS energy: 8.499 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1478.091262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.091262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.769984 (E_RNA) where: Base-Base interactions energy: -1086.777 where: short stacking energy: -445.618 Base-Backbone interact. energy: 0.573 local terms energy: -430.565121 where: bonds (distance) C4'-P energy: -74.209 bonds (distance) P-C4' energy: -92.496 flat angles C4'-P-C4' energy: -86.573 flat angles P-C4'-P energy: -62.336 tors. eta vs tors. theta energy: -114.951 Dist. restrs. and SS energy: 1.929 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1434.728401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.728401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.866689 (E_RNA) where: Base-Base interactions energy: -1050.626 where: short stacking energy: -434.842 Base-Backbone interact. energy: -1.835 local terms energy: -420.405112 where: bonds (distance) C4'-P energy: -77.337 bonds (distance) P-C4' energy: -89.012 flat angles C4'-P-C4' energy: -90.655 flat angles P-C4'-P energy: -43.399 tors. eta vs tors. theta energy: -120.003 Dist. restrs. and SS energy: 1.388 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1404.756375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.756375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.583099 (E_RNA) where: Base-Base interactions energy: -1034.303 where: short stacking energy: -410.292 Base-Backbone interact. energy: 3.436 local terms energy: -412.716723 where: bonds (distance) C4'-P energy: -72.200 bonds (distance) P-C4' energy: -78.252 flat angles C4'-P-C4' energy: -93.380 flat angles P-C4'-P energy: -56.541 tors. eta vs tors. theta energy: -112.344 Dist. restrs. and SS energy: 2.077 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -1301.669584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.669584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.031567 (E_RNA) where: Base-Base interactions energy: -980.027 where: short stacking energy: -386.804 Base-Backbone interact. energy: 5.555 local terms energy: -373.559761 where: bonds (distance) C4'-P energy: -64.385 bonds (distance) P-C4' energy: -79.477 flat angles C4'-P-C4' energy: -77.543 flat angles P-C4'-P energy: -57.060 tors. eta vs tors. theta energy: -95.094 Dist. restrs. and SS energy: 9.612 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -1252.493508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.493508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.009658 (E_RNA) where: Base-Base interactions energy: -901.587 where: short stacking energy: -360.346 Base-Backbone interact. energy: -1.039 local terms energy: -398.382954 where: bonds (distance) C4'-P energy: -81.297 bonds (distance) P-C4' energy: -76.795 flat angles C4'-P-C4' energy: -88.063 flat angles P-C4'-P energy: -48.635 tors. eta vs tors. theta energy: -103.592 Dist. restrs. and SS energy: 11.766 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1673.970438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.970438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.594203 (E_RNA) where: Base-Base interactions energy: -1226.286 where: short stacking energy: -500.814 Base-Backbone interact. energy: -0.672 local terms energy: -489.635618 where: bonds (distance) C4'-P energy: -92.912 bonds (distance) P-C4' energy: -90.767 flat angles C4'-P-C4' energy: -107.384 flat angles P-C4'-P energy: -60.146 tors. eta vs tors. theta energy: -138.427 Dist. restrs. and SS energy: 5.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1600.340981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.340981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1642.236864 (E_RNA) where: Base-Base interactions energy: -1158.896 where: short stacking energy: -484.686 Base-Backbone interact. energy: 0.116 local terms energy: -483.457216 where: bonds (distance) C4'-P energy: -94.066 bonds (distance) P-C4' energy: -87.680 flat angles C4'-P-C4' energy: -100.201 flat angles P-C4'-P energy: -65.199 tors. eta vs tors. theta energy: -136.311 Dist. restrs. and SS energy: 5.146 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1586.645486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.645486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.752586 (E_RNA) where: Base-Base interactions energy: -1141.345 where: short stacking energy: -493.734 Base-Backbone interact. energy: -0.063 local terms energy: -483.344847 where: bonds (distance) C4'-P energy: -87.087 bonds (distance) P-C4' energy: -91.324 flat angles C4'-P-C4' energy: -103.473 flat angles P-C4'-P energy: -61.357 tors. eta vs tors. theta energy: -140.104 Dist. restrs. and SS energy: 1.357 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1563.896281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.896281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.889942 (E_RNA) where: Base-Base interactions energy: -1117.893 where: short stacking energy: -451.327 Base-Backbone interact. energy: -2.322 local terms energy: -481.674240 where: bonds (distance) C4'-P energy: -88.791 bonds (distance) P-C4' energy: -81.293 flat angles C4'-P-C4' energy: -107.542 flat angles P-C4'-P energy: -66.667 tors. eta vs tors. theta energy: -137.380 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1437.473902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.473902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.768945 (E_RNA) where: Base-Base interactions energy: -1046.708 where: short stacking energy: -436.971 Base-Backbone interact. energy: 5.701 local terms energy: -441.761362 where: bonds (distance) C4'-P energy: -82.792 bonds (distance) P-C4' energy: -79.035 flat angles C4'-P-C4' energy: -92.911 flat angles P-C4'-P energy: -70.671 tors. eta vs tors. theta energy: -116.353 Dist. restrs. and SS energy: 8.545 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1479.288815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.288815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.349395 (E_RNA) where: Base-Base interactions energy: -1057.535 where: short stacking energy: -438.901 Base-Backbone interact. energy: -3.165 local terms energy: -457.649401 where: bonds (distance) C4'-P energy: -91.032 bonds (distance) P-C4' energy: -86.428 flat angles C4'-P-C4' energy: -90.309 flat angles P-C4'-P energy: -64.287 tors. eta vs tors. theta energy: -125.594 Dist. restrs. and SS energy: 2.311 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1441.333784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.333784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.385140 (E_RNA) where: Base-Base interactions energy: -1040.039 where: short stacking energy: -433.759 Base-Backbone interact. energy: 0.186 local terms energy: -440.532583 where: bonds (distance) C4'-P energy: -76.170 bonds (distance) P-C4' energy: -78.374 flat angles C4'-P-C4' energy: -99.291 flat angles P-C4'-P energy: -72.693 tors. eta vs tors. theta energy: -114.005 Dist. restrs. and SS energy: 2.301 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1354.461497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.461497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.282941 (E_RNA) where: Base-Base interactions energy: -1012.464 where: short stacking energy: -392.353 Base-Backbone interact. energy: 3.488 local terms energy: -383.306120 where: bonds (distance) C4'-P energy: -75.107 bonds (distance) P-C4' energy: -65.497 flat angles C4'-P-C4' energy: -82.728 flat angles P-C4'-P energy: -58.413 tors. eta vs tors. theta energy: -101.562 Dist. restrs. and SS energy: 1.071 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1286.755091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.755091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.557577 (E_RNA) where: Base-Base interactions energy: -926.038 where: short stacking energy: -388.404 Base-Backbone interact. energy: -0.158 local terms energy: -403.361676 where: bonds (distance) C4'-P energy: -80.526 bonds (distance) P-C4' energy: -83.899 flat angles C4'-P-C4' energy: -86.822 flat angles P-C4'-P energy: -46.026 tors. eta vs tors. theta energy: -106.088 Dist. restrs. and SS energy: 6.052 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -1278.959807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.959807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.015039 (E_RNA) where: Base-Base interactions energy: -941.766 where: short stacking energy: -386.483 Base-Backbone interact. energy: -1.505 local terms energy: -383.744291 where: bonds (distance) C4'-P energy: -68.571 bonds (distance) P-C4' energy: -52.408 flat angles C4'-P-C4' energy: -95.913 flat angles P-C4'-P energy: -51.727 tors. eta vs tors. theta energy: -115.126 Dist. restrs. and SS energy: 11.305 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1688.743248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.743248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.455845 (E_RNA) where: Base-Base interactions energy: -1242.816 where: short stacking energy: -510.662 Base-Backbone interact. energy: -1.063 local terms energy: -488.577119 where: bonds (distance) C4'-P energy: -85.271 bonds (distance) P-C4' energy: -88.345 flat angles C4'-P-C4' energy: -108.340 flat angles P-C4'-P energy: -68.884 tors. eta vs tors. theta energy: -137.737 Dist. restrs. and SS energy: 6.963 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1625.446527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.446527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.907293 (E_RNA) where: Base-Base interactions energy: -1186.560 where: short stacking energy: -486.629 Base-Backbone interact. energy: 0.789 local terms energy: -482.136648 where: bonds (distance) C4'-P energy: -91.794 bonds (distance) P-C4' energy: -85.450 flat angles C4'-P-C4' energy: -96.293 flat angles P-C4'-P energy: -66.120 tors. eta vs tors. theta energy: -142.480 Dist. restrs. and SS energy: 5.711 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1559.479817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.479817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.895016 (E_RNA) where: Base-Base interactions energy: -1124.649 where: short stacking energy: -459.798 Base-Backbone interact. energy: -0.767 local terms energy: -471.478999 where: bonds (distance) C4'-P energy: -90.696 bonds (distance) P-C4' energy: -84.755 flat angles C4'-P-C4' energy: -106.435 flat angles P-C4'-P energy: -64.798 tors. eta vs tors. theta energy: -124.795 Dist. restrs. and SS energy: 0.665 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1528.745180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.745180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.346367 (E_RNA) where: Base-Base interactions energy: -1098.674 where: short stacking energy: -462.352 Base-Backbone interact. energy: -2.185 local terms energy: -466.487383 where: bonds (distance) C4'-P energy: -78.471 bonds (distance) P-C4' energy: -83.504 flat angles C4'-P-C4' energy: -99.135 flat angles P-C4'-P energy: -73.903 tors. eta vs tors. theta energy: -131.474 Dist. restrs. and SS energy: 1.851 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1518.991781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.991781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.382225 (E_RNA) where: Base-Base interactions energy: -1109.090 where: short stacking energy: -470.351 Base-Backbone interact. energy: -2.666 local terms energy: -445.626687 where: bonds (distance) C4'-P energy: -78.550 bonds (distance) P-C4' energy: -82.666 flat angles C4'-P-C4' energy: -93.219 flat angles P-C4'-P energy: -56.756 tors. eta vs tors. theta energy: -134.436 Dist. restrs. and SS energy: 1.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1388.447525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.447525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.028626 (E_RNA) where: Base-Base interactions energy: -1003.069 where: short stacking energy: -406.258 Base-Backbone interact. energy: 1.062 local terms energy: -432.020943 where: bonds (distance) C4'-P energy: -77.269 bonds (distance) P-C4' energy: -85.616 flat angles C4'-P-C4' energy: -94.967 flat angles P-C4'-P energy: -55.180 tors. eta vs tors. theta energy: -118.989 Dist. restrs. and SS energy: 8.831 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1438.670008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.670008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.926872 (E_RNA) where: Base-Base interactions energy: -1062.644 where: short stacking energy: -428.108 Base-Backbone interact. energy: 5.770 local terms energy: -420.052581 where: bonds (distance) C4'-P energy: -71.229 bonds (distance) P-C4' energy: -79.881 flat angles C4'-P-C4' energy: -92.983 flat angles P-C4'-P energy: -64.622 tors. eta vs tors. theta energy: -111.337 Dist. restrs. and SS energy: 1.507 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1371.772514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.772514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.721425 (E_RNA) where: Base-Base interactions energy: -988.690 where: short stacking energy: -382.942 Base-Backbone interact. energy: -1.577 local terms energy: -420.454281 where: bonds (distance) C4'-P energy: -88.578 bonds (distance) P-C4' energy: -79.383 flat angles C4'-P-C4' energy: -91.862 flat angles P-C4'-P energy: -62.314 tors. eta vs tors. theta energy: -98.317 Dist. restrs. and SS energy: 2.199 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1361.887169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.887169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.545170 (E_RNA) where: Base-Base interactions energy: -1006.665 where: short stacking energy: -413.839 Base-Backbone interact. energy: -2.432 local terms energy: -394.447857 where: bonds (distance) C4'-P energy: -74.136 bonds (distance) P-C4' energy: -68.475 flat angles C4'-P-C4' energy: -83.965 flat angles P-C4'-P energy: -59.079 tors. eta vs tors. theta energy: -108.792 Dist. restrs. and SS energy: 4.908 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -1218.835481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.835481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.047310 (E_RNA) where: Base-Base interactions energy: -877.793 where: short stacking energy: -342.789 Base-Backbone interact. energy: -0.816 local terms energy: -388.437360 where: bonds (distance) C4'-P energy: -75.048 bonds (distance) P-C4' energy: -71.433 flat angles C4'-P-C4' energy: -94.168 flat angles P-C4'-P energy: -62.122 tors. eta vs tors. theta energy: -85.666 Dist. restrs. and SS energy: 11.462 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1665.448134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.448134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.799719 (E_RNA) where: Base-Base interactions energy: -1209.723 where: short stacking energy: -485.860 Base-Backbone interact. energy: -0.171 local terms energy: -498.906001 where: bonds (distance) C4'-P energy: -98.645 bonds (distance) P-C4' energy: -87.664 flat angles C4'-P-C4' energy: -107.021 flat angles P-C4'-P energy: -69.690 tors. eta vs tors. theta energy: -135.886 Dist. restrs. and SS energy: 6.602 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1633.646969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.646969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.779927 (E_RNA) where: Base-Base interactions energy: -1186.155 where: short stacking energy: -515.772 Base-Backbone interact. energy: -1.795 local terms energy: -487.829763 where: bonds (distance) C4'-P energy: -90.639 bonds (distance) P-C4' energy: -89.220 flat angles C4'-P-C4' energy: -104.396 flat angles P-C4'-P energy: -62.955 tors. eta vs tors. theta energy: -140.621 Dist. restrs. and SS energy: 5.383 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1567.180107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.180107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.044070 (E_RNA) where: Base-Base interactions energy: -1116.477 where: short stacking energy: -457.904 Base-Backbone interact. energy: -0.178 local terms energy: -488.388774 where: bonds (distance) C4'-P energy: -92.355 bonds (distance) P-C4' energy: -95.368 flat angles C4'-P-C4' energy: -105.992 flat angles P-C4'-P energy: -66.839 tors. eta vs tors. theta energy: -127.834 Dist. restrs. and SS energy: 1.114 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1552.170539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.170539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.733728 (E_RNA) where: Base-Base interactions energy: -1127.073 where: short stacking energy: -482.252 Base-Backbone interact. energy: -2.973 local terms energy: -460.688264 where: bonds (distance) C4'-P energy: -83.567 bonds (distance) P-C4' energy: -84.930 flat angles C4'-P-C4' energy: -106.700 flat angles P-C4'-P energy: -49.690 tors. eta vs tors. theta energy: -135.801 Dist. restrs. and SS energy: 1.813 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1540.722965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.722965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.886931 (E_RNA) where: Base-Base interactions energy: -1098.949 where: short stacking energy: -466.226 Base-Backbone interact. energy: 1.052 local terms energy: -480.989905 where: bonds (distance) C4'-P energy: -82.005 bonds (distance) P-C4' energy: -92.195 flat angles C4'-P-C4' energy: -97.862 flat angles P-C4'-P energy: -68.612 tors. eta vs tors. theta energy: -140.316 Dist. restrs. and SS energy: 1.414 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1413.419261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1413.419261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.680645 (E_RNA) where: Base-Base interactions energy: -1021.186 where: short stacking energy: -418.445 Base-Backbone interact. energy: -1.930 local terms energy: -435.564267 where: bonds (distance) C4'-P energy: -85.744 bonds (distance) P-C4' energy: -80.337 flat angles C4'-P-C4' energy: -94.522 flat angles P-C4'-P energy: -70.427 tors. eta vs tors. theta energy: -104.534 Dist. restrs. and SS energy: 8.511 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1429.955030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.955030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.533202 (E_RNA) where: Base-Base interactions energy: -1046.194 where: short stacking energy: -429.514 Base-Backbone interact. energy: -0.975 local terms energy: -421.364806 where: bonds (distance) C4'-P energy: -64.492 bonds (distance) P-C4' energy: -88.289 flat angles C4'-P-C4' energy: -79.330 flat angles P-C4'-P energy: -68.510 tors. eta vs tors. theta energy: -120.743 Dist. restrs. and SS energy: 1.828 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1384.949906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.949906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.183786 (E_RNA) where: Base-Base interactions energy: -1016.028 where: short stacking energy: -392.822 Base-Backbone interact. energy: -1.188 local terms energy: -405.968347 where: bonds (distance) C4'-P energy: -79.462 bonds (distance) P-C4' energy: -80.102 flat angles C4'-P-C4' energy: -92.224 flat angles P-C4'-P energy: -48.719 tors. eta vs tors. theta energy: -105.462 Dist. restrs. and SS energy: 1.484 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1336.345503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.345503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.327051 (E_RNA) where: Base-Base interactions energy: -990.625 where: short stacking energy: -405.642 Base-Backbone interact. energy: 0.613 local terms energy: -389.315353 where: bonds (distance) C4'-P energy: -68.564 bonds (distance) P-C4' energy: -82.694 flat angles C4'-P-C4' energy: -79.407 flat angles P-C4'-P energy: -51.803 tors. eta vs tors. theta energy: -106.847 Dist. restrs. and SS energy: 6.232 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -1233.026768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.026768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.361290 (E_RNA) where: Base-Base interactions energy: -901.728 where: short stacking energy: -357.281 Base-Backbone interact. energy: -1.297 local terms energy: -379.335702 where: bonds (distance) C4'-P energy: -83.430 bonds (distance) P-C4' energy: -81.003 flat angles C4'-P-C4' energy: -81.734 flat angles P-C4'-P energy: -48.776 tors. eta vs tors. theta energy: -84.393 Dist. restrs. and SS energy: 12.585 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1669.432974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.432974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.056485 (E_RNA) where: Base-Base interactions energy: -1220.842 where: short stacking energy: -498.503 Base-Backbone interact. energy: -1.917 local terms energy: -493.298298 where: bonds (distance) C4'-P energy: -82.829 bonds (distance) P-C4' energy: -96.608 flat angles C4'-P-C4' energy: -109.645 flat angles P-C4'-P energy: -71.690 tors. eta vs tors. theta energy: -132.526 Dist. restrs. and SS energy: 9.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1614.961661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.961661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.730141 (E_RNA) where: Base-Base interactions energy: -1180.138 where: short stacking energy: -480.124 Base-Backbone interact. energy: -2.048 local terms energy: -474.543929 where: bonds (distance) C4'-P energy: -81.637 bonds (distance) P-C4' energy: -92.676 flat angles C4'-P-C4' energy: -102.087 flat angles P-C4'-P energy: -64.689 tors. eta vs tors. theta energy: -133.455 Dist. restrs. and SS energy: 5.018 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1585.346897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.346897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.693171 (E_RNA) where: Base-Base interactions energy: -1172.196 where: short stacking energy: -492.518 Base-Backbone interact. energy: -1.031 local terms energy: -450.465795 where: bonds (distance) C4'-P energy: -79.829 bonds (distance) P-C4' energy: -82.786 flat angles C4'-P-C4' energy: -89.233 flat angles P-C4'-P energy: -63.810 tors. eta vs tors. theta energy: -134.808 Dist. restrs. and SS energy: 1.596 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1542.277238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.277238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.539646 (E_RNA) where: Base-Base interactions energy: -1107.816 where: short stacking energy: -455.544 Base-Backbone interact. energy: -2.062 local terms energy: -470.661721 where: bonds (distance) C4'-P energy: -78.729 bonds (distance) P-C4' energy: -80.159 flat angles C4'-P-C4' energy: -107.692 flat angles P-C4'-P energy: -67.167 tors. eta vs tors. theta energy: -136.915 Dist. restrs. and SS energy: 1.512 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1498.811828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1498.811828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.416485 (E_RNA) where: Base-Base interactions energy: -1102.556 where: short stacking energy: -446.897 Base-Backbone interact. energy: -1.499 local terms energy: -432.362057 where: bonds (distance) C4'-P energy: -80.568 bonds (distance) P-C4' energy: -76.261 flat angles C4'-P-C4' energy: -93.511 flat angles P-C4'-P energy: -54.379 tors. eta vs tors. theta energy: -127.644 Dist. restrs. and SS energy: 0.855 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1389.515355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.515355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.016931 (E_RNA) where: Base-Base interactions energy: -987.387 where: short stacking energy: -415.451 Base-Backbone interact. energy: -1.454 local terms energy: -445.176733 where: bonds (distance) C4'-P energy: -83.383 bonds (distance) P-C4' energy: -96.459 flat angles C4'-P-C4' energy: -94.422 flat angles P-C4'-P energy: -61.934 tors. eta vs tors. theta energy: -108.979 Dist. restrs. and SS energy: 7.752 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1423.810457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.810457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.799510 (E_RNA) where: Base-Base interactions energy: -1027.783 where: short stacking energy: -417.943 Base-Backbone interact. energy: -2.843 local terms energy: -432.173504 where: bonds (distance) C4'-P energy: -73.298 bonds (distance) P-C4' energy: -80.335 flat angles C4'-P-C4' energy: -94.487 flat angles P-C4'-P energy: -60.138 tors. eta vs tors. theta energy: -123.916 Dist. restrs. and SS energy: 2.239 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1392.252399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.252399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.736813 (E_RNA) where: Base-Base interactions energy: -1005.918 where: short stacking energy: -417.915 Base-Backbone interact. energy: 9.583 local terms energy: -434.401442 where: bonds (distance) C4'-P energy: -83.963 bonds (distance) P-C4' energy: -78.857 flat angles C4'-P-C4' energy: -96.349 flat angles P-C4'-P energy: -63.533 tors. eta vs tors. theta energy: -111.700 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1353.605241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.605241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.907806 (E_RNA) where: Base-Base interactions energy: -1014.567 where: short stacking energy: -412.698 Base-Backbone interact. energy: -1.750 local terms energy: -379.591072 where: bonds (distance) C4'-P energy: -73.831 bonds (distance) P-C4' energy: -64.183 flat angles C4'-P-C4' energy: -88.515 flat angles P-C4'-P energy: -42.805 tors. eta vs tors. theta energy: -110.257 Dist. restrs. and SS energy: 5.553 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -1317.628039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.628039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.513027 (E_RNA) where: Base-Base interactions energy: -1006.747 where: short stacking energy: -388.219 Base-Backbone interact. energy: -2.303 local terms energy: -347.462764 where: bonds (distance) C4'-P energy: -55.439 bonds (distance) P-C4' energy: -65.734 flat angles C4'-P-C4' energy: -88.951 flat angles P-C4'-P energy: -37.883 tors. eta vs tors. theta energy: -99.455 Dist. restrs. and SS energy: 2.135 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1649.346372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.346372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.621250 (E_RNA) where: Base-Base interactions energy: -1200.601 where: short stacking energy: -478.836 Base-Backbone interact. energy: 0.652 local terms energy: -495.672081 where: bonds (distance) C4'-P energy: -90.318 bonds (distance) P-C4' energy: -92.151 flat angles C4'-P-C4' energy: -111.486 flat angles P-C4'-P energy: -71.809 tors. eta vs tors. theta energy: -129.908 Dist. restrs. and SS energy: 9.525 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1614.055613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.055613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.073318 (E_RNA) where: Base-Base interactions energy: -1165.007 where: short stacking energy: -470.997 Base-Backbone interact. energy: 0.746 local terms energy: -492.811739 where: bonds (distance) C4'-P energy: -81.561 bonds (distance) P-C4' energy: -100.192 flat angles C4'-P-C4' energy: -110.325 flat angles P-C4'-P energy: -63.295 tors. eta vs tors. theta energy: -137.439 Dist. restrs. and SS energy: 6.268 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1582.364863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.364863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.629848 (E_RNA) where: Base-Base interactions energy: -1159.852 where: short stacking energy: -487.142 Base-Backbone interact. energy: -0.941 local terms energy: -459.837112 where: bonds (distance) C4'-P energy: -82.225 bonds (distance) P-C4' energy: -78.160 flat angles C4'-P-C4' energy: -103.356 flat angles P-C4'-P energy: -61.880 tors. eta vs tors. theta energy: -134.217 Dist. restrs. and SS energy: 1.515 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1549.526822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.526822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.051805 (E_RNA) where: Base-Base interactions energy: -1110.397 where: short stacking energy: -467.806 Base-Backbone interact. energy: -0.065 local terms energy: -477.590017 where: bonds (distance) C4'-P energy: -86.478 bonds (distance) P-C4' energy: -92.769 flat angles C4'-P-C4' energy: -93.856 flat angles P-C4'-P energy: -66.103 tors. eta vs tors. theta energy: -138.385 Dist. restrs. and SS energy: 1.775 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1509.379727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.379727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.479668 (E_RNA) where: Base-Base interactions energy: -1076.894 where: short stacking energy: -452.038 Base-Backbone interact. energy: -0.759 local terms energy: -469.826528 where: bonds (distance) C4'-P energy: -84.030 bonds (distance) P-C4' energy: -85.525 flat angles C4'-P-C4' energy: -105.209 flat angles P-C4'-P energy: -61.700 tors. eta vs tors. theta energy: -133.363 Dist. restrs. and SS energy: 1.350 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1459.501441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.501441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.808516 (E_RNA) where: Base-Base interactions energy: -1063.412 where: short stacking energy: -433.322 Base-Backbone interact. energy: -1.479 local terms energy: -432.917871 where: bonds (distance) C4'-P energy: -76.110 bonds (distance) P-C4' energy: -82.136 flat angles C4'-P-C4' energy: -95.474 flat angles P-C4'-P energy: -65.198 tors. eta vs tors. theta energy: -114.000 Dist. restrs. and SS energy: 1.557 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1356.761739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.761739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.763102 (E_RNA) where: Base-Base interactions energy: -996.867 where: short stacking energy: -409.812 Base-Backbone interact. energy: 1.344 local terms energy: -407.240110 where: bonds (distance) C4'-P energy: -72.248 bonds (distance) P-C4' energy: -70.853 flat angles C4'-P-C4' energy: -92.874 flat angles P-C4'-P energy: -65.338 tors. eta vs tors. theta energy: -105.927 Dist. restrs. and SS energy: 9.251 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1390.192748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.192748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.481460 (E_RNA) where: Base-Base interactions energy: -1014.983 where: short stacking energy: -420.970 Base-Backbone interact. energy: -2.774 local terms energy: -410.724542 where: bonds (distance) C4'-P energy: -66.322 bonds (distance) P-C4' energy: -90.603 flat angles C4'-P-C4' energy: -98.377 flat angles P-C4'-P energy: -50.512 tors. eta vs tors. theta energy: -104.910 Dist. restrs. and SS energy: 1.539 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1342.514423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.514423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.300384 (E_RNA) where: Base-Base interactions energy: -977.946 where: short stacking energy: -396.345 Base-Backbone interact. energy: 0.737 local terms energy: -406.091536 where: bonds (distance) C4'-P energy: -79.980 bonds (distance) P-C4' energy: -75.281 flat angles C4'-P-C4' energy: -92.882 flat angles P-C4'-P energy: -48.148 tors. eta vs tors. theta energy: -109.800 Dist. restrs. and SS energy: 4.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -1309.515402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.515402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.494282 (E_RNA) where: Base-Base interactions energy: -993.768 where: short stacking energy: -416.388 Base-Backbone interact. energy: 2.721 local terms energy: -362.447565 where: bonds (distance) C4'-P energy: -58.593 bonds (distance) P-C4' energy: -68.608 flat angles C4'-P-C4' energy: -65.022 flat angles P-C4'-P energy: -58.995 tors. eta vs tors. theta energy: -111.229 Dist. restrs. and SS energy: 7.229 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1688.245112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.245112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.467354 (E_RNA) where: Base-Base interactions energy: -1242.500 where: short stacking energy: -505.297 Base-Backbone interact. energy: -0.979 local terms energy: -486.989293 where: bonds (distance) C4'-P energy: -86.999 bonds (distance) P-C4' energy: -89.511 flat angles C4'-P-C4' energy: -108.159 flat angles P-C4'-P energy: -65.967 tors. eta vs tors. theta energy: -136.353 Dist. restrs. and SS energy: 5.472 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1642.562418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.562418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.018586 (E_RNA) where: Base-Base interactions energy: -1215.564 where: short stacking energy: -487.640 Base-Backbone interact. energy: -0.550 local terms energy: -472.904889 where: bonds (distance) C4'-P energy: -79.851 bonds (distance) P-C4' energy: -84.052 flat angles C4'-P-C4' energy: -111.383 flat angles P-C4'-P energy: -61.106 tors. eta vs tors. theta energy: -136.513 Dist. restrs. and SS energy: 9.706 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1617.250688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.250688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.715239 (E_RNA) where: Base-Base interactions energy: -1180.646 where: short stacking energy: -488.471 Base-Backbone interact. energy: -2.471 local terms energy: -471.598569 where: bonds (distance) C4'-P energy: -74.026 bonds (distance) P-C4' energy: -89.341 flat angles C4'-P-C4' energy: -107.987 flat angles P-C4'-P energy: -69.919 tors. eta vs tors. theta energy: -130.326 Dist. restrs. and SS energy: 0.715 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1556.593611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.593611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.609137 (E_RNA) where: Base-Base interactions energy: -1145.828 where: short stacking energy: -461.144 Base-Backbone interact. energy: -2.679 local terms energy: -446.102143 where: bonds (distance) C4'-P energy: -87.422 bonds (distance) P-C4' energy: -83.085 flat angles C4'-P-C4' energy: -94.515 flat angles P-C4'-P energy: -56.065 tors. eta vs tors. theta energy: -125.016 Dist. restrs. and SS energy: 1.266 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1512.478947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.478947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.828130 (E_RNA) where: Base-Base interactions energy: -1096.739 where: short stacking energy: -437.578 Base-Backbone interact. energy: 0.247 local terms energy: -454.335956 where: bonds (distance) C4'-P energy: -85.765 bonds (distance) P-C4' energy: -83.457 flat angles C4'-P-C4' energy: -105.713 flat angles P-C4'-P energy: -62.002 tors. eta vs tors. theta energy: -117.399 Dist. restrs. and SS energy: 1.599 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1481.397034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.397034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.088276 (E_RNA) where: Base-Base interactions energy: -1069.181 where: short stacking energy: -442.769 Base-Backbone interact. energy: 1.877 local terms energy: -451.784053 where: bonds (distance) C4'-P energy: -89.238 bonds (distance) P-C4' energy: -81.032 flat angles C4'-P-C4' energy: -98.422 flat angles P-C4'-P energy: -63.708 tors. eta vs tors. theta energy: -119.383 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1427.002109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.002109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.796886 (E_RNA) where: Base-Base interactions energy: -1051.019 where: short stacking energy: -437.124 Base-Backbone interact. energy: -1.749 local terms energy: -412.029522 where: bonds (distance) C4'-P energy: -50.775 bonds (distance) P-C4' energy: -77.484 flat angles C4'-P-C4' energy: -95.532 flat angles P-C4'-P energy: -63.185 tors. eta vs tors. theta energy: -125.054 Dist. restrs. and SS energy: 1.045 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1335.362925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.362925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.758211 (E_RNA) where: Base-Base interactions energy: -965.461 where: short stacking energy: -392.833 Base-Backbone interact. energy: 1.611 local terms energy: -414.908803 where: bonds (distance) C4'-P energy: -80.368 bonds (distance) P-C4' energy: -87.083 flat angles C4'-P-C4' energy: -93.132 flat angles P-C4'-P energy: -42.530 tors. eta vs tors. theta energy: -111.796 Dist. restrs. and SS energy: 6.645 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1351.073506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.073506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.646108 (E_RNA) where: Base-Base interactions energy: -1016.356 where: short stacking energy: -399.827 Base-Backbone interact. energy: 1.171 local terms energy: -373.461903 where: bonds (distance) C4'-P energy: -75.996 bonds (distance) P-C4' energy: -63.255 flat angles C4'-P-C4' energy: -74.085 flat angles P-C4'-P energy: -54.664 tors. eta vs tors. theta energy: -105.463 Dist. restrs. and SS energy: 0.823 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -1265.015890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.015890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.743853 (E_RNA) where: Base-Base interactions energy: -928.772 where: short stacking energy: -360.729 Base-Backbone interact. energy: -1.166 local terms energy: -380.806135 where: bonds (distance) C4'-P energy: -66.720 bonds (distance) P-C4' energy: -77.433 flat angles C4'-P-C4' energy: -98.243 flat angles P-C4'-P energy: -46.284 tors. eta vs tors. theta energy: -92.126 Dist. restrs. and SS energy: 8.978 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1688.151763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.151763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.646779 (E_RNA) where: Base-Base interactions energy: -1229.724 where: short stacking energy: -499.993 Base-Backbone interact. energy: -1.722 local terms energy: -499.201084 where: bonds (distance) C4'-P energy: -95.699 bonds (distance) P-C4' energy: -87.645 flat angles C4'-P-C4' energy: -105.440 flat angles P-C4'-P energy: -72.550 tors. eta vs tors. theta energy: -137.866 Dist. restrs. and SS energy: 5.745 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1653.606346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.606346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.797065 (E_RNA) where: Base-Base interactions energy: -1215.550 where: short stacking energy: -481.827 Base-Backbone interact. energy: -2.542 local terms energy: -481.704922 where: bonds (distance) C4'-P energy: -83.682 bonds (distance) P-C4' energy: -94.502 flat angles C4'-P-C4' energy: -108.220 flat angles P-C4'-P energy: -55.372 tors. eta vs tors. theta energy: -139.929 Dist. restrs. and SS energy: 9.441 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1614.439482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.439482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.101504 (E_RNA) where: Base-Base interactions energy: -1180.517 where: short stacking energy: -495.975 Base-Backbone interact. energy: -1.127 local terms energy: -471.457534 where: bonds (distance) C4'-P energy: -79.866 bonds (distance) P-C4' energy: -86.160 flat angles C4'-P-C4' energy: -101.362 flat angles P-C4'-P energy: -78.105 tors. eta vs tors. theta energy: -125.965 Dist. restrs. and SS energy: 1.912 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1554.635685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.635685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.588625 (E_RNA) where: Base-Base interactions energy: -1142.547 where: short stacking energy: -481.611 Base-Backbone interact. energy: -2.370 local terms energy: -447.671530 where: bonds (distance) C4'-P energy: -72.562 bonds (distance) P-C4' energy: -75.742 flat angles C4'-P-C4' energy: -94.968 flat angles P-C4'-P energy: -61.926 tors. eta vs tors. theta energy: -142.474 Dist. restrs. and SS energy: 1.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1528.172831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.172831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.772149 (E_RNA) where: Base-Base interactions energy: -1112.451 where: short stacking energy: -452.556 Base-Backbone interact. energy: -1.523 local terms energy: -451.798142 where: bonds (distance) C4'-P energy: -89.713 bonds (distance) P-C4' energy: -76.513 flat angles C4'-P-C4' energy: -99.360 flat angles P-C4'-P energy: -62.829 tors. eta vs tors. theta energy: -123.382 Dist. restrs. and SS energy: 0.849 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1478.519076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.519076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.354750 (E_RNA) where: Base-Base interactions energy: -1065.620 where: short stacking energy: -445.660 Base-Backbone interact. energy: 0.627 local terms energy: -452.362043 where: bonds (distance) C4'-P energy: -73.379 bonds (distance) P-C4' energy: -71.701 flat angles C4'-P-C4' energy: -105.443 flat angles P-C4'-P energy: -76.903 tors. eta vs tors. theta energy: -124.937 Dist. restrs. and SS energy: 2.086 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1428.114652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.114652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.332909 (E_RNA) where: Base-Base interactions energy: -1046.766 where: short stacking energy: -446.139 Base-Backbone interact. energy: -0.627 local terms energy: -419.939913 where: bonds (distance) C4'-P energy: -68.108 bonds (distance) P-C4' energy: -84.077 flat angles C4'-P-C4' energy: -90.724 flat angles P-C4'-P energy: -61.242 tors. eta vs tors. theta energy: -115.789 Dist. restrs. and SS energy: 2.468 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1365.324796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.324796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.594264 (E_RNA) where: Base-Base interactions energy: -1018.755 where: short stacking energy: -416.675 Base-Backbone interact. energy: -0.278 local terms energy: -385.561093 where: bonds (distance) C4'-P energy: -51.029 bonds (distance) P-C4' energy: -79.513 flat angles C4'-P-C4' energy: -85.220 flat angles P-C4'-P energy: -54.802 tors. eta vs tors. theta energy: -114.998 Dist. restrs. and SS energy: 2.519 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1277.655078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.655078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.597690 (E_RNA) where: Base-Base interactions energy: -946.959 where: short stacking energy: -389.467 Base-Backbone interact. energy: -0.449 local terms energy: -376.189180 where: bonds (distance) C4'-P energy: -71.998 bonds (distance) P-C4' energy: -60.050 flat angles C4'-P-C4' energy: -81.738 flat angles P-C4'-P energy: -56.437 tors. eta vs tors. theta energy: -105.966 Dist. restrs. and SS energy: 9.193 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -1296.453540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.453540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.325495 (E_RNA) where: Base-Base interactions energy: -942.239 where: short stacking energy: -377.659 Base-Backbone interact. energy: -3.256 local terms energy: -392.830404 where: bonds (distance) C4'-P energy: -69.831 bonds (distance) P-C4' energy: -65.092 flat angles C4'-P-C4' energy: -90.388 flat angles P-C4'-P energy: -51.086 tors. eta vs tors. theta energy: -116.434 Dist. restrs. and SS energy: 5.122 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1700.737254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.737254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.572102 (E_RNA) where: Base-Base interactions energy: -1228.094 where: short stacking energy: -505.551 Base-Backbone interact. energy: -2.273 local terms energy: -510.204398 where: bonds (distance) C4'-P energy: -90.083 bonds (distance) P-C4' energy: -85.776 flat angles C4'-P-C4' energy: -108.444 flat angles P-C4'-P energy: -78.530 tors. eta vs tors. theta energy: -147.372 Dist. restrs. and SS energy: 3.085 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1646.518289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.518289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.774399 (E_RNA) where: Base-Base interactions energy: -1197.871 where: short stacking energy: -505.554 Base-Backbone interact. energy: -0.678 local terms energy: -494.225970 where: bonds (distance) C4'-P energy: -87.419 bonds (distance) P-C4' energy: -90.622 flat angles C4'-P-C4' energy: -102.078 flat angles P-C4'-P energy: -73.617 tors. eta vs tors. theta energy: -140.490 Dist. restrs. and SS energy: 9.506 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1581.445675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.445675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.467600 (E_RNA) where: Base-Base interactions energy: -1151.394 where: short stacking energy: -497.757 Base-Backbone interact. energy: -1.317 local terms energy: -467.755948 where: bonds (distance) C4'-P energy: -79.736 bonds (distance) P-C4' energy: -85.155 flat angles C4'-P-C4' energy: -93.884 flat angles P-C4'-P energy: -72.706 tors. eta vs tors. theta energy: -136.275 Dist. restrs. and SS energy: 2.272 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1577.530263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.530263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.632093 (E_RNA) where: Base-Base interactions energy: -1144.726 where: short stacking energy: -458.776 Base-Backbone interact. energy: -1.823 local terms energy: -468.082906 where: bonds (distance) C4'-P energy: -95.610 bonds (distance) P-C4' energy: -86.022 flat angles C4'-P-C4' energy: -96.493 flat angles P-C4'-P energy: -68.000 tors. eta vs tors. theta energy: -121.958 Dist. restrs. and SS energy: 0.352 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1494.127271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.127271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.934038 (E_RNA) where: Base-Base interactions energy: -1084.111 where: short stacking energy: -450.962 Base-Backbone interact. energy: -1.488 local terms energy: -446.335022 where: bonds (distance) C4'-P energy: -75.830 bonds (distance) P-C4' energy: -70.765 flat angles C4'-P-C4' energy: -101.182 flat angles P-C4'-P energy: -72.158 tors. eta vs tors. theta energy: -126.400 Dist. restrs. and SS energy: 1.057 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1494.828794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.828794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.877496 (E_RNA) where: Base-Base interactions energy: -1087.742 where: short stacking energy: -453.059 Base-Backbone interact. energy: -1.589 local terms energy: -443.545724 where: bonds (distance) C4'-P energy: -68.618 bonds (distance) P-C4' energy: -77.022 flat angles C4'-P-C4' energy: -104.255 flat angles P-C4'-P energy: -71.006 tors. eta vs tors. theta energy: -122.645 Dist. restrs. and SS energy: 1.299 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1439.306296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.306296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.369988 (E_RNA) where: Base-Base interactions energy: -1042.074 where: short stacking energy: -425.931 Base-Backbone interact. energy: -1.244 local terms energy: -434.051417 where: bonds (distance) C4'-P energy: -71.734 bonds (distance) P-C4' energy: -85.107 flat angles C4'-P-C4' energy: -90.232 flat angles P-C4'-P energy: -60.735 tors. eta vs tors. theta energy: -126.244 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1395.610833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.610833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.420557 (E_RNA) where: Base-Base interactions energy: -1018.455 where: short stacking energy: -412.901 Base-Backbone interact. energy: -0.215 local terms energy: -416.750050 where: bonds (distance) C4'-P energy: -80.137 bonds (distance) P-C4' energy: -74.461 flat angles C4'-P-C4' energy: -98.984 flat angles P-C4'-P energy: -57.849 tors. eta vs tors. theta energy: -105.320 Dist. restrs. and SS energy: 3.060 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1305.785957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.785957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.964259 (E_RNA) where: Base-Base interactions energy: -960.255 where: short stacking energy: -396.582 Base-Backbone interact. energy: 0.510 local terms energy: -387.219097 where: bonds (distance) C4'-P energy: -73.209 bonds (distance) P-C4' energy: -69.741 flat angles C4'-P-C4' energy: -81.523 flat angles P-C4'-P energy: -53.747 tors. eta vs tors. theta energy: -108.999 Dist. restrs. and SS energy: 4.428 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -1243.351708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.351708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.743622 (E_RNA) where: Base-Base interactions energy: -908.026 where: short stacking energy: -377.013 Base-Backbone interact. energy: -1.393 local terms energy: -380.324406 where: bonds (distance) C4'-P energy: -64.881 bonds (distance) P-C4' energy: -64.346 flat angles C4'-P-C4' energy: -88.921 flat angles P-C4'-P energy: -63.533 tors. eta vs tors. theta energy: -98.643 Dist. restrs. and SS energy: 9.642 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1696.631070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.631070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.113377 (E_RNA) where: Base-Base interactions energy: -1236.999 where: short stacking energy: -504.503 Base-Backbone interact. energy: -3.309 local terms energy: -496.805637 where: bonds (distance) C4'-P energy: -97.913 bonds (distance) P-C4' energy: -89.667 flat angles C4'-P-C4' energy: -97.603 flat angles P-C4'-P energy: -62.974 tors. eta vs tors. theta energy: -148.648 Dist. restrs. and SS energy: 3.732 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1653.695739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.695739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1701.265063 (E_RNA) where: Base-Base interactions energy: -1209.678 where: short stacking energy: -491.578 Base-Backbone interact. energy: -1.353 local terms energy: -490.233607 where: bonds (distance) C4'-P energy: -95.100 bonds (distance) P-C4' energy: -87.494 flat angles C4'-P-C4' energy: -104.533 flat angles P-C4'-P energy: -69.108 tors. eta vs tors. theta energy: -133.998 Dist. restrs. and SS energy: 10.819 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1576.747214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.747214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.934159 (E_RNA) where: Base-Base interactions energy: -1130.734 where: short stacking energy: -472.797 Base-Backbone interact. energy: -0.879 local terms energy: -483.321844 where: bonds (distance) C4'-P energy: -85.109 bonds (distance) P-C4' energy: -83.656 flat angles C4'-P-C4' energy: -112.665 flat angles P-C4'-P energy: -73.846 tors. eta vs tors. theta energy: -128.045 Dist. restrs. and SS energy: 1.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1571.768519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.768519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.030928 (E_RNA) where: Base-Base interactions energy: -1149.052 where: short stacking energy: -481.345 Base-Backbone interact. energy: -1.528 local terms energy: -459.450780 where: bonds (distance) C4'-P energy: -79.290 bonds (distance) P-C4' energy: -87.851 flat angles C4'-P-C4' energy: -98.576 flat angles P-C4'-P energy: -60.292 tors. eta vs tors. theta energy: -133.442 Dist. restrs. and SS energy: 1.512 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1494.276874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.276874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.699462 (E_RNA) where: Base-Base interactions energy: -1096.489 where: short stacking energy: -470.563 Base-Backbone interact. energy: -1.669 local terms energy: -434.541010 where: bonds (distance) C4'-P energy: -89.773 bonds (distance) P-C4' energy: -68.421 flat angles C4'-P-C4' energy: -87.512 flat angles P-C4'-P energy: -56.862 tors. eta vs tors. theta energy: -131.973 Dist. restrs. and SS energy: 1.673 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1462.373348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.373348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.654486 (E_RNA) where: Base-Base interactions energy: -1057.452 where: short stacking energy: -431.256 Base-Backbone interact. energy: -2.585 local terms energy: -440.617650 where: bonds (distance) C4'-P energy: -81.297 bonds (distance) P-C4' energy: -80.211 flat angles C4'-P-C4' energy: -100.000 flat angles P-C4'-P energy: -61.504 tors. eta vs tors. theta energy: -117.606 Dist. restrs. and SS energy: 1.531 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1397.175018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.175018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.943768 (E_RNA) where: Base-Base interactions energy: -1012.539 where: short stacking energy: -415.977 Base-Backbone interact. energy: -1.144 local terms energy: -424.260857 where: bonds (distance) C4'-P energy: -82.846 bonds (distance) P-C4' energy: -90.398 flat angles C4'-P-C4' energy: -93.229 flat angles P-C4'-P energy: -53.219 tors. eta vs tors. theta energy: -104.570 Dist. restrs. and SS energy: 4.019 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1369.278626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.278626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.275545 (E_RNA) where: Base-Base interactions energy: -1021.730 where: short stacking energy: -408.198 Base-Backbone interact. energy: 3.680 local terms energy: -390.224663 where: bonds (distance) C4'-P energy: -69.667 bonds (distance) P-C4' energy: -81.511 flat angles C4'-P-C4' energy: -75.214 flat angles P-C4'-P energy: -53.293 tors. eta vs tors. theta energy: -110.539 Dist. restrs. and SS energy: 2.247 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1357.911242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.911242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.007875 (E_RNA) where: Base-Base interactions energy: -1007.128 where: short stacking energy: -415.078 Base-Backbone interact. energy: 0.741 local terms energy: -389.621298 where: bonds (distance) C4'-P energy: -73.054 bonds (distance) P-C4' energy: -74.224 flat angles C4'-P-C4' energy: -73.541 flat angles P-C4'-P energy: -46.686 tors. eta vs tors. theta energy: -122.116 Dist. restrs. and SS energy: 1.347 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -1253.171013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.171013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.017281 (E_RNA) where: Base-Base interactions energy: -946.755 where: short stacking energy: -384.747 Base-Backbone interact. energy: -0.905 local terms energy: -357.357283 where: bonds (distance) C4'-P energy: -66.399 bonds (distance) P-C4' energy: -55.822 flat angles C4'-P-C4' energy: -71.267 flat angles P-C4'-P energy: -56.935 tors. eta vs tors. theta energy: -106.934 Dist. restrs. and SS energy: 15.096 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1697.154529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.154529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.595828 (E_RNA) where: Base-Base interactions energy: -1236.409 where: short stacking energy: -507.840 Base-Backbone interact. energy: -2.054 local terms energy: -498.132808 where: bonds (distance) C4'-P energy: -89.059 bonds (distance) P-C4' energy: -82.037 flat angles C4'-P-C4' energy: -110.624 flat angles P-C4'-P energy: -75.594 tors. eta vs tors. theta energy: -140.818 Dist. restrs. and SS energy: 2.691 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1657.603484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.603484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.873906 (E_RNA) where: Base-Base interactions energy: -1203.281 where: short stacking energy: -485.876 Base-Backbone interact. energy: -0.935 local terms energy: -496.657471 where: bonds (distance) C4'-P energy: -88.136 bonds (distance) P-C4' energy: -91.042 flat angles C4'-P-C4' energy: -99.841 flat angles P-C4'-P energy: -73.188 tors. eta vs tors. theta energy: -144.450 Dist. restrs. and SS energy: 6.520 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1616.140709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.140709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.036970 (E_RNA) where: Base-Base interactions energy: -1192.900 where: short stacking energy: -501.414 Base-Backbone interact. energy: -2.171 local terms energy: -458.966743 where: bonds (distance) C4'-P energy: -61.592 bonds (distance) P-C4' energy: -93.193 flat angles C4'-P-C4' energy: -97.997 flat angles P-C4'-P energy: -67.182 tors. eta vs tors. theta energy: -139.003 Dist. restrs. and SS energy: 1.146 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1593.863501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.863501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.469252 (E_RNA) where: Base-Base interactions energy: -1167.545 where: short stacking energy: -480.810 Base-Backbone interact. energy: -0.752 local terms energy: -463.172231 where: bonds (distance) C4'-P energy: -69.408 bonds (distance) P-C4' energy: -87.572 flat angles C4'-P-C4' energy: -103.930 flat angles P-C4'-P energy: -68.386 tors. eta vs tors. theta energy: -133.876 Dist. restrs. and SS energy: 0.856 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1544.378163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.378163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.259327 (E_RNA) where: Base-Base interactions energy: -1106.634 where: short stacking energy: -472.410 Base-Backbone interact. energy: 0.288 local terms energy: -475.913795 where: bonds (distance) C4'-P energy: -78.175 bonds (distance) P-C4' energy: -92.297 flat angles C4'-P-C4' energy: -96.603 flat angles P-C4'-P energy: -66.143 tors. eta vs tors. theta energy: -142.696 Dist. restrs. and SS energy: 1.131 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1493.016667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.016667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.276915 (E_RNA) where: Base-Base interactions energy: -1114.360 where: short stacking energy: -449.065 Base-Backbone interact. energy: -1.911 local terms energy: -415.006674 where: bonds (distance) C4'-P energy: -71.588 bonds (distance) P-C4' energy: -63.152 flat angles C4'-P-C4' energy: -98.455 flat angles P-C4'-P energy: -64.879 tors. eta vs tors. theta energy: -116.932 Dist. restrs. and SS energy: 1.510 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1415.395652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.395652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.716350 (E_RNA) where: Base-Base interactions energy: -1035.603 where: short stacking energy: -427.523 Base-Backbone interact. energy: -1.266 local terms energy: -416.846395 where: bonds (distance) C4'-P energy: -82.825 bonds (distance) P-C4' energy: -85.393 flat angles C4'-P-C4' energy: -80.222 flat angles P-C4'-P energy: -57.683 tors. eta vs tors. theta energy: -110.723 Dist. restrs. and SS energy: 1.571 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1373.924525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.924525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.156693 (E_RNA) where: Base-Base interactions energy: -990.776 where: short stacking energy: -408.327 Base-Backbone interact. energy: -1.051 local terms energy: -420.329689 where: bonds (distance) C4'-P energy: -74.061 bonds (distance) P-C4' energy: -81.765 flat angles C4'-P-C4' energy: -94.231 flat angles P-C4'-P energy: -58.328 tors. eta vs tors. theta energy: -111.945 Dist. restrs. and SS energy: 1.482 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1368.436144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.436144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.305861 (E_RNA) where: Base-Base interactions energy: -977.981 where: short stacking energy: -412.643 Base-Backbone interact. energy: -0.664 local terms energy: -428.661745 where: bonds (distance) C4'-P energy: -90.531 bonds (distance) P-C4' energy: -76.186 flat angles C4'-P-C4' energy: -83.840 flat angles P-C4'-P energy: -64.441 tors. eta vs tors. theta energy: -113.664 Dist. restrs. and SS energy: 2.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -1267.845741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.845741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.376370 (E_RNA) where: Base-Base interactions energy: -940.575 where: short stacking energy: -365.779 Base-Backbone interact. energy: -0.885 local terms energy: -370.915917 where: bonds (distance) C4'-P energy: -80.746 bonds (distance) P-C4' energy: -63.329 flat angles C4'-P-C4' energy: -78.738 flat angles P-C4'-P energy: -51.664 tors. eta vs tors. theta energy: -96.439 Dist. restrs. and SS energy: 7.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1708.076378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.076378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.606976 (E_RNA) where: Base-Base interactions energy: -1242.445 where: short stacking energy: -512.400 Base-Backbone interact. energy: -3.511 local terms energy: -502.651205 where: bonds (distance) C4'-P energy: -93.567 bonds (distance) P-C4' energy: -83.828 flat angles C4'-P-C4' energy: -105.316 flat angles P-C4'-P energy: -74.564 tors. eta vs tors. theta energy: -145.375 Dist. restrs. and SS energy: 3.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1630.544297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.544297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.281294 (E_RNA) where: Base-Base interactions energy: -1180.456 where: short stacking energy: -492.507 Base-Backbone interact. energy: -2.972 local terms energy: -484.853137 where: bonds (distance) C4'-P energy: -82.464 bonds (distance) P-C4' energy: -94.142 flat angles C4'-P-C4' energy: -104.599 flat angles P-C4'-P energy: -72.842 tors. eta vs tors. theta energy: -130.807 Dist. restrs. and SS energy: 0.987 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1613.780291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.780291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.356755 (E_RNA) where: Base-Base interactions energy: -1171.305 where: short stacking energy: -467.447 Base-Backbone interact. energy: -3.182 local terms energy: -485.870412 where: bonds (distance) C4'-P energy: -78.333 bonds (distance) P-C4' energy: -95.731 flat angles C4'-P-C4' energy: -105.797 flat angles P-C4'-P energy: -71.979 tors. eta vs tors. theta energy: -134.031 Dist. restrs. and SS energy: 9.826 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1578.559557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.559557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.660339 (E_RNA) where: Base-Base interactions energy: -1150.678 where: short stacking energy: -482.411 Base-Backbone interact. energy: 0.235 local terms energy: -466.217451 where: bonds (distance) C4'-P energy: -85.417 bonds (distance) P-C4' energy: -76.726 flat angles C4'-P-C4' energy: -103.318 flat angles P-C4'-P energy: -74.064 tors. eta vs tors. theta energy: -126.693 Dist. restrs. and SS energy: 1.351 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1525.369628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.369628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.373753 (E_RNA) where: Base-Base interactions energy: -1122.437 where: short stacking energy: -475.444 Base-Backbone interact. energy: 0.408 local terms energy: -442.344495 where: bonds (distance) C4'-P energy: -77.560 bonds (distance) P-C4' energy: -64.962 flat angles C4'-P-C4' energy: -98.203 flat angles P-C4'-P energy: -56.083 tors. eta vs tors. theta energy: -145.536 Dist. restrs. and SS energy: 2.254 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1518.315671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.315671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.147537 (E_RNA) where: Base-Base interactions energy: -1103.842 where: short stacking energy: -449.214 Base-Backbone interact. energy: -1.344 local terms energy: -450.961787 where: bonds (distance) C4'-P energy: -89.648 bonds (distance) P-C4' energy: -77.936 flat angles C4'-P-C4' energy: -95.646 flat angles P-C4'-P energy: -58.630 tors. eta vs tors. theta energy: -129.101 Dist. restrs. and SS energy: 1.082 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1444.806492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.806492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.719010 (E_RNA) where: Base-Base interactions energy: -1071.204 where: short stacking energy: -438.729 Base-Backbone interact. energy: -2.236 local terms energy: -411.278548 where: bonds (distance) C4'-P energy: -67.572 bonds (distance) P-C4' energy: -74.534 flat angles C4'-P-C4' energy: -96.455 flat angles P-C4'-P energy: -50.886 tors. eta vs tors. theta energy: -121.832 Dist. restrs. and SS energy: 3.163 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1381.706657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.706657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.024887 (E_RNA) where: Base-Base interactions energy: -989.872 where: short stacking energy: -402.514 Base-Backbone interact. energy: -2.220 local terms energy: -427.933137 where: bonds (distance) C4'-P energy: -80.325 bonds (distance) P-C4' energy: -84.180 flat angles C4'-P-C4' energy: -90.495 flat angles P-C4'-P energy: -66.154 tors. eta vs tors. theta energy: -106.779 Dist. restrs. and SS energy: 1.568 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1316.537661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.537661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.885589 (E_RNA) where: Base-Base interactions energy: -982.250 where: short stacking energy: -388.081 Base-Backbone interact. energy: -1.690 local terms energy: -372.945109 where: bonds (distance) C4'-P energy: -59.833 bonds (distance) P-C4' energy: -69.548 flat angles C4'-P-C4' energy: -90.499 flat angles P-C4'-P energy: -37.360 tors. eta vs tors. theta energy: -115.706 Dist. restrs. and SS energy: 3.598 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -1238.873183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.873183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.209311 (E_RNA) where: Base-Base interactions energy: -918.256 where: short stacking energy: -368.346 Base-Backbone interact. energy: -0.810 local terms energy: -367.142874 where: bonds (distance) C4'-P energy: -55.346 bonds (distance) P-C4' energy: -74.570 flat angles C4'-P-C4' energy: -78.083 flat angles P-C4'-P energy: -56.555 tors. eta vs tors. theta energy: -102.589 Dist. restrs. and SS energy: 10.586 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1707.657121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.657121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1747.906099 (E_RNA) where: Base-Base interactions energy: -1237.040 where: short stacking energy: -508.420 Base-Backbone interact. energy: -1.185 local terms energy: -509.681008 where: bonds (distance) C4'-P energy: -94.004 bonds (distance) P-C4' energy: -99.039 flat angles C4'-P-C4' energy: -104.911 flat angles P-C4'-P energy: -67.800 tors. eta vs tors. theta energy: -143.926 Dist. restrs. and SS energy: 3.499 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1632.020510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.020510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.786096 (E_RNA) where: Base-Base interactions energy: -1184.004 where: short stacking energy: -497.933 Base-Backbone interact. energy: -2.125 local terms energy: -483.657358 where: bonds (distance) C4'-P energy: -82.010 bonds (distance) P-C4' energy: -89.356 flat angles C4'-P-C4' energy: -101.719 flat angles P-C4'-P energy: -71.022 tors. eta vs tors. theta energy: -139.551 Dist. restrs. and SS energy: 1.016 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1596.389594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.389594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.621315 (E_RNA) where: Base-Base interactions energy: -1185.175 where: short stacking energy: -511.207 Base-Backbone interact. energy: -1.515 local terms energy: -446.931764 where: bonds (distance) C4'-P energy: -73.733 bonds (distance) P-C4' energy: -72.609 flat angles C4'-P-C4' energy: -97.085 flat angles P-C4'-P energy: -73.218 tors. eta vs tors. theta energy: -130.286 Dist. restrs. and SS energy: 0.482 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1564.782042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.782042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.671252 (E_RNA) where: Base-Base interactions energy: -1139.578 where: short stacking energy: -468.418 Base-Backbone interact. energy: -0.437 local terms energy: -470.656884 where: bonds (distance) C4'-P energy: -91.465 bonds (distance) P-C4' energy: -79.223 flat angles C4'-P-C4' energy: -96.784 flat angles P-C4'-P energy: -67.591 tors. eta vs tors. theta energy: -135.594 Dist. restrs. and SS energy: 9.139 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1504.097162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.097162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.501938 (E_RNA) where: Base-Base interactions energy: -1103.811 where: short stacking energy: -449.497 Base-Backbone interact. energy: 2.158 local terms energy: -441.848446 where: bonds (distance) C4'-P energy: -69.848 bonds (distance) P-C4' energy: -90.188 flat angles C4'-P-C4' energy: -95.262 flat angles P-C4'-P energy: -62.632 tors. eta vs tors. theta energy: -123.919 Dist. restrs. and SS energy: 2.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1451.078754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.078754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.089294 (E_RNA) where: Base-Base interactions energy: -1064.092 where: short stacking energy: -463.492 Base-Backbone interact. energy: 0.946 local terms energy: -425.942759 where: bonds (distance) C4'-P energy: -81.775 bonds (distance) P-C4' energy: -68.761 flat angles C4'-P-C4' energy: -95.170 flat angles P-C4'-P energy: -56.040 tors. eta vs tors. theta energy: -124.197 Dist. restrs. and SS energy: 1.261 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1410.080343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.080343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.321384 (E_RNA) where: Base-Base interactions energy: -1026.571 where: short stacking energy: -437.353 Base-Backbone interact. energy: -2.676 local terms energy: -420.074597 where: bonds (distance) C4'-P energy: -79.495 bonds (distance) P-C4' energy: -79.279 flat angles C4'-P-C4' energy: -93.260 flat angles P-C4'-P energy: -47.473 tors. eta vs tors. theta energy: -120.568 Dist. restrs. and SS energy: 2.491 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1364.434956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.434956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.713265 (E_RNA) where: Base-Base interactions energy: -1011.276 where: short stacking energy: -412.698 Base-Backbone interact. energy: 7.454 local terms energy: -398.892044 where: bonds (distance) C4'-P energy: -75.781 bonds (distance) P-C4' energy: -76.114 flat angles C4'-P-C4' energy: -82.990 flat angles P-C4'-P energy: -54.579 tors. eta vs tors. theta energy: -109.429 Dist. restrs. and SS energy: 1.528 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1302.311831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.311831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.483483 (E_RNA) where: Base-Base interactions energy: -935.720 where: short stacking energy: -388.783 Base-Backbone interact. energy: 1.890 local terms energy: -411.654012 where: bonds (distance) C4'-P energy: -86.025 bonds (distance) P-C4' energy: -81.565 flat angles C4'-P-C4' energy: -85.989 flat angles P-C4'-P energy: -51.246 tors. eta vs tors. theta energy: -106.829 Dist. restrs. and SS energy: 6.422 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -1286.245600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.245600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.157783 (E_RNA) where: Base-Base interactions energy: -932.260 where: short stacking energy: -385.161 Base-Backbone interact. energy: -2.696 local terms energy: -395.201211 where: bonds (distance) C4'-P energy: -71.685 bonds (distance) P-C4' energy: -74.045 flat angles C4'-P-C4' energy: -84.795 flat angles P-C4'-P energy: -53.587 tors. eta vs tors. theta energy: -111.089 Dist. restrs. and SS energy: 7.162 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1705.631566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.631566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1745.400726 (E_RNA) where: Base-Base interactions energy: -1225.964 where: short stacking energy: -522.779 Base-Backbone interact. energy: -1.180 local terms energy: -518.257041 where: bonds (distance) C4'-P energy: -90.147 bonds (distance) P-C4' energy: -99.418 flat angles C4'-P-C4' energy: -107.859 flat angles P-C4'-P energy: -72.518 tors. eta vs tors. theta energy: -148.315 Dist. restrs. and SS energy: 3.019 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1641.119167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1641.119167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.022066 (E_RNA) where: Base-Base interactions energy: -1192.214 where: short stacking energy: -481.624 Base-Backbone interact. energy: -2.697 local terms energy: -484.111870 where: bonds (distance) C4'-P energy: -95.051 bonds (distance) P-C4' energy: -90.943 flat angles C4'-P-C4' energy: -101.956 flat angles P-C4'-P energy: -58.311 tors. eta vs tors. theta energy: -137.851 Dist. restrs. and SS energy: 1.153 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1600.247441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.247441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.868489 (E_RNA) where: Base-Base interactions energy: -1163.696 where: short stacking energy: -493.021 Base-Backbone interact. energy: -2.592 local terms energy: -471.580766 where: bonds (distance) C4'-P energy: -77.750 bonds (distance) P-C4' energy: -89.089 flat angles C4'-P-C4' energy: -100.980 flat angles P-C4'-P energy: -76.000 tors. eta vs tors. theta energy: -127.762 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1551.249071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.249071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.598723 (E_RNA) where: Base-Base interactions energy: -1131.272 where: short stacking energy: -445.507 Base-Backbone interact. energy: -1.919 local terms energy: -464.407060 where: bonds (distance) C4'-P energy: -83.427 bonds (distance) P-C4' energy: -78.695 flat angles C4'-P-C4' energy: -98.458 flat angles P-C4'-P energy: -68.895 tors. eta vs tors. theta energy: -134.932 Dist. restrs. and SS energy: 9.600 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1506.753079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1506.753079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.329145 (E_RNA) where: Base-Base interactions energy: -1100.934 where: short stacking energy: -451.609 Base-Backbone interact. energy: -0.942 local terms energy: -442.452183 where: bonds (distance) C4'-P energy: -74.762 bonds (distance) P-C4' energy: -88.276 flat angles C4'-P-C4' energy: -95.750 flat angles P-C4'-P energy: -59.319 tors. eta vs tors. theta energy: -124.345 Dist. restrs. and SS energy: 0.826 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1455.366915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.366915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.386810 (E_RNA) where: Base-Base interactions energy: -1058.689 where: short stacking energy: -459.188 Base-Backbone interact. energy: -2.929 local terms energy: -432.768925 where: bonds (distance) C4'-P energy: -72.635 bonds (distance) P-C4' energy: -78.837 flat angles C4'-P-C4' energy: -95.064 flat angles P-C4'-P energy: -57.348 tors. eta vs tors. theta energy: -128.885 Dist. restrs. and SS energy: 2.270 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1418.657228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.657228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.919275 (E_RNA) where: Base-Base interactions energy: -1027.521 where: short stacking energy: -426.226 Base-Backbone interact. energy: -2.332 local terms energy: -427.066696 where: bonds (distance) C4'-P energy: -79.292 bonds (distance) P-C4' energy: -81.230 flat angles C4'-P-C4' energy: -84.511 flat angles P-C4'-P energy: -60.390 tors. eta vs tors. theta energy: -121.644 Dist. restrs. and SS energy: 1.512 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1369.860129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.860129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.564253 (E_RNA) where: Base-Base interactions energy: -1007.365 where: short stacking energy: -405.377 Base-Backbone interact. energy: -1.375 local terms energy: -398.824746 where: bonds (distance) C4'-P energy: -48.461 bonds (distance) P-C4' energy: -82.818 flat angles C4'-P-C4' energy: -96.176 flat angles P-C4'-P energy: -65.822 tors. eta vs tors. theta energy: -105.547 Dist. restrs. and SS energy: 0.954 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1313.672249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.672249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.699166 (E_RNA) where: Base-Base interactions energy: -974.680 where: short stacking energy: -402.615 Base-Backbone interact. energy: -0.757 local terms energy: -386.262178 where: bonds (distance) C4'-P energy: -59.158 bonds (distance) P-C4' energy: -71.180 flat angles C4'-P-C4' energy: -93.702 flat angles P-C4'-P energy: -51.183 tors. eta vs tors. theta energy: -111.038 Dist. restrs. and SS energy: 11.277 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -1254.072510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.072510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.273086 (E_RNA) where: Base-Base interactions energy: -914.773 where: short stacking energy: -381.106 Base-Backbone interact. energy: 2.057 local terms energy: -389.557729 where: bonds (distance) C4'-P energy: -60.420 bonds (distance) P-C4' energy: -73.732 flat angles C4'-P-C4' energy: -99.859 flat angles P-C4'-P energy: -52.026 tors. eta vs tors. theta energy: -103.521 Dist. restrs. and SS energy: 11.451 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1698.708009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1698.708009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.936386 (E_RNA) where: Base-Base interactions energy: -1216.921 where: short stacking energy: -505.199 Base-Backbone interact. energy: -2.692 local terms energy: -518.323458 where: bonds (distance) C4'-P energy: -92.632 bonds (distance) P-C4' energy: -103.612 flat angles C4'-P-C4' energy: -107.910 flat angles P-C4'-P energy: -75.792 tors. eta vs tors. theta energy: -138.377 Dist. restrs. and SS energy: 2.478 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1630.587182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.587182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.712590 (E_RNA) where: Base-Base interactions energy: -1183.481 where: short stacking energy: -488.508 Base-Backbone interact. energy: -1.260 local terms energy: -483.972129 where: bonds (distance) C4'-P energy: -95.014 bonds (distance) P-C4' energy: -90.577 flat angles C4'-P-C4' energy: -98.333 flat angles P-C4'-P energy: -61.357 tors. eta vs tors. theta energy: -138.691 Dist. restrs. and SS energy: 1.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1589.519060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.519060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.412170 (E_RNA) where: Base-Base interactions energy: -1141.488 where: short stacking energy: -462.237 Base-Backbone interact. energy: -1.127 local terms energy: -484.797027 where: bonds (distance) C4'-P energy: -86.578 bonds (distance) P-C4' energy: -91.956 flat angles C4'-P-C4' energy: -108.129 flat angles P-C4'-P energy: -70.823 tors. eta vs tors. theta energy: -127.311 Dist. restrs. and SS energy: 1.143 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1543.957530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.957530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.260823 (E_RNA) where: Base-Base interactions energy: -1123.040 where: short stacking energy: -444.574 Base-Backbone interact. energy: -2.490 local terms energy: -462.730231 where: bonds (distance) C4'-P energy: -79.193 bonds (distance) P-C4' energy: -95.411 flat angles C4'-P-C4' energy: -97.315 flat angles P-C4'-P energy: -64.109 tors. eta vs tors. theta energy: -126.703 Dist. restrs. and SS energy: 7.553 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1507.273285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.273285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1545.542520 (E_RNA) where: Base-Base interactions energy: -1093.145 where: short stacking energy: -454.370 Base-Backbone interact. energy: -1.060 local terms energy: -451.337327 where: bonds (distance) C4'-P energy: -82.534 bonds (distance) P-C4' energy: -83.893 flat angles C4'-P-C4' energy: -95.596 flat angles P-C4'-P energy: -64.259 tors. eta vs tors. theta energy: -125.055 Dist. restrs. and SS energy: 1.519 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1468.987748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.987748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.832099 (E_RNA) where: Base-Base interactions energy: -1086.440 where: short stacking energy: -449.107 Base-Backbone interact. energy: -2.441 local terms energy: -417.951281 where: bonds (distance) C4'-P energy: -75.455 bonds (distance) P-C4' energy: -77.579 flat angles C4'-P-C4' energy: -81.368 flat angles P-C4'-P energy: -62.072 tors. eta vs tors. theta energy: -121.478 Dist. restrs. and SS energy: 1.094 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1448.305243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.305243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.854748 (E_RNA) where: Base-Base interactions energy: -1074.783 where: short stacking energy: -452.509 Base-Backbone interact. energy: 0.069 local terms energy: -411.140594 where: bonds (distance) C4'-P energy: -80.262 bonds (distance) P-C4' energy: -57.225 flat angles C4'-P-C4' energy: -83.737 flat angles P-C4'-P energy: -60.709 tors. eta vs tors. theta energy: -129.208 Dist. restrs. and SS energy: 0.800 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1338.328956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.328956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.452217 (E_RNA) where: Base-Base interactions energy: -997.677 where: short stacking energy: -411.203 Base-Backbone interact. energy: 2.329 local terms energy: -382.104833 where: bonds (distance) C4'-P energy: -62.684 bonds (distance) P-C4' energy: -74.911 flat angles C4'-P-C4' energy: -83.299 flat angles P-C4'-P energy: -51.388 tors. eta vs tors. theta energy: -109.823 Dist. restrs. and SS energy: 2.373 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1336.297743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.297743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.701803 (E_RNA) where: Base-Base interactions energy: -1000.955 where: short stacking energy: -411.066 Base-Backbone interact. energy: -2.305 local terms energy: -371.440978 where: bonds (distance) C4'-P energy: -74.711 bonds (distance) P-C4' energy: -59.821 flat angles C4'-P-C4' energy: -85.419 flat angles P-C4'-P energy: -45.208 tors. eta vs tors. theta energy: -106.283 Dist. restrs. and SS energy: 1.654 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -1231.982977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.982977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.090273 (E_RNA) where: Base-Base interactions energy: -915.213 where: short stacking energy: -358.949 Base-Backbone interact. energy: -1.649 local terms energy: -364.228631 where: bonds (distance) C4'-P energy: -51.661 bonds (distance) P-C4' energy: -74.724 flat angles C4'-P-C4' energy: -79.294 flat angles P-C4'-P energy: -59.062 tors. eta vs tors. theta energy: -99.487 Dist. restrs. and SS energy: 12.357 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1700.208511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.208511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1740.586777 (E_RNA) where: Base-Base interactions energy: -1226.405 where: short stacking energy: -501.331 Base-Backbone interact. energy: -2.157 local terms energy: -512.025005 where: bonds (distance) C4'-P energy: -92.824 bonds (distance) P-C4' energy: -91.920 flat angles C4'-P-C4' energy: -104.209 flat angles P-C4'-P energy: -71.198 tors. eta vs tors. theta energy: -151.874 Dist. restrs. and SS energy: 3.628 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1625.152000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.152000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1663.364841 (E_RNA) where: Base-Base interactions energy: -1183.091 where: short stacking energy: -516.132 Base-Backbone interact. energy: -1.592 local terms energy: -478.681884 where: bonds (distance) C4'-P energy: -77.316 bonds (distance) P-C4' energy: -99.529 flat angles C4'-P-C4' energy: -104.996 flat angles P-C4'-P energy: -56.491 tors. eta vs tors. theta energy: -140.350 Dist. restrs. and SS energy: 1.463 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1595.726884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.726884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.055435 (E_RNA) where: Base-Base interactions energy: -1162.827 where: short stacking energy: -466.631 Base-Backbone interact. energy: -1.777 local terms energy: -469.451442 where: bonds (distance) C4'-P energy: -81.446 bonds (distance) P-C4' energy: -90.155 flat angles C4'-P-C4' energy: -103.314 flat angles P-C4'-P energy: -66.907 tors. eta vs tors. theta energy: -127.629 Dist. restrs. and SS energy: 1.579 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1576.380538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.380538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.589677 (E_RNA) where: Base-Base interactions energy: -1136.508 where: short stacking energy: -458.603 Base-Backbone interact. energy: -3.691 local terms energy: -473.391241 where: bonds (distance) C4'-P energy: -91.574 bonds (distance) P-C4' energy: -92.376 flat angles C4'-P-C4' energy: -104.838 flat angles P-C4'-P energy: -50.274 tors. eta vs tors. theta energy: -134.330 Dist. restrs. and SS energy: 0.459 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1548.468843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.468843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.210700 (E_RNA) where: Base-Base interactions energy: -1125.233 where: short stacking energy: -470.245 Base-Backbone interact. energy: -0.752 local terms energy: -468.225060 where: bonds (distance) C4'-P energy: -87.441 bonds (distance) P-C4' energy: -95.306 flat angles C4'-P-C4' energy: -92.889 flat angles P-C4'-P energy: -60.796 tors. eta vs tors. theta energy: -131.794 Dist. restrs. and SS energy: 8.992 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1460.833798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.833798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.332621 (E_RNA) where: Base-Base interactions energy: -1071.434 where: short stacking energy: -426.151 Base-Backbone interact. energy: -1.540 local terms energy: -425.358119 where: bonds (distance) C4'-P energy: -82.805 bonds (distance) P-C4' energy: -67.244 flat angles C4'-P-C4' energy: -93.194 flat angles P-C4'-P energy: -60.980 tors. eta vs tors. theta energy: -121.133 Dist. restrs. and SS energy: 0.749 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1425.045966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.045966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.555088 (E_RNA) where: Base-Base interactions energy: -1054.984 where: short stacking energy: -430.715 Base-Backbone interact. energy: -0.146 local terms energy: -407.425499 where: bonds (distance) C4'-P energy: -81.079 bonds (distance) P-C4' energy: -71.430 flat angles C4'-P-C4' energy: -87.591 flat angles P-C4'-P energy: -47.227 tors. eta vs tors. theta energy: -120.099 Dist. restrs. and SS energy: 0.759 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1381.996946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.996946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.677308 (E_RNA) where: Base-Base interactions energy: -1022.281 where: short stacking energy: -412.906 Base-Backbone interact. energy: -1.508 local terms energy: -396.888948 where: bonds (distance) C4'-P energy: -66.191 bonds (distance) P-C4' energy: -63.320 flat angles C4'-P-C4' energy: -85.380 flat angles P-C4'-P energy: -60.815 tors. eta vs tors. theta energy: -121.182 Dist. restrs. and SS energy: 1.930 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1409.938487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.938487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.023324 (E_RNA) where: Base-Base interactions energy: -1048.212 where: short stacking energy: -426.985 Base-Backbone interact. energy: -2.254 local terms energy: -397.557685 where: bonds (distance) C4'-P energy: -70.885 bonds (distance) P-C4' energy: -81.725 flat angles C4'-P-C4' energy: -89.752 flat angles P-C4'-P energy: -39.670 tors. eta vs tors. theta energy: -115.526 Dist. restrs. and SS energy: 1.335 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -1275.781770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.781770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.131614 (E_RNA) where: Base-Base interactions energy: -949.088 where: short stacking energy: -394.134 Base-Backbone interact. energy: 2.231 local terms energy: -379.274617 where: bonds (distance) C4'-P energy: -66.121 bonds (distance) P-C4' energy: -69.990 flat angles C4'-P-C4' energy: -74.623 flat angles P-C4'-P energy: -51.947 tors. eta vs tors. theta energy: -116.594 Dist. restrs. and SS energy: 13.600 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1709.827921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.827921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.406722 (E_RNA) where: Base-Base interactions energy: -1224.190 where: short stacking energy: -506.680 Base-Backbone interact. energy: -2.820 local terms energy: -521.397240 where: bonds (distance) C4'-P energy: -100.894 bonds (distance) P-C4' energy: -92.416 flat angles C4'-P-C4' energy: -106.737 flat angles P-C4'-P energy: -69.176 tors. eta vs tors. theta energy: -152.174 Dist. restrs. and SS energy: 1.829 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1620.693785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.693785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.891517 (E_RNA) where: Base-Base interactions energy: -1183.923 where: short stacking energy: -496.960 Base-Backbone interact. energy: -1.920 local terms energy: -472.049303 where: bonds (distance) C4'-P energy: -83.103 bonds (distance) P-C4' energy: -84.201 flat angles C4'-P-C4' energy: -97.330 flat angles P-C4'-P energy: -64.956 tors. eta vs tors. theta energy: -142.459 Dist. restrs. and SS energy: 0.448 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1602.048768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.048768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.430273 (E_RNA) where: Base-Base interactions energy: -1161.736 where: short stacking energy: -472.358 Base-Backbone interact. energy: -1.105 local terms energy: -476.589119 where: bonds (distance) C4'-P energy: -75.885 bonds (distance) P-C4' energy: -95.022 flat angles C4'-P-C4' energy: -107.244 flat angles P-C4'-P energy: -63.299 tors. eta vs tors. theta energy: -135.138 Dist. restrs. and SS energy: 0.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1588.778610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.778610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.228538 (E_RNA) where: Base-Base interactions energy: -1163.323 where: short stacking energy: -480.245 Base-Backbone interact. energy: -1.818 local terms energy: -461.087223 where: bonds (distance) C4'-P energy: -85.107 bonds (distance) P-C4' energy: -74.259 flat angles C4'-P-C4' energy: -105.697 flat angles P-C4'-P energy: -62.300 tors. eta vs tors. theta energy: -133.725 Dist. restrs. and SS energy: 0.700 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1476.691361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.691361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.010464 (E_RNA) where: Base-Base interactions energy: -1061.762 where: short stacking energy: -458.790 Base-Backbone interact. energy: -1.021 local terms energy: -452.227467 where: bonds (distance) C4'-P energy: -78.920 bonds (distance) P-C4' energy: -90.533 flat angles C4'-P-C4' energy: -92.779 flat angles P-C4'-P energy: -69.085 tors. eta vs tors. theta energy: -120.910 Dist. restrs. and SS energy: 1.569 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1476.587607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.587607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.653142 (E_RNA) where: Base-Base interactions energy: -1080.770 where: short stacking energy: -436.355 Base-Backbone interact. energy: -0.681 local terms energy: -439.202726 where: bonds (distance) C4'-P energy: -79.800 bonds (distance) P-C4' energy: -81.516 flat angles C4'-P-C4' energy: -93.920 flat angles P-C4'-P energy: -64.505 tors. eta vs tors. theta energy: -119.462 Dist. restrs. and SS energy: 7.316 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1408.445266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.445266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.848853 (E_RNA) where: Base-Base interactions energy: -1052.098 where: short stacking energy: -424.351 Base-Backbone interact. energy: 2.283 local terms energy: -397.033644 where: bonds (distance) C4'-P energy: -65.391 bonds (distance) P-C4' energy: -80.354 flat angles C4'-P-C4' energy: -87.267 flat angles P-C4'-P energy: -51.595 tors. eta vs tors. theta energy: -112.426 Dist. restrs. and SS energy: 1.654 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1408.579316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.579316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.290827 (E_RNA) where: Base-Base interactions energy: -1038.159 where: short stacking energy: -432.083 Base-Backbone interact. energy: -1.247 local terms energy: -406.884881 where: bonds (distance) C4'-P energy: -69.265 bonds (distance) P-C4' energy: -79.554 flat angles C4'-P-C4' energy: -90.413 flat angles P-C4'-P energy: -45.187 tors. eta vs tors. theta energy: -122.466 Dist. restrs. and SS energy: 0.962 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1333.482426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.482426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.076641 (E_RNA) where: Base-Base interactions energy: -981.072 where: short stacking energy: -393.004 Base-Backbone interact. energy: -0.640 local terms energy: -390.364535 where: bonds (distance) C4'-P energy: -70.578 bonds (distance) P-C4' energy: -87.467 flat angles C4'-P-C4' energy: -81.733 flat angles P-C4'-P energy: -41.152 tors. eta vs tors. theta energy: -109.434 Dist. restrs. and SS energy: 1.844 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -1273.231802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.231802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1318.418529 (E_RNA) where: Base-Base interactions energy: -949.846 where: short stacking energy: -382.496 Base-Backbone interact. energy: -0.892 local terms energy: -367.681232 where: bonds (distance) C4'-P energy: -80.630 bonds (distance) P-C4' energy: -68.407 flat angles C4'-P-C4' energy: -79.060 flat angles P-C4'-P energy: -48.060 tors. eta vs tors. theta energy: -91.524 Dist. restrs. and SS energy: 8.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1713.366608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.366608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1750.484800 (E_RNA) where: Base-Base interactions energy: -1228.565 where: short stacking energy: -526.356 Base-Backbone interact. energy: -2.129 local terms energy: -519.791151 where: bonds (distance) C4'-P energy: -95.515 bonds (distance) P-C4' energy: -90.955 flat angles C4'-P-C4' energy: -111.374 flat angles P-C4'-P energy: -72.955 tors. eta vs tors. theta energy: -148.991 Dist. restrs. and SS energy: 0.368 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1616.751368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.751368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.742391 (E_RNA) where: Base-Base interactions energy: -1164.492 where: short stacking energy: -498.232 Base-Backbone interact. energy: -1.952 local terms energy: -488.298793 where: bonds (distance) C4'-P energy: -86.318 bonds (distance) P-C4' energy: -91.664 flat angles C4'-P-C4' energy: -104.408 flat angles P-C4'-P energy: -75.697 tors. eta vs tors. theta energy: -130.212 Dist. restrs. and SS energy: 1.241 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1619.432564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.432564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.622653 (E_RNA) where: Base-Base interactions energy: -1171.921 where: short stacking energy: -479.488 Base-Backbone interact. energy: -3.731 local terms energy: -481.970462 where: bonds (distance) C4'-P energy: -89.173 bonds (distance) P-C4' energy: -82.889 flat angles C4'-P-C4' energy: -103.464 flat angles P-C4'-P energy: -73.314 tors. eta vs tors. theta energy: -133.131 Dist. restrs. and SS energy: 1.440 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1578.276455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.276455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.856890 (E_RNA) where: Base-Base interactions energy: -1147.925 where: short stacking energy: -489.224 Base-Backbone interact. energy: -1.792 local terms energy: -466.140499 where: bonds (distance) C4'-P energy: -74.515 bonds (distance) P-C4' energy: -86.086 flat angles C4'-P-C4' energy: -105.290 flat angles P-C4'-P energy: -58.190 tors. eta vs tors. theta energy: -142.059 Dist. restrs. and SS energy: 0.830 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1494.929767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.929767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.466766 (E_RNA) where: Base-Base interactions energy: -1078.220 where: short stacking energy: -446.951 Base-Backbone interact. energy: 0.214 local terms energy: -455.460150 where: bonds (distance) C4'-P energy: -80.696 bonds (distance) P-C4' energy: -81.735 flat angles C4'-P-C4' energy: -102.458 flat angles P-C4'-P energy: -58.396 tors. eta vs tors. theta energy: -132.176 Dist. restrs. and SS energy: 1.787 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1447.818871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.818871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.907235 (E_RNA) where: Base-Base interactions energy: -1042.040 where: short stacking energy: -442.218 Base-Backbone interact. energy: -2.258 local terms energy: -441.609450 where: bonds (distance) C4'-P energy: -71.013 bonds (distance) P-C4' energy: -80.798 flat angles C4'-P-C4' energy: -96.594 flat angles P-C4'-P energy: -69.437 tors. eta vs tors. theta energy: -123.768 Dist. restrs. and SS energy: 1.338 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1435.534518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.534518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.933486 (E_RNA) where: Base-Base interactions energy: -1060.164 where: short stacking energy: -447.816 Base-Backbone interact. energy: -1.147 local terms energy: -419.623292 where: bonds (distance) C4'-P energy: -54.644 bonds (distance) P-C4' energy: -77.047 flat angles C4'-P-C4' energy: -92.009 flat angles P-C4'-P energy: -71.992 tors. eta vs tors. theta energy: -123.931 Dist. restrs. and SS energy: 8.649 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1426.550043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.550043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.541774 (E_RNA) where: Base-Base interactions energy: -1043.660 where: short stacking energy: -420.417 Base-Backbone interact. energy: -0.977 local terms energy: -420.905202 where: bonds (distance) C4'-P energy: -63.905 bonds (distance) P-C4' energy: -75.246 flat angles C4'-P-C4' energy: -95.279 flat angles P-C4'-P energy: -72.613 tors. eta vs tors. theta energy: -113.863 Dist. restrs. and SS energy: 2.242 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1342.954759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.954759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.817778 (E_RNA) where: Base-Base interactions energy: -979.785 where: short stacking energy: -390.514 Base-Backbone interact. energy: -0.765 local terms energy: -401.267242 where: bonds (distance) C4'-P energy: -86.933 bonds (distance) P-C4' energy: -63.129 flat angles C4'-P-C4' energy: -82.422 flat angles P-C4'-P energy: -57.852 tors. eta vs tors. theta energy: -110.930 Dist. restrs. and SS energy: 2.113 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1264.286068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.286068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.228681 (E_RNA) where: Base-Base interactions energy: -957.017 where: short stacking energy: -380.981 Base-Backbone interact. energy: 5.643 local terms energy: -355.854047 where: bonds (distance) C4'-P energy: -68.857 bonds (distance) P-C4' energy: -43.505 flat angles C4'-P-C4' energy: -86.702 flat angles P-C4'-P energy: -54.930 tors. eta vs tors. theta energy: -101.860 Dist. restrs. and SS energy: 6.193 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1707.000896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.000896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1744.325838 (E_RNA) where: Base-Base interactions energy: -1228.341 where: short stacking energy: -513.262 Base-Backbone interact. energy: -2.533 local terms energy: -513.451408 where: bonds (distance) C4'-P energy: -93.131 bonds (distance) P-C4' energy: -100.892 flat angles C4'-P-C4' energy: -99.086 flat angles P-C4'-P energy: -68.738 tors. eta vs tors. theta energy: -151.604 Dist. restrs. and SS energy: 0.575 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1626.377583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.377583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1663.878807 (E_RNA) where: Base-Base interactions energy: -1170.647 where: short stacking energy: -492.184 Base-Backbone interact. energy: -1.790 local terms energy: -491.441979 where: bonds (distance) C4'-P energy: -79.971 bonds (distance) P-C4' energy: -91.299 flat angles C4'-P-C4' energy: -110.684 flat angles P-C4'-P energy: -71.584 tors. eta vs tors. theta energy: -137.903 Dist. restrs. and SS energy: 0.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1620.906929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.906929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.483845 (E_RNA) where: Base-Base interactions energy: -1184.802 where: short stacking energy: -475.987 Base-Backbone interact. energy: -1.530 local terms energy: -472.152004 where: bonds (distance) C4'-P energy: -91.675 bonds (distance) P-C4' energy: -91.701 flat angles C4'-P-C4' energy: -95.954 flat angles P-C4'-P energy: -64.323 tors. eta vs tors. theta energy: -128.498 Dist. restrs. and SS energy: 0.827 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1566.430133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.430133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.169823 (E_RNA) where: Base-Base interactions energy: -1155.455 where: short stacking energy: -472.940 Base-Backbone interact. energy: -1.034 local terms energy: -447.681140 where: bonds (distance) C4'-P energy: -72.572 bonds (distance) P-C4' energy: -83.855 flat angles C4'-P-C4' energy: -106.904 flat angles P-C4'-P energy: -58.946 tors. eta vs tors. theta energy: -125.403 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1511.209020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.209020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.980197 (E_RNA) where: Base-Base interactions energy: -1105.058 where: short stacking energy: -460.902 Base-Backbone interact. energy: -1.631 local terms energy: -442.291608 where: bonds (distance) C4'-P energy: -77.055 bonds (distance) P-C4' energy: -79.872 flat angles C4'-P-C4' energy: -96.621 flat angles P-C4'-P energy: -58.896 tors. eta vs tors. theta energy: -129.848 Dist. restrs. and SS energy: 1.021 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1458.795764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.795764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.350948 (E_RNA) where: Base-Base interactions energy: -1057.422 where: short stacking energy: -429.011 Base-Backbone interact. energy: -3.460 local terms energy: -435.468776 where: bonds (distance) C4'-P energy: -81.030 bonds (distance) P-C4' energy: -88.257 flat angles C4'-P-C4' energy: -91.210 flat angles P-C4'-P energy: -60.148 tors. eta vs tors. theta energy: -114.823 Dist. restrs. and SS energy: 0.805 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1425.343705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.343705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.432878 (E_RNA) where: Base-Base interactions energy: -1048.508 where: short stacking energy: -428.477 Base-Backbone interact. energy: 0.444 local terms energy: -415.369031 where: bonds (distance) C4'-P energy: -79.753 bonds (distance) P-C4' energy: -77.047 flat angles C4'-P-C4' energy: -80.074 flat angles P-C4'-P energy: -59.254 tors. eta vs tors. theta energy: -119.241 Dist. restrs. and SS energy: 1.339 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1357.234558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.234558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.806121 (E_RNA) where: Base-Base interactions energy: -1003.282 where: short stacking energy: -407.716 Base-Backbone interact. energy: -1.625 local terms energy: -399.898617 where: bonds (distance) C4'-P energy: -71.624 bonds (distance) P-C4' energy: -77.043 flat angles C4'-P-C4' energy: -83.447 flat angles P-C4'-P energy: -50.288 tors. eta vs tors. theta energy: -117.496 Dist. restrs. and SS energy: 10.822 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1379.890112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.890112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.479290 (E_RNA) where: Base-Base interactions energy: -1014.056 where: short stacking energy: -406.433 Base-Backbone interact. energy: 1.801 local terms energy: -406.224586 where: bonds (distance) C4'-P energy: -74.139 bonds (distance) P-C4' energy: -84.233 flat angles C4'-P-C4' energy: -79.369 flat angles P-C4'-P energy: -58.933 tors. eta vs tors. theta energy: -109.551 Dist. restrs. and SS energy: 1.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -1249.569077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.569077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.888189 (E_RNA) where: Base-Base interactions energy: -894.181 where: short stacking energy: -372.140 Base-Backbone interact. energy: -0.553 local terms energy: -401.154894 where: bonds (distance) C4'-P energy: -69.377 bonds (distance) P-C4' energy: -91.516 flat angles C4'-P-C4' energy: -89.434 flat angles P-C4'-P energy: -47.936 tors. eta vs tors. theta energy: -102.891 Dist. restrs. and SS energy: 9.569 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1705.422966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.422966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.397276 (E_RNA) where: Base-Base interactions energy: -1242.818 where: short stacking energy: -514.989 Base-Backbone interact. energy: -3.010 local terms energy: -497.569674 where: bonds (distance) C4'-P energy: -89.018 bonds (distance) P-C4' energy: -95.390 flat angles C4'-P-C4' energy: -106.954 flat angles P-C4'-P energy: -62.001 tors. eta vs tors. theta energy: -144.207 Dist. restrs. and SS energy: 1.224 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1654.312591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.312591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.097405 (E_RNA) where: Base-Base interactions energy: -1202.148 where: short stacking energy: -498.893 Base-Backbone interact. energy: -1.177 local terms energy: -488.772332 where: bonds (distance) C4'-P energy: -92.503 bonds (distance) P-C4' energy: -86.268 flat angles C4'-P-C4' energy: -98.329 flat angles P-C4'-P energy: -72.360 tors. eta vs tors. theta energy: -139.313 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1590.987881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1590.987881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.208251 (E_RNA) where: Base-Base interactions energy: -1142.748 where: short stacking energy: -456.810 Base-Backbone interact. energy: -1.378 local terms energy: -486.083030 where: bonds (distance) C4'-P energy: -90.426 bonds (distance) P-C4' energy: -94.867 flat angles C4'-P-C4' energy: -109.578 flat angles P-C4'-P energy: -55.493 tors. eta vs tors. theta energy: -135.719 Dist. restrs. and SS energy: 2.470 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1576.454595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.454595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.806192 (E_RNA) where: Base-Base interactions energy: -1130.794 where: short stacking energy: -445.926 Base-Backbone interact. energy: -1.487 local terms energy: -482.525146 where: bonds (distance) C4'-P energy: -95.544 bonds (distance) P-C4' energy: -91.374 flat angles C4'-P-C4' energy: -104.436 flat angles P-C4'-P energy: -67.418 tors. eta vs tors. theta energy: -123.754 Dist. restrs. and SS energy: 1.602 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1521.931139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1521.931139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.135548 (E_RNA) where: Base-Base interactions energy: -1091.786 where: short stacking energy: -455.764 Base-Backbone interact. energy: -0.658 local terms energy: -467.691842 where: bonds (distance) C4'-P energy: -96.330 bonds (distance) P-C4' energy: -80.555 flat angles C4'-P-C4' energy: -96.358 flat angles P-C4'-P energy: -60.346 tors. eta vs tors. theta energy: -134.103 Dist. restrs. and SS energy: 1.454 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1504.640262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.640262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1542.956833 (E_RNA) where: Base-Base interactions energy: -1077.651 where: short stacking energy: -445.195 Base-Backbone interact. energy: -1.233 local terms energy: -464.072901 where: bonds (distance) C4'-P energy: -75.862 bonds (distance) P-C4' energy: -92.104 flat angles C4'-P-C4' energy: -101.507 flat angles P-C4'-P energy: -67.273 tors. eta vs tors. theta energy: -127.326 Dist. restrs. and SS energy: 1.567 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1442.412841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.412841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.134322 (E_RNA) where: Base-Base interactions energy: -1051.307 where: short stacking energy: -433.224 Base-Backbone interact. energy: -0.768 local terms energy: -428.059088 where: bonds (distance) C4'-P energy: -79.975 bonds (distance) P-C4' energy: -80.382 flat angles C4'-P-C4' energy: -96.698 flat angles P-C4'-P energy: -55.070 tors. eta vs tors. theta energy: -115.935 Dist. restrs. and SS energy: 0.971 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1377.681958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.681958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.680115 (E_RNA) where: Base-Base interactions energy: -1009.942 where: short stacking energy: -401.139 Base-Backbone interact. energy: -1.308 local terms energy: -414.429979 where: bonds (distance) C4'-P energy: -77.329 bonds (distance) P-C4' energy: -74.741 flat angles C4'-P-C4' energy: -91.204 flat angles P-C4'-P energy: -58.412 tors. eta vs tors. theta energy: -112.744 Dist. restrs. and SS energy: 11.248 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1346.647692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.647692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.471819 (E_RNA) where: Base-Base interactions energy: -994.304 where: short stacking energy: -394.753 Base-Backbone interact. energy: 0.133 local terms energy: -390.301595 where: bonds (distance) C4'-P energy: -81.309 bonds (distance) P-C4' energy: -69.040 flat angles C4'-P-C4' energy: -76.639 flat angles P-C4'-P energy: -54.903 tors. eta vs tors. theta energy: -108.410 Dist. restrs. and SS energy: 1.074 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1246.318973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.318973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.878708 (E_RNA) where: Base-Base interactions energy: -903.470 where: short stacking energy: -390.552 Base-Backbone interact. energy: -2.779 local terms energy: -388.629847 where: bonds (distance) C4'-P energy: -87.385 bonds (distance) P-C4' energy: -72.287 flat angles C4'-P-C4' energy: -81.808 flat angles P-C4'-P energy: -50.999 tors. eta vs tors. theta energy: -96.150 Dist. restrs. and SS energy: 11.810 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1701.148221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.148221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.949097 (E_RNA) where: Base-Base interactions energy: -1228.737 where: short stacking energy: -497.819 Base-Backbone interact. energy: -0.461 local terms energy: -509.750959 where: bonds (distance) C4'-P energy: -96.680 bonds (distance) P-C4' energy: -94.550 flat angles C4'-P-C4' energy: -110.501 flat angles P-C4'-P energy: -68.216 tors. eta vs tors. theta energy: -139.803 Dist. restrs. and SS energy: 1.051 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1660.374607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1660.374607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.827015 (E_RNA) where: Base-Base interactions energy: -1191.986 where: short stacking energy: -469.876 Base-Backbone interact. energy: 1.331 local terms energy: -507.171655 where: bonds (distance) C4'-P energy: -99.681 bonds (distance) P-C4' energy: -92.815 flat angles C4'-P-C4' energy: -112.263 flat angles P-C4'-P energy: -70.489 tors. eta vs tors. theta energy: -131.924 Dist. restrs. and SS energy: 0.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1603.327802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.327802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.213815 (E_RNA) where: Base-Base interactions energy: -1148.713 where: short stacking energy: -490.542 Base-Backbone interact. energy: -1.116 local terms energy: -491.384156 where: bonds (distance) C4'-P energy: -76.427 bonds (distance) P-C4' energy: -96.279 flat angles C4'-P-C4' energy: -107.572 flat angles P-C4'-P energy: -70.459 tors. eta vs tors. theta energy: -140.648 Dist. restrs. and SS energy: 1.136 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1569.693942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.693942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.622443 (E_RNA) where: Base-Base interactions energy: -1151.922 where: short stacking energy: -476.562 Base-Backbone interact. energy: -2.628 local terms energy: -453.071995 where: bonds (distance) C4'-P energy: -86.736 bonds (distance) P-C4' energy: -77.363 flat angles C4'-P-C4' energy: -101.272 flat angles P-C4'-P energy: -60.157 tors. eta vs tors. theta energy: -127.544 Dist. restrs. and SS energy: 1.179 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1502.413702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.413702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.677111 (E_RNA) where: Base-Base interactions energy: -1102.359 where: short stacking energy: -459.679 Base-Backbone interact. energy: -1.498 local terms energy: -435.820103 where: bonds (distance) C4'-P energy: -87.279 bonds (distance) P-C4' energy: -74.817 flat angles C4'-P-C4' energy: -91.082 flat angles P-C4'-P energy: -55.484 tors. eta vs tors. theta energy: -127.158 Dist. restrs. and SS energy: 0.513 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1496.686302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.686302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.582946 (E_RNA) where: Base-Base interactions energy: -1084.990 where: short stacking energy: -472.397 Base-Backbone interact. energy: 2.270 local terms energy: -452.863037 where: bonds (distance) C4'-P energy: -76.777 bonds (distance) P-C4' energy: -80.295 flat angles C4'-P-C4' energy: -98.378 flat angles P-C4'-P energy: -59.031 tors. eta vs tors. theta energy: -138.383 Dist. restrs. and SS energy: 2.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1420.906186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.906186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.212109 (E_RNA) where: Base-Base interactions energy: -1042.516 where: short stacking energy: -434.742 Base-Backbone interact. energy: -1.045 local terms energy: -415.651088 where: bonds (distance) C4'-P energy: -73.223 bonds (distance) P-C4' energy: -77.776 flat angles C4'-P-C4' energy: -91.178 flat angles P-C4'-P energy: -55.994 tors. eta vs tors. theta energy: -117.480 Dist. restrs. and SS energy: 1.556 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1387.137185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.137185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.971608 (E_RNA) where: Base-Base interactions energy: -1027.378 where: short stacking energy: -411.751 Base-Backbone interact. energy: -0.174 local terms energy: -405.420118 where: bonds (distance) C4'-P energy: -73.212 bonds (distance) P-C4' energy: -79.584 flat angles C4'-P-C4' energy: -89.206 flat angles P-C4'-P energy: -51.005 tors. eta vs tors. theta energy: -112.412 Dist. restrs. and SS energy: 9.084 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1347.174422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.174422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.774524 (E_RNA) where: Base-Base interactions energy: -991.399 where: short stacking energy: -395.193 Base-Backbone interact. energy: 3.739 local terms energy: -397.115093 where: bonds (distance) C4'-P energy: -54.239 bonds (distance) P-C4' energy: -82.673 flat angles C4'-P-C4' energy: -81.886 flat angles P-C4'-P energy: -67.666 tors. eta vs tors. theta energy: -110.650 Dist. restrs. and SS energy: 0.850 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1283.141553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.141553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.340247 (E_RNA) where: Base-Base interactions energy: -959.345 where: short stacking energy: -388.572 Base-Backbone interact. energy: -1.745 local terms energy: -365.249958 where: bonds (distance) C4'-P energy: -64.781 bonds (distance) P-C4' energy: -78.969 flat angles C4'-P-C4' energy: -70.201 flat angles P-C4'-P energy: -49.291 tors. eta vs tors. theta energy: -102.008 Dist. restrs. and SS energy: 6.449 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1706.121171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.121171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.829454 (E_RNA) where: Base-Base interactions energy: -1235.149 where: short stacking energy: -509.521 Base-Backbone interact. energy: -1.744 local terms energy: -506.936311 where: bonds (distance) C4'-P energy: -82.647 bonds (distance) P-C4' energy: -93.460 flat angles C4'-P-C4' energy: -108.835 flat angles P-C4'-P energy: -79.186 tors. eta vs tors. theta energy: -142.809 Dist. restrs. and SS energy: 0.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1654.102125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.102125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.178414 (E_RNA) where: Base-Base interactions energy: -1198.492 where: short stacking energy: -519.032 Base-Backbone interact. energy: 6.350 local terms energy: -501.035892 where: bonds (distance) C4'-P energy: -85.937 bonds (distance) P-C4' energy: -96.922 flat angles C4'-P-C4' energy: -106.191 flat angles P-C4'-P energy: -69.288 tors. eta vs tors. theta energy: -142.699 Dist. restrs. and SS energy: 2.326 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1656.555812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.555812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.425810 (E_RNA) where: Base-Base interactions energy: -1212.151 where: short stacking energy: -501.319 Base-Backbone interact. energy: 1.999 local terms energy: -484.273543 where: bonds (distance) C4'-P energy: -91.118 bonds (distance) P-C4' energy: -82.204 flat angles C4'-P-C4' energy: -107.594 flat angles P-C4'-P energy: -66.979 tors. eta vs tors. theta energy: -136.379 Dist. restrs. and SS energy: 1.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1556.172615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.172615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.949461 (E_RNA) where: Base-Base interactions energy: -1144.646 where: short stacking energy: -479.153 Base-Backbone interact. energy: -1.161 local terms energy: -448.142365 where: bonds (distance) C4'-P energy: -73.936 bonds (distance) P-C4' energy: -83.718 flat angles C4'-P-C4' energy: -102.725 flat angles P-C4'-P energy: -58.592 tors. eta vs tors. theta energy: -129.171 Dist. restrs. and SS energy: 1.027 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1516.012709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.012709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.218136 (E_RNA) where: Base-Base interactions energy: -1099.526 where: short stacking energy: -455.246 Base-Backbone interact. energy: 0.415 local terms energy: -455.107454 where: bonds (distance) C4'-P energy: -78.143 bonds (distance) P-C4' energy: -88.766 flat angles C4'-P-C4' energy: -94.240 flat angles P-C4'-P energy: -62.684 tors. eta vs tors. theta energy: -131.275 Dist. restrs. and SS energy: 1.455 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1525.201866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.201866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.448704 (E_RNA) where: Base-Base interactions energy: -1087.052 where: short stacking energy: -431.476 Base-Backbone interact. energy: 0.749 local terms energy: -477.145705 where: bonds (distance) C4'-P energy: -91.647 bonds (distance) P-C4' energy: -83.409 flat angles C4'-P-C4' energy: -104.749 flat angles P-C4'-P energy: -66.389 tors. eta vs tors. theta energy: -130.952 Dist. restrs. and SS energy: 1.497 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1414.592278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.592278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.171203 (E_RNA) where: Base-Base interactions energy: -1060.770 where: short stacking energy: -435.380 Base-Backbone interact. energy: -1.219 local terms energy: -390.182378 where: bonds (distance) C4'-P energy: -58.782 bonds (distance) P-C4' energy: -62.539 flat angles C4'-P-C4' energy: -94.044 flat angles P-C4'-P energy: -56.346 tors. eta vs tors. theta energy: -118.471 Dist. restrs. and SS energy: 0.829 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1359.386150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.386150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.462232 (E_RNA) where: Base-Base interactions energy: -981.963 where: short stacking energy: -424.312 Base-Backbone interact. energy: -0.768 local terms energy: -424.731380 where: bonds (distance) C4'-P energy: -60.157 bonds (distance) P-C4' energy: -79.042 flat angles C4'-P-C4' energy: -108.015 flat angles P-C4'-P energy: -55.491 tors. eta vs tors. theta energy: -122.027 Dist. restrs. and SS energy: 11.326 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1350.517968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.517968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.647231 (E_RNA) where: Base-Base interactions energy: -995.157 where: short stacking energy: -398.036 Base-Backbone interact. energy: 4.925 local terms energy: -399.414514 where: bonds (distance) C4'-P energy: -71.976 bonds (distance) P-C4' energy: -73.511 flat angles C4'-P-C4' energy: -83.904 flat angles P-C4'-P energy: -64.152 tors. eta vs tors. theta energy: -105.872 Dist. restrs. and SS energy: 2.379 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1264.143746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.143746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.038388 (E_RNA) where: Base-Base interactions energy: -934.462 where: short stacking energy: -373.098 Base-Backbone interact. energy: -0.680 local terms energy: -378.896529 where: bonds (distance) C4'-P energy: -63.664 bonds (distance) P-C4' energy: -90.438 flat angles C4'-P-C4' energy: -77.941 flat angles P-C4'-P energy: -51.288 tors. eta vs tors. theta energy: -95.567 Dist. restrs. and SS energy: 13.145 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1694.294693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.294693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.154201 (E_RNA) where: Base-Base interactions energy: -1225.858 where: short stacking energy: -503.545 Base-Backbone interact. energy: -2.965 local terms energy: -503.330744 where: bonds (distance) C4'-P energy: -91.073 bonds (distance) P-C4' energy: -98.052 flat angles C4'-P-C4' energy: -101.570 flat angles P-C4'-P energy: -73.717 tors. eta vs tors. theta energy: -138.919 Dist. restrs. and SS energy: 1.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1653.921288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.921288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.138850 (E_RNA) where: Base-Base interactions energy: -1193.326 where: short stacking energy: -502.406 Base-Backbone interact. energy: 0.829 local terms energy: -498.641620 where: bonds (distance) C4'-P energy: -85.936 bonds (distance) P-C4' energy: -90.622 flat angles C4'-P-C4' energy: -108.934 flat angles P-C4'-P energy: -67.268 tors. eta vs tors. theta energy: -145.882 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1638.683387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.683387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.404778 (E_RNA) where: Base-Base interactions energy: -1197.292 where: short stacking energy: -493.256 Base-Backbone interact. energy: -0.288 local terms energy: -479.825609 where: bonds (distance) C4'-P energy: -84.385 bonds (distance) P-C4' energy: -94.402 flat angles C4'-P-C4' energy: -106.577 flat angles P-C4'-P energy: -57.406 tors. eta vs tors. theta energy: -137.055 Dist. restrs. and SS energy: 1.971 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1554.181239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.181239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.544452 (E_RNA) where: Base-Base interactions energy: -1142.933 where: short stacking energy: -465.940 Base-Backbone interact. energy: 2.705 local terms energy: -453.316033 where: bonds (distance) C4'-P energy: -77.645 bonds (distance) P-C4' energy: -90.361 flat angles C4'-P-C4' energy: -100.337 flat angles P-C4'-P energy: -61.990 tors. eta vs tors. theta energy: -122.983 Dist. restrs. and SS energy: 2.613 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1530.502617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.502617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.546277 (E_RNA) where: Base-Base interactions energy: -1095.228 where: short stacking energy: -457.060 Base-Backbone interact. energy: -1.658 local terms energy: -472.659963 where: bonds (distance) C4'-P energy: -85.976 bonds (distance) P-C4' energy: -85.947 flat angles C4'-P-C4' energy: -103.982 flat angles P-C4'-P energy: -67.551 tors. eta vs tors. theta energy: -129.204 Dist. restrs. and SS energy: 2.294 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1467.244201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.244201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.048412 (E_RNA) where: Base-Base interactions energy: -1065.971 where: short stacking energy: -443.037 Base-Backbone interact. energy: -2.642 local terms energy: -437.434618 where: bonds (distance) C4'-P energy: -81.215 bonds (distance) P-C4' energy: -69.452 flat angles C4'-P-C4' energy: -94.061 flat angles P-C4'-P energy: -65.706 tors. eta vs tors. theta energy: -127.000 Dist. restrs. and SS energy: 2.054 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1397.161061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.161061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.986739 (E_RNA) where: Base-Base interactions energy: -1009.060 where: short stacking energy: -420.208 Base-Backbone interact. energy: -1.541 local terms energy: -430.385610 where: bonds (distance) C4'-P energy: -81.652 bonds (distance) P-C4' energy: -79.462 flat angles C4'-P-C4' energy: -93.995 flat angles P-C4'-P energy: -57.851 tors. eta vs tors. theta energy: -117.426 Dist. restrs. and SS energy: 7.076 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1408.919483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.919483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.634762 (E_RNA) where: Base-Base interactions energy: -1041.132 where: short stacking energy: -414.260 Base-Backbone interact. energy: -0.079 local terms energy: -405.424475 where: bonds (distance) C4'-P energy: -67.617 bonds (distance) P-C4' energy: -81.603 flat angles C4'-P-C4' energy: -94.434 flat angles P-C4'-P energy: -50.378 tors. eta vs tors. theta energy: -111.392 Dist. restrs. and SS energy: 0.965 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1358.991895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.991895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.262234 (E_RNA) where: Base-Base interactions energy: -992.943 where: short stacking energy: -416.169 Base-Backbone interact. energy: -0.086 local terms energy: -406.232891 where: bonds (distance) C4'-P energy: -71.760 bonds (distance) P-C4' energy: -70.598 flat angles C4'-P-C4' energy: -87.440 flat angles P-C4'-P energy: -55.234 tors. eta vs tors. theta energy: -121.202 Dist. restrs. and SS energy: 3.520 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -1275.762687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.762687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.471627 (E_RNA) where: Base-Base interactions energy: -932.198 where: short stacking energy: -373.217 Base-Backbone interact. energy: -0.222 local terms energy: -391.051072 where: bonds (distance) C4'-P energy: -63.219 bonds (distance) P-C4' energy: -69.359 flat angles C4'-P-C4' energy: -93.565 flat angles P-C4'-P energy: -61.218 tors. eta vs tors. theta energy: -103.690 Dist. restrs. and SS energy: 10.959 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1684.119771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1684.119771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1722.904694 (E_RNA) where: Base-Base interactions energy: -1218.518 where: short stacking energy: -504.756 Base-Backbone interact. energy: 1.304 local terms energy: -505.690276 where: bonds (distance) C4'-P energy: -88.286 bonds (distance) P-C4' energy: -91.547 flat angles C4'-P-C4' energy: -107.095 flat angles P-C4'-P energy: -73.955 tors. eta vs tors. theta energy: -144.807 Dist. restrs. and SS energy: 2.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1649.239748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.239748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.962637 (E_RNA) where: Base-Base interactions energy: -1193.804 where: short stacking energy: -491.527 Base-Backbone interact. energy: -2.227 local terms energy: -491.931809 where: bonds (distance) C4'-P energy: -89.349 bonds (distance) P-C4' energy: -94.080 flat angles C4'-P-C4' energy: -106.937 flat angles P-C4'-P energy: -69.342 tors. eta vs tors. theta energy: -132.225 Dist. restrs. and SS energy: 1.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1597.121649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.121649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.120542 (E_RNA) where: Base-Base interactions energy: -1166.360 where: short stacking energy: -498.733 Base-Backbone interact. energy: 0.829 local terms energy: -469.588872 where: bonds (distance) C4'-P energy: -82.752 bonds (distance) P-C4' energy: -72.844 flat angles C4'-P-C4' energy: -108.175 flat angles P-C4'-P energy: -67.627 tors. eta vs tors. theta energy: -138.190 Dist. restrs. and SS energy: 1.249 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1554.107698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.107698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.426241 (E_RNA) where: Base-Base interactions energy: -1113.075 where: short stacking energy: -472.053 Base-Backbone interact. energy: -0.735 local terms energy: -479.616457 where: bonds (distance) C4'-P energy: -80.108 bonds (distance) P-C4' energy: -98.850 flat angles C4'-P-C4' energy: -105.666 flat angles P-C4'-P energy: -58.707 tors. eta vs tors. theta energy: -136.286 Dist. restrs. and SS energy: 2.569 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1538.834151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.834151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.535697 (E_RNA) where: Base-Base interactions energy: -1107.624 where: short stacking energy: -464.578 Base-Backbone interact. energy: -1.668 local terms energy: -468.243995 where: bonds (distance) C4'-P energy: -80.038 bonds (distance) P-C4' energy: -85.300 flat angles C4'-P-C4' energy: -102.661 flat angles P-C4'-P energy: -69.573 tors. eta vs tors. theta energy: -130.672 Dist. restrs. and SS energy: 1.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1477.733290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.733290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.939564 (E_RNA) where: Base-Base interactions energy: -1060.082 where: short stacking energy: -434.012 Base-Backbone interact. energy: -3.133 local terms energy: -452.725063 where: bonds (distance) C4'-P energy: -82.421 bonds (distance) P-C4' energy: -77.165 flat angles C4'-P-C4' energy: -104.698 flat angles P-C4'-P energy: -72.501 tors. eta vs tors. theta energy: -115.940 Dist. restrs. and SS energy: 1.456 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1427.474579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.474579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.305725 (E_RNA) where: Base-Base interactions energy: -1026.525 where: short stacking energy: -426.680 Base-Backbone interact. energy: -0.643 local terms energy: -445.137135 where: bonds (distance) C4'-P energy: -88.216 bonds (distance) P-C4' energy: -78.214 flat angles C4'-P-C4' energy: -104.326 flat angles P-C4'-P energy: -56.774 tors. eta vs tors. theta energy: -117.608 Dist. restrs. and SS energy: 8.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1389.460491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.460491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.230484 (E_RNA) where: Base-Base interactions energy: -991.856 where: short stacking energy: -421.215 Base-Backbone interact. energy: -1.842 local terms energy: -433.533196 where: bonds (distance) C4'-P energy: -78.004 bonds (distance) P-C4' energy: -82.632 flat angles C4'-P-C4' energy: -86.343 flat angles P-C4'-P energy: -60.570 tors. eta vs tors. theta energy: -125.984 Dist. restrs. and SS energy: 1.020 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1331.240509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.240509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.158902 (E_RNA) where: Base-Base interactions energy: -1005.090 where: short stacking energy: -394.419 Base-Backbone interact. energy: 4.582 local terms energy: -368.650972 where: bonds (distance) C4'-P energy: -80.996 bonds (distance) P-C4' energy: -63.767 flat angles C4'-P-C4' energy: -86.428 flat angles P-C4'-P energy: -43.300 tors. eta vs tors. theta energy: -94.160 Dist. restrs. and SS energy: 1.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1232.840580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.840580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.215651 (E_RNA) where: Base-Base interactions energy: -923.139 where: short stacking energy: -377.062 Base-Backbone interact. energy: -1.416 local terms energy: -357.661282 where: bonds (distance) C4'-P energy: -66.058 bonds (distance) P-C4' energy: -60.120 flat angles C4'-P-C4' energy: -89.916 flat angles P-C4'-P energy: -38.055 tors. eta vs tors. theta energy: -103.511 Dist. restrs. and SS energy: 12.625 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1690.740912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.740912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.834081 (E_RNA) where: Base-Base interactions energy: -1229.867 where: short stacking energy: -495.044 Base-Backbone interact. energy: -3.004 local terms energy: -494.963031 where: bonds (distance) C4'-P energy: -86.554 bonds (distance) P-C4' energy: -96.033 flat angles C4'-P-C4' energy: -111.293 flat angles P-C4'-P energy: -79.030 tors. eta vs tors. theta energy: -122.054 Dist. restrs. and SS energy: 0.343 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1647.101193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.101193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.699041 (E_RNA) where: Base-Base interactions energy: -1203.000 where: short stacking energy: -497.712 Base-Backbone interact. energy: -1.580 local terms energy: -480.118765 where: bonds (distance) C4'-P energy: -83.082 bonds (distance) P-C4' energy: -85.125 flat angles C4'-P-C4' energy: -105.774 flat angles P-C4'-P energy: -63.623 tors. eta vs tors. theta energy: -142.515 Dist. restrs. and SS energy: 0.848 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1569.420379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.420379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.533346 (E_RNA) where: Base-Base interactions energy: -1140.080 where: short stacking energy: -469.255 Base-Backbone interact. energy: -0.546 local terms energy: -466.907890 where: bonds (distance) C4'-P energy: -80.182 bonds (distance) P-C4' energy: -82.677 flat angles C4'-P-C4' energy: -104.757 flat angles P-C4'-P energy: -60.879 tors. eta vs tors. theta energy: -138.412 Dist. restrs. and SS energy: 1.363 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1577.438607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.438607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.704751 (E_RNA) where: Base-Base interactions energy: -1168.492 where: short stacking energy: -495.003 Base-Backbone interact. energy: 3.128 local terms energy: -449.340063 where: bonds (distance) C4'-P energy: -70.178 bonds (distance) P-C4' energy: -80.695 flat angles C4'-P-C4' energy: -100.100 flat angles P-C4'-P energy: -60.548 tors. eta vs tors. theta energy: -137.820 Dist. restrs. and SS energy: 0.516 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1541.221712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1541.221712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1579.935367 (E_RNA) where: Base-Base interactions energy: -1099.525 where: short stacking energy: -443.315 Base-Backbone interact. energy: -1.434 local terms energy: -478.975977 where: bonds (distance) C4'-P energy: -89.734 bonds (distance) P-C4' energy: -91.963 flat angles C4'-P-C4' energy: -103.660 flat angles P-C4'-P energy: -70.093 tors. eta vs tors. theta energy: -123.525 Dist. restrs. and SS energy: 1.964 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1505.094625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.094625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.269801 (E_RNA) where: Base-Base interactions energy: -1083.239 where: short stacking energy: -441.171 Base-Backbone interact. energy: 1.876 local terms energy: -461.906043 where: bonds (distance) C4'-P energy: -80.532 bonds (distance) P-C4' energy: -92.571 flat angles C4'-P-C4' energy: -101.748 flat angles P-C4'-P energy: -68.953 tors. eta vs tors. theta energy: -118.103 Dist. restrs. and SS energy: 1.425 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1434.146747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.146747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.271054 (E_RNA) where: Base-Base interactions energy: -1053.512 where: short stacking energy: -427.616 Base-Backbone interact. energy: -1.590 local terms energy: -417.168339 where: bonds (distance) C4'-P energy: -74.608 bonds (distance) P-C4' energy: -81.791 flat angles C4'-P-C4' energy: -98.126 flat angles P-C4'-P energy: -57.679 tors. eta vs tors. theta energy: -104.964 Dist. restrs. and SS energy: 1.374 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1341.974990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.974990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.792180 (E_RNA) where: Base-Base interactions energy: -975.127 where: short stacking energy: -406.454 Base-Backbone interact. energy: -0.389 local terms energy: -412.275949 where: bonds (distance) C4'-P energy: -80.441 bonds (distance) P-C4' energy: -67.016 flat angles C4'-P-C4' energy: -97.147 flat angles P-C4'-P energy: -52.164 tors. eta vs tors. theta energy: -115.507 Dist. restrs. and SS energy: 9.067 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1349.154114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.154114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.914728 (E_RNA) where: Base-Base interactions energy: -1017.033 where: short stacking energy: -421.432 Base-Backbone interact. energy: 0.684 local terms energy: -371.566014 where: bonds (distance) C4'-P energy: -49.480 bonds (distance) P-C4' energy: -72.972 flat angles C4'-P-C4' energy: -79.659 flat angles P-C4'-P energy: -64.762 tors. eta vs tors. theta energy: -104.693 Dist. restrs. and SS energy: 2.011 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1259.424135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.424135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.450483 (E_RNA) where: Base-Base interactions energy: -927.037 where: short stacking energy: -362.607 Base-Backbone interact. energy: -0.152 local terms energy: -378.262097 where: bonds (distance) C4'-P energy: -70.497 bonds (distance) P-C4' energy: -82.194 flat angles C4'-P-C4' energy: -81.633 flat angles P-C4'-P energy: -44.764 tors. eta vs tors. theta energy: -99.175 Dist. restrs. and SS energy: 9.276 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1681.706132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.706132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1719.775220 (E_RNA) where: Base-Base interactions energy: -1226.783 where: short stacking energy: -497.956 Base-Backbone interact. energy: -2.912 local terms energy: -490.080456 where: bonds (distance) C4'-P energy: -86.009 bonds (distance) P-C4' energy: -95.644 flat angles C4'-P-C4' energy: -107.156 flat angles P-C4'-P energy: -65.898 tors. eta vs tors. theta energy: -135.374 Dist. restrs. and SS energy: 1.319 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1668.559831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.559831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.282890 (E_RNA) where: Base-Base interactions energy: -1224.238 where: short stacking energy: -499.932 Base-Backbone interact. energy: -1.711 local terms energy: -480.333693 where: bonds (distance) C4'-P energy: -86.825 bonds (distance) P-C4' energy: -86.724 flat angles C4'-P-C4' energy: -96.530 flat angles P-C4'-P energy: -70.070 tors. eta vs tors. theta energy: -140.186 Dist. restrs. and SS energy: 0.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1596.647462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.647462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.231067 (E_RNA) where: Base-Base interactions energy: -1157.153 where: short stacking energy: -480.212 Base-Backbone interact. energy: -2.047 local terms energy: -476.030786 where: bonds (distance) C4'-P energy: -81.977 bonds (distance) P-C4' energy: -87.523 flat angles C4'-P-C4' energy: -99.223 flat angles P-C4'-P energy: -68.756 tors. eta vs tors. theta energy: -138.552 Dist. restrs. and SS energy: 1.834 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1569.193127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.193127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.771722 (E_RNA) where: Base-Base interactions energy: -1125.391 where: short stacking energy: -483.132 Base-Backbone interact. energy: -0.200 local terms energy: -481.180740 where: bonds (distance) C4'-P energy: -91.169 bonds (distance) P-C4' energy: -92.364 flat angles C4'-P-C4' energy: -93.855 flat angles P-C4'-P energy: -66.826 tors. eta vs tors. theta energy: -136.966 Dist. restrs. and SS energy: 0.829 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1525.463291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.463291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.154422 (E_RNA) where: Base-Base interactions energy: -1115.346 where: short stacking energy: -467.438 Base-Backbone interact. energy: -0.001 local terms energy: -447.807307 where: bonds (distance) C4'-P energy: -83.991 bonds (distance) P-C4' energy: -92.794 flat angles C4'-P-C4' energy: -92.208 flat angles P-C4'-P energy: -59.362 tors. eta vs tors. theta energy: -119.452 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1509.100826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.100826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.131293 (E_RNA) where: Base-Base interactions energy: -1086.226 where: short stacking energy: -443.532 Base-Backbone interact. energy: -0.845 local terms energy: -460.060637 where: bonds (distance) C4'-P energy: -70.136 bonds (distance) P-C4' energy: -101.127 flat angles C4'-P-C4' energy: -87.023 flat angles P-C4'-P energy: -69.563 tors. eta vs tors. theta energy: -132.212 Dist. restrs. and SS energy: 1.280 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1445.693237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.693237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.325711 (E_RNA) where: Base-Base interactions energy: -1050.049 where: short stacking energy: -424.487 Base-Backbone interact. energy: 2.761 local terms energy: -436.037435 where: bonds (distance) C4'-P energy: -81.404 bonds (distance) P-C4' energy: -86.708 flat angles C4'-P-C4' energy: -91.815 flat angles P-C4'-P energy: -63.667 tors. eta vs tors. theta energy: -112.443 Dist. restrs. and SS energy: 0.882 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1398.975337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.975337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.275544 (E_RNA) where: Base-Base interactions energy: -1025.261 where: short stacking energy: -417.857 Base-Backbone interact. energy: -2.978 local terms energy: -409.036476 where: bonds (distance) C4'-P energy: -58.527 bonds (distance) P-C4' energy: -83.849 flat angles C4'-P-C4' energy: -89.474 flat angles P-C4'-P energy: -62.761 tors. eta vs tors. theta energy: -114.425 Dist. restrs. and SS energy: 1.550 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1320.178929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.178929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.183099 (E_RNA) where: Base-Base interactions energy: -974.125 where: short stacking energy: -406.625 Base-Backbone interact. energy: -0.878 local terms energy: -390.179576 where: bonds (distance) C4'-P energy: -77.711 bonds (distance) P-C4' energy: -74.817 flat angles C4'-P-C4' energy: -75.340 flat angles P-C4'-P energy: -52.281 tors. eta vs tors. theta energy: -110.031 Dist. restrs. and SS energy: 8.254 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1303.906362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.906362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.985400 (E_RNA) where: Base-Base interactions energy: -969.835 where: short stacking energy: -403.867 Base-Backbone interact. energy: -0.471 local terms energy: -381.680090 where: bonds (distance) C4'-P energy: -75.563 bonds (distance) P-C4' energy: -69.500 flat angles C4'-P-C4' energy: -86.099 flat angles P-C4'-P energy: -49.448 tors. eta vs tors. theta energy: -101.069 Dist. restrs. and SS energy: 11.329 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1680.011279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.011279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.649540 (E_RNA) where: Base-Base interactions energy: -1210.614 where: short stacking energy: -504.681 Base-Backbone interact. energy: 0.240 local terms energy: -508.276027 where: bonds (distance) C4'-P energy: -90.870 bonds (distance) P-C4' energy: -97.949 flat angles C4'-P-C4' energy: -104.705 flat angles P-C4'-P energy: -72.273 tors. eta vs tors. theta energy: -142.479 Dist. restrs. and SS energy: 1.888 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1662.007100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.007100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.070620 (E_RNA) where: Base-Base interactions energy: -1205.611 where: short stacking energy: -493.456 Base-Backbone interact. energy: -1.340 local terms energy: -493.120443 where: bonds (distance) C4'-P energy: -96.155 bonds (distance) P-C4' energy: -90.659 flat angles C4'-P-C4' energy: -100.012 flat angles P-C4'-P energy: -71.404 tors. eta vs tors. theta energy: -134.890 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1578.369798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.369798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.644367 (E_RNA) where: Base-Base interactions energy: -1159.923 where: short stacking energy: -482.688 Base-Backbone interact. energy: -0.505 local terms energy: -457.216837 where: bonds (distance) C4'-P energy: -75.833 bonds (distance) P-C4' energy: -88.177 flat angles C4'-P-C4' energy: -99.759 flat angles P-C4'-P energy: -56.398 tors. eta vs tors. theta energy: -137.051 Dist. restrs. and SS energy: 2.525 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1567.812736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.812736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.510735 (E_RNA) where: Base-Base interactions energy: -1136.176 where: short stacking energy: -476.363 Base-Backbone interact. energy: -2.265 local terms energy: -467.070328 where: bonds (distance) C4'-P energy: -90.086 bonds (distance) P-C4' energy: -84.944 flat angles C4'-P-C4' energy: -98.677 flat angles P-C4'-P energy: -66.992 tors. eta vs tors. theta energy: -126.371 Dist. restrs. and SS energy: 0.948 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1523.168300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.168300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.201174 (E_RNA) where: Base-Base interactions energy: -1111.456 where: short stacking energy: -458.033 Base-Backbone interact. energy: -0.183 local terms energy: -449.561954 where: bonds (distance) C4'-P energy: -84.819 bonds (distance) P-C4' energy: -86.535 flat angles C4'-P-C4' energy: -93.926 flat angles P-C4'-P energy: -59.810 tors. eta vs tors. theta energy: -124.472 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1493.551727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.551727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.014311 (E_RNA) where: Base-Base interactions energy: -1085.799 where: short stacking energy: -470.891 Base-Backbone interact. energy: -0.668 local terms energy: -445.547063 where: bonds (distance) C4'-P energy: -90.930 bonds (distance) P-C4' energy: -73.447 flat angles C4'-P-C4' energy: -90.173 flat angles P-C4'-P energy: -60.171 tors. eta vs tors. theta energy: -130.826 Dist. restrs. and SS energy: 1.713 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1439.800525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.800525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.018926 (E_RNA) where: Base-Base interactions energy: -1042.540 where: short stacking energy: -426.487 Base-Backbone interact. energy: -0.493 local terms energy: -435.985738 where: bonds (distance) C4'-P energy: -83.124 bonds (distance) P-C4' energy: -72.023 flat angles C4'-P-C4' energy: -95.735 flat angles P-C4'-P energy: -61.828 tors. eta vs tors. theta energy: -123.275 Dist. restrs. and SS energy: 2.468 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1398.220052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.220052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.457946 (E_RNA) where: Base-Base interactions energy: -1018.612 where: short stacking energy: -401.920 Base-Backbone interact. energy: -0.678 local terms energy: -417.167991 where: bonds (distance) C4'-P energy: -73.183 bonds (distance) P-C4' energy: -83.211 flat angles C4'-P-C4' energy: -91.110 flat angles P-C4'-P energy: -61.701 tors. eta vs tors. theta energy: -107.963 Dist. restrs. and SS energy: 1.488 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1304.473824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.473824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.220867 (E_RNA) where: Base-Base interactions energy: -956.514 where: short stacking energy: -388.337 Base-Backbone interact. energy: 1.876 local terms energy: -396.582816 where: bonds (distance) C4'-P energy: -70.323 bonds (distance) P-C4' energy: -78.619 flat angles C4'-P-C4' energy: -83.497 flat angles P-C4'-P energy: -61.043 tors. eta vs tors. theta energy: -103.101 Dist. restrs. and SS energy: 9.997 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1256.573871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.573871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.593810 (E_RNA) where: Base-Base interactions energy: -938.356 where: short stacking energy: -368.555 Base-Backbone interact. energy: -2.460 local terms energy: -361.778529 where: bonds (distance) C4'-P energy: -69.158 bonds (distance) P-C4' energy: -71.635 flat angles C4'-P-C4' energy: -76.140 flat angles P-C4'-P energy: -45.640 tors. eta vs tors. theta energy: -99.206 Dist. restrs. and SS energy: 9.270 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)