SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-11ffbe2f/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -942.424679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.424679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.931780 (E_RNA) where: Base-Base interactions energy: -704.766 where: short stacking energy: -338.686 Base-Backbone interact. energy: 5.542 local terms energy: -395.708044 where: bonds (distance) C4'-P energy: -90.120 bonds (distance) P-C4' energy: -86.553 flat angles C4'-P-C4' energy: -88.315 flat angles P-C4'-P energy: -48.216 tors. eta vs tors. theta energy: -82.504 Dist. restrs. and SS energy: 115.757 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -763.911097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.911097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.378765 (E_RNA) where: Base-Base interactions energy: -562.606 where: short stacking energy: -283.418 Base-Backbone interact. energy: -0.911 local terms energy: -367.862668 where: bonds (distance) C4'-P energy: -85.767 bonds (distance) P-C4' energy: -90.552 flat angles C4'-P-C4' energy: -87.733 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -67.317 Dist. restrs. and SS energy: 130.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1021.759205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.759205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.096235 (E_RNA) where: Base-Base interactions energy: -744.113 where: short stacking energy: -321.431 Base-Backbone interact. energy: -1.122 local terms energy: -382.860745 where: bonds (distance) C4'-P energy: -82.968 bonds (distance) P-C4' energy: -84.277 flat angles C4'-P-C4' energy: -86.296 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -74.252 Dist. restrs. and SS energy: 69.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1143.816791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.816791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.011950 (E_RNA) where: Base-Base interactions energy: -849.288 where: short stacking energy: -362.345 Base-Backbone interact. energy: 0.467 local terms energy: -376.190629 where: bonds (distance) C4'-P energy: -75.970 bonds (distance) P-C4' energy: -80.390 flat angles C4'-P-C4' energy: -92.523 flat angles P-C4'-P energy: -48.293 tors. eta vs tors. theta energy: -79.014 Dist. restrs. and SS energy: 44.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -959.406718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.406718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.573247 (E_RNA) where: Base-Base interactions energy: -701.170 where: short stacking energy: -292.773 Base-Backbone interact. energy: -0.611 local terms energy: -357.792064 where: bonds (distance) C4'-P energy: -82.004 bonds (distance) P-C4' energy: -86.498 flat angles C4'-P-C4' energy: -75.058 flat angles P-C4'-P energy: -48.234 tors. eta vs tors. theta energy: -65.999 Dist. restrs. and SS energy: 63.417 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -830.519889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.519889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.588220 (E_RNA) where: Base-Base interactions energy: -587.651 where: short stacking energy: -250.886 Base-Backbone interact. energy: 0.146 local terms energy: -343.083926 where: bonds (distance) C4'-P energy: -78.035 bonds (distance) P-C4' energy: -85.640 flat angles C4'-P-C4' energy: -67.732 flat angles P-C4'-P energy: -56.409 tors. eta vs tors. theta energy: -55.268 Dist. restrs. and SS energy: 63.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -795.384900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.384900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.979442 (E_RNA) where: Base-Base interactions energy: -622.390 where: short stacking energy: -281.645 Base-Backbone interact. energy: -1.915 local terms energy: -321.673884 where: bonds (distance) C4'-P energy: -70.826 bonds (distance) P-C4' energy: -83.034 flat angles C4'-P-C4' energy: -78.020 flat angles P-C4'-P energy: -23.539 tors. eta vs tors. theta energy: -66.254 Dist. restrs. and SS energy: 113.845 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -806.874339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.874339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.366854 (E_RNA) where: Base-Base interactions energy: -617.485 where: short stacking energy: -250.218 Base-Backbone interact. energy: 1.181 local terms energy: -298.063707 where: bonds (distance) C4'-P energy: -74.177 bonds (distance) P-C4' energy: -65.043 flat angles C4'-P-C4' energy: -56.925 flat angles P-C4'-P energy: -51.683 tors. eta vs tors. theta energy: -50.235 Dist. restrs. and SS energy: 70.743 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -789.982367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.982367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.006648 (E_RNA) where: Base-Base interactions energy: -567.006 where: short stacking energy: -252.460 Base-Backbone interact. energy: -1.564 local terms energy: -305.436563 where: bonds (distance) C4'-P energy: -81.847 bonds (distance) P-C4' energy: -79.212 flat angles C4'-P-C4' energy: -57.190 flat angles P-C4'-P energy: -35.753 tors. eta vs tors. theta energy: -51.435 Dist. restrs. and SS energy: 47.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -812.038704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.038704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.122381 (E_RNA) where: Base-Base interactions energy: -582.071 where: short stacking energy: -238.267 Base-Backbone interact. energy: -1.819 local terms energy: -313.232753 where: bonds (distance) C4'-P energy: -60.002 bonds (distance) P-C4' energy: -73.807 flat angles C4'-P-C4' energy: -78.279 flat angles P-C4'-P energy: -46.183 tors. eta vs tors. theta energy: -54.962 Dist. restrs. and SS energy: 48.334 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1129.355488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.355488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.459639 (E_RNA) where: Base-Base interactions energy: -786.230 where: short stacking energy: -348.679 Base-Backbone interact. energy: -3.708 local terms energy: -425.521660 where: bonds (distance) C4'-P energy: -87.818 bonds (distance) P-C4' energy: -90.185 flat angles C4'-P-C4' energy: -100.426 flat angles P-C4'-P energy: -58.988 tors. eta vs tors. theta energy: -88.104 Dist. restrs. and SS energy: 49.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1244.623799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.623799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.297907 (E_RNA) where: Base-Base interactions energy: -926.094 where: short stacking energy: -369.587 Base-Backbone interact. energy: -1.506 local terms energy: -385.697836 where: bonds (distance) C4'-P energy: -79.202 bonds (distance) P-C4' energy: -96.117 flat angles C4'-P-C4' energy: -84.255 flat angles P-C4'-P energy: -53.278 tors. eta vs tors. theta energy: -72.846 Dist. restrs. and SS energy: 31.924 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1085.898049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.898049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.290618 (E_RNA) where: Base-Base interactions energy: -802.171 where: short stacking energy: -307.823 Base-Backbone interact. energy: -0.534 local terms energy: -351.585368 where: bonds (distance) C4'-P energy: -95.110 bonds (distance) P-C4' energy: -82.809 flat angles C4'-P-C4' energy: -72.719 flat angles P-C4'-P energy: -33.219 tors. eta vs tors. theta energy: -67.729 Dist. restrs. and SS energy: 31.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1267.613586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.613586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.267954 (E_RNA) where: Base-Base interactions energy: -918.549 where: short stacking energy: -370.349 Base-Backbone interact. energy: -1.073 local terms energy: -409.645336 where: bonds (distance) C4'-P energy: -85.424 bonds (distance) P-C4' energy: -85.051 flat angles C4'-P-C4' energy: -84.280 flat angles P-C4'-P energy: -61.472 tors. eta vs tors. theta energy: -93.418 Dist. restrs. and SS energy: 24.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1083.635692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.635692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.357267 (E_RNA) where: Base-Base interactions energy: -772.514 where: short stacking energy: -304.507 Base-Backbone interact. energy: -2.664 local terms energy: -380.179430 where: bonds (distance) C4'-P energy: -71.586 bonds (distance) P-C4' energy: -88.324 flat angles C4'-P-C4' energy: -96.097 flat angles P-C4'-P energy: -60.416 tors. eta vs tors. theta energy: -63.757 Dist. restrs. and SS energy: 34.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1107.821370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.821370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.974861 (E_RNA) where: Base-Base interactions energy: -802.661 where: short stacking energy: -328.185 Base-Backbone interact. energy: 0.747 local terms energy: -369.060462 where: bonds (distance) C4'-P energy: -91.292 bonds (distance) P-C4' energy: -70.932 flat angles C4'-P-C4' energy: -70.089 flat angles P-C4'-P energy: -50.974 tors. eta vs tors. theta energy: -85.773 Dist. restrs. and SS energy: 26.403 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -994.966860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.966860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.779293 (E_RNA) where: Base-Base interactions energy: -734.511 where: short stacking energy: -317.206 Base-Backbone interact. energy: -2.520 local terms energy: -324.748238 where: bonds (distance) C4'-P energy: -67.528 bonds (distance) P-C4' energy: -69.939 flat angles C4'-P-C4' energy: -72.363 flat angles P-C4'-P energy: -51.615 tors. eta vs tors. theta energy: -63.304 Dist. restrs. and SS energy: 30.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -1049.539160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.539160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.035257 (E_RNA) where: Base-Base interactions energy: -754.246 where: short stacking energy: -298.085 Base-Backbone interact. energy: -0.511 local terms energy: -346.278181 where: bonds (distance) C4'-P energy: -76.638 bonds (distance) P-C4' energy: -70.703 flat angles C4'-P-C4' energy: -82.796 flat angles P-C4'-P energy: -50.552 tors. eta vs tors. theta energy: -65.589 Dist. restrs. and SS energy: 14.746 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -1006.829431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.829431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.531671 (E_RNA) where: Base-Base interactions energy: -717.924 where: short stacking energy: -310.214 Base-Backbone interact. energy: 4.531 local terms energy: -359.138530 where: bonds (distance) C4'-P energy: -72.678 bonds (distance) P-C4' energy: -69.145 flat angles C4'-P-C4' energy: -82.473 flat angles P-C4'-P energy: -54.170 tors. eta vs tors. theta energy: -80.672 Dist. restrs. and SS energy: 28.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -1045.009204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.009204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.410720 (E_RNA) where: Base-Base interactions energy: -790.563 where: short stacking energy: -316.334 Base-Backbone interact. energy: 2.538 local terms energy: -317.385466 where: bonds (distance) C4'-P energy: -68.369 bonds (distance) P-C4' energy: -73.964 flat angles C4'-P-C4' energy: -79.185 flat angles P-C4'-P energy: -25.419 tors. eta vs tors. theta energy: -70.448 Dist. restrs. and SS energy: 23.652 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1347.051083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.051083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.271850 (E_RNA) where: Base-Base interactions energy: -986.947 where: short stacking energy: -387.352 Base-Backbone interact. energy: -0.507 local terms energy: -413.816937 where: bonds (distance) C4'-P energy: -83.226 bonds (distance) P-C4' energy: -88.371 flat angles C4'-P-C4' energy: -94.322 flat angles P-C4'-P energy: -53.740 tors. eta vs tors. theta energy: -94.158 Dist. restrs. and SS energy: 17.471 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1209.523942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.523942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.465513 (E_RNA) where: Base-Base interactions energy: -843.849 where: short stacking energy: -377.675 Base-Backbone interact. energy: -1.548 local terms energy: -436.068369 where: bonds (distance) C4'-P energy: -88.227 bonds (distance) P-C4' energy: -89.560 flat angles C4'-P-C4' energy: -102.532 flat angles P-C4'-P energy: -55.216 tors. eta vs tors. theta energy: -100.534 Dist. restrs. and SS energy: 35.192 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1370.553453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.553453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.581177 (E_RNA) where: Base-Base interactions energy: -973.328 where: short stacking energy: -388.387 Base-Backbone interact. energy: -2.116 local terms energy: -452.137318 where: bonds (distance) C4'-P energy: -80.434 bonds (distance) P-C4' energy: -92.977 flat angles C4'-P-C4' energy: -100.482 flat angles P-C4'-P energy: -69.382 tors. eta vs tors. theta energy: -108.862 Dist. restrs. and SS energy: 20.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1103.824086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.824086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.472670 (E_RNA) where: Base-Base interactions energy: -792.721 where: short stacking energy: -320.390 Base-Backbone interact. energy: -2.250 local terms energy: -378.501781 where: bonds (distance) C4'-P energy: -77.136 bonds (distance) P-C4' energy: -98.065 flat angles C4'-P-C4' energy: -89.233 flat angles P-C4'-P energy: -46.747 tors. eta vs tors. theta energy: -67.321 Dist. restrs. and SS energy: 32.899 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1243.871903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.871903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.961408 (E_RNA) where: Base-Base interactions energy: -891.049 where: short stacking energy: -387.307 Base-Backbone interact. energy: -2.163 local terms energy: -407.749222 where: bonds (distance) C4'-P energy: -90.988 bonds (distance) P-C4' energy: -78.893 flat angles C4'-P-C4' energy: -90.801 flat angles P-C4'-P energy: -41.631 tors. eta vs tors. theta energy: -105.435 Dist. restrs. and SS energy: 20.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1192.948983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.948983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.758237 (E_RNA) where: Base-Base interactions energy: -844.279 where: short stacking energy: -361.757 Base-Backbone interact. energy: -2.808 local terms energy: -408.671753 where: bonds (distance) C4'-P energy: -76.742 bonds (distance) P-C4' energy: -93.264 flat angles C4'-P-C4' energy: -102.612 flat angles P-C4'-P energy: -55.839 tors. eta vs tors. theta energy: -80.215 Dist. restrs. and SS energy: 26.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -1196.755467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.755467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.097839 (E_RNA) where: Base-Base interactions energy: -851.560 where: short stacking energy: -357.080 Base-Backbone interact. energy: 4.942 local terms energy: -407.479724 where: bonds (distance) C4'-P energy: -85.170 bonds (distance) P-C4' energy: -84.816 flat angles C4'-P-C4' energy: -90.421 flat angles P-C4'-P energy: -53.261 tors. eta vs tors. theta energy: -93.811 Dist. restrs. and SS energy: 20.592 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -1041.869784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.869784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.500359 (E_RNA) where: Base-Base interactions energy: -745.862 where: short stacking energy: -296.047 Base-Backbone interact. energy: -1.593 local terms energy: -357.045374 where: bonds (distance) C4'-P energy: -84.750 bonds (distance) P-C4' energy: -78.296 flat angles C4'-P-C4' energy: -69.616 flat angles P-C4'-P energy: -51.551 tors. eta vs tors. theta energy: -72.832 Dist. restrs. and SS energy: 25.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -1102.524962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.524962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.439875 (E_RNA) where: Base-Base interactions energy: -812.353 where: short stacking energy: -314.659 Base-Backbone interact. energy: 0.414 local terms energy: -337.500527 where: bonds (distance) C4'-P energy: -74.712 bonds (distance) P-C4' energy: -76.400 flat angles C4'-P-C4' energy: -72.822 flat angles P-C4'-P energy: -47.469 tors. eta vs tors. theta energy: -66.097 Dist. restrs. and SS energy: 10.165 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -1049.221142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.221142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.914992 (E_RNA) where: Base-Base interactions energy: -769.507 where: short stacking energy: -284.380 Base-Backbone interact. energy: -0.758 local terms energy: -329.650195 where: bonds (distance) C4'-P energy: -80.535 bonds (distance) P-C4' energy: -73.052 flat angles C4'-P-C4' energy: -55.281 flat angles P-C4'-P energy: -53.113 tors. eta vs tors. theta energy: -67.670 Dist. restrs. and SS energy: 13.944 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1357.656277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.656277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.157143 (E_RNA) where: Base-Base interactions energy: -984.693 where: short stacking energy: -387.273 Base-Backbone interact. energy: -0.002 local terms energy: -425.462174 where: bonds (distance) C4'-P energy: -87.839 bonds (distance) P-C4' energy: -94.610 flat angles C4'-P-C4' energy: -93.162 flat angles P-C4'-P energy: -61.353 tors. eta vs tors. theta energy: -88.498 Dist. restrs. and SS energy: 15.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1451.638909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.638909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.840530 (E_RNA) where: Base-Base interactions energy: -1056.744 where: short stacking energy: -442.516 Base-Backbone interact. energy: -0.920 local terms energy: -450.176303 where: bonds (distance) C4'-P energy: -89.850 bonds (distance) P-C4' energy: -100.405 flat angles C4'-P-C4' energy: -100.433 flat angles P-C4'-P energy: -55.443 tors. eta vs tors. theta energy: -104.044 Dist. restrs. and SS energy: 19.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1273.285412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.285412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.902101 (E_RNA) where: Base-Base interactions energy: -939.203 where: short stacking energy: -379.302 Base-Backbone interact. energy: 0.639 local terms energy: -397.338434 where: bonds (distance) C4'-P energy: -76.695 bonds (distance) P-C4' energy: -81.457 flat angles C4'-P-C4' energy: -94.513 flat angles P-C4'-P energy: -52.637 tors. eta vs tors. theta energy: -92.036 Dist. restrs. and SS energy: 25.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1371.476655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.476655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.961701 (E_RNA) where: Base-Base interactions energy: -986.258 where: short stacking energy: -418.472 Base-Backbone interact. energy: -2.538 local terms energy: -433.165234 where: bonds (distance) C4'-P energy: -86.976 bonds (distance) P-C4' energy: -81.603 flat angles C4'-P-C4' energy: -88.527 flat angles P-C4'-P energy: -65.088 tors. eta vs tors. theta energy: -110.971 Dist. restrs. and SS energy: 13.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1115.609361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.609361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.244300 (E_RNA) where: Base-Base interactions energy: -809.004 where: short stacking energy: -329.841 Base-Backbone interact. energy: -2.195 local terms energy: -374.045558 where: bonds (distance) C4'-P energy: -82.698 bonds (distance) P-C4' energy: -90.429 flat angles C4'-P-C4' energy: -73.558 flat angles P-C4'-P energy: -59.441 tors. eta vs tors. theta energy: -67.919 Dist. restrs. and SS energy: 32.885 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1256.154243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.154243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.907892 (E_RNA) where: Base-Base interactions energy: -926.551 where: short stacking energy: -378.542 Base-Backbone interact. energy: -1.341 local terms energy: -378.016357 where: bonds (distance) C4'-P energy: -69.469 bonds (distance) P-C4' energy: -69.877 flat angles C4'-P-C4' energy: -88.434 flat angles P-C4'-P energy: -55.657 tors. eta vs tors. theta energy: -94.580 Dist. restrs. and SS energy: 13.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -1217.173064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.173064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.988643 (E_RNA) where: Base-Base interactions energy: -883.734 where: short stacking energy: -385.585 Base-Backbone interact. energy: 0.876 local terms energy: -387.130361 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -83.038 flat angles C4'-P-C4' energy: -71.770 flat angles P-C4'-P energy: -51.467 tors. eta vs tors. theta energy: -101.773 Dist. restrs. and SS energy: 16.066 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -1228.766927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.766927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.633926 (E_RNA) where: Base-Base interactions energy: -903.393 where: short stacking energy: -360.932 Base-Backbone interact. energy: -0.786 local terms energy: -376.455077 where: bonds (distance) C4'-P energy: -72.258 bonds (distance) P-C4' energy: -70.885 flat angles C4'-P-C4' energy: -71.662 flat angles P-C4'-P energy: -63.757 tors. eta vs tors. theta energy: -97.894 Dist. restrs. and SS energy: 15.117 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -1082.194123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.194123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.138895 (E_RNA) where: Base-Base interactions energy: -796.072 where: short stacking energy: -321.149 Base-Backbone interact. energy: 4.698 local terms energy: -344.764713 where: bonds (distance) C4'-P energy: -65.221 bonds (distance) P-C4' energy: -85.861 flat angles C4'-P-C4' energy: -74.504 flat angles P-C4'-P energy: -46.596 tors. eta vs tors. theta energy: -72.582 Dist. restrs. and SS energy: 17.195 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -1179.464242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.464242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.918239 (E_RNA) where: Base-Base interactions energy: -864.221 where: short stacking energy: -358.594 Base-Backbone interact. energy: 0.310 local terms energy: -362.006675 where: bonds (distance) C4'-P energy: -52.888 bonds (distance) P-C4' energy: -82.685 flat angles C4'-P-C4' energy: -89.399 flat angles P-C4'-P energy: -49.941 tors. eta vs tors. theta energy: -87.094 Dist. restrs. and SS energy: 9.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1505.527453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.527453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.729259 (E_RNA) where: Base-Base interactions energy: -1088.661 where: short stacking energy: -456.628 Base-Backbone interact. energy: -2.082 local terms energy: -468.986101 where: bonds (distance) C4'-P energy: -88.112 bonds (distance) P-C4' energy: -94.814 flat angles C4'-P-C4' energy: -100.469 flat angles P-C4'-P energy: -66.625 tors. eta vs tors. theta energy: -118.966 Dist. restrs. and SS energy: 17.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1334.248255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.248255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.000669 (E_RNA) where: Base-Base interactions energy: -970.658 where: short stacking energy: -400.077 Base-Backbone interact. energy: -0.577 local terms energy: -420.765116 where: bonds (distance) C4'-P energy: -81.507 bonds (distance) P-C4' energy: -92.728 flat angles C4'-P-C4' energy: -99.258 flat angles P-C4'-P energy: -49.297 tors. eta vs tors. theta energy: -97.975 Dist. restrs. and SS energy: 21.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1424.869628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.869628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.064842 (E_RNA) where: Base-Base interactions energy: -1008.538 where: short stacking energy: -399.820 Base-Backbone interact. energy: -2.810 local terms energy: -466.717130 where: bonds (distance) C4'-P energy: -96.589 bonds (distance) P-C4' energy: -99.161 flat angles C4'-P-C4' energy: -97.882 flat angles P-C4'-P energy: -64.686 tors. eta vs tors. theta energy: -108.399 Dist. restrs. and SS energy: 16.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1342.340279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.340279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.861030 (E_RNA) where: Base-Base interactions energy: -979.104 where: short stacking energy: -423.868 Base-Backbone interact. energy: -2.489 local terms energy: -417.268018 where: bonds (distance) C4'-P energy: -81.163 bonds (distance) P-C4' energy: -83.883 flat angles C4'-P-C4' energy: -93.812 flat angles P-C4'-P energy: -59.318 tors. eta vs tors. theta energy: -99.091 Dist. restrs. and SS energy: 19.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1262.487594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.487594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.973337 (E_RNA) where: Base-Base interactions energy: -913.512 where: short stacking energy: -365.296 Base-Backbone interact. energy: -1.623 local terms energy: -400.837868 where: bonds (distance) C4'-P energy: -82.118 bonds (distance) P-C4' energy: -88.350 flat angles C4'-P-C4' energy: -90.173 flat angles P-C4'-P energy: -57.260 tors. eta vs tors. theta energy: -82.936 Dist. restrs. and SS energy: 16.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1125.843648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.843648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.674795 (E_RNA) where: Base-Base interactions energy: -835.620 where: short stacking energy: -343.761 Base-Backbone interact. energy: -2.096 local terms energy: -338.958552 where: bonds (distance) C4'-P energy: -56.587 bonds (distance) P-C4' energy: -84.064 flat angles C4'-P-C4' energy: -65.287 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -77.953 Dist. restrs. and SS energy: 14.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1334.628822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.628822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.809022 (E_RNA) where: Base-Base interactions energy: -965.949 where: short stacking energy: -401.222 Base-Backbone interact. energy: -1.089 local terms energy: -412.770956 where: bonds (distance) C4'-P energy: -72.822 bonds (distance) P-C4' energy: -80.153 flat angles C4'-P-C4' energy: -91.962 flat angles P-C4'-P energy: -55.707 tors. eta vs tors. theta energy: -112.127 Dist. restrs. and SS energy: 8.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -1230.244722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.244722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.947286 (E_RNA) where: Base-Base interactions energy: -899.073 where: short stacking energy: -356.634 Base-Backbone interact. energy: -1.095 local terms energy: -378.779408 where: bonds (distance) C4'-P energy: -85.398 bonds (distance) P-C4' energy: -63.275 flat angles C4'-P-C4' energy: -83.243 flat angles P-C4'-P energy: -54.304 tors. eta vs tors. theta energy: -92.560 Dist. restrs. and SS energy: 11.953 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -1214.444823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.444823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.401888 (E_RNA) where: Base-Base interactions energy: -895.931 where: short stacking energy: -354.572 Base-Backbone interact. energy: -1.266 local terms energy: -361.205556 where: bonds (distance) C4'-P energy: -75.738 bonds (distance) P-C4' energy: -71.364 flat angles C4'-P-C4' energy: -69.654 flat angles P-C4'-P energy: -56.621 tors. eta vs tors. theta energy: -87.828 Dist. restrs. and SS energy: 7.207 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -1081.115892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.115892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.438304 (E_RNA) where: Base-Base interactions energy: -827.203 where: short stacking energy: -321.599 Base-Backbone interact. energy: 1.528 local terms energy: -300.763763 where: bonds (distance) C4'-P energy: -81.081 bonds (distance) P-C4' energy: -60.705 flat angles C4'-P-C4' energy: -62.052 flat angles P-C4'-P energy: -25.254 tors. eta vs tors. theta energy: -71.671 Dist. restrs. and SS energy: 8.572 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1537.666990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.666990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.606365 (E_RNA) where: Base-Base interactions energy: -1113.049 where: short stacking energy: -447.734 Base-Backbone interact. energy: -3.023 local terms energy: -474.534038 where: bonds (distance) C4'-P energy: -90.843 bonds (distance) P-C4' energy: -99.533 flat angles C4'-P-C4' energy: -94.591 flat angles P-C4'-P energy: -64.112 tors. eta vs tors. theta energy: -125.455 Dist. restrs. and SS energy: 16.189 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1462.532908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.532908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.755528 (E_RNA) where: Base-Base interactions energy: -1059.682 where: short stacking energy: -439.710 Base-Backbone interact. energy: -0.623 local terms energy: -458.450196 where: bonds (distance) C4'-P energy: -92.916 bonds (distance) P-C4' energy: -80.357 flat angles C4'-P-C4' energy: -98.795 flat angles P-C4'-P energy: -70.823 tors. eta vs tors. theta energy: -115.559 Dist. restrs. and SS energy: 19.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1315.978057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.978057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.763391 (E_RNA) where: Base-Base interactions energy: -970.080 where: short stacking energy: -393.956 Base-Backbone interact. energy: -3.035 local terms energy: -403.648609 where: bonds (distance) C4'-P energy: -80.754 bonds (distance) P-C4' energy: -83.484 flat angles C4'-P-C4' energy: -90.051 flat angles P-C4'-P energy: -54.622 tors. eta vs tors. theta energy: -94.738 Dist. restrs. and SS energy: 24.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1406.727937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.727937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.138638 (E_RNA) where: Base-Base interactions energy: -1022.228 where: short stacking energy: -431.808 Base-Backbone interact. energy: -2.453 local terms energy: -433.458070 where: bonds (distance) C4'-P energy: -83.673 bonds (distance) P-C4' energy: -87.109 flat angles C4'-P-C4' energy: -98.677 flat angles P-C4'-P energy: -59.069 tors. eta vs tors. theta energy: -104.930 Dist. restrs. and SS energy: 14.661 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1380.924900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.924900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.420948 (E_RNA) where: Base-Base interactions energy: -976.321 where: short stacking energy: -409.582 Base-Backbone interact. energy: -2.249 local terms energy: -452.851359 where: bonds (distance) C4'-P energy: -82.066 bonds (distance) P-C4' energy: -91.179 flat angles C4'-P-C4' energy: -95.709 flat angles P-C4'-P energy: -64.797 tors. eta vs tors. theta energy: -119.100 Dist. restrs. and SS energy: 13.746 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1384.287461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.287461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.412122 (E_RNA) where: Base-Base interactions energy: -1000.248 where: short stacking energy: -418.933 Base-Backbone interact. energy: -1.708 local terms energy: -424.456242 where: bonds (distance) C4'-P energy: -78.113 bonds (distance) P-C4' energy: -82.018 flat angles C4'-P-C4' energy: -84.131 flat angles P-C4'-P energy: -61.451 tors. eta vs tors. theta energy: -118.744 Dist. restrs. and SS energy: 5.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1180.029782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.029782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.802402 (E_RNA) where: Base-Base interactions energy: -859.202 where: short stacking energy: -346.844 Base-Backbone interact. energy: 2.954 local terms energy: -374.553675 where: bonds (distance) C4'-P energy: -77.640 bonds (distance) P-C4' energy: -81.480 flat angles C4'-P-C4' energy: -79.477 flat angles P-C4'-P energy: -49.770 tors. eta vs tors. theta energy: -86.187 Dist. restrs. and SS energy: 14.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -1273.216793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.216793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.803020 (E_RNA) where: Base-Base interactions energy: -938.442 where: short stacking energy: -380.055 Base-Backbone interact. energy: 2.374 local terms energy: -380.735445 where: bonds (distance) C4'-P energy: -75.954 bonds (distance) P-C4' energy: -59.629 flat angles C4'-P-C4' energy: -91.653 flat angles P-C4'-P energy: -58.999 tors. eta vs tors. theta energy: -94.500 Dist. restrs. and SS energy: 6.836 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -1233.881369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.881369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.741847 (E_RNA) where: Base-Base interactions energy: -898.921 where: short stacking energy: -355.052 Base-Backbone interact. energy: -1.585 local terms energy: -375.235632 where: bonds (distance) C4'-P energy: -59.957 bonds (distance) P-C4' energy: -68.762 flat angles C4'-P-C4' energy: -102.451 flat angles P-C4'-P energy: -53.715 tors. eta vs tors. theta energy: -90.351 Dist. restrs. and SS energy: 5.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -1086.912746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.912746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.464906 (E_RNA) where: Base-Base interactions energy: -782.511 where: short stacking energy: -325.627 Base-Backbone interact. energy: 0.369 local terms energy: -350.322752 where: bonds (distance) C4'-P energy: -53.594 bonds (distance) P-C4' energy: -85.278 flat angles C4'-P-C4' energy: -89.837 flat angles P-C4'-P energy: -30.553 tors. eta vs tors. theta energy: -91.060 Dist. restrs. and SS energy: 8.802 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1507.996927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.996927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.808394 (E_RNA) where: Base-Base interactions energy: -1087.516 where: short stacking energy: -462.586 Base-Backbone interact. energy: 0.896 local terms energy: -475.188154 where: bonds (distance) C4'-P energy: -97.974 bonds (distance) P-C4' energy: -83.069 flat angles C4'-P-C4' energy: -100.789 flat angles P-C4'-P energy: -62.456 tors. eta vs tors. theta energy: -130.901 Dist. restrs. and SS energy: 17.061 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1489.594345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.594345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.976261 (E_RNA) where: Base-Base interactions energy: -1068.107 where: short stacking energy: -439.790 Base-Backbone interact. energy: -1.060 local terms energy: -478.809262 where: bonds (distance) C4'-P energy: -103.420 bonds (distance) P-C4' energy: -92.352 flat angles C4'-P-C4' energy: -88.851 flat angles P-C4'-P energy: -77.718 tors. eta vs tors. theta energy: -116.468 Dist. restrs. and SS energy: 21.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1489.160694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.160694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.503951 (E_RNA) where: Base-Base interactions energy: -1082.818 where: short stacking energy: -444.189 Base-Backbone interact. energy: 0.527 local terms energy: -447.213314 where: bonds (distance) C4'-P energy: -84.505 bonds (distance) P-C4' energy: -92.884 flat angles C4'-P-C4' energy: -96.105 flat angles P-C4'-P energy: -57.291 tors. eta vs tors. theta energy: -116.427 Dist. restrs. and SS energy: 3.593 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1300.553942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.553942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.577940 (E_RNA) where: Base-Base interactions energy: -973.700 where: short stacking energy: -401.827 Base-Backbone interact. energy: -2.003 local terms energy: -387.875062 where: bonds (distance) C4'-P energy: -71.263 bonds (distance) P-C4' energy: -78.572 flat angles C4'-P-C4' energy: -90.172 flat angles P-C4'-P energy: -54.270 tors. eta vs tors. theta energy: -93.598 Dist. restrs. and SS energy: 26.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1469.117466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.117466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.658270 (E_RNA) where: Base-Base interactions energy: -1060.879 where: short stacking energy: -441.779 Base-Backbone interact. energy: -0.951 local terms energy: -446.827855 where: bonds (distance) C4'-P energy: -83.950 bonds (distance) P-C4' energy: -79.029 flat angles C4'-P-C4' energy: -86.320 flat angles P-C4'-P energy: -70.778 tors. eta vs tors. theta energy: -126.751 Dist. restrs. and SS energy: 2.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1366.181519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.181519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.368733 (E_RNA) where: Base-Base interactions energy: -983.760 where: short stacking energy: -411.774 Base-Backbone interact. energy: 1.492 local terms energy: -430.100599 where: bonds (distance) C4'-P energy: -79.870 bonds (distance) P-C4' energy: -83.560 flat angles C4'-P-C4' energy: -92.379 flat angles P-C4'-P energy: -64.594 tors. eta vs tors. theta energy: -109.697 Dist. restrs. and SS energy: 9.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1257.869144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.869144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.673356 (E_RNA) where: Base-Base interactions energy: -905.470 where: short stacking energy: -378.349 Base-Backbone interact. energy: -1.061 local terms energy: -400.142848 where: bonds (distance) C4'-P energy: -80.863 bonds (distance) P-C4' energy: -83.085 flat angles C4'-P-C4' energy: -92.249 flat angles P-C4'-P energy: -52.306 tors. eta vs tors. theta energy: -91.640 Dist. restrs. and SS energy: 12.054 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -1251.521802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.521802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.258503 (E_RNA) where: Base-Base interactions energy: -925.767 where: short stacking energy: -375.598 Base-Backbone interact. energy: -0.036 local terms energy: -375.455652 where: bonds (distance) C4'-P energy: -92.923 bonds (distance) P-C4' energy: -63.224 flat angles C4'-P-C4' energy: -78.186 flat angles P-C4'-P energy: -37.610 tors. eta vs tors. theta energy: -103.513 Dist. restrs. and SS energy: 12.987 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -1305.619332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.619332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.246665 (E_RNA) where: Base-Base interactions energy: -933.830 where: short stacking energy: -374.196 Base-Backbone interact. energy: 0.230 local terms energy: -411.646862 where: bonds (distance) C4'-P energy: -89.178 bonds (distance) P-C4' energy: -83.655 flat angles C4'-P-C4' energy: -77.387 flat angles P-C4'-P energy: -60.052 tors. eta vs tors. theta energy: -101.375 Dist. restrs. and SS energy: 2.877 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -1091.135097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.135097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.605616 (E_RNA) where: Base-Base interactions energy: -813.674 where: short stacking energy: -327.688 Base-Backbone interact. energy: -0.782 local terms energy: -339.149282 where: bonds (distance) C4'-P energy: -67.163 bonds (distance) P-C4' energy: -68.249 flat angles C4'-P-C4' energy: -75.245 flat angles P-C4'-P energy: -51.040 tors. eta vs tors. theta energy: -77.452 Dist. restrs. and SS energy: 25.721 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1540.497711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.497711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.167604 (E_RNA) where: Base-Base interactions energy: -1123.976 where: short stacking energy: -444.091 Base-Backbone interact. energy: -2.596 local terms energy: -462.595136 where: bonds (distance) C4'-P energy: -87.596 bonds (distance) P-C4' energy: -92.566 flat angles C4'-P-C4' energy: -97.932 flat angles P-C4'-P energy: -65.042 tors. eta vs tors. theta energy: -119.459 Dist. restrs. and SS energy: 11.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1543.370006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.370006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.895065 (E_RNA) where: Base-Base interactions energy: -1112.104 where: short stacking energy: -478.406 Base-Backbone interact. energy: -1.203 local terms energy: -467.588698 where: bonds (distance) C4'-P energy: -85.843 bonds (distance) P-C4' energy: -97.678 flat angles C4'-P-C4' energy: -101.030 flat angles P-C4'-P energy: -67.596 tors. eta vs tors. theta energy: -115.442 Dist. restrs. and SS energy: 0.775 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1485.658732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.658732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.220139 (E_RNA) where: Base-Base interactions energy: -1078.608 where: short stacking energy: -460.407 Base-Backbone interact. energy: -0.746 local terms energy: -456.866721 where: bonds (distance) C4'-P energy: -78.541 bonds (distance) P-C4' energy: -83.773 flat angles C4'-P-C4' energy: -99.562 flat angles P-C4'-P energy: -67.655 tors. eta vs tors. theta energy: -127.336 Dist. restrs. and SS energy: 13.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1532.755421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.755421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.626060 (E_RNA) where: Base-Base interactions energy: -1106.579 where: short stacking energy: -470.850 Base-Backbone interact. energy: -0.843 local terms energy: -463.204380 where: bonds (distance) C4'-P energy: -92.460 bonds (distance) P-C4' energy: -88.679 flat angles C4'-P-C4' energy: -97.251 flat angles P-C4'-P energy: -54.978 tors. eta vs tors. theta energy: -129.837 Dist. restrs. and SS energy: 1.121 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1294.758493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.758493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.223049 (E_RNA) where: Base-Base interactions energy: -921.981 where: short stacking energy: -383.820 Base-Backbone interact. energy: 2.250 local terms energy: -432.492490 where: bonds (distance) C4'-P energy: -83.921 bonds (distance) P-C4' energy: -78.220 flat angles C4'-P-C4' energy: -95.602 flat angles P-C4'-P energy: -68.838 tors. eta vs tors. theta energy: -105.912 Dist. restrs. and SS energy: 20.715 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1352.766107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.766107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.606538 (E_RNA) where: Base-Base interactions energy: -970.913 where: short stacking energy: -396.450 Base-Backbone interact. energy: 1.929 local terms energy: -428.622403 where: bonds (distance) C4'-P energy: -74.329 bonds (distance) P-C4' energy: -88.681 flat angles C4'-P-C4' energy: -94.455 flat angles P-C4'-P energy: -61.813 tors. eta vs tors. theta energy: -109.345 Dist. restrs. and SS energy: 8.090 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1287.751048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.751048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.739036 (E_RNA) where: Base-Base interactions energy: -947.659 where: short stacking energy: -396.605 Base-Backbone interact. energy: -3.373 local terms energy: -383.707883 where: bonds (distance) C4'-P energy: -67.641 bonds (distance) P-C4' energy: -83.058 flat angles C4'-P-C4' energy: -96.099 flat angles P-C4'-P energy: -52.266 tors. eta vs tors. theta energy: -84.645 Dist. restrs. and SS energy: 10.238 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1327.611819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.611819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.690082 (E_RNA) where: Base-Base interactions energy: -977.717 where: short stacking energy: -380.507 Base-Backbone interact. energy: 4.476 local terms energy: -393.449579 where: bonds (distance) C4'-P energy: -79.628 bonds (distance) P-C4' energy: -85.442 flat angles C4'-P-C4' energy: -81.613 flat angles P-C4'-P energy: -42.010 tors. eta vs tors. theta energy: -104.756 Dist. restrs. and SS energy: 2.328 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -1295.221065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.221065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.885704 (E_RNA) where: Base-Base interactions energy: -972.155 where: short stacking energy: -388.524 Base-Backbone interact. energy: -0.504 local terms energy: -363.226497 where: bonds (distance) C4'-P energy: -84.582 bonds (distance) P-C4' energy: -67.711 flat angles C4'-P-C4' energy: -87.067 flat angles P-C4'-P energy: -32.531 tors. eta vs tors. theta energy: -91.336 Dist. restrs. and SS energy: 3.915 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -1127.709314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.709314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.069230 (E_RNA) where: Base-Base interactions energy: -824.093 where: short stacking energy: -312.546 Base-Backbone interact. energy: 3.147 local terms energy: -352.122327 where: bonds (distance) C4'-P energy: -75.323 bonds (distance) P-C4' energy: -78.905 flat angles C4'-P-C4' energy: -67.825 flat angles P-C4'-P energy: -56.030 tors. eta vs tors. theta energy: -74.038 Dist. restrs. and SS energy: 8.610 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1561.901317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.901317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.417017 (E_RNA) where: Base-Base interactions energy: -1147.100 where: short stacking energy: -463.486 Base-Backbone interact. energy: -0.370 local terms energy: -463.947259 where: bonds (distance) C4'-P energy: -84.026 bonds (distance) P-C4' energy: -91.948 flat angles C4'-P-C4' energy: -101.559 flat angles P-C4'-P energy: -68.398 tors. eta vs tors. theta energy: -118.016 Dist. restrs. and SS energy: 12.766 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1585.861564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.861564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.789689 (E_RNA) where: Base-Base interactions energy: -1157.272 where: short stacking energy: -478.379 Base-Backbone interact. energy: -0.155 local terms energy: -466.362820 where: bonds (distance) C4'-P energy: -86.402 bonds (distance) P-C4' energy: -97.874 flat angles C4'-P-C4' energy: -99.207 flat angles P-C4'-P energy: -66.542 tors. eta vs tors. theta energy: -116.338 Dist. restrs. and SS energy: 1.178 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1576.609761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.609761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.736430 (E_RNA) where: Base-Base interactions energy: -1141.448 where: short stacking energy: -473.588 Base-Backbone interact. energy: -1.395 local terms energy: -471.894082 where: bonds (distance) C4'-P energy: -82.750 bonds (distance) P-C4' energy: -77.239 flat angles C4'-P-C4' energy: -108.800 flat angles P-C4'-P energy: -66.867 tors. eta vs tors. theta energy: -136.237 Dist. restrs. and SS energy: 1.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1460.626311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.626311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.407563 (E_RNA) where: Base-Base interactions energy: -1060.474 where: short stacking energy: -443.151 Base-Backbone interact. energy: -2.974 local terms energy: -444.959328 where: bonds (distance) C4'-P energy: -83.421 bonds (distance) P-C4' energy: -90.813 flat angles C4'-P-C4' energy: -95.023 flat angles P-C4'-P energy: -62.309 tors. eta vs tors. theta energy: -113.393 Dist. restrs. and SS energy: 11.031 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1389.853247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.853247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.814927 (E_RNA) where: Base-Base interactions energy: -1008.818 where: short stacking energy: -419.166 Base-Backbone interact. energy: -1.733 local terms energy: -425.263988 where: bonds (distance) C4'-P energy: -82.677 bonds (distance) P-C4' energy: -79.320 flat angles C4'-P-C4' energy: -90.912 flat angles P-C4'-P energy: -54.953 tors. eta vs tors. theta energy: -117.402 Dist. restrs. and SS energy: 9.212 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1353.818515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.818515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.715369 (E_RNA) where: Base-Base interactions energy: -985.365 where: short stacking energy: -399.494 Base-Backbone interact. energy: -1.441 local terms energy: -416.909277 where: bonds (distance) C4'-P energy: -95.118 bonds (distance) P-C4' energy: -85.520 flat angles C4'-P-C4' energy: -89.811 flat angles P-C4'-P energy: -51.605 tors. eta vs tors. theta energy: -94.856 Dist. restrs. and SS energy: 13.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1392.546219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.546219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.084353 (E_RNA) where: Base-Base interactions energy: -1041.603 where: short stacking energy: -440.528 Base-Backbone interact. energy: 0.104 local terms energy: -392.586226 where: bonds (distance) C4'-P energy: -54.451 bonds (distance) P-C4' energy: -80.349 flat angles C4'-P-C4' energy: -88.195 flat angles P-C4'-P energy: -52.090 tors. eta vs tors. theta energy: -117.500 Dist. restrs. and SS energy: 4.788 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -1253.301351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.301351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.832012 (E_RNA) where: Base-Base interactions energy: -935.612 where: short stacking energy: -367.485 Base-Backbone interact. energy: -2.444 local terms energy: -360.776740 where: bonds (distance) C4'-P energy: -62.674 bonds (distance) P-C4' energy: -74.489 flat angles C4'-P-C4' energy: -84.803 flat angles P-C4'-P energy: -51.988 tors. eta vs tors. theta energy: -86.823 Dist. restrs. and SS energy: 8.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1312.846837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.846837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.896385 (E_RNA) where: Base-Base interactions energy: -1012.128 where: short stacking energy: -397.002 Base-Backbone interact. energy: -0.732 local terms energy: -342.036087 where: bonds (distance) C4'-P energy: -61.441 bonds (distance) P-C4' energy: -75.740 flat angles C4'-P-C4' energy: -73.289 flat angles P-C4'-P energy: -33.639 tors. eta vs tors. theta energy: -97.927 Dist. restrs. and SS energy: 5.300 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -1173.412895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.412895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.303923 (E_RNA) where: Base-Base interactions energy: -882.633 where: short stacking energy: -349.146 Base-Backbone interact. energy: -1.607 local terms energy: -334.063943 where: bonds (distance) C4'-P energy: -68.614 bonds (distance) P-C4' energy: -65.480 flat angles C4'-P-C4' energy: -61.988 flat angles P-C4'-P energy: -51.847 tors. eta vs tors. theta energy: -86.134 Dist. restrs. and SS energy: 8.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1583.060751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.060751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.051092 (E_RNA) where: Base-Base interactions energy: -1141.704 where: short stacking energy: -483.165 Base-Backbone interact. energy: -1.314 local terms energy: -489.032654 where: bonds (distance) C4'-P energy: -82.514 bonds (distance) P-C4' energy: -102.061 flat angles C4'-P-C4' energy: -106.963 flat angles P-C4'-P energy: -70.630 tors. eta vs tors. theta energy: -126.865 Dist. restrs. and SS energy: 12.240 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1578.189627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.189627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.052481 (E_RNA) where: Base-Base interactions energy: -1151.036 where: short stacking energy: -484.441 Base-Backbone interact. energy: -0.785 local terms energy: -465.231503 where: bonds (distance) C4'-P energy: -72.626 bonds (distance) P-C4' energy: -92.981 flat angles C4'-P-C4' energy: -106.192 flat angles P-C4'-P energy: -72.041 tors. eta vs tors. theta energy: -121.391 Dist. restrs. and SS energy: 2.113 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1551.439749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.439749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.252490 (E_RNA) where: Base-Base interactions energy: -1106.847 where: short stacking energy: -475.470 Base-Backbone interact. energy: -2.089 local terms energy: -480.316583 where: bonds (distance) C4'-P energy: -88.604 bonds (distance) P-C4' energy: -90.873 flat angles C4'-P-C4' energy: -109.617 flat angles P-C4'-P energy: -58.467 tors. eta vs tors. theta energy: -132.756 Dist. restrs. and SS energy: 1.063 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1453.882294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.882294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.546470 (E_RNA) where: Base-Base interactions energy: -1061.913 where: short stacking energy: -442.228 Base-Backbone interact. energy: -3.079 local terms energy: -443.554332 where: bonds (distance) C4'-P energy: -86.799 bonds (distance) P-C4' energy: -83.321 flat angles C4'-P-C4' energy: -102.258 flat angles P-C4'-P energy: -58.920 tors. eta vs tors. theta energy: -112.256 Dist. restrs. and SS energy: 17.914 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1400.533372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.533372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.789551 (E_RNA) where: Base-Base interactions energy: -1008.274 where: short stacking energy: -413.050 Base-Backbone interact. energy: -1.863 local terms energy: -436.652625 where: bonds (distance) C4'-P energy: -84.826 bonds (distance) P-C4' energy: -83.225 flat angles C4'-P-C4' energy: -98.228 flat angles P-C4'-P energy: -51.888 tors. eta vs tors. theta energy: -118.484 Dist. restrs. and SS energy: 9.506 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1444.744169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.744169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.300488 (E_RNA) where: Base-Base interactions energy: -1070.642 where: short stacking energy: -440.809 Base-Backbone interact. energy: -1.187 local terms energy: -418.470684 where: bonds (distance) C4'-P energy: -61.618 bonds (distance) P-C4' energy: -80.628 flat angles C4'-P-C4' energy: -101.051 flat angles P-C4'-P energy: -54.992 tors. eta vs tors. theta energy: -120.183 Dist. restrs. and SS energy: 8.806 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1344.233789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.233789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.183643 (E_RNA) where: Base-Base interactions energy: -1009.047 where: short stacking energy: -402.492 Base-Backbone interact. energy: -1.672 local terms energy: -381.464656 where: bonds (distance) C4'-P energy: -63.245 bonds (distance) P-C4' energy: -67.698 flat angles C4'-P-C4' energy: -85.142 flat angles P-C4'-P energy: -59.246 tors. eta vs tors. theta energy: -106.134 Dist. restrs. and SS energy: 11.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1356.708421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.708421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.209667 (E_RNA) where: Base-Base interactions energy: -1008.246 where: short stacking energy: -387.316 Base-Backbone interact. energy: -0.089 local terms energy: -392.874381 where: bonds (distance) C4'-P energy: -65.178 bonds (distance) P-C4' energy: -72.627 flat angles C4'-P-C4' energy: -97.604 flat angles P-C4'-P energy: -58.236 tors. eta vs tors. theta energy: -99.230 Dist. restrs. and SS energy: 7.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -1233.455294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.455294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.429449 (E_RNA) where: Base-Base interactions energy: -922.938 where: short stacking energy: -360.266 Base-Backbone interact. energy: -0.613 local terms energy: -362.877976 where: bonds (distance) C4'-P energy: -53.949 bonds (distance) P-C4' energy: -78.085 flat angles C4'-P-C4' energy: -81.470 flat angles P-C4'-P energy: -59.495 tors. eta vs tors. theta energy: -89.879 Dist. restrs. and SS energy: 16.224 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -1177.012807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.012807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.252827 (E_RNA) where: Base-Base interactions energy: -888.556 where: short stacking energy: -354.810 Base-Backbone interact. energy: -1.364 local terms energy: -333.333137 where: bonds (distance) C4'-P energy: -60.667 bonds (distance) P-C4' energy: -64.829 flat angles C4'-P-C4' energy: -68.931 flat angles P-C4'-P energy: -51.206 tors. eta vs tors. theta energy: -87.700 Dist. restrs. and SS energy: 9.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1580.863661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.863661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.739892 (E_RNA) where: Base-Base interactions energy: -1130.821 where: short stacking energy: -464.695 Base-Backbone interact. energy: -2.563 local terms energy: -494.355586 where: bonds (distance) C4'-P energy: -97.057 bonds (distance) P-C4' energy: -95.478 flat angles C4'-P-C4' energy: -106.295 flat angles P-C4'-P energy: -65.467 tors. eta vs tors. theta energy: -130.059 Dist. restrs. and SS energy: 10.126 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1592.526706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.526706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.944438 (E_RNA) where: Base-Base interactions energy: -1151.800 where: short stacking energy: -475.769 Base-Backbone interact. energy: 1.235 local terms energy: -480.379804 where: bonds (distance) C4'-P energy: -97.683 bonds (distance) P-C4' energy: -84.813 flat angles C4'-P-C4' energy: -108.443 flat angles P-C4'-P energy: -66.125 tors. eta vs tors. theta energy: -123.316 Dist. restrs. and SS energy: 1.668 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1573.401284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.401284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.241423 (E_RNA) where: Base-Base interactions energy: -1144.430 where: short stacking energy: -481.351 Base-Backbone interact. energy: -2.393 local terms energy: -464.417978 where: bonds (distance) C4'-P energy: -86.194 bonds (distance) P-C4' energy: -88.101 flat angles C4'-P-C4' energy: -97.312 flat angles P-C4'-P energy: -61.822 tors. eta vs tors. theta energy: -130.989 Dist. restrs. and SS energy: 1.090 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1471.659680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.659680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.787726 (E_RNA) where: Base-Base interactions energy: -1066.245 where: short stacking energy: -449.415 Base-Backbone interact. energy: 2.241 local terms energy: -463.783600 where: bonds (distance) C4'-P energy: -81.055 bonds (distance) P-C4' energy: -88.649 flat angles C4'-P-C4' energy: -107.668 flat angles P-C4'-P energy: -61.278 tors. eta vs tors. theta energy: -125.133 Dist. restrs. and SS energy: 19.378 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1511.478843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.478843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.782136 (E_RNA) where: Base-Base interactions energy: -1099.206 where: short stacking energy: -475.585 Base-Backbone interact. energy: -0.994 local terms energy: -450.582450 where: bonds (distance) C4'-P energy: -75.622 bonds (distance) P-C4' energy: -83.608 flat angles C4'-P-C4' energy: -92.214 flat angles P-C4'-P energy: -69.255 tors. eta vs tors. theta energy: -129.884 Dist. restrs. and SS energy: 2.553 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1344.698894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.698894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.043833 (E_RNA) where: Base-Base interactions energy: -976.773 where: short stacking energy: -417.818 Base-Backbone interact. energy: -0.377 local terms energy: -420.894204 where: bonds (distance) C4'-P energy: -79.342 bonds (distance) P-C4' energy: -75.076 flat angles C4'-P-C4' energy: -93.200 flat angles P-C4'-P energy: -61.939 tors. eta vs tors. theta energy: -111.337 Dist. restrs. and SS energy: 16.595 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1400.393131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.393131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.770999 (E_RNA) where: Base-Base interactions energy: -1031.112 where: short stacking energy: -420.530 Base-Backbone interact. energy: 7.485 local terms energy: -420.144037 where: bonds (distance) C4'-P energy: -75.705 bonds (distance) P-C4' energy: -78.676 flat angles C4'-P-C4' energy: -81.642 flat angles P-C4'-P energy: -76.101 tors. eta vs tors. theta energy: -108.018 Dist. restrs. and SS energy: 6.628 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1275.689300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.689300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.173073 (E_RNA) where: Base-Base interactions energy: -921.271 where: short stacking energy: -379.282 Base-Backbone interact. energy: 1.337 local terms energy: -402.239119 where: bonds (distance) C4'-P energy: -80.236 bonds (distance) P-C4' energy: -83.386 flat angles C4'-P-C4' energy: -76.829 flat angles P-C4'-P energy: -64.277 tors. eta vs tors. theta energy: -97.511 Dist. restrs. and SS energy: 9.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1225.835266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.835266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.998512 (E_RNA) where: Base-Base interactions energy: -920.059 where: short stacking energy: -346.626 Base-Backbone interact. energy: 0.070 local terms energy: -358.009271 where: bonds (distance) C4'-P energy: -71.676 bonds (distance) P-C4' energy: -73.063 flat angles C4'-P-C4' energy: -77.478 flat angles P-C4'-P energy: -50.819 tors. eta vs tors. theta energy: -84.973 Dist. restrs. and SS energy: 15.413 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -1193.689486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.689486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.412464 (E_RNA) where: Base-Base interactions energy: -875.365 where: short stacking energy: -346.936 Base-Backbone interact. energy: 1.709 local terms energy: -365.756933 where: bonds (distance) C4'-P energy: -77.757 bonds (distance) P-C4' energy: -73.153 flat angles C4'-P-C4' energy: -82.616 flat angles P-C4'-P energy: -41.756 tors. eta vs tors. theta energy: -90.475 Dist. restrs. and SS energy: 8.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1577.466150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.466150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.134340 (E_RNA) where: Base-Base interactions energy: -1156.428 where: short stacking energy: -470.952 Base-Backbone interact. energy: -1.195 local terms energy: -467.511798 where: bonds (distance) C4'-P energy: -91.567 bonds (distance) P-C4' energy: -82.212 flat angles C4'-P-C4' energy: -97.053 flat angles P-C4'-P energy: -62.594 tors. eta vs tors. theta energy: -134.086 Dist. restrs. and SS energy: 10.918 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1624.370140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.370140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.875236 (E_RNA) where: Base-Base interactions energy: -1170.601 where: short stacking energy: -493.407 Base-Backbone interact. energy: -0.365 local terms energy: -491.909046 where: bonds (distance) C4'-P energy: -86.514 bonds (distance) P-C4' energy: -91.201 flat angles C4'-P-C4' energy: -105.267 flat angles P-C4'-P energy: -75.860 tors. eta vs tors. theta energy: -133.067 Dist. restrs. and SS energy: 1.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1539.770526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.770526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.673882 (E_RNA) where: Base-Base interactions energy: -1121.861 where: short stacking energy: -472.476 Base-Backbone interact. energy: -1.130 local terms energy: -454.682937 where: bonds (distance) C4'-P energy: -80.075 bonds (distance) P-C4' energy: -88.088 flat angles C4'-P-C4' energy: -107.192 flat angles P-C4'-P energy: -60.354 tors. eta vs tors. theta energy: -118.974 Dist. restrs. and SS energy: 1.153 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1515.722586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.722586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.457410 (E_RNA) where: Base-Base interactions energy: -1100.479 where: short stacking energy: -445.019 Base-Backbone interact. energy: -0.049 local terms energy: -455.929110 where: bonds (distance) C4'-P energy: -88.938 bonds (distance) P-C4' energy: -82.063 flat angles C4'-P-C4' energy: -96.967 flat angles P-C4'-P energy: -63.758 tors. eta vs tors. theta energy: -124.203 Dist. restrs. and SS energy: 3.985 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1437.333993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.333993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.234709 (E_RNA) where: Base-Base interactions energy: -1035.380 where: short stacking energy: -429.853 Base-Backbone interact. energy: -2.178 local terms energy: -447.677083 where: bonds (distance) C4'-P energy: -77.178 bonds (distance) P-C4' energy: -88.992 flat angles C4'-P-C4' energy: -97.387 flat angles P-C4'-P energy: -52.081 tors. eta vs tors. theta energy: -132.038 Dist. restrs. and SS energy: 11.151 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1404.340346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.340346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.358282 (E_RNA) where: Base-Base interactions energy: -1019.864 where: short stacking energy: -442.319 Base-Backbone interact. energy: -0.547 local terms energy: -423.947209 where: bonds (distance) C4'-P energy: -75.152 bonds (distance) P-C4' energy: -80.250 flat angles C4'-P-C4' energy: -92.653 flat angles P-C4'-P energy: -60.547 tors. eta vs tors. theta energy: -115.345 Dist. restrs. and SS energy: 3.268 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1353.230519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.230519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.768143 (E_RNA) where: Base-Base interactions energy: -1019.137 where: short stacking energy: -411.186 Base-Backbone interact. energy: 0.871 local terms energy: -381.502404 where: bonds (distance) C4'-P energy: -70.499 bonds (distance) P-C4' energy: -73.092 flat angles C4'-P-C4' energy: -89.908 flat angles P-C4'-P energy: -49.595 tors. eta vs tors. theta energy: -98.408 Dist. restrs. and SS energy: 9.788 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1279.258664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.258664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.252071 (E_RNA) where: Base-Base interactions energy: -927.572 where: short stacking energy: -377.301 Base-Backbone interact. energy: -0.978 local terms energy: -400.701229 where: bonds (distance) C4'-P energy: -68.793 bonds (distance) P-C4' energy: -80.307 flat angles C4'-P-C4' energy: -79.431 flat angles P-C4'-P energy: -65.833 tors. eta vs tors. theta energy: -106.337 Dist. restrs. and SS energy: 13.243 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -1287.028386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.028386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.760664 (E_RNA) where: Base-Base interactions energy: -955.626 where: short stacking energy: -396.144 Base-Backbone interact. energy: -1.885 local terms energy: -377.249414 where: bonds (distance) C4'-P energy: -65.426 bonds (distance) P-C4' energy: -66.309 flat angles C4'-P-C4' energy: -83.333 flat angles P-C4'-P energy: -55.976 tors. eta vs tors. theta energy: -106.204 Dist. restrs. and SS energy: 10.982 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -1206.503655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.503655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.574000 (E_RNA) where: Base-Base interactions energy: -881.259 where: short stacking energy: -340.323 Base-Backbone interact. energy: -3.363 local terms energy: -368.951387 where: bonds (distance) C4'-P energy: -72.685 bonds (distance) P-C4' energy: -78.127 flat angles C4'-P-C4' energy: -74.842 flat angles P-C4'-P energy: -53.672 tors. eta vs tors. theta energy: -89.626 Dist. restrs. and SS energy: 10.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1579.136912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.136912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.376177 (E_RNA) where: Base-Base interactions energy: -1168.130 where: short stacking energy: -474.951 Base-Backbone interact. energy: 0.974 local terms energy: -468.219693 where: bonds (distance) C4'-P energy: -83.486 bonds (distance) P-C4' energy: -91.125 flat angles C4'-P-C4' energy: -96.169 flat angles P-C4'-P energy: -70.930 tors. eta vs tors. theta energy: -126.509 Dist. restrs. and SS energy: 19.489 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1611.150713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1611.150713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.517125 (E_RNA) where: Base-Base interactions energy: -1161.894 where: short stacking energy: -476.139 Base-Backbone interact. energy: -1.006 local terms energy: -485.617879 where: bonds (distance) C4'-P energy: -91.001 bonds (distance) P-C4' energy: -94.098 flat angles C4'-P-C4' energy: -102.981 flat angles P-C4'-P energy: -64.757 tors. eta vs tors. theta energy: -132.781 Dist. restrs. and SS energy: 0.616 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1559.787032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.787032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.456719 (E_RNA) where: Base-Base interactions energy: -1125.366 where: short stacking energy: -470.921 Base-Backbone interact. energy: 1.299 local terms energy: -473.390504 where: bonds (distance) C4'-P energy: -92.668 bonds (distance) P-C4' energy: -83.243 flat angles C4'-P-C4' energy: -103.716 flat angles P-C4'-P energy: -72.206 tors. eta vs tors. theta energy: -121.557 Dist. restrs. and SS energy: 0.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1519.477483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.477483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.321703 (E_RNA) where: Base-Base interactions energy: -1095.885 where: short stacking energy: -462.738 Base-Backbone interact. energy: -2.008 local terms energy: -460.428348 where: bonds (distance) C4'-P energy: -83.562 bonds (distance) P-C4' energy: -91.947 flat angles C4'-P-C4' energy: -95.214 flat angles P-C4'-P energy: -67.755 tors. eta vs tors. theta energy: -121.952 Dist. restrs. and SS energy: 2.094 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1455.858225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.858225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.049138 (E_RNA) where: Base-Base interactions energy: -1066.883 where: short stacking energy: -437.995 Base-Backbone interact. energy: 1.847 local terms energy: -431.012858 where: bonds (distance) C4'-P energy: -82.710 bonds (distance) P-C4' energy: -69.045 flat angles C4'-P-C4' energy: -93.708 flat angles P-C4'-P energy: -63.442 tors. eta vs tors. theta energy: -122.109 Dist. restrs. and SS energy: 3.441 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1386.525121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.525121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.876823 (E_RNA) where: Base-Base interactions energy: -1001.296 where: short stacking energy: -432.718 Base-Backbone interact. energy: -0.354 local terms energy: -437.226934 where: bonds (distance) C4'-P energy: -85.806 bonds (distance) P-C4' energy: -88.973 flat angles C4'-P-C4' energy: -95.250 flat angles P-C4'-P energy: -50.152 tors. eta vs tors. theta energy: -117.046 Dist. restrs. and SS energy: 15.602 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1291.739635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.739635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.455956 (E_RNA) where: Base-Base interactions energy: -958.528 where: short stacking energy: -404.105 Base-Backbone interact. energy: -0.640 local terms energy: -380.287879 where: bonds (distance) C4'-P energy: -70.922 bonds (distance) P-C4' energy: -67.626 flat angles C4'-P-C4' energy: -93.989 flat angles P-C4'-P energy: -44.386 tors. eta vs tors. theta energy: -103.365 Dist. restrs. and SS energy: 10.966 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1286.934473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.934473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.906630 (E_RNA) where: Base-Base interactions energy: -951.199 where: short stacking energy: -376.234 Base-Backbone interact. energy: 1.755 local terms energy: -384.462155 where: bonds (distance) C4'-P energy: -69.315 bonds (distance) P-C4' energy: -73.238 flat angles C4'-P-C4' energy: -87.997 flat angles P-C4'-P energy: -54.091 tors. eta vs tors. theta energy: -99.822 Dist. restrs. and SS energy: 10.222 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1319.636306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.636306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.744182 (E_RNA) where: Base-Base interactions energy: -1001.108 where: short stacking energy: -414.432 Base-Backbone interact. energy: 3.748 local terms energy: -372.383977 where: bonds (distance) C4'-P energy: -82.112 bonds (distance) P-C4' energy: -52.281 flat angles C4'-P-C4' energy: -79.541 flat angles P-C4'-P energy: -48.051 tors. eta vs tors. theta energy: -110.399 Dist. restrs. and SS energy: 13.358 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -1268.536809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.536809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.205545 (E_RNA) where: Base-Base interactions energy: -949.009 where: short stacking energy: -382.614 Base-Backbone interact. energy: -2.410 local terms energy: -358.787203 where: bonds (distance) C4'-P energy: -58.579 bonds (distance) P-C4' energy: -82.261 flat angles C4'-P-C4' energy: -79.265 flat angles P-C4'-P energy: -33.202 tors. eta vs tors. theta energy: -105.481 Dist. restrs. and SS energy: 4.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1608.901911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.901911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.622268 (E_RNA) where: Base-Base interactions energy: -1183.546 where: short stacking energy: -480.210 Base-Backbone interact. energy: 2.422 local terms energy: -474.498796 where: bonds (distance) C4'-P energy: -78.973 bonds (distance) P-C4' energy: -88.385 flat angles C4'-P-C4' energy: -107.797 flat angles P-C4'-P energy: -67.096 tors. eta vs tors. theta energy: -132.248 Dist. restrs. and SS energy: 9.970 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1607.746559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.746559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.131018 (E_RNA) where: Base-Base interactions energy: -1160.715 where: short stacking energy: -499.052 Base-Backbone interact. energy: -1.551 local terms energy: -483.865973 where: bonds (distance) C4'-P energy: -82.099 bonds (distance) P-C4' energy: -91.393 flat angles C4'-P-C4' energy: -106.814 flat angles P-C4'-P energy: -71.950 tors. eta vs tors. theta energy: -131.610 Dist. restrs. and SS energy: 1.634 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1549.714265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.714265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.801158 (E_RNA) where: Base-Base interactions energy: -1146.498 where: short stacking energy: -464.441 Base-Backbone interact. energy: -3.409 local terms energy: -437.893366 where: bonds (distance) C4'-P energy: -83.591 bonds (distance) P-C4' energy: -84.461 flat angles C4'-P-C4' energy: -95.311 flat angles P-C4'-P energy: -62.371 tors. eta vs tors. theta energy: -112.160 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1528.297876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.297876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.380833 (E_RNA) where: Base-Base interactions energy: -1098.143 where: short stacking energy: -464.346 Base-Backbone interact. energy: -0.981 local terms energy: -470.256144 where: bonds (distance) C4'-P energy: -97.105 bonds (distance) P-C4' energy: -80.214 flat angles C4'-P-C4' energy: -103.392 flat angles P-C4'-P energy: -65.929 tors. eta vs tors. theta energy: -123.616 Dist. restrs. and SS energy: 4.333 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1468.447992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.447992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.529009 (E_RNA) where: Base-Base interactions energy: -1057.200 where: short stacking energy: -431.200 Base-Backbone interact. energy: -3.014 local terms energy: -446.315752 where: bonds (distance) C4'-P energy: -81.548 bonds (distance) P-C4' energy: -85.790 flat angles C4'-P-C4' energy: -97.424 flat angles P-C4'-P energy: -65.213 tors. eta vs tors. theta energy: -116.342 Dist. restrs. and SS energy: 1.331 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1400.786503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.786503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.292852 (E_RNA) where: Base-Base interactions energy: -1021.602 where: short stacking energy: -415.258 Base-Backbone interact. energy: -2.979 local terms energy: -423.712485 where: bonds (distance) C4'-P energy: -80.727 bonds (distance) P-C4' energy: -86.326 flat angles C4'-P-C4' energy: -89.328 flat angles P-C4'-P energy: -46.959 tors. eta vs tors. theta energy: -120.373 Dist. restrs. and SS energy: 10.756 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1330.157145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.157145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.611185 (E_RNA) where: Base-Base interactions energy: -982.865 where: short stacking energy: -390.180 Base-Backbone interact. energy: 3.350 local terms energy: -398.095683 where: bonds (distance) C4'-P energy: -74.526 bonds (distance) P-C4' energy: -77.694 flat angles C4'-P-C4' energy: -94.847 flat angles P-C4'-P energy: -52.878 tors. eta vs tors. theta energy: -98.151 Dist. restrs. and SS energy: 10.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1363.523433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.523433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.741911 (E_RNA) where: Base-Base interactions energy: -1007.007 where: short stacking energy: -410.788 Base-Backbone interact. energy: -1.661 local terms energy: -406.074076 where: bonds (distance) C4'-P energy: -72.611 bonds (distance) P-C4' energy: -76.110 flat angles C4'-P-C4' energy: -95.850 flat angles P-C4'-P energy: -56.740 tors. eta vs tors. theta energy: -104.764 Dist. restrs. and SS energy: 14.468 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -1297.533361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.533361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.019909 (E_RNA) where: Base-Base interactions energy: -949.567 where: short stacking energy: -379.543 Base-Backbone interact. energy: -0.591 local terms energy: -397.861386 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -83.669 flat angles C4'-P-C4' energy: -77.923 flat angles P-C4'-P energy: -45.564 tors. eta vs tors. theta energy: -111.623 Dist. restrs. and SS energy: 13.737 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -1322.256985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.256985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.978005 (E_RNA) where: Base-Base interactions energy: -981.205 where: short stacking energy: -388.453 Base-Backbone interact. energy: -1.898 local terms energy: -379.875141 where: bonds (distance) C4'-P energy: -72.522 bonds (distance) P-C4' energy: -69.725 flat angles C4'-P-C4' energy: -71.385 flat angles P-C4'-P energy: -55.814 tors. eta vs tors. theta energy: -110.428 Dist. restrs. and SS energy: 3.971 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1650.912329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.912329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.626392 (E_RNA) where: Base-Base interactions energy: -1191.110 where: short stacking energy: -503.655 Base-Backbone interact. energy: 0.191 local terms energy: -497.707157 where: bonds (distance) C4'-P energy: -85.720 bonds (distance) P-C4' energy: -97.296 flat angles C4'-P-C4' energy: -100.582 flat angles P-C4'-P energy: -64.384 tors. eta vs tors. theta energy: -149.725 Dist. restrs. and SS energy: 0.964 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1577.046553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.046553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.661883 (E_RNA) where: Base-Base interactions energy: -1137.091 where: short stacking energy: -466.868 Base-Backbone interact. energy: -1.233 local terms energy: -486.337993 where: bonds (distance) C4'-P energy: -100.408 bonds (distance) P-C4' energy: -89.953 flat angles C4'-P-C4' energy: -100.665 flat angles P-C4'-P energy: -67.842 tors. eta vs tors. theta energy: -127.469 Dist. restrs. and SS energy: 10.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1593.172782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.172782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.794140 (E_RNA) where: Base-Base interactions energy: -1160.330 where: short stacking energy: -465.690 Base-Backbone interact. energy: -1.014 local terms energy: -469.449698 where: bonds (distance) C4'-P energy: -80.833 bonds (distance) P-C4' energy: -86.805 flat angles C4'-P-C4' energy: -107.021 flat angles P-C4'-P energy: -72.974 tors. eta vs tors. theta energy: -121.816 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1526.151135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1526.151135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.350154 (E_RNA) where: Base-Base interactions energy: -1115.128 where: short stacking energy: -446.160 Base-Backbone interact. energy: -1.326 local terms energy: -449.895515 where: bonds (distance) C4'-P energy: -76.759 bonds (distance) P-C4' energy: -82.182 flat angles C4'-P-C4' energy: -101.039 flat angles P-C4'-P energy: -65.899 tors. eta vs tors. theta energy: -124.016 Dist. restrs. and SS energy: 3.449 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1483.165998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.165998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.050167 (E_RNA) where: Base-Base interactions energy: -1064.250 where: short stacking energy: -442.550 Base-Backbone interact. energy: -2.934 local terms energy: -453.866243 where: bonds (distance) C4'-P energy: -75.924 bonds (distance) P-C4' energy: -96.730 flat angles C4'-P-C4' energy: -100.017 flat angles P-C4'-P energy: -60.545 tors. eta vs tors. theta energy: -120.650 Dist. restrs. and SS energy: 1.134 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1375.784741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.784741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.782612 (E_RNA) where: Base-Base interactions energy: -1011.719 where: short stacking energy: -409.116 Base-Backbone interact. energy: 3.164 local terms energy: -413.227513 where: bonds (distance) C4'-P energy: -74.772 bonds (distance) P-C4' energy: -79.980 flat angles C4'-P-C4' energy: -86.861 flat angles P-C4'-P energy: -57.886 tors. eta vs tors. theta energy: -113.729 Dist. restrs. and SS energy: 9.248 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1427.313406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.313406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.497318 (E_RNA) where: Base-Base interactions energy: -1035.993 where: short stacking energy: -448.667 Base-Backbone interact. energy: -0.759 local terms energy: -434.746000 where: bonds (distance) C4'-P energy: -85.113 bonds (distance) P-C4' energy: -79.191 flat angles C4'-P-C4' energy: -97.158 flat angles P-C4'-P energy: -51.574 tors. eta vs tors. theta energy: -121.709 Dist. restrs. and SS energy: 7.434 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1311.291215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1311.291215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.021220 (E_RNA) where: Base-Base interactions energy: -967.017 where: short stacking energy: -386.469 Base-Backbone interact. energy: -1.082 local terms energy: -393.922269 where: bonds (distance) C4'-P energy: -70.131 bonds (distance) P-C4' energy: -81.493 flat angles C4'-P-C4' energy: -90.580 flat angles P-C4'-P energy: -53.622 tors. eta vs tors. theta energy: -98.097 Dist. restrs. and SS energy: 13.980 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -1349.952520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.952520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.933126 (E_RNA) where: Base-Base interactions energy: -1000.775 where: short stacking energy: -395.492 Base-Backbone interact. energy: -1.563 local terms energy: -385.595415 where: bonds (distance) C4'-P energy: -71.848 bonds (distance) P-C4' energy: -77.731 flat angles C4'-P-C4' energy: -80.064 flat angles P-C4'-P energy: -50.752 tors. eta vs tors. theta energy: -105.200 Dist. restrs. and SS energy: 1.231 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -1262.947839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.947839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.704143 (E_RNA) where: Base-Base interactions energy: -947.974 where: short stacking energy: -375.530 Base-Backbone interact. energy: 0.638 local terms energy: -354.367608 where: bonds (distance) C4'-P energy: -49.457 bonds (distance) P-C4' energy: -71.886 flat angles C4'-P-C4' energy: -86.640 flat angles P-C4'-P energy: -48.706 tors. eta vs tors. theta energy: -97.679 Dist. restrs. and SS energy: 2.006 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1658.295292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.295292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.533862 (E_RNA) where: Base-Base interactions energy: -1184.029 where: short stacking energy: -492.394 Base-Backbone interact. energy: -1.508 local terms energy: -510.996481 where: bonds (distance) C4'-P energy: -94.540 bonds (distance) P-C4' energy: -100.391 flat angles C4'-P-C4' energy: -108.216 flat angles P-C4'-P energy: -68.119 tors. eta vs tors. theta energy: -139.730 Dist. restrs. and SS energy: 1.489 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1635.298313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.298313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.603848 (E_RNA) where: Base-Base interactions energy: -1218.797 where: short stacking energy: -487.618 Base-Backbone interact. energy: 0.827 local terms energy: -454.633601 where: bonds (distance) C4'-P energy: -68.998 bonds (distance) P-C4' energy: -98.687 flat angles C4'-P-C4' energy: -94.756 flat angles P-C4'-P energy: -70.931 tors. eta vs tors. theta energy: -121.262 Dist. restrs. and SS energy: 0.556 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1538.895550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.895550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.399130 (E_RNA) where: Base-Base interactions energy: -1121.355 where: short stacking energy: -442.730 Base-Backbone interact. energy: -2.408 local terms energy: -463.636184 where: bonds (distance) C4'-P energy: -95.162 bonds (distance) P-C4' energy: -88.463 flat angles C4'-P-C4' energy: -99.089 flat angles P-C4'-P energy: -56.801 tors. eta vs tors. theta energy: -124.122 Dist. restrs. and SS energy: 11.754 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1538.391460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.391460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.057290 (E_RNA) where: Base-Base interactions energy: -1113.999 where: short stacking energy: -471.290 Base-Backbone interact. energy: 0.527 local terms energy: -467.585004 where: bonds (distance) C4'-P energy: -85.601 bonds (distance) P-C4' energy: -92.940 flat angles C4'-P-C4' energy: -99.974 flat angles P-C4'-P energy: -60.178 tors. eta vs tors. theta energy: -128.892 Dist. restrs. and SS energy: 5.916 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1482.289001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.289001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.033842 (E_RNA) where: Base-Base interactions energy: -1078.045 where: short stacking energy: -456.049 Base-Backbone interact. energy: 2.707 local terms energy: -445.696489 where: bonds (distance) C4'-P energy: -79.741 bonds (distance) P-C4' energy: -82.443 flat angles C4'-P-C4' energy: -103.756 flat angles P-C4'-P energy: -58.813 tors. eta vs tors. theta energy: -120.944 Dist. restrs. and SS energy: 1.995 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1418.665707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.665707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.854077 (E_RNA) where: Base-Base interactions energy: -1030.316 where: short stacking energy: -423.243 Base-Backbone interact. energy: -0.532 local terms energy: -430.005953 where: bonds (distance) C4'-P energy: -87.100 bonds (distance) P-C4' energy: -91.465 flat angles C4'-P-C4' energy: -78.882 flat angles P-C4'-P energy: -62.706 tors. eta vs tors. theta energy: -109.852 Dist. restrs. and SS energy: 5.438 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1322.762011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.762011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.450492 (E_RNA) where: Base-Base interactions energy: -964.588 where: short stacking energy: -411.425 Base-Backbone interact. energy: -2.071 local terms energy: -409.791114 where: bonds (distance) C4'-P energy: -75.393 bonds (distance) P-C4' energy: -68.587 flat angles C4'-P-C4' energy: -99.784 flat angles P-C4'-P energy: -43.325 tors. eta vs tors. theta energy: -122.702 Dist. restrs. and SS energy: 16.938 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1408.668875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.668875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.984904 (E_RNA) where: Base-Base interactions energy: -1018.026 where: short stacking energy: -405.565 Base-Backbone interact. energy: -0.456 local terms energy: -428.502527 where: bonds (distance) C4'-P energy: -84.134 bonds (distance) P-C4' energy: -85.345 flat angles C4'-P-C4' energy: -91.490 flat angles P-C4'-P energy: -55.005 tors. eta vs tors. theta energy: -112.529 Dist. restrs. and SS energy: 1.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -1284.226481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.226481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.010114 (E_RNA) where: Base-Base interactions energy: -941.085 where: short stacking energy: -383.917 Base-Backbone interact. energy: -2.906 local terms energy: -389.019944 where: bonds (distance) C4'-P energy: -66.983 bonds (distance) P-C4' energy: -73.626 flat angles C4'-P-C4' energy: -93.382 flat angles P-C4'-P energy: -58.877 tors. eta vs tors. theta energy: -96.152 Dist. restrs. and SS energy: 12.034 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -1290.780649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.780649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.838236 (E_RNA) where: Base-Base interactions energy: -943.440 where: short stacking energy: -387.833 Base-Backbone interact. energy: -0.293 local terms energy: -386.105658 where: bonds (distance) C4'-P energy: -70.806 bonds (distance) P-C4' energy: -76.749 flat angles C4'-P-C4' energy: -76.792 flat angles P-C4'-P energy: -59.241 tors. eta vs tors. theta energy: -102.517 Dist. restrs. and SS energy: 2.308 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1686.265493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.265493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.357141 (E_RNA) where: Base-Base interactions energy: -1225.174 where: short stacking energy: -497.181 Base-Backbone interact. energy: -1.954 local terms energy: -497.229641 where: bonds (distance) C4'-P energy: -96.346 bonds (distance) P-C4' energy: -103.430 flat angles C4'-P-C4' energy: -98.267 flat angles P-C4'-P energy: -71.630 tors. eta vs tors. theta energy: -127.557 Dist. restrs. and SS energy: 1.342 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1636.254859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.254859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.740475 (E_RNA) where: Base-Base interactions energy: -1182.706 where: short stacking energy: -493.710 Base-Backbone interact. energy: -1.994 local terms energy: -490.040542 where: bonds (distance) C4'-P energy: -90.370 bonds (distance) P-C4' energy: -85.365 flat angles C4'-P-C4' energy: -109.450 flat angles P-C4'-P energy: -64.463 tors. eta vs tors. theta energy: -140.393 Dist. restrs. and SS energy: 1.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1576.230820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.230820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.740366 (E_RNA) where: Base-Base interactions energy: -1155.382 where: short stacking energy: -498.568 Base-Backbone interact. energy: 2.199 local terms energy: -464.557510 where: bonds (distance) C4'-P energy: -84.317 bonds (distance) P-C4' energy: -88.399 flat angles C4'-P-C4' energy: -95.295 flat angles P-C4'-P energy: -60.928 tors. eta vs tors. theta energy: -135.618 Dist. restrs. and SS energy: 4.760 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1545.458873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.458873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.158536 (E_RNA) where: Base-Base interactions energy: -1113.222 where: short stacking energy: -451.272 Base-Backbone interact. energy: -1.787 local terms energy: -471.149229 where: bonds (distance) C4'-P energy: -81.755 bonds (distance) P-C4' energy: -90.945 flat angles C4'-P-C4' energy: -99.147 flat angles P-C4'-P energy: -66.203 tors. eta vs tors. theta energy: -133.100 Dist. restrs. and SS energy: 3.950 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1505.560691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.560691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.492149 (E_RNA) where: Base-Base interactions energy: -1096.639 where: short stacking energy: -463.475 Base-Backbone interact. energy: -2.406 local terms energy: -445.447225 where: bonds (distance) C4'-P energy: -59.093 bonds (distance) P-C4' energy: -87.017 flat angles C4'-P-C4' energy: -105.926 flat angles P-C4'-P energy: -63.953 tors. eta vs tors. theta energy: -129.459 Dist. restrs. and SS energy: 2.181 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1394.044982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.044982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.361045 (E_RNA) where: Base-Base interactions energy: -1028.346 where: short stacking energy: -428.317 Base-Backbone interact. energy: -1.252 local terms energy: -409.763469 where: bonds (distance) C4'-P energy: -80.667 bonds (distance) P-C4' energy: -84.336 flat angles C4'-P-C4' energy: -87.833 flat angles P-C4'-P energy: -39.825 tors. eta vs tors. theta energy: -117.102 Dist. restrs. and SS energy: 8.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1407.812137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.812137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.346268 (E_RNA) where: Base-Base interactions energy: -1021.021 where: short stacking energy: -426.251 Base-Backbone interact. energy: 2.122 local terms energy: -427.446619 where: bonds (distance) C4'-P energy: -81.847 bonds (distance) P-C4' energy: -86.000 flat angles C4'-P-C4' energy: -86.360 flat angles P-C4'-P energy: -53.109 tors. eta vs tors. theta energy: -120.130 Dist. restrs. and SS energy: 1.784 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1300.051143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.051143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.436984 (E_RNA) where: Base-Base interactions energy: -937.866 where: short stacking energy: -370.480 Base-Backbone interact. energy: 1.695 local terms energy: -411.266472 where: bonds (distance) C4'-P energy: -73.175 bonds (distance) P-C4' energy: -86.415 flat angles C4'-P-C4' energy: -87.117 flat angles P-C4'-P energy: -49.750 tors. eta vs tors. theta energy: -114.810 Dist. restrs. and SS energy: 10.636 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -1370.036565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.036565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.720168 (E_RNA) where: Base-Base interactions energy: -995.128 where: short stacking energy: -395.033 Base-Backbone interact. energy: 0.595 local terms energy: -414.187992 where: bonds (distance) C4'-P energy: -69.901 bonds (distance) P-C4' energy: -88.725 flat angles C4'-P-C4' energy: -89.003 flat angles P-C4'-P energy: -61.993 tors. eta vs tors. theta energy: -104.567 Dist. restrs. and SS energy: 1.934 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -1263.272011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.272011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.585384 (E_RNA) where: Base-Base interactions energy: -923.993 where: short stacking energy: -373.991 Base-Backbone interact. energy: 0.014 local terms energy: -392.606808 where: bonds (distance) C4'-P energy: -62.522 bonds (distance) P-C4' energy: -75.340 flat angles C4'-P-C4' energy: -90.759 flat angles P-C4'-P energy: -61.332 tors. eta vs tors. theta energy: -102.653 Dist. restrs. and SS energy: 16.563 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1662.426698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.426698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.373518 (E_RNA) where: Base-Base interactions energy: -1219.665 where: short stacking energy: -493.401 Base-Backbone interact. energy: -0.127 local terms energy: -480.581464 where: bonds (distance) C4'-P energy: -89.638 bonds (distance) P-C4' energy: -85.182 flat angles C4'-P-C4' energy: -106.004 flat angles P-C4'-P energy: -70.635 tors. eta vs tors. theta energy: -129.123 Dist. restrs. and SS energy: 1.197 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1650.863298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.863298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.347795 (E_RNA) where: Base-Base interactions energy: -1186.157 where: short stacking energy: -489.851 Base-Backbone interact. energy: 0.231 local terms energy: -502.422145 where: bonds (distance) C4'-P energy: -94.060 bonds (distance) P-C4' energy: -95.220 flat angles C4'-P-C4' energy: -102.464 flat angles P-C4'-P energy: -72.929 tors. eta vs tors. theta energy: -137.749 Dist. restrs. and SS energy: 0.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1588.463497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.463497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.618297 (E_RNA) where: Base-Base interactions energy: -1179.097 where: short stacking energy: -482.291 Base-Backbone interact. energy: -1.848 local terms energy: -448.673100 where: bonds (distance) C4'-P energy: -67.018 bonds (distance) P-C4' energy: -84.835 flat angles C4'-P-C4' energy: -93.087 flat angles P-C4'-P energy: -64.768 tors. eta vs tors. theta energy: -138.965 Dist. restrs. and SS energy: 4.405 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1543.708265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.708265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.833641 (E_RNA) where: Base-Base interactions energy: -1090.096 where: short stacking energy: -451.745 Base-Backbone interact. energy: -1.385 local terms energy: -490.353079 where: bonds (distance) C4'-P energy: -88.781 bonds (distance) P-C4' energy: -88.293 flat angles C4'-P-C4' energy: -111.356 flat angles P-C4'-P energy: -73.159 tors. eta vs tors. theta energy: -128.764 Dist. restrs. and SS energy: 1.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1512.441540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.441540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.606065 (E_RNA) where: Base-Base interactions energy: -1107.889 where: short stacking energy: -465.022 Base-Backbone interact. energy: 1.946 local terms energy: -444.663256 where: bonds (distance) C4'-P energy: -74.250 bonds (distance) P-C4' energy: -87.722 flat angles C4'-P-C4' energy: -92.168 flat angles P-C4'-P energy: -62.376 tors. eta vs tors. theta energy: -128.147 Dist. restrs. and SS energy: 1.415 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1415.005557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.005557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.522258 (E_RNA) where: Base-Base interactions energy: -1033.155 where: short stacking energy: -426.452 Base-Backbone interact. energy: 1.699 local terms energy: -431.066408 where: bonds (distance) C4'-P energy: -81.143 bonds (distance) P-C4' energy: -74.831 flat angles C4'-P-C4' energy: -87.493 flat angles P-C4'-P energy: -67.143 tors. eta vs tors. theta energy: -120.456 Dist. restrs. and SS energy: 10.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1426.704607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.704607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.187874 (E_RNA) where: Base-Base interactions energy: -1062.394 where: short stacking energy: -449.952 Base-Backbone interact. energy: -0.887 local terms energy: -401.906996 where: bonds (distance) C4'-P energy: -73.439 bonds (distance) P-C4' energy: -72.826 flat angles C4'-P-C4' energy: -83.568 flat angles P-C4'-P energy: -49.004 tors. eta vs tors. theta energy: -123.071 Dist. restrs. and SS energy: 1.733 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1334.475640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.475640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.596907 (E_RNA) where: Base-Base interactions energy: -969.654 where: short stacking energy: -394.227 Base-Backbone interact. energy: -2.135 local terms energy: -408.807873 where: bonds (distance) C4'-P energy: -82.347 bonds (distance) P-C4' energy: -82.711 flat angles C4'-P-C4' energy: -90.464 flat angles P-C4'-P energy: -54.119 tors. eta vs tors. theta energy: -99.167 Dist. restrs. and SS energy: 9.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1339.047519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.047519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.398736 (E_RNA) where: Base-Base interactions energy: -1001.223 where: short stacking energy: -403.595 Base-Backbone interact. energy: 4.303 local terms energy: -381.478591 where: bonds (distance) C4'-P energy: -62.626 bonds (distance) P-C4' energy: -60.567 flat angles C4'-P-C4' energy: -90.364 flat angles P-C4'-P energy: -57.142 tors. eta vs tors. theta energy: -110.780 Dist. restrs. and SS energy: 2.601 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -1252.289681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.289681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.896019 (E_RNA) where: Base-Base interactions energy: -932.083 where: short stacking energy: -378.599 Base-Backbone interact. energy: 2.538 local terms energy: -377.350509 where: bonds (distance) C4'-P energy: -66.406 bonds (distance) P-C4' energy: -72.864 flat angles C4'-P-C4' energy: -83.665 flat angles P-C4'-P energy: -49.671 tors. eta vs tors. theta energy: -104.745 Dist. restrs. and SS energy: 17.856 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1676.401256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.401256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.805718 (E_RNA) where: Base-Base interactions energy: -1217.353 where: short stacking energy: -493.874 Base-Backbone interact. energy: 0.403 local terms energy: -496.855731 where: bonds (distance) C4'-P energy: -89.050 bonds (distance) P-C4' energy: -100.177 flat angles C4'-P-C4' energy: -103.022 flat angles P-C4'-P energy: -69.828 tors. eta vs tors. theta energy: -134.780 Dist. restrs. and SS energy: 0.654 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1639.575741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.575741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.473046 (E_RNA) where: Base-Base interactions energy: -1179.614 where: short stacking energy: -507.344 Base-Backbone interact. energy: -0.773 local terms energy: -498.085989 where: bonds (distance) C4'-P energy: -87.739 bonds (distance) P-C4' energy: -93.609 flat angles C4'-P-C4' energy: -109.242 flat angles P-C4'-P energy: -68.081 tors. eta vs tors. theta energy: -139.414 Dist. restrs. and SS energy: 2.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1566.607201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.607201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.363984 (E_RNA) where: Base-Base interactions energy: -1119.057 where: short stacking energy: -467.178 Base-Backbone interact. energy: 0.417 local terms energy: -485.724542 where: bonds (distance) C4'-P energy: -87.775 bonds (distance) P-C4' energy: -88.863 flat angles C4'-P-C4' energy: -101.167 flat angles P-C4'-P energy: -81.045 tors. eta vs tors. theta energy: -126.875 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1535.120094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.120094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.631184 (E_RNA) where: Base-Base interactions energy: -1118.893 where: short stacking energy: -451.893 Base-Backbone interact. energy: -1.945 local terms energy: -455.792851 where: bonds (distance) C4'-P energy: -85.896 bonds (distance) P-C4' energy: -83.536 flat angles C4'-P-C4' energy: -106.929 flat angles P-C4'-P energy: -56.515 tors. eta vs tors. theta energy: -122.916 Dist. restrs. and SS energy: 4.761 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1500.930819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.930819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.729156 (E_RNA) where: Base-Base interactions energy: -1092.157 where: short stacking energy: -454.020 Base-Backbone interact. energy: -1.441 local terms energy: -446.131545 where: bonds (distance) C4'-P energy: -75.679 bonds (distance) P-C4' energy: -76.501 flat angles C4'-P-C4' energy: -103.931 flat angles P-C4'-P energy: -57.297 tors. eta vs tors. theta energy: -132.723 Dist. restrs. and SS energy: 2.048 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1426.824850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.824850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.877921 (E_RNA) where: Base-Base interactions energy: -1038.316 where: short stacking energy: -445.770 Base-Backbone interact. energy: 1.405 local terms energy: -435.966897 where: bonds (distance) C4'-P energy: -76.706 bonds (distance) P-C4' energy: -97.405 flat angles C4'-P-C4' energy: -88.023 flat angles P-C4'-P energy: -59.780 tors. eta vs tors. theta energy: -114.053 Dist. restrs. and SS energy: 9.303 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1402.501124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.501124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.039907 (E_RNA) where: Base-Base interactions energy: -1007.130 where: short stacking energy: -416.749 Base-Backbone interact. energy: -2.077 local terms energy: -431.832270 where: bonds (distance) C4'-P energy: -84.755 bonds (distance) P-C4' energy: -82.047 flat angles C4'-P-C4' energy: -89.829 flat angles P-C4'-P energy: -59.243 tors. eta vs tors. theta energy: -115.958 Dist. restrs. and SS energy: 1.789 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1369.663602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.663602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.573660 (E_RNA) where: Base-Base interactions energy: -999.575 where: short stacking energy: -421.561 Base-Backbone interact. energy: -0.213 local terms energy: -416.785380 where: bonds (distance) C4'-P energy: -71.652 bonds (distance) P-C4' energy: -80.257 flat angles C4'-P-C4' energy: -96.022 flat angles P-C4'-P energy: -54.485 tors. eta vs tors. theta energy: -114.370 Dist. restrs. and SS energy: 10.160 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1366.939265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.939265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.683793 (E_RNA) where: Base-Base interactions energy: -1004.920 where: short stacking energy: -405.030 Base-Backbone interact. energy: -0.475 local terms energy: -399.288915 where: bonds (distance) C4'-P energy: -72.185 bonds (distance) P-C4' energy: -80.170 flat angles C4'-P-C4' energy: -87.575 flat angles P-C4'-P energy: -55.771 tors. eta vs tors. theta energy: -103.588 Dist. restrs. and SS energy: 0.995 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -1232.319877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.319877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.558685 (E_RNA) where: Base-Base interactions energy: -881.262 where: short stacking energy: -373.848 Base-Backbone interact. energy: -0.416 local terms energy: -395.880517 where: bonds (distance) C4'-P energy: -67.133 bonds (distance) P-C4' energy: -78.348 flat angles C4'-P-C4' energy: -90.821 flat angles P-C4'-P energy: -54.419 tors. eta vs tors. theta energy: -105.159 Dist. restrs. and SS energy: 8.489 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1702.047335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.047335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.552139 (E_RNA) where: Base-Base interactions energy: -1238.046 where: short stacking energy: -508.855 Base-Backbone interact. energy: -0.646 local terms energy: -500.860355 where: bonds (distance) C4'-P energy: -102.475 bonds (distance) P-C4' energy: -87.971 flat angles C4'-P-C4' energy: -104.748 flat angles P-C4'-P energy: -63.935 tors. eta vs tors. theta energy: -141.731 Dist. restrs. and SS energy: 0.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1647.318997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.318997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.645696 (E_RNA) where: Base-Base interactions energy: -1171.948 where: short stacking energy: -496.355 Base-Backbone interact. energy: -0.941 local terms energy: -512.756909 where: bonds (distance) C4'-P energy: -95.182 bonds (distance) P-C4' energy: -95.567 flat angles C4'-P-C4' energy: -107.152 flat angles P-C4'-P energy: -73.190 tors. eta vs tors. theta energy: -141.666 Dist. restrs. and SS energy: 1.577 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1588.312017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.312017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.826607 (E_RNA) where: Base-Base interactions energy: -1144.961 where: short stacking energy: -486.110 Base-Backbone interact. energy: -2.009 local terms energy: -478.857072 where: bonds (distance) C4'-P energy: -86.400 bonds (distance) P-C4' energy: -92.409 flat angles C4'-P-C4' energy: -98.429 flat angles P-C4'-P energy: -76.781 tors. eta vs tors. theta energy: -124.838 Dist. restrs. and SS energy: 0.765 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1554.403900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.403900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.683501 (E_RNA) where: Base-Base interactions energy: -1138.897 where: short stacking energy: -463.972 Base-Backbone interact. energy: -1.617 local terms energy: -454.169675 where: bonds (distance) C4'-P energy: -87.256 bonds (distance) P-C4' energy: -83.098 flat angles C4'-P-C4' energy: -108.349 flat angles P-C4'-P energy: -53.385 tors. eta vs tors. theta energy: -122.081 Dist. restrs. and SS energy: 3.530 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1500.733236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.733236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.244937 (E_RNA) where: Base-Base interactions energy: -1090.260 where: short stacking energy: -458.133 Base-Backbone interact. energy: -1.852 local terms energy: -447.133661 where: bonds (distance) C4'-P energy: -79.586 bonds (distance) P-C4' energy: -84.440 flat angles C4'-P-C4' energy: -94.326 flat angles P-C4'-P energy: -63.241 tors. eta vs tors. theta energy: -125.541 Dist. restrs. and SS energy: 1.762 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1449.152988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.152988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.339745 (E_RNA) where: Base-Base interactions energy: -1039.145 where: short stacking energy: -435.051 Base-Backbone interact. energy: -2.034 local terms energy: -456.161218 where: bonds (distance) C4'-P energy: -91.687 bonds (distance) P-C4' energy: -72.453 flat angles C4'-P-C4' energy: -93.699 flat angles P-C4'-P energy: -71.622 tors. eta vs tors. theta energy: -126.700 Dist. restrs. and SS energy: 11.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1383.025017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.025017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.069184 (E_RNA) where: Base-Base interactions energy: -1002.257 where: short stacking energy: -403.349 Base-Backbone interact. energy: -1.617 local terms energy: -418.194750 where: bonds (distance) C4'-P energy: -74.950 bonds (distance) P-C4' energy: -64.141 flat angles C4'-P-C4' energy: -99.876 flat angles P-C4'-P energy: -71.446 tors. eta vs tors. theta energy: -107.782 Dist. restrs. and SS energy: 2.294 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1416.032061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.032061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.464649 (E_RNA) where: Base-Base interactions energy: -1051.523 where: short stacking energy: -432.523 Base-Backbone interact. energy: -0.150 local terms energy: -402.792160 where: bonds (distance) C4'-P energy: -88.710 bonds (distance) P-C4' energy: -73.457 flat angles C4'-P-C4' energy: -85.098 flat angles P-C4'-P energy: -43.287 tors. eta vs tors. theta energy: -112.240 Dist. restrs. and SS energy: 1.683 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1305.121515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.121515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.088563 (E_RNA) where: Base-Base interactions energy: -961.221 where: short stacking energy: -392.131 Base-Backbone interact. energy: -1.383 local terms energy: -391.484632 where: bonds (distance) C4'-P energy: -82.466 bonds (distance) P-C4' energy: -66.808 flat angles C4'-P-C4' energy: -83.930 flat angles P-C4'-P energy: -56.781 tors. eta vs tors. theta energy: -101.499 Dist. restrs. and SS energy: 12.217 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -1268.234608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.234608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.647067 (E_RNA) where: Base-Base interactions energy: -951.068 where: short stacking energy: -372.738 Base-Backbone interact. energy: 2.087 local terms energy: -368.666137 where: bonds (distance) C4'-P energy: -70.869 bonds (distance) P-C4' energy: -54.029 flat angles C4'-P-C4' energy: -89.391 flat angles P-C4'-P energy: -50.867 tors. eta vs tors. theta energy: -103.512 Dist. restrs. and SS energy: 12.662 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1691.482003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.482003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.344869 (E_RNA) where: Base-Base interactions energy: -1217.712 where: short stacking energy: -508.490 Base-Backbone interact. energy: -1.236 local terms energy: -510.397157 where: bonds (distance) C4'-P energy: -92.267 bonds (distance) P-C4' energy: -95.575 flat angles C4'-P-C4' energy: -106.167 flat angles P-C4'-P energy: -74.046 tors. eta vs tors. theta energy: -142.341 Dist. restrs. and SS energy: 1.113 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1650.375643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.375643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.167190 (E_RNA) where: Base-Base interactions energy: -1177.316 where: short stacking energy: -490.545 Base-Backbone interact. energy: -2.355 local terms energy: -508.496126 where: bonds (distance) C4'-P energy: -86.625 bonds (distance) P-C4' energy: -95.657 flat angles C4'-P-C4' energy: -111.011 flat angles P-C4'-P energy: -73.242 tors. eta vs tors. theta energy: -141.960 Dist. restrs. and SS energy: 1.042 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1575.648494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.648494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.695048 (E_RNA) where: Base-Base interactions energy: -1143.683 where: short stacking energy: -477.985 Base-Backbone interact. energy: -1.251 local terms energy: -470.761419 where: bonds (distance) C4'-P energy: -90.189 bonds (distance) P-C4' energy: -87.091 flat angles C4'-P-C4' energy: -98.987 flat angles P-C4'-P energy: -71.099 tors. eta vs tors. theta energy: -123.396 Dist. restrs. and SS energy: 3.297 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1576.704727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.704727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.919293 (E_RNA) where: Base-Base interactions energy: -1149.124 where: short stacking energy: -485.863 Base-Backbone interact. energy: 2.821 local terms energy: -467.615746 where: bonds (distance) C4'-P energy: -86.379 bonds (distance) P-C4' energy: -85.621 flat angles C4'-P-C4' energy: -98.926 flat angles P-C4'-P energy: -72.737 tors. eta vs tors. theta energy: -123.953 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1511.311278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.311278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1549.579776 (E_RNA) where: Base-Base interactions energy: -1100.932 where: short stacking energy: -441.336 Base-Backbone interact. energy: 1.300 local terms energy: -449.947298 where: bonds (distance) C4'-P energy: -77.177 bonds (distance) P-C4' energy: -85.780 flat angles C4'-P-C4' energy: -102.435 flat angles P-C4'-P energy: -64.413 tors. eta vs tors. theta energy: -120.143 Dist. restrs. and SS energy: 1.518 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1439.629845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.629845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.880190 (E_RNA) where: Base-Base interactions energy: -1044.482 where: short stacking energy: -436.815 Base-Backbone interact. energy: -0.682 local terms energy: -437.716204 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -76.328 flat angles C4'-P-C4' energy: -93.953 flat angles P-C4'-P energy: -63.921 tors. eta vs tors. theta energy: -124.430 Dist. restrs. and SS energy: 6.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1401.146194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.146194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.557570 (E_RNA) where: Base-Base interactions energy: -1015.673 where: short stacking energy: -420.224 Base-Backbone interact. energy: -0.819 local terms energy: -423.065731 where: bonds (distance) C4'-P energy: -77.816 bonds (distance) P-C4' energy: -86.566 flat angles C4'-P-C4' energy: -81.073 flat angles P-C4'-P energy: -63.979 tors. eta vs tors. theta energy: -113.632 Dist. restrs. and SS energy: 1.661 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1428.207111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.207111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.353747 (E_RNA) where: Base-Base interactions energy: -1048.813 where: short stacking energy: -457.876 Base-Backbone interact. energy: -0.363 local terms energy: -421.177953 where: bonds (distance) C4'-P energy: -78.607 bonds (distance) P-C4' energy: -67.495 flat angles C4'-P-C4' energy: -80.953 flat angles P-C4'-P energy: -61.096 tors. eta vs tors. theta energy: -133.026 Dist. restrs. and SS energy: 5.397 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1301.779250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.779250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1349.222522 (E_RNA) where: Base-Base interactions energy: -941.908 where: short stacking energy: -359.316 Base-Backbone interact. energy: 1.156 local terms energy: -408.470221 where: bonds (distance) C4'-P energy: -87.440 bonds (distance) P-C4' energy: -77.115 flat angles C4'-P-C4' energy: -81.539 flat angles P-C4'-P energy: -55.343 tors. eta vs tors. theta energy: -107.034 Dist. restrs. and SS energy: 10.693 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -1246.965399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.965399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.333510 (E_RNA) where: Base-Base interactions energy: -915.301 where: short stacking energy: -356.971 Base-Backbone interact. energy: -3.292 local terms energy: -374.740845 where: bonds (distance) C4'-P energy: -83.913 bonds (distance) P-C4' energy: -66.753 flat angles C4'-P-C4' energy: -82.821 flat angles P-C4'-P energy: -43.092 tors. eta vs tors. theta energy: -98.161 Dist. restrs. and SS energy: 9.618 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1697.391984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.391984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.104980 (E_RNA) where: Base-Base interactions energy: -1229.846 where: short stacking energy: -523.666 Base-Backbone interact. energy: -1.923 local terms energy: -504.335132 where: bonds (distance) C4'-P energy: -90.749 bonds (distance) P-C4' energy: -98.465 flat angles C4'-P-C4' energy: -101.848 flat angles P-C4'-P energy: -71.119 tors. eta vs tors. theta energy: -142.153 Dist. restrs. and SS energy: 1.963 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1639.450639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.450639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.795733 (E_RNA) where: Base-Base interactions energy: -1178.995 where: short stacking energy: -495.624 Base-Backbone interact. energy: -1.381 local terms energy: -497.418819 where: bonds (distance) C4'-P energy: -95.632 bonds (distance) P-C4' energy: -91.317 flat angles C4'-P-C4' energy: -109.122 flat angles P-C4'-P energy: -67.402 tors. eta vs tors. theta energy: -133.946 Dist. restrs. and SS energy: 1.595 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1604.638108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.638108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.585966 (E_RNA) where: Base-Base interactions energy: -1154.982 where: short stacking energy: -466.467 Base-Backbone interact. energy: -1.423 local terms energy: -488.181453 where: bonds (distance) C4'-P energy: -91.562 bonds (distance) P-C4' energy: -85.784 flat angles C4'-P-C4' energy: -100.239 flat angles P-C4'-P energy: -76.732 tors. eta vs tors. theta energy: -133.865 Dist. restrs. and SS energy: 3.198 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1557.910787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.910787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.212763 (E_RNA) where: Base-Base interactions energy: -1112.405 where: short stacking energy: -459.817 Base-Backbone interact. energy: 0.883 local terms energy: -484.689982 where: bonds (distance) C4'-P energy: -85.030 bonds (distance) P-C4' energy: -95.353 flat angles C4'-P-C4' energy: -101.765 flat angles P-C4'-P energy: -74.733 tors. eta vs tors. theta energy: -127.809 Dist. restrs. and SS energy: 1.552 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1510.862981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.862981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.675809 (E_RNA) where: Base-Base interactions energy: -1096.106 where: short stacking energy: -465.986 Base-Backbone interact. energy: 0.732 local terms energy: -453.301711 where: bonds (distance) C4'-P energy: -79.369 bonds (distance) P-C4' energy: -82.875 flat angles C4'-P-C4' energy: -95.480 flat angles P-C4'-P energy: -68.252 tors. eta vs tors. theta energy: -127.325 Dist. restrs. and SS energy: 1.063 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1448.951301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.951301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.858029 (E_RNA) where: Base-Base interactions energy: -1049.405 where: short stacking energy: -444.129 Base-Backbone interact. energy: -1.192 local terms energy: -437.260283 where: bonds (distance) C4'-P energy: -74.998 bonds (distance) P-C4' energy: -77.922 flat angles C4'-P-C4' energy: -106.463 flat angles P-C4'-P energy: -53.607 tors. eta vs tors. theta energy: -124.270 Dist. restrs. and SS energy: 2.157 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1377.340665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.340665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.701283 (E_RNA) where: Base-Base interactions energy: -1022.459 where: short stacking energy: -426.063 Base-Backbone interact. energy: -2.530 local terms energy: -397.711894 where: bonds (distance) C4'-P energy: -73.917 bonds (distance) P-C4' energy: -67.603 flat angles C4'-P-C4' energy: -81.029 flat angles P-C4'-P energy: -58.453 tors. eta vs tors. theta energy: -116.710 Dist. restrs. and SS energy: 8.611 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1384.592605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.592605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.284160 (E_RNA) where: Base-Base interactions energy: -1008.766 where: short stacking energy: -416.067 Base-Backbone interact. energy: -0.014 local terms energy: -413.504992 where: bonds (distance) C4'-P energy: -73.172 bonds (distance) P-C4' energy: -86.076 flat angles C4'-P-C4' energy: -81.135 flat angles P-C4'-P energy: -56.525 tors. eta vs tors. theta energy: -116.597 Dist. restrs. and SS energy: 0.942 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1298.326636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.326636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.402385 (E_RNA) where: Base-Base interactions energy: -972.120 where: short stacking energy: -380.739 Base-Backbone interact. energy: 5.653 local terms energy: -377.935636 where: bonds (distance) C4'-P energy: -75.302 bonds (distance) P-C4' energy: -74.906 flat angles C4'-P-C4' energy: -93.650 flat angles P-C4'-P energy: -42.255 tors. eta vs tors. theta energy: -91.823 Dist. restrs. and SS energy: 9.326 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -1270.317091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.317091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.200968 (E_RNA) where: Base-Base interactions energy: -907.216 where: short stacking energy: -370.243 Base-Backbone interact. energy: -2.446 local terms energy: -411.538932 where: bonds (distance) C4'-P energy: -77.340 bonds (distance) P-C4' energy: -74.899 flat angles C4'-P-C4' energy: -89.447 flat angles P-C4'-P energy: -52.309 tors. eta vs tors. theta energy: -117.544 Dist. restrs. and SS energy: 14.134 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1686.300207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.300207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1723.787250 (E_RNA) where: Base-Base interactions energy: -1201.901 where: short stacking energy: -495.081 Base-Backbone interact. energy: -1.733 local terms energy: -520.152996 where: bonds (distance) C4'-P energy: -90.597 bonds (distance) P-C4' energy: -89.632 flat angles C4'-P-C4' energy: -117.668 flat angles P-C4'-P energy: -83.490 tors. eta vs tors. theta energy: -138.766 Dist. restrs. and SS energy: 0.737 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1645.921601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.921601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.583738 (E_RNA) where: Base-Base interactions energy: -1222.681 where: short stacking energy: -501.871 Base-Backbone interact. energy: -1.680 local terms energy: -459.222570 where: bonds (distance) C4'-P energy: -76.961 bonds (distance) P-C4' energy: -87.839 flat angles C4'-P-C4' energy: -102.161 flat angles P-C4'-P energy: -58.909 tors. eta vs tors. theta energy: -133.353 Dist. restrs. and SS energy: 0.912 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1605.794659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.794659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.395265 (E_RNA) where: Base-Base interactions energy: -1148.739 where: short stacking energy: -477.887 Base-Backbone interact. energy: -1.666 local terms energy: -493.990322 where: bonds (distance) C4'-P energy: -87.072 bonds (distance) P-C4' energy: -97.425 flat angles C4'-P-C4' energy: -95.660 flat angles P-C4'-P energy: -71.226 tors. eta vs tors. theta energy: -142.608 Dist. restrs. and SS energy: 1.851 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1565.266157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.266157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.460917 (E_RNA) where: Base-Base interactions energy: -1153.230 where: short stacking energy: -482.233 Base-Backbone interact. energy: 0.893 local terms energy: -453.124204 where: bonds (distance) C4'-P energy: -70.702 bonds (distance) P-C4' energy: -90.983 flat angles C4'-P-C4' energy: -92.478 flat angles P-C4'-P energy: -71.362 tors. eta vs tors. theta energy: -127.600 Dist. restrs. and SS energy: 3.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1479.751812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.751812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.236206 (E_RNA) where: Base-Base interactions energy: -1071.786 where: short stacking energy: -440.779 Base-Backbone interact. energy: -0.264 local terms energy: -446.186682 where: bonds (distance) C4'-P energy: -81.931 bonds (distance) P-C4' energy: -90.859 flat angles C4'-P-C4' energy: -85.061 flat angles P-C4'-P energy: -65.816 tors. eta vs tors. theta energy: -122.519 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1482.211706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.211706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.018077 (E_RNA) where: Base-Base interactions energy: -1046.821 where: short stacking energy: -441.736 Base-Backbone interact. energy: -0.237 local terms energy: -472.959945 where: bonds (distance) C4'-P energy: -90.316 bonds (distance) P-C4' energy: -95.957 flat angles C4'-P-C4' energy: -98.471 flat angles P-C4'-P energy: -66.554 tors. eta vs tors. theta energy: -121.662 Dist. restrs. and SS energy: 1.056 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1363.571579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.571579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.739253 (E_RNA) where: Base-Base interactions energy: -1027.721 where: short stacking energy: -403.003 Base-Backbone interact. energy: 1.821 local terms energy: -382.838345 where: bonds (distance) C4'-P energy: -72.473 bonds (distance) P-C4' energy: -78.714 flat angles C4'-P-C4' energy: -81.109 flat angles P-C4'-P energy: -48.887 tors. eta vs tors. theta energy: -101.656 Dist. restrs. and SS energy: 8.418 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1379.378476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.378476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.827659 (E_RNA) where: Base-Base interactions energy: -1023.358 where: short stacking energy: -421.330 Base-Backbone interact. energy: -0.823 local terms energy: -394.646490 where: bonds (distance) C4'-P energy: -65.612 bonds (distance) P-C4' energy: -64.466 flat angles C4'-P-C4' energy: -89.434 flat angles P-C4'-P energy: -60.704 tors. eta vs tors. theta energy: -114.431 Dist. restrs. and SS energy: 2.699 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1286.734215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.734215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.973800 (E_RNA) where: Base-Base interactions energy: -968.503 where: short stacking energy: -401.273 Base-Backbone interact. energy: 0.441 local terms energy: -358.911858 where: bonds (distance) C4'-P energy: -65.516 bonds (distance) P-C4' energy: -62.444 flat angles C4'-P-C4' energy: -70.320 flat angles P-C4'-P energy: -57.716 tors. eta vs tors. theta energy: -102.916 Dist. restrs. and SS energy: 3.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -1247.057860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.057860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.638068 (E_RNA) where: Base-Base interactions energy: -925.680 where: short stacking energy: -358.042 Base-Backbone interact. energy: 0.070 local terms energy: -368.029040 where: bonds (distance) C4'-P energy: -70.886 bonds (distance) P-C4' energy: -66.782 flat angles C4'-P-C4' energy: -77.067 flat angles P-C4'-P energy: -57.733 tors. eta vs tors. theta energy: -95.560 Dist. restrs. and SS energy: 9.830 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1673.804658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.804658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.047373 (E_RNA) where: Base-Base interactions energy: -1200.665 where: short stacking energy: -511.790 Base-Backbone interact. energy: -1.352 local terms energy: -510.030711 where: bonds (distance) C4'-P energy: -96.936 bonds (distance) P-C4' energy: -95.657 flat angles C4'-P-C4' energy: -106.514 flat angles P-C4'-P energy: -69.913 tors. eta vs tors. theta energy: -141.012 Dist. restrs. and SS energy: 1.493 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1654.175839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.175839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.429696 (E_RNA) where: Base-Base interactions energy: -1209.390 where: short stacking energy: -494.512 Base-Backbone interact. energy: 1.179 local terms energy: -483.218799 where: bonds (distance) C4'-P energy: -90.230 bonds (distance) P-C4' energy: -84.869 flat angles C4'-P-C4' energy: -101.816 flat angles P-C4'-P energy: -70.470 tors. eta vs tors. theta energy: -135.833 Dist. restrs. and SS energy: 0.504 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1602.646536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.646536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.047136 (E_RNA) where: Base-Base interactions energy: -1150.278 where: short stacking energy: -487.808 Base-Backbone interact. energy: -2.449 local terms energy: -488.320355 where: bonds (distance) C4'-P energy: -87.601 bonds (distance) P-C4' energy: -98.498 flat angles C4'-P-C4' energy: -100.403 flat angles P-C4'-P energy: -66.129 tors. eta vs tors. theta energy: -135.690 Dist. restrs. and SS energy: 1.651 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1562.120621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.120621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.402734 (E_RNA) where: Base-Base interactions energy: -1150.147 where: short stacking energy: -471.183 Base-Backbone interact. energy: -1.011 local terms energy: -451.245279 where: bonds (distance) C4'-P energy: -79.718 bonds (distance) P-C4' energy: -84.329 flat angles C4'-P-C4' energy: -102.356 flat angles P-C4'-P energy: -60.477 tors. eta vs tors. theta energy: -124.365 Dist. restrs. and SS energy: 3.532 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1483.407702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.407702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.438465 (E_RNA) where: Base-Base interactions energy: -1079.332 where: short stacking energy: -444.184 Base-Backbone interact. energy: -1.424 local terms energy: -440.682057 where: bonds (distance) C4'-P energy: -79.697 bonds (distance) P-C4' energy: -80.113 flat angles C4'-P-C4' energy: -100.852 flat angles P-C4'-P energy: -62.827 tors. eta vs tors. theta energy: -117.193 Dist. restrs. and SS energy: 1.281 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1472.437529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.437529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.541026 (E_RNA) where: Base-Base interactions energy: -1059.148 where: short stacking energy: -414.005 Base-Backbone interact. energy: -1.357 local terms energy: -451.036733 where: bonds (distance) C4'-P energy: -88.595 bonds (distance) P-C4' energy: -96.072 flat angles C4'-P-C4' energy: -100.945 flat angles P-C4'-P energy: -56.343 tors. eta vs tors. theta energy: -109.082 Dist. restrs. and SS energy: 2.353 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1373.658822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.658822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.577303 (E_RNA) where: Base-Base interactions energy: -989.101 where: short stacking energy: -407.206 Base-Backbone interact. energy: 1.020 local terms energy: -430.496281 where: bonds (distance) C4'-P energy: -75.543 bonds (distance) P-C4' energy: -85.655 flat angles C4'-P-C4' energy: -94.535 flat angles P-C4'-P energy: -53.246 tors. eta vs tors. theta energy: -121.517 Dist. restrs. and SS energy: 8.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1392.007226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.007226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.977533 (E_RNA) where: Base-Base interactions energy: -1019.342 where: short stacking energy: -423.849 Base-Backbone interact. energy: -0.789 local terms energy: -409.846034 where: bonds (distance) C4'-P energy: -70.397 bonds (distance) P-C4' energy: -63.590 flat angles C4'-P-C4' energy: -98.102 flat angles P-C4'-P energy: -68.179 tors. eta vs tors. theta energy: -109.579 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1281.570209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.570209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.977786 (E_RNA) where: Base-Base interactions energy: -951.839 where: short stacking energy: -387.511 Base-Backbone interact. energy: 4.779 local terms energy: -377.917295 where: bonds (distance) C4'-P energy: -68.044 bonds (distance) P-C4' energy: -77.644 flat angles C4'-P-C4' energy: -75.454 flat angles P-C4'-P energy: -54.996 tors. eta vs tors. theta energy: -101.780 Dist. restrs. and SS energy: 6.658 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -1251.522738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.522738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.028029 (E_RNA) where: Base-Base interactions energy: -912.845 where: short stacking energy: -362.973 Base-Backbone interact. energy: -1.103 local terms energy: -381.079346 where: bonds (distance) C4'-P energy: -86.309 bonds (distance) P-C4' energy: -68.654 flat angles C4'-P-C4' energy: -72.692 flat angles P-C4'-P energy: -55.174 tors. eta vs tors. theta energy: -98.250 Dist. restrs. and SS energy: 6.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1677.366393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1677.366393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.625913 (E_RNA) where: Base-Base interactions energy: -1231.641 where: short stacking energy: -501.124 Base-Backbone interact. energy: 0.151 local terms energy: -483.136016 where: bonds (distance) C4'-P energy: -77.226 bonds (distance) P-C4' energy: -98.249 flat angles C4'-P-C4' energy: -103.155 flat angles P-C4'-P energy: -61.747 tors. eta vs tors. theta energy: -142.759 Dist. restrs. and SS energy: 0.510 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1639.797571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.797571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.159801 (E_RNA) where: Base-Base interactions energy: -1163.430 where: short stacking energy: -498.812 Base-Backbone interact. energy: -0.946 local terms energy: -513.784209 where: bonds (distance) C4'-P energy: -92.623 bonds (distance) P-C4' energy: -98.781 flat angles C4'-P-C4' energy: -110.258 flat angles P-C4'-P energy: -67.447 tors. eta vs tors. theta energy: -144.675 Dist. restrs. and SS energy: 1.612 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1622.272446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1622.272446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.513817 (E_RNA) where: Base-Base interactions energy: -1178.095 where: short stacking energy: -476.870 Base-Backbone interact. energy: 0.973 local terms energy: -483.391551 where: bonds (distance) C4'-P energy: -76.033 bonds (distance) P-C4' energy: -91.918 flat angles C4'-P-C4' energy: -106.618 flat angles P-C4'-P energy: -74.239 tors. eta vs tors. theta energy: -134.584 Dist. restrs. and SS energy: 1.491 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1576.877376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.877376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.249992 (E_RNA) where: Base-Base interactions energy: -1150.480 where: short stacking energy: -479.405 Base-Backbone interact. energy: -0.761 local terms energy: -466.009243 where: bonds (distance) C4'-P energy: -83.887 bonds (distance) P-C4' energy: -82.125 flat angles C4'-P-C4' energy: -105.815 flat angles P-C4'-P energy: -63.973 tors. eta vs tors. theta energy: -130.210 Dist. restrs. and SS energy: 3.623 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1515.741936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.741936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.146571 (E_RNA) where: Base-Base interactions energy: -1098.316 where: short stacking energy: -443.008 Base-Backbone interact. energy: -0.776 local terms energy: -455.055357 where: bonds (distance) C4'-P energy: -77.947 bonds (distance) P-C4' energy: -83.087 flat angles C4'-P-C4' energy: -107.728 flat angles P-C4'-P energy: -63.719 tors. eta vs tors. theta energy: -122.575 Dist. restrs. and SS energy: 1.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1456.246877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.246877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.989731 (E_RNA) where: Base-Base interactions energy: -1044.929 where: short stacking energy: -420.573 Base-Backbone interact. energy: 0.962 local terms energy: -450.022800 where: bonds (distance) C4'-P energy: -87.333 bonds (distance) P-C4' energy: -96.460 flat angles C4'-P-C4' energy: -87.724 flat angles P-C4'-P energy: -66.943 tors. eta vs tors. theta energy: -111.562 Dist. restrs. and SS energy: 0.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1384.098617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.098617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.925994 (E_RNA) where: Base-Base interactions energy: -983.108 where: short stacking energy: -403.867 Base-Backbone interact. energy: 0.433 local terms energy: -448.250841 where: bonds (distance) C4'-P energy: -89.687 bonds (distance) P-C4' energy: -84.158 flat angles C4'-P-C4' energy: -96.652 flat angles P-C4'-P energy: -54.946 tors. eta vs tors. theta energy: -122.808 Dist. restrs. and SS energy: 10.077 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1384.838668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.838668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.903829 (E_RNA) where: Base-Base interactions energy: -1017.117 where: short stacking energy: -410.275 Base-Backbone interact. energy: 0.212 local terms energy: -405.999387 where: bonds (distance) C4'-P energy: -74.009 bonds (distance) P-C4' energy: -78.360 flat angles C4'-P-C4' energy: -92.331 flat angles P-C4'-P energy: -46.254 tors. eta vs tors. theta energy: -115.046 Dist. restrs. and SS energy: 1.315 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1306.091557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.091557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.346390 (E_RNA) where: Base-Base interactions energy: -966.620 where: short stacking energy: -402.346 Base-Backbone interact. energy: -1.418 local terms energy: -384.308408 where: bonds (distance) C4'-P energy: -61.033 bonds (distance) P-C4' energy: -81.706 flat angles C4'-P-C4' energy: -89.941 flat angles P-C4'-P energy: -45.521 tors. eta vs tors. theta energy: -106.108 Dist. restrs. and SS energy: 9.505 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -1260.078684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.078684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.071049 (E_RNA) where: Base-Base interactions energy: -937.243 where: short stacking energy: -362.989 Base-Backbone interact. energy: -1.480 local terms energy: -362.348065 where: bonds (distance) C4'-P energy: -66.562 bonds (distance) P-C4' energy: -73.009 flat angles C4'-P-C4' energy: -83.157 flat angles P-C4'-P energy: -37.989 tors. eta vs tors. theta energy: -101.632 Dist. restrs. and SS energy: 4.242 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1717.552066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.552066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1756.092295 (E_RNA) where: Base-Base interactions energy: -1250.124 where: short stacking energy: -529.410 Base-Backbone interact. energy: -1.912 local terms energy: -504.057097 where: bonds (distance) C4'-P energy: -83.821 bonds (distance) P-C4' energy: -86.416 flat angles C4'-P-C4' energy: -112.164 flat angles P-C4'-P energy: -74.396 tors. eta vs tors. theta energy: -147.260 Dist. restrs. and SS energy: 1.790 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1634.379790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.379790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.498744 (E_RNA) where: Base-Base interactions energy: -1182.226 where: short stacking energy: -497.829 Base-Backbone interact. energy: -2.408 local terms energy: -487.864692 where: bonds (distance) C4'-P energy: -75.809 bonds (distance) P-C4' energy: -91.114 flat angles C4'-P-C4' energy: -106.465 flat angles P-C4'-P energy: -72.151 tors. eta vs tors. theta energy: -142.326 Dist. restrs. and SS energy: 1.369 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1596.424158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.424158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.922812 (E_RNA) where: Base-Base interactions energy: -1156.800 where: short stacking energy: -490.885 Base-Backbone interact. energy: -0.230 local terms energy: -476.893548 where: bonds (distance) C4'-P energy: -89.704 bonds (distance) P-C4' energy: -87.853 flat angles C4'-P-C4' energy: -101.057 flat angles P-C4'-P energy: -60.930 tors. eta vs tors. theta energy: -137.350 Dist. restrs. and SS energy: 0.749 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1560.381517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.381517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.825310 (E_RNA) where: Base-Base interactions energy: -1143.877 where: short stacking energy: -469.750 Base-Backbone interact. energy: -1.239 local terms energy: -454.709357 where: bonds (distance) C4'-P energy: -71.574 bonds (distance) P-C4' energy: -85.457 flat angles C4'-P-C4' energy: -94.389 flat angles P-C4'-P energy: -67.552 tors. eta vs tors. theta energy: -135.737 Dist. restrs. and SS energy: 2.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1514.683699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.683699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.653207 (E_RNA) where: Base-Base interactions energy: -1106.205 where: short stacking energy: -450.159 Base-Backbone interact. energy: -1.541 local terms energy: -445.906862 where: bonds (distance) C4'-P energy: -81.687 bonds (distance) P-C4' energy: -91.997 flat angles C4'-P-C4' energy: -98.271 flat angles P-C4'-P energy: -58.369 tors. eta vs tors. theta energy: -115.583 Dist. restrs. and SS energy: 2.220 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1442.242140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.242140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.882722 (E_RNA) where: Base-Base interactions energy: -1053.577 where: short stacking energy: -435.456 Base-Backbone interact. energy: -0.404 local terms energy: -426.901592 where: bonds (distance) C4'-P energy: -73.032 bonds (distance) P-C4' energy: -75.525 flat angles C4'-P-C4' energy: -96.539 flat angles P-C4'-P energy: -63.904 tors. eta vs tors. theta energy: -117.902 Dist. restrs. and SS energy: 1.891 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1386.540886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.540886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.307554 (E_RNA) where: Base-Base interactions energy: -1040.395 where: short stacking energy: -422.783 Base-Backbone interact. energy: -2.103 local terms energy: -391.809823 where: bonds (distance) C4'-P energy: -75.997 bonds (distance) P-C4' energy: -68.128 flat angles C4'-P-C4' energy: -78.095 flat angles P-C4'-P energy: -55.360 tors. eta vs tors. theta energy: -114.229 Dist. restrs. and SS energy: 11.017 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1372.956087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.956087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.422275 (E_RNA) where: Base-Base interactions energy: -1020.655 where: short stacking energy: -429.481 Base-Backbone interact. energy: 4.023 local terms energy: -405.789799 where: bonds (distance) C4'-P energy: -77.102 bonds (distance) P-C4' energy: -75.632 flat angles C4'-P-C4' energy: -83.588 flat angles P-C4'-P energy: -55.030 tors. eta vs tors. theta energy: -114.439 Dist. restrs. and SS energy: 12.716 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1345.666150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.666150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.432703 (E_RNA) where: Base-Base interactions energy: -978.205 where: short stacking energy: -403.426 Base-Backbone interact. energy: -1.353 local terms energy: -404.874946 where: bonds (distance) C4'-P energy: -66.716 bonds (distance) P-C4' energy: -75.487 flat angles C4'-P-C4' energy: -100.375 flat angles P-C4'-P energy: -48.693 tors. eta vs tors. theta energy: -113.604 Dist. restrs. and SS energy: 2.017 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -1244.236204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.236204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.807497 (E_RNA) where: Base-Base interactions energy: -895.496 where: short stacking energy: -359.704 Base-Backbone interact. energy: 0.341 local terms energy: -397.652171 where: bonds (distance) C4'-P energy: -68.141 bonds (distance) P-C4' energy: -84.785 flat angles C4'-P-C4' energy: -95.498 flat angles P-C4'-P energy: -53.832 tors. eta vs tors. theta energy: -95.396 Dist. restrs. and SS energy: 11.821 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1721.553696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.553696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.873746 (E_RNA) where: Base-Base interactions energy: -1247.357 where: short stacking energy: -509.535 Base-Backbone interact. energy: -2.076 local terms energy: -509.440884 where: bonds (distance) C4'-P energy: -98.601 bonds (distance) P-C4' energy: -93.123 flat angles C4'-P-C4' energy: -98.145 flat angles P-C4'-P energy: -70.651 tors. eta vs tors. theta energy: -148.921 Dist. restrs. and SS energy: 0.570 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1635.637437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.637437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.845236 (E_RNA) where: Base-Base interactions energy: -1187.199 where: short stacking energy: -499.552 Base-Backbone interact. energy: -1.448 local terms energy: -486.198836 where: bonds (distance) C4'-P energy: -88.599 bonds (distance) P-C4' energy: -87.083 flat angles C4'-P-C4' energy: -102.506 flat angles P-C4'-P energy: -63.640 tors. eta vs tors. theta energy: -144.371 Dist. restrs. and SS energy: 2.458 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1582.004343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.004343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.767239 (E_RNA) where: Base-Base interactions energy: -1161.455 where: short stacking energy: -484.601 Base-Backbone interact. energy: 0.645 local terms energy: -458.957713 where: bonds (distance) C4'-P energy: -80.196 bonds (distance) P-C4' energy: -86.744 flat angles C4'-P-C4' energy: -101.738 flat angles P-C4'-P energy: -55.628 tors. eta vs tors. theta energy: -134.653 Dist. restrs. and SS energy: 1.013 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1591.131395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.131395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.061588 (E_RNA) where: Base-Base interactions energy: -1144.742 where: short stacking energy: -469.323 Base-Backbone interact. energy: -0.938 local terms energy: -485.381428 where: bonds (distance) C4'-P energy: -87.222 bonds (distance) P-C4' energy: -82.311 flat angles C4'-P-C4' energy: -107.050 flat angles P-C4'-P energy: -73.808 tors. eta vs tors. theta energy: -134.990 Dist. restrs. and SS energy: 3.180 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1494.192312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.192312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.862289 (E_RNA) where: Base-Base interactions energy: -1088.868 where: short stacking energy: -452.319 Base-Backbone interact. energy: 5.414 local terms energy: -449.408549 where: bonds (distance) C4'-P energy: -69.132 bonds (distance) P-C4' energy: -93.076 flat angles C4'-P-C4' energy: -95.956 flat angles P-C4'-P energy: -69.083 tors. eta vs tors. theta energy: -122.162 Dist. restrs. and SS energy: 1.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1489.468344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.468344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.336256 (E_RNA) where: Base-Base interactions energy: -1071.486 where: short stacking energy: -431.947 Base-Backbone interact. energy: 1.258 local terms energy: -458.108202 where: bonds (distance) C4'-P energy: -79.717 bonds (distance) P-C4' energy: -83.944 flat angles C4'-P-C4' energy: -92.389 flat angles P-C4'-P energy: -69.920 tors. eta vs tors. theta energy: -132.138 Dist. restrs. and SS energy: 2.118 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1342.840341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.840341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.433436 (E_RNA) where: Base-Base interactions energy: -983.275 where: short stacking energy: -390.673 Base-Backbone interact. energy: -1.712 local terms energy: -404.445923 where: bonds (distance) C4'-P energy: -69.034 bonds (distance) P-C4' energy: -73.508 flat angles C4'-P-C4' energy: -98.753 flat angles P-C4'-P energy: -61.539 tors. eta vs tors. theta energy: -101.613 Dist. restrs. and SS energy: 9.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1375.258785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.258785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.558077 (E_RNA) where: Base-Base interactions energy: -976.042 where: short stacking energy: -418.953 Base-Backbone interact. energy: 1.185 local terms energy: -444.701006 where: bonds (distance) C4'-P energy: -73.350 bonds (distance) P-C4' energy: -85.453 flat angles C4'-P-C4' energy: -102.535 flat angles P-C4'-P energy: -57.758 tors. eta vs tors. theta energy: -125.606 Dist. restrs. and SS energy: 7.549 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1375.893034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.893034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.013767 (E_RNA) where: Base-Base interactions energy: -1019.533 where: short stacking energy: -419.283 Base-Backbone interact. energy: -1.989 local terms energy: -393.492218 where: bonds (distance) C4'-P energy: -69.644 bonds (distance) P-C4' energy: -72.903 flat angles C4'-P-C4' energy: -85.597 flat angles P-C4'-P energy: -51.912 tors. eta vs tors. theta energy: -113.437 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -1292.232037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.232037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.230244 (E_RNA) where: Base-Base interactions energy: -954.734 where: short stacking energy: -364.336 Base-Backbone interact. energy: -0.088 local terms energy: -378.407887 where: bonds (distance) C4'-P energy: -82.569 bonds (distance) P-C4' energy: -65.769 flat angles C4'-P-C4' energy: -69.941 flat angles P-C4'-P energy: -63.292 tors. eta vs tors. theta energy: -96.838 Dist. restrs. and SS energy: 4.248 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1732.744874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.744874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.386913 (E_RNA) where: Base-Base interactions energy: -1241.101 where: short stacking energy: -501.460 Base-Backbone interact. energy: 0.823 local terms energy: -530.108250 where: bonds (distance) C4'-P energy: -91.495 bonds (distance) P-C4' energy: -99.370 flat angles C4'-P-C4' energy: -117.368 flat angles P-C4'-P energy: -77.317 tors. eta vs tors. theta energy: -144.559 Dist. restrs. and SS energy: 0.892 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1653.342199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.342199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.062067 (E_RNA) where: Base-Base interactions energy: -1215.833 where: short stacking energy: -501.123 Base-Backbone interact. energy: -0.744 local terms energy: -474.485080 where: bonds (distance) C4'-P energy: -89.845 bonds (distance) P-C4' energy: -91.770 flat angles C4'-P-C4' energy: -98.299 flat angles P-C4'-P energy: -56.349 tors. eta vs tors. theta energy: -138.221 Dist. restrs. and SS energy: 0.970 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1584.371679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.371679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.757776 (E_RNA) where: Base-Base interactions energy: -1154.120 where: short stacking energy: -465.470 Base-Backbone interact. energy: -2.865 local terms energy: -466.773601 where: bonds (distance) C4'-P energy: -85.195 bonds (distance) P-C4' energy: -90.021 flat angles C4'-P-C4' energy: -102.390 flat angles P-C4'-P energy: -56.097 tors. eta vs tors. theta energy: -133.071 Dist. restrs. and SS energy: 2.636 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1595.121299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.121299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.948047 (E_RNA) where: Base-Base interactions energy: -1185.930 where: short stacking energy: -482.140 Base-Backbone interact. energy: 0.553 local terms energy: -449.571887 where: bonds (distance) C4'-P energy: -75.459 bonds (distance) P-C4' energy: -74.135 flat angles C4'-P-C4' energy: -100.045 flat angles P-C4'-P energy: -64.658 tors. eta vs tors. theta energy: -135.275 Dist. restrs. and SS energy: 3.077 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1492.946451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.946451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.734186 (E_RNA) where: Base-Base interactions energy: -1092.933 where: short stacking energy: -453.673 Base-Backbone interact. energy: -1.563 local terms energy: -437.238972 where: bonds (distance) C4'-P energy: -77.340 bonds (distance) P-C4' energy: -84.533 flat angles C4'-P-C4' energy: -94.733 flat angles P-C4'-P energy: -54.110 tors. eta vs tors. theta energy: -126.524 Dist. restrs. and SS energy: 2.038 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1455.790244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.790244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.707406 (E_RNA) where: Base-Base interactions energy: -1079.984 where: short stacking energy: -432.410 Base-Backbone interact. energy: 1.684 local terms energy: -415.407451 where: bonds (distance) C4'-P energy: -78.478 bonds (distance) P-C4' energy: -81.298 flat angles C4'-P-C4' energy: -87.995 flat angles P-C4'-P energy: -49.606 tors. eta vs tors. theta energy: -118.030 Dist. restrs. and SS energy: 1.167 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1362.415889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.415889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.856194 (E_RNA) where: Base-Base interactions energy: -982.933 where: short stacking energy: -389.568 Base-Backbone interact. energy: 2.269 local terms energy: -427.191489 where: bonds (distance) C4'-P energy: -71.452 bonds (distance) P-C4' energy: -78.201 flat angles C4'-P-C4' energy: -91.726 flat angles P-C4'-P energy: -76.432 tors. eta vs tors. theta energy: -109.380 Dist. restrs. and SS energy: 8.690 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1340.665618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.665618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.809203 (E_RNA) where: Base-Base interactions energy: -986.518 where: short stacking energy: -386.550 Base-Backbone interact. energy: 0.067 local terms energy: -398.358118 where: bonds (distance) C4'-P energy: -68.129 bonds (distance) P-C4' energy: -78.708 flat angles C4'-P-C4' energy: -87.069 flat angles P-C4'-P energy: -59.173 tors. eta vs tors. theta energy: -105.279 Dist. restrs. and SS energy: 7.394 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1324.148264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.148264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.234721 (E_RNA) where: Base-Base interactions energy: -981.155 where: short stacking energy: -394.340 Base-Backbone interact. energy: -1.176 local terms energy: -380.903009 where: bonds (distance) C4'-P energy: -66.369 bonds (distance) P-C4' energy: -70.812 flat angles C4'-P-C4' energy: -83.495 flat angles P-C4'-P energy: -63.539 tors. eta vs tors. theta energy: -96.688 Dist. restrs. and SS energy: 2.336 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -1359.087710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.087710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.065963 (E_RNA) where: Base-Base interactions energy: -982.882 where: short stacking energy: -387.968 Base-Backbone interact. energy: -0.674 local terms energy: -413.510307 where: bonds (distance) C4'-P energy: -73.417 bonds (distance) P-C4' energy: -84.345 flat angles C4'-P-C4' energy: -86.388 flat angles P-C4'-P energy: -60.547 tors. eta vs tors. theta energy: -108.813 Dist. restrs. and SS energy: 1.228 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1723.790110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1723.790110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1761.933338 (E_RNA) where: Base-Base interactions energy: -1242.244 where: short stacking energy: -521.955 Base-Backbone interact. energy: -0.298 local terms energy: -519.391710 where: bonds (distance) C4'-P energy: -88.612 bonds (distance) P-C4' energy: -95.644 flat angles C4'-P-C4' energy: -113.407 flat angles P-C4'-P energy: -70.872 tors. eta vs tors. theta energy: -150.856 Dist. restrs. and SS energy: 1.393 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1676.457787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.457787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.837312 (E_RNA) where: Base-Base interactions energy: -1213.333 where: short stacking energy: -510.942 Base-Backbone interact. energy: 1.980 local terms energy: -502.483802 where: bonds (distance) C4'-P energy: -88.985 bonds (distance) P-C4' energy: -88.475 flat angles C4'-P-C4' energy: -102.591 flat angles P-C4'-P energy: -74.727 tors. eta vs tors. theta energy: -147.705 Dist. restrs. and SS energy: 0.630 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1616.357283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.357283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.507721 (E_RNA) where: Base-Base interactions energy: -1153.610 where: short stacking energy: -464.489 Base-Backbone interact. energy: -2.700 local terms energy: -500.197833 where: bonds (distance) C4'-P energy: -90.566 bonds (distance) P-C4' energy: -101.593 flat angles C4'-P-C4' energy: -94.518 flat angles P-C4'-P energy: -72.323 tors. eta vs tors. theta energy: -141.198 Dist. restrs. and SS energy: 3.400 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1572.373109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.373109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.654332 (E_RNA) where: Base-Base interactions energy: -1142.379 where: short stacking energy: -473.902 Base-Backbone interact. energy: 3.022 local terms energy: -471.297745 where: bonds (distance) C4'-P energy: -72.930 bonds (distance) P-C4' energy: -87.926 flat angles C4'-P-C4' energy: -105.128 flat angles P-C4'-P energy: -69.601 tors. eta vs tors. theta energy: -135.713 Dist. restrs. and SS energy: 1.531 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1504.568273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.568273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1542.354212 (E_RNA) where: Base-Base interactions energy: -1111.943 where: short stacking energy: -442.461 Base-Backbone interact. energy: -1.046 local terms energy: -429.366075 where: bonds (distance) C4'-P energy: -76.108 bonds (distance) P-C4' energy: -81.008 flat angles C4'-P-C4' energy: -88.666 flat angles P-C4'-P energy: -63.535 tors. eta vs tors. theta energy: -120.049 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1518.008236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.008236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1555.544688 (E_RNA) where: Base-Base interactions energy: -1081.521 where: short stacking energy: -454.049 Base-Backbone interact. energy: -0.108 local terms energy: -473.915597 where: bonds (distance) C4'-P energy: -97.322 bonds (distance) P-C4' energy: -77.193 flat angles C4'-P-C4' energy: -104.690 flat angles P-C4'-P energy: -65.537 tors. eta vs tors. theta energy: -129.174 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1355.918899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.918899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.190321 (E_RNA) where: Base-Base interactions energy: -980.251 where: short stacking energy: -417.960 Base-Backbone interact. energy: 4.438 local terms energy: -425.376932 where: bonds (distance) C4'-P energy: -79.374 bonds (distance) P-C4' energy: -86.244 flat angles C4'-P-C4' energy: -86.603 flat angles P-C4'-P energy: -54.627 tors. eta vs tors. theta energy: -118.529 Dist. restrs. and SS energy: 8.521 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1339.031592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.031592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.072398 (E_RNA) where: Base-Base interactions energy: -990.019 where: short stacking energy: -392.235 Base-Backbone interact. energy: 1.005 local terms energy: -398.058071 where: bonds (distance) C4'-P energy: -76.573 bonds (distance) P-C4' energy: -72.670 flat angles C4'-P-C4' energy: -93.425 flat angles P-C4'-P energy: -49.396 tors. eta vs tors. theta energy: -105.993 Dist. restrs. and SS energy: 11.291 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1375.526789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.526789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.977534 (E_RNA) where: Base-Base interactions energy: -1008.689 where: short stacking energy: -416.875 Base-Backbone interact. energy: -0.743 local terms energy: -404.544949 where: bonds (distance) C4'-P energy: -78.551 bonds (distance) P-C4' energy: -60.063 flat angles C4'-P-C4' energy: -92.587 flat angles P-C4'-P energy: -54.306 tors. eta vs tors. theta energy: -119.038 Dist. restrs. and SS energy: 1.701 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -1308.948626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.948626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.885092 (E_RNA) where: Base-Base interactions energy: -982.705 where: short stacking energy: -389.653 Base-Backbone interact. energy: 4.147 local terms energy: -369.326528 where: bonds (distance) C4'-P energy: -75.432 bonds (distance) P-C4' energy: -68.998 flat angles C4'-P-C4' energy: -86.157 flat angles P-C4'-P energy: -40.303 tors. eta vs tors. theta energy: -98.437 Dist. restrs. and SS energy: 2.186 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1727.138720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.138720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.746893 (E_RNA) where: Base-Base interactions energy: -1243.026 where: short stacking energy: -524.768 Base-Backbone interact. energy: -2.428 local terms energy: -519.293493 where: bonds (distance) C4'-P energy: -97.341 bonds (distance) P-C4' energy: -99.027 flat angles C4'-P-C4' energy: -105.949 flat angles P-C4'-P energy: -70.793 tors. eta vs tors. theta energy: -146.184 Dist. restrs. and SS energy: 0.858 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1683.309604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.309604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.093594 (E_RNA) where: Base-Base interactions energy: -1205.317 where: short stacking energy: -507.970 Base-Backbone interact. energy: -1.987 local terms energy: -513.789772 where: bonds (distance) C4'-P energy: -96.916 bonds (distance) P-C4' energy: -88.380 flat angles C4'-P-C4' energy: -106.088 flat angles P-C4'-P energy: -78.102 tors. eta vs tors. theta energy: -144.303 Dist. restrs. and SS energy: 1.034 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1630.717652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.717652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.685932 (E_RNA) where: Base-Base interactions energy: -1181.494 where: short stacking energy: -498.349 Base-Backbone interact. energy: -0.233 local terms energy: -489.959501 where: bonds (distance) C4'-P energy: -92.942 bonds (distance) P-C4' energy: -90.902 flat angles C4'-P-C4' energy: -98.009 flat angles P-C4'-P energy: -73.157 tors. eta vs tors. theta energy: -134.949 Dist. restrs. and SS energy: 4.218 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1526.304361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1526.304361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.201630 (E_RNA) where: Base-Base interactions energy: -1113.897 where: short stacking energy: -465.346 Base-Backbone interact. energy: -0.138 local terms energy: -450.166716 where: bonds (distance) C4'-P energy: -83.372 bonds (distance) P-C4' energy: -81.404 flat angles C4'-P-C4' energy: -90.436 flat angles P-C4'-P energy: -68.483 tors. eta vs tors. theta energy: -126.471 Dist. restrs. and SS energy: 1.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1517.272943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.272943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1555.239132 (E_RNA) where: Base-Base interactions energy: -1125.832 where: short stacking energy: -467.595 Base-Backbone interact. energy: 2.674 local terms energy: -432.081370 where: bonds (distance) C4'-P energy: -71.883 bonds (distance) P-C4' energy: -79.357 flat angles C4'-P-C4' energy: -90.825 flat angles P-C4'-P energy: -66.166 tors. eta vs tors. theta energy: -123.849 Dist. restrs. and SS energy: 1.216 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1452.457660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.457660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.697550 (E_RNA) where: Base-Base interactions energy: -1061.904 where: short stacking energy: -447.384 Base-Backbone interact. energy: -1.883 local terms energy: -427.910423 where: bonds (distance) C4'-P energy: -77.775 bonds (distance) P-C4' energy: -77.769 flat angles C4'-P-C4' energy: -94.545 flat angles P-C4'-P energy: -64.366 tors. eta vs tors. theta energy: -113.455 Dist. restrs. and SS energy: 2.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1392.276844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.276844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.253008 (E_RNA) where: Base-Base interactions energy: -1020.583 where: short stacking energy: -438.121 Base-Backbone interact. energy: -1.389 local terms energy: -417.281572 where: bonds (distance) C4'-P energy: -86.337 bonds (distance) P-C4' energy: -72.500 flat angles C4'-P-C4' energy: -81.296 flat angles P-C4'-P energy: -63.375 tors. eta vs tors. theta energy: -113.774 Dist. restrs. and SS energy: 10.226 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1382.785887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.785887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.564180 (E_RNA) where: Base-Base interactions energy: -1013.103 where: short stacking energy: -402.983 Base-Backbone interact. energy: 0.662 local terms energy: -408.122738 where: bonds (distance) C4'-P energy: -67.258 bonds (distance) P-C4' energy: -72.815 flat angles C4'-P-C4' energy: -98.846 flat angles P-C4'-P energy: -57.445 tors. eta vs tors. theta energy: -111.759 Dist. restrs. and SS energy: 1.028 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1329.534217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.534217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.146079 (E_RNA) where: Base-Base interactions energy: -969.730 where: short stacking energy: -404.242 Base-Backbone interact. energy: -1.893 local terms energy: -403.523000 where: bonds (distance) C4'-P energy: -65.307 bonds (distance) P-C4' energy: -77.950 flat angles C4'-P-C4' energy: -83.878 flat angles P-C4'-P energy: -63.872 tors. eta vs tors. theta energy: -112.515 Dist. restrs. and SS energy: 8.862 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -1331.396787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.396787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.349907 (E_RNA) where: Base-Base interactions energy: -985.235 where: short stacking energy: -413.957 Base-Backbone interact. energy: -1.803 local terms energy: -383.312134 where: bonds (distance) C4'-P energy: -65.869 bonds (distance) P-C4' energy: -76.300 flat angles C4'-P-C4' energy: -80.646 flat angles P-C4'-P energy: -53.541 tors. eta vs tors. theta energy: -106.956 Dist. restrs. and SS energy: 2.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1685.498277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.498277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.540143 (E_RNA) where: Base-Base interactions energy: -1223.342 where: short stacking energy: -512.748 Base-Backbone interact. energy: -0.028 local terms energy: -501.170264 where: bonds (distance) C4'-P energy: -98.559 bonds (distance) P-C4' energy: -87.720 flat angles C4'-P-C4' energy: -102.582 flat angles P-C4'-P energy: -70.076 tors. eta vs tors. theta energy: -142.234 Dist. restrs. and SS energy: 2.292 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1703.531889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.531889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.434311 (E_RNA) where: Base-Base interactions energy: -1235.982 where: short stacking energy: -536.284 Base-Backbone interact. energy: -1.727 local terms energy: -503.725271 where: bonds (distance) C4'-P energy: -76.739 bonds (distance) P-C4' energy: -87.890 flat angles C4'-P-C4' energy: -113.271 flat angles P-C4'-P energy: -74.802 tors. eta vs tors. theta energy: -151.023 Dist. restrs. and SS energy: 1.152 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1619.269332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.269332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.288410 (E_RNA) where: Base-Base interactions energy: -1174.325 where: short stacking energy: -507.452 Base-Backbone interact. energy: -0.977 local terms energy: -483.986312 where: bonds (distance) C4'-P energy: -77.538 bonds (distance) P-C4' energy: -85.907 flat angles C4'-P-C4' energy: -104.523 flat angles P-C4'-P energy: -74.342 tors. eta vs tors. theta energy: -141.675 Dist. restrs. and SS energy: 3.269 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1548.904034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.904034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.606473 (E_RNA) where: Base-Base interactions energy: -1112.516 where: short stacking energy: -458.560 Base-Backbone interact. energy: -0.341 local terms energy: -474.749416 where: bonds (distance) C4'-P energy: -91.230 bonds (distance) P-C4' energy: -97.635 flat angles C4'-P-C4' energy: -103.798 flat angles P-C4'-P energy: -50.461 tors. eta vs tors. theta energy: -131.625 Dist. restrs. and SS energy: 1.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1522.999879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.999879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.452247 (E_RNA) where: Base-Base interactions energy: -1103.368 where: short stacking energy: -448.802 Base-Backbone interact. energy: -0.465 local terms energy: -458.619305 where: bonds (distance) C4'-P energy: -83.301 bonds (distance) P-C4' energy: -78.716 flat angles C4'-P-C4' energy: -103.794 flat angles P-C4'-P energy: -65.189 tors. eta vs tors. theta energy: -127.619 Dist. restrs. and SS energy: 2.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1465.124480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.124480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.284782 (E_RNA) where: Base-Base interactions energy: -1081.165 where: short stacking energy: -435.058 Base-Backbone interact. energy: -1.198 local terms energy: -421.921952 where: bonds (distance) C4'-P energy: -73.843 bonds (distance) P-C4' energy: -74.773 flat angles C4'-P-C4' energy: -89.547 flat angles P-C4'-P energy: -57.335 tors. eta vs tors. theta energy: -126.424 Dist. restrs. and SS energy: 2.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1414.004386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.004386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.414496 (E_RNA) where: Base-Base interactions energy: -1011.456 where: short stacking energy: -424.503 Base-Backbone interact. energy: -2.004 local terms energy: -438.954807 where: bonds (distance) C4'-P energy: -81.644 bonds (distance) P-C4' energy: -82.539 flat angles C4'-P-C4' energy: -95.336 flat angles P-C4'-P energy: -62.883 tors. eta vs tors. theta energy: -116.553 Dist. restrs. and SS energy: 1.660 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1369.233044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.233044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.448184 (E_RNA) where: Base-Base interactions energy: -1015.994 where: short stacking energy: -428.468 Base-Backbone interact. energy: 1.564 local terms energy: -393.017538 where: bonds (distance) C4'-P energy: -78.323 bonds (distance) P-C4' energy: -84.471 flat angles C4'-P-C4' energy: -66.713 flat angles P-C4'-P energy: -45.410 tors. eta vs tors. theta energy: -118.100 Dist. restrs. and SS energy: 1.465 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1357.972023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.972023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.422997 (E_RNA) where: Base-Base interactions energy: -1008.532 where: short stacking energy: -415.970 Base-Backbone interact. energy: 2.168 local terms energy: -393.058567 where: bonds (distance) C4'-P energy: -63.961 bonds (distance) P-C4' energy: -82.029 flat angles C4'-P-C4' energy: -79.845 flat angles P-C4'-P energy: -54.659 tors. eta vs tors. theta energy: -112.564 Dist. restrs. and SS energy: 4.701 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -1308.789239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.789239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.023161 (E_RNA) where: Base-Base interactions energy: -979.117 where: short stacking energy: -395.485 Base-Backbone interact. energy: -1.083 local terms energy: -366.823398 where: bonds (distance) C4'-P energy: -60.645 bonds (distance) P-C4' energy: -70.778 flat angles C4'-P-C4' energy: -71.356 flat angles P-C4'-P energy: -58.267 tors. eta vs tors. theta energy: -105.778 Dist. restrs. and SS energy: 1.484 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1728.126992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.126992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1765.532246 (E_RNA) where: Base-Base interactions energy: -1241.680 where: short stacking energy: -530.256 Base-Backbone interact. energy: -1.941 local terms energy: -521.910428 where: bonds (distance) C4'-P energy: -96.178 bonds (distance) P-C4' energy: -98.690 flat angles C4'-P-C4' energy: -109.384 flat angles P-C4'-P energy: -70.448 tors. eta vs tors. theta energy: -147.211 Dist. restrs. and SS energy: 0.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1700.648242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.648242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.465230 (E_RNA) where: Base-Base interactions energy: -1226.266 where: short stacking energy: -504.941 Base-Backbone interact. energy: -1.312 local terms energy: -510.887247 where: bonds (distance) C4'-P energy: -98.587 bonds (distance) P-C4' energy: -99.965 flat angles C4'-P-C4' energy: -99.740 flat angles P-C4'-P energy: -69.994 tors. eta vs tors. theta energy: -142.602 Dist. restrs. and SS energy: 1.067 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1629.273780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.273780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.185636 (E_RNA) where: Base-Base interactions energy: -1196.452 where: short stacking energy: -506.844 Base-Backbone interact. energy: -0.705 local terms energy: -472.028525 where: bonds (distance) C4'-P energy: -79.600 bonds (distance) P-C4' energy: -87.707 flat angles C4'-P-C4' energy: -98.979 flat angles P-C4'-P energy: -67.207 tors. eta vs tors. theta energy: -138.537 Dist. restrs. and SS energy: 3.162 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1567.543686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.543686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.863769 (E_RNA) where: Base-Base interactions energy: -1125.133 where: short stacking energy: -486.263 Base-Backbone interact. energy: -1.065 local terms energy: -479.665919 where: bonds (distance) C4'-P energy: -92.903 bonds (distance) P-C4' energy: -81.164 flat angles C4'-P-C4' energy: -99.548 flat angles P-C4'-P energy: -75.200 tors. eta vs tors. theta energy: -130.850 Dist. restrs. and SS energy: 1.570 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1548.870472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.870472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.829201 (E_RNA) where: Base-Base interactions energy: -1124.232 where: short stacking energy: -469.370 Base-Backbone interact. energy: -1.530 local terms energy: -463.067308 where: bonds (distance) C4'-P energy: -85.984 bonds (distance) P-C4' energy: -78.458 flat angles C4'-P-C4' energy: -102.198 flat angles P-C4'-P energy: -61.351 tors. eta vs tors. theta energy: -135.077 Dist. restrs. and SS energy: 3.209 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1484.386762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.386762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.470508 (E_RNA) where: Base-Base interactions energy: -1076.984 where: short stacking energy: -450.803 Base-Backbone interact. energy: -2.021 local terms energy: -443.465781 where: bonds (distance) C4'-P energy: -76.120 bonds (distance) P-C4' energy: -87.469 flat angles C4'-P-C4' energy: -87.435 flat angles P-C4'-P energy: -70.086 tors. eta vs tors. theta energy: -122.356 Dist. restrs. and SS energy: 1.334 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1407.110369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.110369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.993660 (E_RNA) where: Base-Base interactions energy: -1019.016 where: short stacking energy: -420.787 Base-Backbone interact. energy: -2.879 local terms energy: -423.099124 where: bonds (distance) C4'-P energy: -75.979 bonds (distance) P-C4' energy: -83.768 flat angles C4'-P-C4' energy: -92.338 flat angles P-C4'-P energy: -51.046 tors. eta vs tors. theta energy: -119.969 Dist. restrs. and SS energy: 1.133 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1383.380142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.380142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.307598 (E_RNA) where: Base-Base interactions energy: -1020.174 where: short stacking energy: -418.672 Base-Backbone interact. energy: -0.416 local terms energy: -400.717165 where: bonds (distance) C4'-P energy: -57.101 bonds (distance) P-C4' energy: -70.685 flat angles C4'-P-C4' energy: -98.107 flat angles P-C4'-P energy: -68.679 tors. eta vs tors. theta energy: -106.146 Dist. restrs. and SS energy: 1.177 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1304.208768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.208768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1349.778682 (E_RNA) where: Base-Base interactions energy: -977.567 where: short stacking energy: -401.239 Base-Backbone interact. energy: 2.018 local terms energy: -374.228956 where: bonds (distance) C4'-P energy: -62.260 bonds (distance) P-C4' energy: -55.285 flat angles C4'-P-C4' energy: -85.837 flat angles P-C4'-P energy: -53.695 tors. eta vs tors. theta energy: -117.151 Dist. restrs. and SS energy: 8.820 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -1331.235835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.235835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.638429 (E_RNA) where: Base-Base interactions energy: -1003.146 where: short stacking energy: -404.579 Base-Backbone interact. energy: -0.023 local terms energy: -367.469209 where: bonds (distance) C4'-P energy: -66.698 bonds (distance) P-C4' energy: -60.465 flat angles C4'-P-C4' energy: -89.223 flat angles P-C4'-P energy: -44.026 tors. eta vs tors. theta energy: -107.057 Dist. restrs. and SS energy: 2.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1716.915260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1716.915260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.229866 (E_RNA) where: Base-Base interactions energy: -1235.826 where: short stacking energy: -517.610 Base-Backbone interact. energy: -0.860 local terms energy: -517.544072 where: bonds (distance) C4'-P energy: -92.894 bonds (distance) P-C4' energy: -90.403 flat angles C4'-P-C4' energy: -109.677 flat angles P-C4'-P energy: -77.223 tors. eta vs tors. theta energy: -147.347 Dist. restrs. and SS energy: 0.565 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1687.645651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.645651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.363976 (E_RNA) where: Base-Base interactions energy: -1211.197 where: short stacking energy: -497.425 Base-Backbone interact. energy: -1.837 local terms energy: -512.329788 where: bonds (distance) C4'-P energy: -91.913 bonds (distance) P-C4' energy: -98.637 flat angles C4'-P-C4' energy: -102.505 flat angles P-C4'-P energy: -76.243 tors. eta vs tors. theta energy: -143.031 Dist. restrs. and SS energy: 0.968 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1598.822678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.822678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.482678 (E_RNA) where: Base-Base interactions energy: -1145.495 where: short stacking energy: -490.428 Base-Backbone interact. energy: -0.939 local terms energy: -490.048363 where: bonds (distance) C4'-P energy: -88.812 bonds (distance) P-C4' energy: -91.705 flat angles C4'-P-C4' energy: -99.637 flat angles P-C4'-P energy: -74.332 tors. eta vs tors. theta energy: -135.562 Dist. restrs. and SS energy: 0.910 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1594.625439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.625439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.545665 (E_RNA) where: Base-Base interactions energy: -1164.312 where: short stacking energy: -464.847 Base-Backbone interact. energy: -3.643 local terms energy: -467.590482 where: bonds (distance) C4'-P energy: -85.515 bonds (distance) P-C4' energy: -83.623 flat angles C4'-P-C4' energy: -110.507 flat angles P-C4'-P energy: -53.890 tors. eta vs tors. theta energy: -134.055 Dist. restrs. and SS energy: 4.170 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1519.159987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.159987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.828880 (E_RNA) where: Base-Base interactions energy: -1134.980 where: short stacking energy: -451.147 Base-Backbone interact. energy: 1.432 local terms energy: -424.281359 where: bonds (distance) C4'-P energy: -90.359 bonds (distance) P-C4' energy: -70.617 flat angles C4'-P-C4' energy: -83.640 flat angles P-C4'-P energy: -54.177 tors. eta vs tors. theta energy: -125.488 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1480.498474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.498474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.524735 (E_RNA) where: Base-Base interactions energy: -1079.680 where: short stacking energy: -442.015 Base-Backbone interact. energy: -1.696 local terms energy: -437.149155 where: bonds (distance) C4'-P energy: -64.734 bonds (distance) P-C4' energy: -80.710 flat angles C4'-P-C4' energy: -92.978 flat angles P-C4'-P energy: -77.555 tors. eta vs tors. theta energy: -121.172 Dist. restrs. and SS energy: 1.276 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1416.347204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.347204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.892829 (E_RNA) where: Base-Base interactions energy: -1042.785 where: short stacking energy: -433.913 Base-Backbone interact. energy: 2.523 local terms energy: -415.630867 where: bonds (distance) C4'-P energy: -67.128 bonds (distance) P-C4' energy: -74.404 flat angles C4'-P-C4' energy: -100.077 flat angles P-C4'-P energy: -58.682 tors. eta vs tors. theta energy: -115.339 Dist. restrs. and SS energy: 2.796 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1402.971289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.971289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.584516 (E_RNA) where: Base-Base interactions energy: -1021.325 where: short stacking energy: -427.149 Base-Backbone interact. energy: 1.004 local terms energy: -424.263020 where: bonds (distance) C4'-P energy: -70.174 bonds (distance) P-C4' energy: -85.424 flat angles C4'-P-C4' energy: -96.376 flat angles P-C4'-P energy: -61.750 tors. eta vs tors. theta energy: -110.540 Dist. restrs. and SS energy: 4.863 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1365.585030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.585030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.116693 (E_RNA) where: Base-Base interactions energy: -975.432 where: short stacking energy: -395.218 Base-Backbone interact. energy: -2.684 local terms energy: -426.000936 where: bonds (distance) C4'-P energy: -86.312 bonds (distance) P-C4' energy: -76.940 flat angles C4'-P-C4' energy: -86.211 flat angles P-C4'-P energy: -70.865 tors. eta vs tors. theta energy: -105.673 Dist. restrs. and SS energy: 1.782 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -1271.723745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.723745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.524962 (E_RNA) where: Base-Base interactions energy: -938.981 where: short stacking energy: -368.211 Base-Backbone interact. energy: 1.114 local terms energy: -384.658008 where: bonds (distance) C4'-P energy: -65.826 bonds (distance) P-C4' energy: -89.077 flat angles C4'-P-C4' energy: -79.907 flat angles P-C4'-P energy: -44.802 tors. eta vs tors. theta energy: -105.047 Dist. restrs. and SS energy: 14.051 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1701.975755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.975755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.701314 (E_RNA) where: Base-Base interactions energy: -1202.579 where: short stacking energy: -504.183 Base-Backbone interact. energy: -0.571 local terms energy: -536.551138 where: bonds (distance) C4'-P energy: -94.013 bonds (distance) P-C4' energy: -100.322 flat angles C4'-P-C4' energy: -108.813 flat angles P-C4'-P energy: -79.125 tors. eta vs tors. theta energy: -154.279 Dist. restrs. and SS energy: 0.976 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1687.408296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.408296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.622998 (E_RNA) where: Base-Base interactions energy: -1215.336 where: short stacking energy: -517.046 Base-Backbone interact. energy: -2.907 local terms energy: -506.380437 where: bonds (distance) C4'-P energy: -92.126 bonds (distance) P-C4' energy: -91.061 flat angles C4'-P-C4' energy: -104.129 flat angles P-C4'-P energy: -70.574 tors. eta vs tors. theta energy: -148.490 Dist. restrs. and SS energy: 0.465 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1600.884630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.884630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.844490 (E_RNA) where: Base-Base interactions energy: -1154.654 where: short stacking energy: -500.002 Base-Backbone interact. energy: -1.412 local terms energy: -482.778520 where: bonds (distance) C4'-P energy: -84.349 bonds (distance) P-C4' energy: -92.381 flat angles C4'-P-C4' energy: -109.207 flat angles P-C4'-P energy: -63.833 tors. eta vs tors. theta energy: -133.009 Dist. restrs. and SS energy: 1.210 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1609.327026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.327026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.387775 (E_RNA) where: Base-Base interactions energy: -1174.488 where: short stacking energy: -476.739 Base-Backbone interact. energy: -1.266 local terms energy: -475.633153 where: bonds (distance) C4'-P energy: -83.476 bonds (distance) P-C4' energy: -84.592 flat angles C4'-P-C4' energy: -107.781 flat angles P-C4'-P energy: -65.761 tors. eta vs tors. theta energy: -134.024 Dist. restrs. and SS energy: 5.311 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1517.930888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.930888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1556.928607 (E_RNA) where: Base-Base interactions energy: -1090.088 where: short stacking energy: -457.419 Base-Backbone interact. energy: 0.330 local terms energy: -467.170675 where: bonds (distance) C4'-P energy: -75.106 bonds (distance) P-C4' energy: -89.438 flat angles C4'-P-C4' energy: -95.443 flat angles P-C4'-P energy: -75.450 tors. eta vs tors. theta energy: -131.734 Dist. restrs. and SS energy: 2.248 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1500.537200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.537200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1538.375041 (E_RNA) where: Base-Base interactions energy: -1087.725 where: short stacking energy: -453.908 Base-Backbone interact. energy: -0.321 local terms energy: -450.329003 where: bonds (distance) C4'-P energy: -70.338 bonds (distance) P-C4' energy: -84.964 flat angles C4'-P-C4' energy: -94.881 flat angles P-C4'-P energy: -68.751 tors. eta vs tors. theta energy: -131.394 Dist. restrs. and SS energy: 1.088 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1415.716770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.716770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.410837 (E_RNA) where: Base-Base interactions energy: -1034.314 where: short stacking energy: -427.472 Base-Backbone interact. energy: 0.533 local terms energy: -420.629671 where: bonds (distance) C4'-P energy: -87.127 bonds (distance) P-C4' energy: -63.811 flat angles C4'-P-C4' energy: -83.247 flat angles P-C4'-P energy: -61.635 tors. eta vs tors. theta energy: -124.808 Dist. restrs. and SS energy: 1.944 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1355.659063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.659063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.313345 (E_RNA) where: Base-Base interactions energy: -1010.685 where: short stacking energy: -407.138 Base-Backbone interact. energy: 1.486 local terms energy: -384.114573 where: bonds (distance) C4'-P energy: -79.158 bonds (distance) P-C4' energy: -62.041 flat angles C4'-P-C4' energy: -88.878 flat angles P-C4'-P energy: -50.145 tors. eta vs tors. theta energy: -103.892 Dist. restrs. and SS energy: 0.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1313.940523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.940523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.424935 (E_RNA) where: Base-Base interactions energy: -951.959 where: short stacking energy: -380.860 Base-Backbone interact. energy: -0.084 local terms energy: -404.382216 where: bonds (distance) C4'-P energy: -66.061 bonds (distance) P-C4' energy: -76.683 flat angles C4'-P-C4' energy: -91.783 flat angles P-C4'-P energy: -51.468 tors. eta vs tors. theta energy: -118.388 Dist. restrs. and SS energy: 5.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1285.909880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.909880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.141420 (E_RNA) where: Base-Base interactions energy: -976.867 where: short stacking energy: -399.620 Base-Backbone interact. energy: 2.645 local terms energy: -357.919815 where: bonds (distance) C4'-P energy: -57.736 bonds (distance) P-C4' energy: -54.900 flat angles C4'-P-C4' energy: -94.759 flat angles P-C4'-P energy: -44.831 tors. eta vs tors. theta energy: -105.694 Dist. restrs. and SS energy: 9.482 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1711.382687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1711.382687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.652690 (E_RNA) where: Base-Base interactions energy: -1236.613 where: short stacking energy: -515.882 Base-Backbone interact. energy: -0.806 local terms energy: -511.233828 where: bonds (distance) C4'-P energy: -89.782 bonds (distance) P-C4' energy: -86.907 flat angles C4'-P-C4' energy: -114.350 flat angles P-C4'-P energy: -75.131 tors. eta vs tors. theta energy: -145.064 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1680.173807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.173807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.132636 (E_RNA) where: Base-Base interactions energy: -1212.191 where: short stacking energy: -495.689 Base-Backbone interact. energy: -1.970 local terms energy: -502.971034 where: bonds (distance) C4'-P energy: -87.897 bonds (distance) P-C4' energy: -98.421 flat angles C4'-P-C4' energy: -105.937 flat angles P-C4'-P energy: -70.199 tors. eta vs tors. theta energy: -140.518 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1577.786877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.786877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.488061 (E_RNA) where: Base-Base interactions energy: -1130.877 where: short stacking energy: -472.457 Base-Backbone interact. energy: -2.777 local terms energy: -481.834446 where: bonds (distance) C4'-P energy: -82.788 bonds (distance) P-C4' energy: -85.987 flat angles C4'-P-C4' energy: -104.438 flat angles P-C4'-P energy: -72.336 tors. eta vs tors. theta energy: -136.285 Dist. restrs. and SS energy: 0.951 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1570.704311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.704311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.303539 (E_RNA) where: Base-Base interactions energy: -1152.288 where: short stacking energy: -480.052 Base-Backbone interact. energy: -1.017 local terms energy: -456.999091 where: bonds (distance) C4'-P energy: -67.727 bonds (distance) P-C4' energy: -76.919 flat angles C4'-P-C4' energy: -101.877 flat angles P-C4'-P energy: -73.647 tors. eta vs tors. theta energy: -136.828 Dist. restrs. and SS energy: 2.849 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1524.130798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.130798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.061779 (E_RNA) where: Base-Base interactions energy: -1108.491 where: short stacking energy: -451.611 Base-Backbone interact. energy: -3.334 local terms energy: -450.236276 where: bonds (distance) C4'-P energy: -89.271 bonds (distance) P-C4' energy: -73.468 flat angles C4'-P-C4' energy: -100.637 flat angles P-C4'-P energy: -60.816 tors. eta vs tors. theta energy: -126.044 Dist. restrs. and SS energy: 1.181 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1473.990275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.990275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.950888 (E_RNA) where: Base-Base interactions energy: -1063.948 where: short stacking energy: -436.246 Base-Backbone interact. energy: -2.084 local terms energy: -445.918610 where: bonds (distance) C4'-P energy: -89.307 bonds (distance) P-C4' energy: -81.639 flat angles C4'-P-C4' energy: -91.035 flat angles P-C4'-P energy: -65.909 tors. eta vs tors. theta energy: -118.028 Dist. restrs. and SS energy: 1.211 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1419.929164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.929164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.374712 (E_RNA) where: Base-Base interactions energy: -1042.797 where: short stacking energy: -428.808 Base-Backbone interact. energy: -0.131 local terms energy: -415.447134 where: bonds (distance) C4'-P energy: -73.878 bonds (distance) P-C4' energy: -66.945 flat angles C4'-P-C4' energy: -81.437 flat angles P-C4'-P energy: -69.171 tors. eta vs tors. theta energy: -124.016 Dist. restrs. and SS energy: 1.696 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1387.075025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.075025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.097233 (E_RNA) where: Base-Base interactions energy: -999.854 where: short stacking energy: -423.548 Base-Backbone interact. energy: -3.273 local terms energy: -422.970091 where: bonds (distance) C4'-P energy: -73.095 bonds (distance) P-C4' energy: -71.628 flat angles C4'-P-C4' energy: -88.222 flat angles P-C4'-P energy: -65.870 tors. eta vs tors. theta energy: -124.156 Dist. restrs. and SS energy: 2.272 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1345.552770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.552770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.579552 (E_RNA) where: Base-Base interactions energy: -1011.322 where: short stacking energy: -407.893 Base-Backbone interact. energy: -0.636 local terms energy: -372.621234 where: bonds (distance) C4'-P energy: -70.904 bonds (distance) P-C4' energy: -61.463 flat angles C4'-P-C4' energy: -79.899 flat angles P-C4'-P energy: -46.862 tors. eta vs tors. theta energy: -113.494 Dist. restrs. and SS energy: 2.277 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -1282.865697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.865697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.275855 (E_RNA) where: Base-Base interactions energy: -960.261 where: short stacking energy: -381.810 Base-Backbone interact. energy: -0.192 local terms energy: -370.822863 where: bonds (distance) C4'-P energy: -84.731 bonds (distance) P-C4' energy: -49.232 flat angles C4'-P-C4' energy: -80.428 flat angles P-C4'-P energy: -56.816 tors. eta vs tors. theta energy: -99.617 Dist. restrs. and SS energy: 11.660 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1708.180038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.180038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.211588 (E_RNA) where: Base-Base interactions energy: -1232.180 where: short stacking energy: -518.146 Base-Backbone interact. energy: -2.631 local terms energy: -511.400258 where: bonds (distance) C4'-P energy: -83.446 bonds (distance) P-C4' energy: -101.735 flat angles C4'-P-C4' energy: -105.606 flat angles P-C4'-P energy: -78.654 tors. eta vs tors. theta energy: -141.959 Dist. restrs. and SS energy: 1.282 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1614.223833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.223833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.912196 (E_RNA) where: Base-Base interactions energy: -1155.211 where: short stacking energy: -477.244 Base-Backbone interact. energy: -1.941 local terms energy: -494.759697 where: bonds (distance) C4'-P energy: -83.311 bonds (distance) P-C4' energy: -83.138 flat angles C4'-P-C4' energy: -109.022 flat angles P-C4'-P energy: -85.001 tors. eta vs tors. theta energy: -134.288 Dist. restrs. and SS energy: 0.938 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1656.558019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.558019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.427556 (E_RNA) where: Base-Base interactions energy: -1197.997 where: short stacking energy: -506.180 Base-Backbone interact. energy: -2.112 local terms energy: -494.318255 where: bonds (distance) C4'-P energy: -85.809 bonds (distance) P-C4' energy: -84.761 flat angles C4'-P-C4' energy: -107.325 flat angles P-C4'-P energy: -71.787 tors. eta vs tors. theta energy: -144.636 Dist. restrs. and SS energy: 1.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1600.310871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.310871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.881287 (E_RNA) where: Base-Base interactions energy: -1173.025 where: short stacking energy: -476.484 Base-Backbone interact. energy: -2.272 local terms energy: -462.584407 where: bonds (distance) C4'-P energy: -73.776 bonds (distance) P-C4' energy: -96.461 flat angles C4'-P-C4' energy: -102.259 flat angles P-C4'-P energy: -59.314 tors. eta vs tors. theta energy: -130.774 Dist. restrs. and SS energy: 0.820 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1564.310573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.310573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.700489 (E_RNA) where: Base-Base interactions energy: -1131.188 where: short stacking energy: -484.732 Base-Backbone interact. energy: -0.241 local terms energy: -471.271839 where: bonds (distance) C4'-P energy: -82.765 bonds (distance) P-C4' energy: -87.800 flat angles C4'-P-C4' energy: -103.505 flat angles P-C4'-P energy: -68.847 tors. eta vs tors. theta energy: -128.354 Dist. restrs. and SS energy: 1.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1449.772515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.772515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.936775 (E_RNA) where: Base-Base interactions energy: -1043.235 where: short stacking energy: -424.927 Base-Backbone interact. energy: -3.585 local terms energy: -441.116485 where: bonds (distance) C4'-P energy: -75.288 bonds (distance) P-C4' energy: -97.435 flat angles C4'-P-C4' energy: -91.471 flat angles P-C4'-P energy: -53.908 tors. eta vs tors. theta energy: -123.014 Dist. restrs. and SS energy: 1.414 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1439.951327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.951327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.651184 (E_RNA) where: Base-Base interactions energy: -1045.849 where: short stacking energy: -425.463 Base-Backbone interact. energy: -1.295 local terms energy: -430.507202 where: bonds (distance) C4'-P energy: -75.247 bonds (distance) P-C4' energy: -90.485 flat angles C4'-P-C4' energy: -89.213 flat angles P-C4'-P energy: -57.637 tors. eta vs tors. theta energy: -117.925 Dist. restrs. and SS energy: 0.950 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1398.907410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.907410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.086630 (E_RNA) where: Base-Base interactions energy: -1019.635 where: short stacking energy: -418.262 Base-Backbone interact. energy: 0.145 local terms energy: -418.596368 where: bonds (distance) C4'-P energy: -72.232 bonds (distance) P-C4' energy: -88.721 flat angles C4'-P-C4' energy: -92.321 flat angles P-C4'-P energy: -51.527 tors. eta vs tors. theta energy: -113.796 Dist. restrs. and SS energy: 2.429 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1375.354111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.354111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.495746 (E_RNA) where: Base-Base interactions energy: -1016.929 where: short stacking energy: -411.590 Base-Backbone interact. energy: -0.226 local terms energy: -396.340657 where: bonds (distance) C4'-P energy: -63.687 bonds (distance) P-C4' energy: -75.141 flat angles C4'-P-C4' energy: -78.213 flat angles P-C4'-P energy: -62.288 tors. eta vs tors. theta energy: -117.011 Dist. restrs. and SS energy: 1.392 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1287.219172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.219172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.932952 (E_RNA) where: Base-Base interactions energy: -945.781 where: short stacking energy: -355.778 Base-Backbone interact. energy: -1.260 local terms energy: -386.891873 where: bonds (distance) C4'-P energy: -68.233 bonds (distance) P-C4' energy: -75.538 flat angles C4'-P-C4' energy: -84.178 flat angles P-C4'-P energy: -57.522 tors. eta vs tors. theta energy: -101.420 Dist. restrs. and SS energy: 9.964 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1710.096443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.096443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1747.813049 (E_RNA) where: Base-Base interactions energy: -1243.131 where: short stacking energy: -504.178 Base-Backbone interact. energy: -0.822 local terms energy: -503.860624 where: bonds (distance) C4'-P energy: -88.166 bonds (distance) P-C4' energy: -92.653 flat angles C4'-P-C4' energy: -111.435 flat angles P-C4'-P energy: -70.648 tors. eta vs tors. theta energy: -140.958 Dist. restrs. and SS energy: 0.967 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1652.927912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.927912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.695661 (E_RNA) where: Base-Base interactions energy: -1192.339 where: short stacking energy: -509.463 Base-Backbone interact. energy: -1.773 local terms energy: -496.583190 where: bonds (distance) C4'-P energy: -87.592 bonds (distance) P-C4' energy: -82.954 flat angles C4'-P-C4' energy: -107.862 flat angles P-C4'-P energy: -78.346 tors. eta vs tors. theta energy: -139.829 Dist. restrs. and SS energy: 1.018 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1632.420209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.420209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1670.107160 (E_RNA) where: Base-Base interactions energy: -1178.782 where: short stacking energy: -513.497 Base-Backbone interact. energy: 0.468 local terms energy: -491.793270 where: bonds (distance) C4'-P energy: -84.878 bonds (distance) P-C4' energy: -83.965 flat angles C4'-P-C4' energy: -103.326 flat angles P-C4'-P energy: -76.329 tors. eta vs tors. theta energy: -143.296 Dist. restrs. and SS energy: 0.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1592.907316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.907316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.862578 (E_RNA) where: Base-Base interactions energy: -1139.027 where: short stacking energy: -482.720 Base-Backbone interact. energy: -1.753 local terms energy: -490.082560 where: bonds (distance) C4'-P energy: -81.679 bonds (distance) P-C4' energy: -96.227 flat angles C4'-P-C4' energy: -105.970 flat angles P-C4'-P energy: -65.213 tors. eta vs tors. theta energy: -140.994 Dist. restrs. and SS energy: 1.205 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1590.563065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1590.563065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.991743 (E_RNA) where: Base-Base interactions energy: -1161.563 where: short stacking energy: -485.311 Base-Backbone interact. energy: 0.620 local terms energy: -467.048794 where: bonds (distance) C4'-P energy: -73.780 bonds (distance) P-C4' energy: -88.657 flat angles C4'-P-C4' energy: -91.734 flat angles P-C4'-P energy: -70.839 tors. eta vs tors. theta energy: -142.039 Dist. restrs. and SS energy: 0.679 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1432.052025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.052025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.851963 (E_RNA) where: Base-Base interactions energy: -1025.782 where: short stacking energy: -418.186 Base-Backbone interact. energy: 5.069 local terms energy: -450.138985 where: bonds (distance) C4'-P energy: -87.129 bonds (distance) P-C4' energy: -77.336 flat angles C4'-P-C4' energy: -97.830 flat angles P-C4'-P energy: -67.600 tors. eta vs tors. theta energy: -120.244 Dist. restrs. and SS energy: 2.050 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1429.891689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.891689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.752599 (E_RNA) where: Base-Base interactions energy: -1044.970 where: short stacking energy: -427.318 Base-Backbone interact. energy: -0.534 local terms energy: -428.248305 where: bonds (distance) C4'-P energy: -80.947 bonds (distance) P-C4' energy: -73.517 flat angles C4'-P-C4' energy: -88.372 flat angles P-C4'-P energy: -61.935 tors. eta vs tors. theta energy: -123.477 Dist. restrs. and SS energy: 7.111 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1366.536126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.536126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.137230 (E_RNA) where: Base-Base interactions energy: -1014.125 where: short stacking energy: -411.050 Base-Backbone interact. energy: -0.913 local terms energy: -390.098970 where: bonds (distance) C4'-P energy: -64.814 bonds (distance) P-C4' energy: -83.355 flat angles C4'-P-C4' energy: -75.578 flat angles P-C4'-P energy: -51.640 tors. eta vs tors. theta energy: -114.713 Dist. restrs. and SS energy: 1.851 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1306.778722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.778722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.061733 (E_RNA) where: Base-Base interactions energy: -977.157 where: short stacking energy: -408.643 Base-Backbone interact. energy: 0.001 local terms energy: -377.905875 where: bonds (distance) C4'-P energy: -60.373 bonds (distance) P-C4' energy: -63.973 flat angles C4'-P-C4' energy: -80.339 flat angles P-C4'-P energy: -65.412 tors. eta vs tors. theta energy: -107.809 Dist. restrs. and SS energy: 11.533 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1342.124517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.124517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.445487 (E_RNA) where: Base-Base interactions energy: -987.575 where: short stacking energy: -408.909 Base-Backbone interact. energy: -0.458 local terms energy: -396.412199 where: bonds (distance) C4'-P energy: -74.128 bonds (distance) P-C4' energy: -64.210 flat angles C4'-P-C4' energy: -93.796 flat angles P-C4'-P energy: -57.303 tors. eta vs tors. theta energy: -106.975 Dist. restrs. and SS energy: 5.571 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1714.609906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.609906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1753.002033 (E_RNA) where: Base-Base interactions energy: -1246.899 where: short stacking energy: -522.205 Base-Backbone interact. energy: -0.733 local terms energy: -505.370086 where: bonds (distance) C4'-P energy: -88.666 bonds (distance) P-C4' energy: -82.577 flat angles C4'-P-C4' energy: -103.403 flat angles P-C4'-P energy: -79.778 tors. eta vs tors. theta energy: -150.946 Dist. restrs. and SS energy: 1.642 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1672.355507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.355507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.837307 (E_RNA) where: Base-Base interactions energy: -1212.670 where: short stacking energy: -504.459 Base-Backbone interact. energy: -0.769 local terms energy: -496.398930 where: bonds (distance) C4'-P energy: -93.826 bonds (distance) P-C4' energy: -87.591 flat angles C4'-P-C4' energy: -94.997 flat angles P-C4'-P energy: -78.636 tors. eta vs tors. theta energy: -141.349 Dist. restrs. and SS energy: 0.732 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1598.145986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.145986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.728479 (E_RNA) where: Base-Base interactions energy: -1164.095 where: short stacking energy: -493.312 Base-Backbone interact. energy: 0.131 local terms energy: -472.764537 where: bonds (distance) C4'-P energy: -69.352 bonds (distance) P-C4' energy: -91.047 flat angles C4'-P-C4' energy: -106.926 flat angles P-C4'-P energy: -74.891 tors. eta vs tors. theta energy: -130.548 Dist. restrs. and SS energy: 1.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1600.603513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.603513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.625666 (E_RNA) where: Base-Base interactions energy: -1157.046 where: short stacking energy: -501.232 Base-Backbone interact. energy: -1.142 local terms energy: -481.438214 where: bonds (distance) C4'-P energy: -88.071 bonds (distance) P-C4' energy: -83.845 flat angles C4'-P-C4' energy: -103.948 flat angles P-C4'-P energy: -71.546 tors. eta vs tors. theta energy: -134.028 Dist. restrs. and SS energy: 2.272 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1543.115364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.115364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.112998 (E_RNA) where: Base-Base interactions energy: -1120.792 where: short stacking energy: -478.486 Base-Backbone interact. energy: 0.005 local terms energy: -460.325966 where: bonds (distance) C4'-P energy: -87.088 bonds (distance) P-C4' energy: -78.707 flat angles C4'-P-C4' energy: -92.722 flat angles P-C4'-P energy: -67.764 tors. eta vs tors. theta energy: -134.045 Dist. restrs. and SS energy: 1.248 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1494.520006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.520006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.977357 (E_RNA) where: Base-Base interactions energy: -1088.282 where: short stacking energy: -443.309 Base-Backbone interact. energy: -2.104 local terms energy: -443.590684 where: bonds (distance) C4'-P energy: -82.392 bonds (distance) P-C4' energy: -79.855 flat angles C4'-P-C4' energy: -100.248 flat angles P-C4'-P energy: -58.531 tors. eta vs tors. theta energy: -122.564 Dist. restrs. and SS energy: 2.707 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1439.873744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.873744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.698730 (E_RNA) where: Base-Base interactions energy: -1036.836 where: short stacking energy: -435.042 Base-Backbone interact. energy: -1.062 local terms energy: -441.800464 where: bonds (distance) C4'-P energy: -93.927 bonds (distance) P-C4' energy: -74.502 flat angles C4'-P-C4' energy: -89.570 flat angles P-C4'-P energy: -57.703 tors. eta vs tors. theta energy: -126.100 Dist. restrs. and SS energy: 3.075 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1380.541940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.541940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.861823 (E_RNA) where: Base-Base interactions energy: -1014.418 where: short stacking energy: -410.354 Base-Backbone interact. energy: -0.194 local terms energy: -404.249032 where: bonds (distance) C4'-P energy: -74.017 bonds (distance) P-C4' energy: -73.105 flat angles C4'-P-C4' energy: -85.833 flat angles P-C4'-P energy: -55.924 tors. eta vs tors. theta energy: -115.370 Dist. restrs. and SS energy: 1.570 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1327.373712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.373712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.597108 (E_RNA) where: Base-Base interactions energy: -1001.533 where: short stacking energy: -407.359 Base-Backbone interact. energy: -1.610 local terms energy: -371.454500 where: bonds (distance) C4'-P energy: -56.393 bonds (distance) P-C4' energy: -55.754 flat angles C4'-P-C4' energy: -89.540 flat angles P-C4'-P energy: -56.205 tors. eta vs tors. theta energy: -113.563 Dist. restrs. and SS energy: 10.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1315.364136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.364136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.997892 (E_RNA) where: Base-Base interactions energy: -955.382 where: short stacking energy: -382.695 Base-Backbone interact. energy: -0.830 local terms energy: -397.786517 where: bonds (distance) C4'-P energy: -68.921 bonds (distance) P-C4' energy: -72.155 flat angles C4'-P-C4' energy: -97.105 flat angles P-C4'-P energy: -45.950 tors. eta vs tors. theta energy: -113.655 Dist. restrs. and SS energy: 1.884 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1713.978593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.978593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.400885 (E_RNA) where: Base-Base interactions energy: -1231.002 where: short stacking energy: -518.304 Base-Backbone interact. energy: -1.369 local terms energy: -519.029911 where: bonds (distance) C4'-P energy: -96.594 bonds (distance) P-C4' energy: -98.157 flat angles C4'-P-C4' energy: -106.071 flat angles P-C4'-P energy: -69.232 tors. eta vs tors. theta energy: -148.975 Dist. restrs. and SS energy: 0.672 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1676.858542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.858542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.523821 (E_RNA) where: Base-Base interactions energy: -1225.030 where: short stacking energy: -526.834 Base-Backbone interact. energy: -0.836 local terms energy: -488.658160 where: bonds (distance) C4'-P energy: -94.092 bonds (distance) P-C4' energy: -83.939 flat angles C4'-P-C4' energy: -104.761 flat angles P-C4'-P energy: -65.529 tors. eta vs tors. theta energy: -140.338 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1618.115368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.115368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.098341 (E_RNA) where: Base-Base interactions energy: -1186.042 where: short stacking energy: -481.300 Base-Backbone interact. energy: -0.802 local terms energy: -469.254052 where: bonds (distance) C4'-P energy: -88.244 bonds (distance) P-C4' energy: -94.249 flat angles C4'-P-C4' energy: -90.846 flat angles P-C4'-P energy: -59.922 tors. eta vs tors. theta energy: -135.992 Dist. restrs. and SS energy: 1.233 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1591.424241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.424241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.632944 (E_RNA) where: Base-Base interactions energy: -1148.752 where: short stacking energy: -481.885 Base-Backbone interact. energy: -0.428 local terms energy: -480.452901 where: bonds (distance) C4'-P energy: -82.330 bonds (distance) P-C4' energy: -89.250 flat angles C4'-P-C4' energy: -97.299 flat angles P-C4'-P energy: -72.790 tors. eta vs tors. theta energy: -138.785 Dist. restrs. and SS energy: 1.459 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1539.863272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.863272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.454691 (E_RNA) where: Base-Base interactions energy: -1142.387 where: short stacking energy: -468.171 Base-Backbone interact. energy: 1.256 local terms energy: -437.323973 where: bonds (distance) C4'-P energy: -70.418 bonds (distance) P-C4' energy: -80.655 flat angles C4'-P-C4' energy: -102.115 flat angles P-C4'-P energy: -54.583 tors. eta vs tors. theta energy: -129.553 Dist. restrs. and SS energy: 1.841 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1473.536147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.536147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1512.831281 (E_RNA) where: Base-Base interactions energy: -1119.611 where: short stacking energy: -455.804 Base-Backbone interact. energy: -1.467 local terms energy: -391.753118 where: bonds (distance) C4'-P energy: -64.277 bonds (distance) P-C4' energy: -73.502 flat angles C4'-P-C4' energy: -76.766 flat angles P-C4'-P energy: -58.539 tors. eta vs tors. theta energy: -118.670 Dist. restrs. and SS energy: 2.545 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1443.997742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.997742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.835371 (E_RNA) where: Base-Base interactions energy: -1067.140 where: short stacking energy: -425.147 Base-Backbone interact. energy: -0.801 local terms energy: -413.894383 where: bonds (distance) C4'-P energy: -76.418 bonds (distance) P-C4' energy: -85.902 flat angles C4'-P-C4' energy: -94.652 flat angles P-C4'-P energy: -44.970 tors. eta vs tors. theta energy: -111.953 Dist. restrs. and SS energy: 1.088 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1380.915281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.915281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.921674 (E_RNA) where: Base-Base interactions energy: -1048.649 where: short stacking energy: -415.465 Base-Backbone interact. energy: -2.537 local terms energy: -367.735999 where: bonds (distance) C4'-P energy: -69.918 bonds (distance) P-C4' energy: -55.559 flat angles C4'-P-C4' energy: -80.503 flat angles P-C4'-P energy: -49.028 tors. eta vs tors. theta energy: -112.727 Dist. restrs. and SS energy: 1.256 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1359.254867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.254867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.011648 (E_RNA) where: Base-Base interactions energy: -988.979 where: short stacking energy: -408.125 Base-Backbone interact. energy: -3.586 local terms energy: -407.445983 where: bonds (distance) C4'-P energy: -64.404 bonds (distance) P-C4' energy: -76.808 flat angles C4'-P-C4' energy: -88.079 flat angles P-C4'-P energy: -57.712 tors. eta vs tors. theta energy: -120.443 Dist. restrs. and SS energy: 4.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -1296.433960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.433960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.179053 (E_RNA) where: Base-Base interactions energy: -954.129 where: short stacking energy: -407.752 Base-Backbone interact. energy: -1.487 local terms energy: -391.563539 where: bonds (distance) C4'-P energy: -73.915 bonds (distance) P-C4' energy: -73.163 flat angles C4'-P-C4' energy: -88.078 flat angles P-C4'-P energy: -53.430 tors. eta vs tors. theta energy: -102.978 Dist. restrs. and SS energy: 13.995 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1744.439354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1744.439354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.405563 (E_RNA) where: Base-Base interactions energy: -1258.230 where: short stacking energy: -532.861 Base-Backbone interact. energy: 0.402 local terms energy: -525.577212 where: bonds (distance) C4'-P energy: -97.703 bonds (distance) P-C4' energy: -91.437 flat angles C4'-P-C4' energy: -110.527 flat angles P-C4'-P energy: -72.960 tors. eta vs tors. theta energy: -152.950 Dist. restrs. and SS energy: 2.216 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1667.062827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1667.062827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.802539 (E_RNA) where: Base-Base interactions energy: -1202.617 where: short stacking energy: -495.283 Base-Backbone interact. energy: -1.630 local terms energy: -500.554911 where: bonds (distance) C4'-P energy: -77.122 bonds (distance) P-C4' energy: -99.165 flat angles C4'-P-C4' energy: -110.509 flat angles P-C4'-P energy: -74.356 tors. eta vs tors. theta energy: -139.402 Dist. restrs. and SS energy: 0.990 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1616.373178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.373178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.798733 (E_RNA) where: Base-Base interactions energy: -1169.547 where: short stacking energy: -482.011 Base-Backbone interact. energy: 1.694 local terms energy: -485.945878 where: bonds (distance) C4'-P energy: -91.782 bonds (distance) P-C4' energy: -91.273 flat angles C4'-P-C4' energy: -94.486 flat angles P-C4'-P energy: -69.881 tors. eta vs tors. theta energy: -138.524 Dist. restrs. and SS energy: 0.676 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1565.706966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.706966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.578972 (E_RNA) where: Base-Base interactions energy: -1136.211 where: short stacking energy: -474.138 Base-Backbone interact. energy: 0.838 local terms energy: -468.205904 where: bonds (distance) C4'-P energy: -75.093 bonds (distance) P-C4' energy: -89.899 flat angles C4'-P-C4' energy: -99.738 flat angles P-C4'-P energy: -69.111 tors. eta vs tors. theta energy: -134.365 Dist. restrs. and SS energy: 1.122 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1572.228432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.228432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.437041 (E_RNA) where: Base-Base interactions energy: -1126.085 where: short stacking energy: -450.351 Base-Backbone interact. energy: -3.259 local terms energy: -481.092920 where: bonds (distance) C4'-P energy: -75.239 bonds (distance) P-C4' energy: -92.620 flat angles C4'-P-C4' energy: -102.862 flat angles P-C4'-P energy: -75.965 tors. eta vs tors. theta energy: -134.406 Dist. restrs. and SS energy: 1.459 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1465.735794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.735794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.827127 (E_RNA) where: Base-Base interactions energy: -1055.168 where: short stacking energy: -427.875 Base-Backbone interact. energy: 0.920 local terms energy: -450.579467 where: bonds (distance) C4'-P energy: -88.194 bonds (distance) P-C4' energy: -88.214 flat angles C4'-P-C4' energy: -100.199 flat angles P-C4'-P energy: -58.338 tors. eta vs tors. theta energy: -115.635 Dist. restrs. and SS energy: 2.341 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1469.568210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.568210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.661505 (E_RNA) where: Base-Base interactions energy: -1082.942 where: short stacking energy: -440.212 Base-Backbone interact. energy: -2.432 local terms energy: -423.287450 where: bonds (distance) C4'-P energy: -79.487 bonds (distance) P-C4' energy: -74.099 flat angles C4'-P-C4' energy: -91.100 flat angles P-C4'-P energy: -57.885 tors. eta vs tors. theta energy: -120.716 Dist. restrs. and SS energy: 2.343 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1388.980687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.980687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.706373 (E_RNA) where: Base-Base interactions energy: -1016.964 where: short stacking energy: -416.808 Base-Backbone interact. energy: -1.049 local terms energy: -408.692991 where: bonds (distance) C4'-P energy: -65.922 bonds (distance) P-C4' energy: -75.852 flat angles C4'-P-C4' energy: -83.290 flat angles P-C4'-P energy: -67.194 tors. eta vs tors. theta energy: -116.436 Dist. restrs. and SS energy: 0.976 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1370.973207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.973207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.914621 (E_RNA) where: Base-Base interactions energy: -1017.067 where: short stacking energy: -418.188 Base-Backbone interact. energy: -1.197 local terms energy: -391.650818 where: bonds (distance) C4'-P energy: -60.817 bonds (distance) P-C4' energy: -75.154 flat angles C4'-P-C4' energy: -87.394 flat angles P-C4'-P energy: -53.135 tors. eta vs tors. theta energy: -115.151 Dist. restrs. and SS energy: 2.191 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1281.850972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.850972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.306786 (E_RNA) where: Base-Base interactions energy: -945.880 where: short stacking energy: -392.060 Base-Backbone interact. energy: 3.709 local terms energy: -388.136449 where: bonds (distance) C4'-P energy: -77.596 bonds (distance) P-C4' energy: -76.277 flat angles C4'-P-C4' energy: -77.848 flat angles P-C4'-P energy: -56.327 tors. eta vs tors. theta energy: -100.089 Dist. restrs. and SS energy: 11.706 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1692.873401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1692.873401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.220085 (E_RNA) where: Base-Base interactions energy: -1228.170 where: short stacking energy: -526.986 Base-Backbone interact. energy: -1.074 local terms energy: -500.976109 where: bonds (distance) C4'-P energy: -95.309 bonds (distance) P-C4' energy: -83.247 flat angles C4'-P-C4' energy: -105.668 flat angles P-C4'-P energy: -71.044 tors. eta vs tors. theta energy: -145.709 Dist. restrs. and SS energy: 0.597 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1692.867095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1692.867095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.652166 (E_RNA) where: Base-Base interactions energy: -1226.499 where: short stacking energy: -517.342 Base-Backbone interact. energy: -2.029 local terms energy: -502.123897 where: bonds (distance) C4'-P energy: -89.036 bonds (distance) P-C4' energy: -89.666 flat angles C4'-P-C4' energy: -102.052 flat angles P-C4'-P energy: -67.021 tors. eta vs tors. theta energy: -154.350 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1624.059955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.059955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.768311 (E_RNA) where: Base-Base interactions energy: -1162.823 where: short stacking energy: -502.344 Base-Backbone interact. energy: -2.710 local terms energy: -496.234919 where: bonds (distance) C4'-P energy: -88.575 bonds (distance) P-C4' energy: -91.563 flat angles C4'-P-C4' energy: -103.373 flat angles P-C4'-P energy: -67.300 tors. eta vs tors. theta energy: -145.425 Dist. restrs. and SS energy: 0.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1596.803747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.803747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.084242 (E_RNA) where: Base-Base interactions energy: -1151.501 where: short stacking energy: -478.554 Base-Backbone interact. energy: -1.987 local terms energy: -481.595342 where: bonds (distance) C4'-P energy: -84.697 bonds (distance) P-C4' energy: -88.947 flat angles C4'-P-C4' energy: -110.019 flat angles P-C4'-P energy: -60.925 tors. eta vs tors. theta energy: -137.007 Dist. restrs. and SS energy: 1.530 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1562.486462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.486462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.703222 (E_RNA) where: Base-Base interactions energy: -1131.281 where: short stacking energy: -473.723 Base-Backbone interact. energy: -0.445 local terms energy: -468.977932 where: bonds (distance) C4'-P energy: -82.565 bonds (distance) P-C4' energy: -96.334 flat angles C4'-P-C4' energy: -87.212 flat angles P-C4'-P energy: -67.306 tors. eta vs tors. theta energy: -135.560 Dist. restrs. and SS energy: 1.467 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1450.068401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.068401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.953794 (E_RNA) where: Base-Base interactions energy: -1048.706 where: short stacking energy: -446.771 Base-Backbone interact. energy: -1.827 local terms energy: -438.419901 where: bonds (distance) C4'-P energy: -85.569 bonds (distance) P-C4' energy: -79.254 flat angles C4'-P-C4' energy: -89.775 flat angles P-C4'-P energy: -58.740 tors. eta vs tors. theta energy: -125.082 Dist. restrs. and SS energy: 2.135 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1425.148020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.148020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.140640 (E_RNA) where: Base-Base interactions energy: -1021.794 where: short stacking energy: -404.689 Base-Backbone interact. energy: -1.664 local terms energy: -439.682306 where: bonds (distance) C4'-P energy: -79.563 bonds (distance) P-C4' energy: -85.251 flat angles C4'-P-C4' energy: -105.373 flat angles P-C4'-P energy: -51.784 tors. eta vs tors. theta energy: -117.711 Dist. restrs. and SS energy: 1.243 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1403.222763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.222763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.849408 (E_RNA) where: Base-Base interactions energy: -1043.437 where: short stacking energy: -433.340 Base-Backbone interact. energy: 3.789 local terms energy: -402.201547 where: bonds (distance) C4'-P energy: -78.684 bonds (distance) P-C4' energy: -71.939 flat angles C4'-P-C4' energy: -84.123 flat angles P-C4'-P energy: -57.887 tors. eta vs tors. theta energy: -109.569 Dist. restrs. and SS energy: 1.877 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1351.162222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.162222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.198400 (E_RNA) where: Base-Base interactions energy: -1010.691 where: short stacking energy: -421.625 Base-Backbone interact. energy: -1.508 local terms energy: -378.999455 where: bonds (distance) C4'-P energy: -50.413 bonds (distance) P-C4' energy: -74.702 flat angles C4'-P-C4' energy: -89.535 flat angles P-C4'-P energy: -57.012 tors. eta vs tors. theta energy: -107.337 Dist. restrs. and SS energy: 3.286 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1234.651784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.651784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.212789 (E_RNA) where: Base-Base interactions energy: -886.614 where: short stacking energy: -352.247 Base-Backbone interact. energy: -1.985 local terms energy: -393.613446 where: bonds (distance) C4'-P energy: -81.509 bonds (distance) P-C4' energy: -87.522 flat angles C4'-P-C4' energy: -81.151 flat angles P-C4'-P energy: -49.209 tors. eta vs tors. theta energy: -94.223 Dist. restrs. and SS energy: 10.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1702.203306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.203306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.749808 (E_RNA) where: Base-Base interactions energy: -1226.727 where: short stacking energy: -523.545 Base-Backbone interact. energy: -2.660 local terms energy: -510.362148 where: bonds (distance) C4'-P energy: -90.879 bonds (distance) P-C4' energy: -91.018 flat angles C4'-P-C4' energy: -107.632 flat angles P-C4'-P energy: -73.056 tors. eta vs tors. theta energy: -147.777 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1696.235582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.235582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.676431 (E_RNA) where: Base-Base interactions energy: -1232.240 where: short stacking energy: -513.737 Base-Backbone interact. energy: -1.722 local terms energy: -499.715085 where: bonds (distance) C4'-P energy: -87.263 bonds (distance) P-C4' energy: -89.659 flat angles C4'-P-C4' energy: -105.173 flat angles P-C4'-P energy: -69.317 tors. eta vs tors. theta energy: -148.303 Dist. restrs. and SS energy: 0.691 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1600.407977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.407977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.293085 (E_RNA) where: Base-Base interactions energy: -1155.479 where: short stacking energy: -499.924 Base-Backbone interact. energy: -1.432 local terms energy: -481.382205 where: bonds (distance) C4'-P energy: -86.272 bonds (distance) P-C4' energy: -89.305 flat angles C4'-P-C4' energy: -97.180 flat angles P-C4'-P energy: -65.053 tors. eta vs tors. theta energy: -143.573 Dist. restrs. and SS energy: 1.135 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1588.437814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.437814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.567531 (E_RNA) where: Base-Base interactions energy: -1152.294 where: short stacking energy: -482.357 Base-Backbone interact. energy: -2.898 local terms energy: -472.374946 where: bonds (distance) C4'-P energy: -84.678 bonds (distance) P-C4' energy: -88.986 flat angles C4'-P-C4' energy: -102.981 flat angles P-C4'-P energy: -63.499 tors. eta vs tors. theta energy: -132.232 Dist. restrs. and SS energy: 2.380 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1529.922000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.922000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.082097 (E_RNA) where: Base-Base interactions energy: -1110.732 where: short stacking energy: -458.316 Base-Backbone interact. energy: -1.070 local terms energy: -456.280154 where: bonds (distance) C4'-P energy: -86.729 bonds (distance) P-C4' energy: -89.340 flat angles C4'-P-C4' energy: -94.105 flat angles P-C4'-P energy: -62.182 tors. eta vs tors. theta energy: -123.924 Dist. restrs. and SS energy: 1.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1493.366547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.366547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.383549 (E_RNA) where: Base-Base interactions energy: -1072.907 where: short stacking energy: -451.949 Base-Backbone interact. energy: -1.386 local terms energy: -457.090590 where: bonds (distance) C4'-P energy: -92.045 bonds (distance) P-C4' energy: -81.901 flat angles C4'-P-C4' energy: -97.257 flat angles P-C4'-P energy: -60.879 tors. eta vs tors. theta energy: -125.009 Dist. restrs. and SS energy: 1.267 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1415.830094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.830094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.987067 (E_RNA) where: Base-Base interactions energy: -1025.339 where: short stacking energy: -435.563 Base-Backbone interact. energy: -0.927 local terms energy: -427.720833 where: bonds (distance) C4'-P energy: -79.422 bonds (distance) P-C4' energy: -84.390 flat angles C4'-P-C4' energy: -91.787 flat angles P-C4'-P energy: -56.266 tors. eta vs tors. theta energy: -115.856 Dist. restrs. and SS energy: 1.407 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1392.598705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.598705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.322058 (E_RNA) where: Base-Base interactions energy: -1021.830 where: short stacking energy: -419.757 Base-Backbone interact. energy: -0.764 local terms energy: -408.727535 where: bonds (distance) C4'-P energy: -75.771 bonds (distance) P-C4' energy: -81.149 flat angles C4'-P-C4' energy: -93.501 flat angles P-C4'-P energy: -45.893 tors. eta vs tors. theta energy: -112.414 Dist. restrs. and SS energy: 1.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1393.749752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.749752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.996336 (E_RNA) where: Base-Base interactions energy: -1030.178 where: short stacking energy: -423.423 Base-Backbone interact. energy: -2.031 local terms energy: -400.787578 where: bonds (distance) C4'-P energy: -76.917 bonds (distance) P-C4' energy: -46.933 flat angles C4'-P-C4' energy: -96.595 flat angles P-C4'-P energy: -60.864 tors. eta vs tors. theta energy: -119.478 Dist. restrs. and SS energy: 2.497 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1269.595282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.595282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.267041 (E_RNA) where: Base-Base interactions energy: -921.990 where: short stacking energy: -366.738 Base-Backbone interact. energy: -0.878 local terms energy: -393.399787 where: bonds (distance) C4'-P energy: -90.396 bonds (distance) P-C4' energy: -70.784 flat angles C4'-P-C4' energy: -80.991 flat angles P-C4'-P energy: -48.666 tors. eta vs tors. theta energy: -102.562 Dist. restrs. and SS energy: 9.922 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1710.910618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.910618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.405765 (E_RNA) where: Base-Base interactions energy: -1241.306 where: short stacking energy: -529.546 Base-Backbone interact. energy: -2.038 local terms energy: -505.061486 where: bonds (distance) C4'-P energy: -89.036 bonds (distance) P-C4' energy: -93.279 flat angles C4'-P-C4' energy: -102.334 flat angles P-C4'-P energy: -74.831 tors. eta vs tors. theta energy: -145.580 Dist. restrs. and SS energy: 0.745 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1672.331765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.331765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.512248 (E_RNA) where: Base-Base interactions energy: -1201.844 where: short stacking energy: -497.907 Base-Backbone interact. energy: -2.814 local terms energy: -504.854424 where: bonds (distance) C4'-P energy: -77.451 bonds (distance) P-C4' energy: -100.374 flat angles C4'-P-C4' energy: -109.928 flat angles P-C4'-P energy: -77.296 tors. eta vs tors. theta energy: -139.806 Dist. restrs. and SS energy: 0.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1612.009842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.009842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.836519 (E_RNA) where: Base-Base interactions energy: -1170.457 where: short stacking energy: -500.348 Base-Backbone interact. energy: -1.873 local terms energy: -477.505664 where: bonds (distance) C4'-P energy: -74.077 bonds (distance) P-C4' energy: -83.772 flat angles C4'-P-C4' energy: -108.502 flat angles P-C4'-P energy: -68.820 tors. eta vs tors. theta energy: -142.335 Dist. restrs. and SS energy: 1.077 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1573.587944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.587944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.828151 (E_RNA) where: Base-Base interactions energy: -1139.940 where: short stacking energy: -480.894 Base-Backbone interact. energy: -0.605 local terms energy: -471.282871 where: bonds (distance) C4'-P energy: -76.189 bonds (distance) P-C4' energy: -91.580 flat angles C4'-P-C4' energy: -96.007 flat angles P-C4'-P energy: -76.657 tors. eta vs tors. theta energy: -130.850 Dist. restrs. and SS energy: 1.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1532.322445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.322445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.986551 (E_RNA) where: Base-Base interactions energy: -1138.305 where: short stacking energy: -459.045 Base-Backbone interact. energy: -1.232 local terms energy: -430.448802 where: bonds (distance) C4'-P energy: -64.210 bonds (distance) P-C4' energy: -84.206 flat angles C4'-P-C4' energy: -101.690 flat angles P-C4'-P energy: -58.852 tors. eta vs tors. theta energy: -121.490 Dist. restrs. and SS energy: 0.914 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1469.812343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.812343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.087640 (E_RNA) where: Base-Base interactions energy: -1068.986 where: short stacking energy: -445.504 Base-Backbone interact. energy: 0.215 local terms energy: -439.316174 where: bonds (distance) C4'-P energy: -71.032 bonds (distance) P-C4' energy: -95.312 flat angles C4'-P-C4' energy: -103.878 flat angles P-C4'-P energy: -55.976 tors. eta vs tors. theta energy: -113.118 Dist. restrs. and SS energy: 1.525 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1436.221657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.221657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.655222 (E_RNA) where: Base-Base interactions energy: -1041.345 where: short stacking energy: -439.760 Base-Backbone interact. energy: -1.774 local terms energy: -431.536411 where: bonds (distance) C4'-P energy: -67.036 bonds (distance) P-C4' energy: -82.845 flat angles C4'-P-C4' energy: -92.120 flat angles P-C4'-P energy: -68.732 tors. eta vs tors. theta energy: -120.804 Dist. restrs. and SS energy: 1.684 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1379.588417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.588417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.538148 (E_RNA) where: Base-Base interactions energy: -1005.476 where: short stacking energy: -410.744 Base-Backbone interact. energy: -0.280 local terms energy: -411.782168 where: bonds (distance) C4'-P energy: -72.196 bonds (distance) P-C4' energy: -75.085 flat angles C4'-P-C4' energy: -94.411 flat angles P-C4'-P energy: -59.225 tors. eta vs tors. theta energy: -110.865 Dist. restrs. and SS energy: 1.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1407.987826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.987826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.377475 (E_RNA) where: Base-Base interactions energy: -1033.735 where: short stacking energy: -414.447 Base-Backbone interact. energy: -1.783 local terms energy: -410.860221 where: bonds (distance) C4'-P energy: -54.759 bonds (distance) P-C4' energy: -84.183 flat angles C4'-P-C4' energy: -96.986 flat angles P-C4'-P energy: -50.965 tors. eta vs tors. theta energy: -123.968 Dist. restrs. and SS energy: 1.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1247.938740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.938740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.062028 (E_RNA) where: Base-Base interactions energy: -924.568 where: short stacking energy: -380.799 Base-Backbone interact. energy: -2.192 local terms energy: -366.302831 where: bonds (distance) C4'-P energy: -59.323 bonds (distance) P-C4' energy: -75.566 flat angles C4'-P-C4' energy: -89.470 flat angles P-C4'-P energy: -39.643 tors. eta vs tors. theta energy: -102.301 Dist. restrs. and SS energy: 8.373 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1701.293869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.293869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.512297 (E_RNA) where: Base-Base interactions energy: -1253.487 where: short stacking energy: -535.778 Base-Backbone interact. energy: 0.658 local terms energy: -485.682730 where: bonds (distance) C4'-P energy: -84.791 bonds (distance) P-C4' energy: -87.270 flat angles C4'-P-C4' energy: -104.172 flat angles P-C4'-P energy: -69.025 tors. eta vs tors. theta energy: -140.426 Dist. restrs. and SS energy: 0.468 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1638.980838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.980838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1676.418418 (E_RNA) where: Base-Base interactions energy: -1173.699 where: short stacking energy: -484.804 Base-Backbone interact. energy: -0.362 local terms energy: -502.357285 where: bonds (distance) C4'-P energy: -92.765 bonds (distance) P-C4' energy: -92.760 flat angles C4'-P-C4' energy: -98.497 flat angles P-C4'-P energy: -75.083 tors. eta vs tors. theta energy: -143.252 Dist. restrs. and SS energy: 0.688 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1596.050213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.050213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.893438 (E_RNA) where: Base-Base interactions energy: -1161.532 where: short stacking energy: -490.296 Base-Backbone interact. energy: -3.157 local terms energy: -470.204262 where: bonds (distance) C4'-P energy: -84.890 bonds (distance) P-C4' energy: -89.622 flat angles C4'-P-C4' energy: -99.090 flat angles P-C4'-P energy: -65.004 tors. eta vs tors. theta energy: -131.599 Dist. restrs. and SS energy: 2.093 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1555.715873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.715873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.023917 (E_RNA) where: Base-Base interactions energy: -1120.916 where: short stacking energy: -459.967 Base-Backbone interact. energy: -0.199 local terms energy: -472.908091 where: bonds (distance) C4'-P energy: -78.308 bonds (distance) P-C4' energy: -97.100 flat angles C4'-P-C4' energy: -100.405 flat angles P-C4'-P energy: -59.426 tors. eta vs tors. theta energy: -137.670 Dist. restrs. and SS energy: 1.558 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1522.572109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.572109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.861055 (E_RNA) where: Base-Base interactions energy: -1080.024 where: short stacking energy: -455.092 Base-Backbone interact. energy: -1.140 local terms energy: -479.697209 where: bonds (distance) C4'-P energy: -77.453 bonds (distance) P-C4' energy: -97.110 flat angles C4'-P-C4' energy: -106.509 flat angles P-C4'-P energy: -63.895 tors. eta vs tors. theta energy: -134.730 Dist. restrs. and SS energy: 1.539 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1459.335428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.335428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.424734 (E_RNA) where: Base-Base interactions energy: -1077.601 where: short stacking energy: -442.583 Base-Backbone interact. energy: -1.666 local terms energy: -418.158140 where: bonds (distance) C4'-P energy: -67.964 bonds (distance) P-C4' energy: -76.431 flat angles C4'-P-C4' energy: -95.230 flat angles P-C4'-P energy: -53.768 tors. eta vs tors. theta energy: -124.765 Dist. restrs. and SS energy: 1.339 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1430.726293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.726293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.685961 (E_RNA) where: Base-Base interactions energy: -1044.580 where: short stacking energy: -421.085 Base-Backbone interact. energy: 2.136 local terms energy: -428.242208 where: bonds (distance) C4'-P energy: -77.449 bonds (distance) P-C4' energy: -83.816 flat angles C4'-P-C4' energy: -87.169 flat angles P-C4'-P energy: -58.323 tors. eta vs tors. theta energy: -121.485 Dist. restrs. and SS energy: 3.210 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1414.866346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.866346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.909802 (E_RNA) where: Base-Base interactions energy: -1030.245 where: short stacking energy: -424.619 Base-Backbone interact. energy: -0.581 local terms energy: -423.084065 where: bonds (distance) C4'-P energy: -85.031 bonds (distance) P-C4' energy: -71.784 flat angles C4'-P-C4' energy: -96.256 flat angles P-C4'-P energy: -44.029 tors. eta vs tors. theta energy: -125.984 Dist. restrs. and SS energy: 2.293 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1378.693947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.693947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.535217 (E_RNA) where: Base-Base interactions energy: -978.897 where: short stacking energy: -398.878 Base-Backbone interact. energy: -0.943 local terms energy: -437.695014 where: bonds (distance) C4'-P energy: -79.650 bonds (distance) P-C4' energy: -87.350 flat angles C4'-P-C4' energy: -98.855 flat angles P-C4'-P energy: -58.670 tors. eta vs tors. theta energy: -113.169 Dist. restrs. and SS energy: 2.091 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1246.429783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.429783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.391282 (E_RNA) where: Base-Base interactions energy: -928.109 where: short stacking energy: -384.320 Base-Backbone interact. energy: -1.504 local terms energy: -363.777597 where: bonds (distance) C4'-P energy: -72.608 bonds (distance) P-C4' energy: -72.135 flat angles C4'-P-C4' energy: -76.607 flat angles P-C4'-P energy: -49.350 tors. eta vs tors. theta energy: -93.078 Dist. restrs. and SS energy: 10.211 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1691.935347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.935347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.488405 (E_RNA) where: Base-Base interactions energy: -1221.137 where: short stacking energy: -515.737 Base-Backbone interact. energy: -0.734 local terms energy: -507.617258 where: bonds (distance) C4'-P energy: -92.281 bonds (distance) P-C4' energy: -95.239 flat angles C4'-P-C4' energy: -104.270 flat angles P-C4'-P energy: -69.285 tors. eta vs tors. theta energy: -146.543 Dist. restrs. and SS energy: 0.803 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1631.722686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.722686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.470792 (E_RNA) where: Base-Base interactions energy: -1158.115 where: short stacking energy: -499.265 Base-Backbone interact. energy: -1.762 local terms energy: -509.593562 where: bonds (distance) C4'-P energy: -91.992 bonds (distance) P-C4' energy: -100.547 flat angles C4'-P-C4' energy: -98.747 flat angles P-C4'-P energy: -81.319 tors. eta vs tors. theta energy: -136.988 Dist. restrs. and SS energy: 0.998 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1593.216237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.216237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.146045 (E_RNA) where: Base-Base interactions energy: -1160.349 where: short stacking energy: -484.882 Base-Backbone interact. energy: -1.432 local terms energy: -469.364656 where: bonds (distance) C4'-P energy: -73.088 bonds (distance) P-C4' energy: -84.606 flat angles C4'-P-C4' energy: -103.266 flat angles P-C4'-P energy: -67.291 tors. eta vs tors. theta energy: -141.114 Dist. restrs. and SS energy: 1.180 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1587.577874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.577874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.872379 (E_RNA) where: Base-Base interactions energy: -1138.261 where: short stacking energy: -477.871 Base-Backbone interact. energy: -1.835 local terms energy: -486.776887 where: bonds (distance) C4'-P energy: -84.169 bonds (distance) P-C4' energy: -88.359 flat angles C4'-P-C4' energy: -105.415 flat angles P-C4'-P energy: -68.392 tors. eta vs tors. theta energy: -140.441 Dist. restrs. and SS energy: 2.545 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1476.677318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.677318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.738964 (E_RNA) where: Base-Base interactions energy: -1064.224 where: short stacking energy: -437.736 Base-Backbone interact. energy: 1.401 local terms energy: -451.916129 where: bonds (distance) C4'-P energy: -79.573 bonds (distance) P-C4' energy: -81.674 flat angles C4'-P-C4' energy: -98.193 flat angles P-C4'-P energy: -71.515 tors. eta vs tors. theta energy: -120.960 Dist. restrs. and SS energy: 1.312 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1471.731813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.731813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.887701 (E_RNA) where: Base-Base interactions energy: -1061.621 where: short stacking energy: -444.449 Base-Backbone interact. energy: -0.362 local terms energy: -447.904051 where: bonds (distance) C4'-P energy: -87.485 bonds (distance) P-C4' energy: -80.440 flat angles C4'-P-C4' energy: -97.112 flat angles P-C4'-P energy: -66.455 tors. eta vs tors. theta energy: -116.412 Dist. restrs. and SS energy: 1.406 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1392.823064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.823064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.951344 (E_RNA) where: Base-Base interactions energy: -1013.018 where: short stacking energy: -410.784 Base-Backbone interact. energy: -0.726 local terms energy: -417.207186 where: bonds (distance) C4'-P energy: -83.372 bonds (distance) P-C4' energy: -76.185 flat angles C4'-P-C4' energy: -96.038 flat angles P-C4'-P energy: -56.203 tors. eta vs tors. theta energy: -105.408 Dist. restrs. and SS energy: 1.378 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1393.511570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.511570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.114271 (E_RNA) where: Base-Base interactions energy: -1000.204 where: short stacking energy: -428.229 Base-Backbone interact. energy: -0.565 local terms energy: -431.345076 where: bonds (distance) C4'-P energy: -81.906 bonds (distance) P-C4' energy: -69.781 flat angles C4'-P-C4' energy: -93.588 flat angles P-C4'-P energy: -62.422 tors. eta vs tors. theta energy: -123.650 Dist. restrs. and SS energy: 1.853 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1366.453063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.453063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.374917 (E_RNA) where: Base-Base interactions energy: -1010.665 where: short stacking energy: -412.711 Base-Backbone interact. energy: -0.731 local terms energy: -394.978219 where: bonds (distance) C4'-P energy: -64.672 bonds (distance) P-C4' energy: -64.942 flat angles C4'-P-C4' energy: -84.861 flat angles P-C4'-P energy: -62.782 tors. eta vs tors. theta energy: -117.720 Dist. restrs. and SS energy: 3.172 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1270.081363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.081363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.864166 (E_RNA) where: Base-Base interactions energy: -939.017 where: short stacking energy: -398.616 Base-Backbone interact. energy: 1.745 local terms energy: -380.592298 where: bonds (distance) C4'-P energy: -57.119 bonds (distance) P-C4' energy: -74.231 flat angles C4'-P-C4' energy: -93.136 flat angles P-C4'-P energy: -45.426 tors. eta vs tors. theta energy: -110.680 Dist. restrs. and SS energy: 11.033 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1696.304301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.304301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.840683 (E_RNA) where: Base-Base interactions energy: -1227.418 where: short stacking energy: -529.932 Base-Backbone interact. energy: -0.537 local terms energy: -505.884846 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -95.014 flat angles C4'-P-C4' energy: -108.545 flat angles P-C4'-P energy: -70.075 tors. eta vs tors. theta energy: -153.168 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1648.622218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.622218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.406829 (E_RNA) where: Base-Base interactions energy: -1179.935 where: short stacking energy: -495.624 Base-Backbone interact. energy: -0.859 local terms energy: -505.613317 where: bonds (distance) C4'-P energy: -90.757 bonds (distance) P-C4' energy: -90.381 flat angles C4'-P-C4' energy: -102.394 flat angles P-C4'-P energy: -76.810 tors. eta vs tors. theta energy: -145.272 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1567.887153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.887153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.707415 (E_RNA) where: Base-Base interactions energy: -1135.699 where: short stacking energy: -459.675 Base-Backbone interact. energy: -1.941 local terms energy: -468.067690 where: bonds (distance) C4'-P energy: -81.197 bonds (distance) P-C4' energy: -90.266 flat angles C4'-P-C4' energy: -102.022 flat angles P-C4'-P energy: -64.442 tors. eta vs tors. theta energy: -130.140 Dist. restrs. and SS energy: 1.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1566.317004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.317004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.794312 (E_RNA) where: Base-Base interactions energy: -1122.079 where: short stacking energy: -464.098 Base-Backbone interact. energy: -1.048 local terms energy: -481.667698 where: bonds (distance) C4'-P energy: -79.889 bonds (distance) P-C4' energy: -96.320 flat angles C4'-P-C4' energy: -98.395 flat angles P-C4'-P energy: -71.088 tors. eta vs tors. theta energy: -135.976 Dist. restrs. and SS energy: 1.727 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1488.440546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.440546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1526.166308 (E_RNA) where: Base-Base interactions energy: -1059.191 where: short stacking energy: -428.641 Base-Backbone interact. energy: -0.197 local terms energy: -466.778970 where: bonds (distance) C4'-P energy: -90.194 bonds (distance) P-C4' energy: -78.483 flat angles C4'-P-C4' energy: -99.751 flat angles P-C4'-P energy: -67.219 tors. eta vs tors. theta energy: -131.133 Dist. restrs. and SS energy: 0.976 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1481.501603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.501603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.032672 (E_RNA) where: Base-Base interactions energy: -1078.874 where: short stacking energy: -445.335 Base-Backbone interact. energy: -0.737 local terms energy: -439.421300 where: bonds (distance) C4'-P energy: -82.023 bonds (distance) P-C4' energy: -72.977 flat angles C4'-P-C4' energy: -97.750 flat angles P-C4'-P energy: -64.803 tors. eta vs tors. theta energy: -121.869 Dist. restrs. and SS energy: 0.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1394.961617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.961617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.208946 (E_RNA) where: Base-Base interactions energy: -1014.465 where: short stacking energy: -417.013 Base-Backbone interact. energy: 1.200 local terms energy: -420.944148 where: bonds (distance) C4'-P energy: -68.684 bonds (distance) P-C4' energy: -79.483 flat angles C4'-P-C4' energy: -95.675 flat angles P-C4'-P energy: -64.222 tors. eta vs tors. theta energy: -112.880 Dist. restrs. and SS energy: 2.497 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1404.218848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.218848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.653562 (E_RNA) where: Base-Base interactions energy: -1008.981 where: short stacking energy: -416.661 Base-Backbone interact. energy: -2.013 local terms energy: -431.659521 where: bonds (distance) C4'-P energy: -72.675 bonds (distance) P-C4' energy: -78.354 flat angles C4'-P-C4' energy: -85.926 flat angles P-C4'-P energy: -71.248 tors. eta vs tors. theta energy: -123.456 Dist. restrs. and SS energy: 1.685 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1356.588662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.588662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.494642 (E_RNA) where: Base-Base interactions energy: -986.168 where: short stacking energy: -407.447 Base-Backbone interact. energy: -1.902 local terms energy: -407.424031 where: bonds (distance) C4'-P energy: -66.408 bonds (distance) P-C4' energy: -91.267 flat angles C4'-P-C4' energy: -78.879 flat angles P-C4'-P energy: -57.699 tors. eta vs tors. theta energy: -113.171 Dist. restrs. and SS energy: 2.156 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -1231.027530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.027530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.644284 (E_RNA) where: Base-Base interactions energy: -907.875 where: short stacking energy: -378.425 Base-Backbone interact. energy: -0.056 local terms energy: -370.713570 where: bonds (distance) C4'-P energy: -54.418 bonds (distance) P-C4' energy: -63.964 flat angles C4'-P-C4' energy: -88.692 flat angles P-C4'-P energy: -54.816 tors. eta vs tors. theta energy: -108.824 Dist. restrs. and SS energy: 10.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1701.440410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.440410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.962832 (E_RNA) where: Base-Base interactions energy: -1216.662 where: short stacking energy: -515.004 Base-Backbone interact. energy: -1.849 local terms energy: -520.452423 where: bonds (distance) C4'-P energy: -97.023 bonds (distance) P-C4' energy: -97.374 flat angles C4'-P-C4' energy: -109.288 flat angles P-C4'-P energy: -71.338 tors. eta vs tors. theta energy: -145.430 Dist. restrs. and SS energy: 0.772 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1645.059701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.059701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.602651 (E_RNA) where: Base-Base interactions energy: -1201.490 where: short stacking energy: -491.580 Base-Backbone interact. energy: -2.784 local terms energy: -478.328826 where: bonds (distance) C4'-P energy: -88.169 bonds (distance) P-C4' energy: -83.539 flat angles C4'-P-C4' energy: -99.249 flat angles P-C4'-P energy: -70.811 tors. eta vs tors. theta energy: -136.561 Dist. restrs. and SS energy: 0.793 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1605.765800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.765800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.522743 (E_RNA) where: Base-Base interactions energy: -1174.894 where: short stacking energy: -481.415 Base-Backbone interact. energy: -0.280 local terms energy: -468.348783 where: bonds (distance) C4'-P energy: -92.829 bonds (distance) P-C4' energy: -79.856 flat angles C4'-P-C4' energy: -93.778 flat angles P-C4'-P energy: -64.951 tors. eta vs tors. theta energy: -136.936 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1561.251360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.251360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.854557 (E_RNA) where: Base-Base interactions energy: -1112.570 where: short stacking energy: -462.833 Base-Backbone interact. energy: -1.337 local terms energy: -484.947271 where: bonds (distance) C4'-P energy: -92.777 bonds (distance) P-C4' energy: -87.071 flat angles C4'-P-C4' energy: -104.600 flat angles P-C4'-P energy: -71.182 tors. eta vs tors. theta energy: -129.318 Dist. restrs. and SS energy: 0.853 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1514.055284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.055284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.379711 (E_RNA) where: Base-Base interactions energy: -1096.804 where: short stacking energy: -473.957 Base-Backbone interact. energy: -2.207 local terms energy: -454.368478 where: bonds (distance) C4'-P energy: -73.199 bonds (distance) P-C4' energy: -91.132 flat angles C4'-P-C4' energy: -100.611 flat angles P-C4'-P energy: -56.733 tors. eta vs tors. theta energy: -132.694 Dist. restrs. and SS energy: 2.574 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1451.832952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.832952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.036702 (E_RNA) where: Base-Base interactions energy: -1039.299 where: short stacking energy: -451.619 Base-Backbone interact. energy: -1.892 local terms energy: -449.845104 where: bonds (distance) C4'-P energy: -85.914 bonds (distance) P-C4' energy: -91.404 flat angles C4'-P-C4' energy: -93.425 flat angles P-C4'-P energy: -57.476 tors. eta vs tors. theta energy: -121.627 Dist. restrs. and SS energy: 2.454 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1454.078332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.078332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.733703 (E_RNA) where: Base-Base interactions energy: -1045.520 where: short stacking energy: -430.043 Base-Backbone interact. energy: -2.047 local terms energy: -445.166482 where: bonds (distance) C4'-P energy: -77.135 bonds (distance) P-C4' energy: -91.677 flat angles C4'-P-C4' energy: -102.217 flat angles P-C4'-P energy: -60.780 tors. eta vs tors. theta energy: -113.358 Dist. restrs. and SS energy: 1.905 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1377.045302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.045302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.398572 (E_RNA) where: Base-Base interactions energy: -1023.201 where: short stacking energy: -411.458 Base-Backbone interact. energy: 3.110 local terms energy: -395.307136 where: bonds (distance) C4'-P energy: -77.152 bonds (distance) P-C4' energy: -81.274 flat angles C4'-P-C4' energy: -94.435 flat angles P-C4'-P energy: -38.226 tors. eta vs tors. theta energy: -104.220 Dist. restrs. and SS energy: 1.603 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1367.999793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.999793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.864346 (E_RNA) where: Base-Base interactions energy: -994.907 where: short stacking energy: -412.870 Base-Backbone interact. energy: -0.960 local terms energy: -410.996866 where: bonds (distance) C4'-P energy: -71.267 bonds (distance) P-C4' energy: -79.528 flat angles C4'-P-C4' energy: -92.133 flat angles P-C4'-P energy: -54.853 tors. eta vs tors. theta energy: -113.216 Dist. restrs. and SS energy: 2.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -1298.667716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.667716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.963193 (E_RNA) where: Base-Base interactions energy: -938.062 where: short stacking energy: -381.631 Base-Backbone interact. energy: -1.424 local terms energy: -403.477174 where: bonds (distance) C4'-P energy: -80.079 bonds (distance) P-C4' energy: -76.502 flat angles C4'-P-C4' energy: -98.865 flat angles P-C4'-P energy: -55.649 tors. eta vs tors. theta energy: -92.382 Dist. restrs. and SS energy: 7.545 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1715.322047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.322047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1752.700009 (E_RNA) where: Base-Base interactions energy: -1252.630 where: short stacking energy: -511.359 Base-Backbone interact. energy: 0.666 local terms energy: -500.735733 where: bonds (distance) C4'-P energy: -97.853 bonds (distance) P-C4' energy: -82.674 flat angles C4'-P-C4' energy: -109.363 flat angles P-C4'-P energy: -69.937 tors. eta vs tors. theta energy: -140.909 Dist. restrs. and SS energy: 0.628 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1650.274952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1650.274952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.595606 (E_RNA) where: Base-Base interactions energy: -1191.720 where: short stacking energy: -511.000 Base-Backbone interact. energy: -2.232 local terms energy: -493.643718 where: bonds (distance) C4'-P energy: -90.510 bonds (distance) P-C4' energy: -83.347 flat angles C4'-P-C4' energy: -107.049 flat angles P-C4'-P energy: -66.110 tors. eta vs tors. theta energy: -146.628 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1623.056011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.056011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.719503 (E_RNA) where: Base-Base interactions energy: -1179.530 where: short stacking energy: -467.487 Base-Backbone interact. energy: -1.805 local terms energy: -479.384528 where: bonds (distance) C4'-P energy: -79.365 bonds (distance) P-C4' energy: -97.450 flat angles C4'-P-C4' energy: -105.963 flat angles P-C4'-P energy: -57.582 tors. eta vs tors. theta energy: -139.025 Dist. restrs. and SS energy: 0.913 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1559.016477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.016477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.619429 (E_RNA) where: Base-Base interactions energy: -1106.720 where: short stacking energy: -454.877 Base-Backbone interact. energy: -2.509 local terms energy: -487.390828 where: bonds (distance) C4'-P energy: -78.627 bonds (distance) P-C4' energy: -82.163 flat angles C4'-P-C4' energy: -114.684 flat angles P-C4'-P energy: -74.484 tors. eta vs tors. theta energy: -137.433 Dist. restrs. and SS energy: 0.853 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1536.243533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.243533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.993104 (E_RNA) where: Base-Base interactions energy: -1125.923 where: short stacking energy: -470.092 Base-Backbone interact. energy: -1.642 local terms energy: -446.427620 where: bonds (distance) C4'-P energy: -74.366 bonds (distance) P-C4' energy: -93.226 flat angles C4'-P-C4' energy: -87.806 flat angles P-C4'-P energy: -57.988 tors. eta vs tors. theta energy: -133.042 Dist. restrs. and SS energy: 1.000 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1454.067639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.067639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.001920 (E_RNA) where: Base-Base interactions energy: -1055.162 where: short stacking energy: -431.675 Base-Backbone interact. energy: -0.776 local terms energy: -436.063976 where: bonds (distance) C4'-P energy: -83.091 bonds (distance) P-C4' energy: -88.236 flat angles C4'-P-C4' energy: -89.930 flat angles P-C4'-P energy: -64.168 tors. eta vs tors. theta energy: -110.639 Dist. restrs. and SS energy: 1.184 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1419.191294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.191294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.667634 (E_RNA) where: Base-Base interactions energy: -1044.279 where: short stacking energy: -428.046 Base-Backbone interact. energy: -0.163 local terms energy: -413.225721 where: bonds (distance) C4'-P energy: -62.038 bonds (distance) P-C4' energy: -74.926 flat angles C4'-P-C4' energy: -95.639 flat angles P-C4'-P energy: -63.623 tors. eta vs tors. theta energy: -117.000 Dist. restrs. and SS energy: 1.726 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1365.258385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.258385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.123548 (E_RNA) where: Base-Base interactions energy: -1009.916 where: short stacking energy: -405.077 Base-Backbone interact. energy: -0.519 local terms energy: -392.688639 where: bonds (distance) C4'-P energy: -78.261 bonds (distance) P-C4' energy: -68.037 flat angles C4'-P-C4' energy: -80.470 flat angles P-C4'-P energy: -61.792 tors. eta vs tors. theta energy: -104.128 Dist. restrs. and SS energy: 1.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1340.431101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.431101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.429947 (E_RNA) where: Base-Base interactions energy: -1003.444 where: short stacking energy: -406.644 Base-Backbone interact. energy: -0.306 local terms energy: -376.680214 where: bonds (distance) C4'-P energy: -62.609 bonds (distance) P-C4' energy: -73.772 flat angles C4'-P-C4' energy: -84.892 flat angles P-C4'-P energy: -45.926 tors. eta vs tors. theta energy: -109.481 Dist. restrs. and SS energy: 3.249 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -1288.528588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.528588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.857070 (E_RNA) where: Base-Base interactions energy: -959.530 where: short stacking energy: -387.763 Base-Backbone interact. energy: -1.950 local terms energy: -374.377497 where: bonds (distance) C4'-P energy: -72.892 bonds (distance) P-C4' energy: -75.400 flat angles C4'-P-C4' energy: -82.368 flat angles P-C4'-P energy: -50.247 tors. eta vs tors. theta energy: -93.470 Dist. restrs. and SS energy: 10.578 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1679.585662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.585662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.361001 (E_RNA) where: Base-Base interactions energy: -1190.263 where: short stacking energy: -490.470 Base-Backbone interact. energy: -0.467 local terms energy: -526.630917 where: bonds (distance) C4'-P energy: -101.019 bonds (distance) P-C4' energy: -101.847 flat angles C4'-P-C4' energy: -113.099 flat angles P-C4'-P energy: -69.270 tors. eta vs tors. theta energy: -141.396 Dist. restrs. and SS energy: 1.025 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1694.724379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.724379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.945343 (E_RNA) where: Base-Base interactions energy: -1233.080 where: short stacking energy: -523.105 Base-Backbone interact. energy: -3.020 local terms energy: -495.845516 where: bonds (distance) C4'-P energy: -91.899 bonds (distance) P-C4' energy: -98.547 flat angles C4'-P-C4' energy: -96.875 flat angles P-C4'-P energy: -65.026 tors. eta vs tors. theta energy: -143.498 Dist. restrs. and SS energy: 0.471 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1618.537265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.537265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.699952 (E_RNA) where: Base-Base interactions energy: -1174.228 where: short stacking energy: -481.314 Base-Backbone interact. energy: -2.119 local terms energy: -479.351989 where: bonds (distance) C4'-P energy: -82.222 bonds (distance) P-C4' energy: -89.676 flat angles C4'-P-C4' energy: -102.247 flat angles P-C4'-P energy: -69.790 tors. eta vs tors. theta energy: -135.417 Dist. restrs. and SS energy: 0.413 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1578.198529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.198529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.189800 (E_RNA) where: Base-Base interactions energy: -1132.399 where: short stacking energy: -490.081 Base-Backbone interact. energy: -1.150 local terms energy: -482.640654 where: bonds (distance) C4'-P energy: -87.090 bonds (distance) P-C4' energy: -77.650 flat angles C4'-P-C4' energy: -112.680 flat angles P-C4'-P energy: -68.221 tors. eta vs tors. theta energy: -137.000 Dist. restrs. and SS energy: 1.241 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1483.229452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.229452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.289382 (E_RNA) where: Base-Base interactions energy: -1074.832 where: short stacking energy: -438.364 Base-Backbone interact. energy: -0.886 local terms energy: -445.570777 where: bonds (distance) C4'-P energy: -75.795 bonds (distance) P-C4' energy: -84.087 flat angles C4'-P-C4' energy: -98.996 flat angles P-C4'-P energy: -63.834 tors. eta vs tors. theta energy: -122.859 Dist. restrs. and SS energy: 1.310 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1452.187556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.187556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.512510 (E_RNA) where: Base-Base interactions energy: -1048.845 where: short stacking energy: -433.167 Base-Backbone interact. energy: -0.998 local terms energy: -439.670038 where: bonds (distance) C4'-P energy: -77.580 bonds (distance) P-C4' energy: -87.041 flat angles C4'-P-C4' energy: -96.394 flat angles P-C4'-P energy: -63.128 tors. eta vs tors. theta energy: -115.527 Dist. restrs. and SS energy: 0.575 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1429.963172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.963172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.596705 (E_RNA) where: Base-Base interactions energy: -1043.410 where: short stacking energy: -425.981 Base-Backbone interact. energy: -1.238 local terms energy: -422.948381 where: bonds (distance) C4'-P energy: -68.405 bonds (distance) P-C4' energy: -90.827 flat angles C4'-P-C4' energy: -93.163 flat angles P-C4'-P energy: -53.441 tors. eta vs tors. theta energy: -117.112 Dist. restrs. and SS energy: 0.884 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1393.134629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.134629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.987417 (E_RNA) where: Base-Base interactions energy: -1002.243 where: short stacking energy: -420.430 Base-Backbone interact. energy: -2.436 local terms energy: -426.308770 where: bonds (distance) C4'-P energy: -78.193 bonds (distance) P-C4' energy: -82.893 flat angles C4'-P-C4' energy: -89.366 flat angles P-C4'-P energy: -56.281 tors. eta vs tors. theta energy: -119.576 Dist. restrs. and SS energy: 1.103 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1369.426918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.426918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.213048 (E_RNA) where: Base-Base interactions energy: -1007.734 where: short stacking energy: -428.401 Base-Backbone interact. energy: -0.972 local terms energy: -399.507712 where: bonds (distance) C4'-P energy: -74.413 bonds (distance) P-C4' energy: -76.983 flat angles C4'-P-C4' energy: -72.812 flat angles P-C4'-P energy: -48.499 tors. eta vs tors. theta energy: -126.801 Dist. restrs. and SS energy: 2.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -1281.471197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.471197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.459834 (E_RNA) where: Base-Base interactions energy: -959.559 where: short stacking energy: -381.589 Base-Backbone interact. energy: 2.705 local terms energy: -369.605647 where: bonds (distance) C4'-P energy: -68.512 bonds (distance) P-C4' energy: -70.149 flat angles C4'-P-C4' energy: -82.812 flat angles P-C4'-P energy: -49.776 tors. eta vs tors. theta energy: -98.357 Dist. restrs. and SS energy: 8.239 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1690.912538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.912538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.481568 (E_RNA) where: Base-Base interactions energy: -1229.263 where: short stacking energy: -533.218 Base-Backbone interact. energy: -0.273 local terms energy: -498.945905 where: bonds (distance) C4'-P energy: -89.715 bonds (distance) P-C4' energy: -96.358 flat angles C4'-P-C4' energy: -97.991 flat angles P-C4'-P energy: -67.272 tors. eta vs tors. theta energy: -147.611 Dist. restrs. and SS energy: 0.819 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1684.628969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1684.628969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.963449 (E_RNA) where: Base-Base interactions energy: -1218.374 where: short stacking energy: -516.316 Base-Backbone interact. energy: -0.238 local terms energy: -503.351908 where: bonds (distance) C4'-P energy: -92.693 bonds (distance) P-C4' energy: -92.807 flat angles C4'-P-C4' energy: -105.799 flat angles P-C4'-P energy: -71.253 tors. eta vs tors. theta energy: -140.800 Dist. restrs. and SS energy: 0.584 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1629.494440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.494440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.994351 (E_RNA) where: Base-Base interactions energy: -1167.655 where: short stacking energy: -508.323 Base-Backbone interact. energy: 1.089 local terms energy: -502.427898 where: bonds (distance) C4'-P energy: -86.811 bonds (distance) P-C4' energy: -93.521 flat angles C4'-P-C4' energy: -104.844 flat angles P-C4'-P energy: -75.314 tors. eta vs tors. theta energy: -141.939 Dist. restrs. and SS energy: 2.750 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1559.231087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.231087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.933133 (E_RNA) where: Base-Base interactions energy: -1130.883 where: short stacking energy: -461.629 Base-Backbone interact. energy: -2.105 local terms energy: -463.944490 where: bonds (distance) C4'-P energy: -74.952 bonds (distance) P-C4' energy: -105.607 flat angles C4'-P-C4' energy: -104.299 flat angles P-C4'-P energy: -51.253 tors. eta vs tors. theta energy: -127.833 Dist. restrs. and SS energy: 0.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1575.147861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.147861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.690508 (E_RNA) where: Base-Base interactions energy: -1149.025 where: short stacking energy: -461.150 Base-Backbone interact. energy: -1.425 local terms energy: -462.241051 where: bonds (distance) C4'-P energy: -82.813 bonds (distance) P-C4' energy: -89.761 flat angles C4'-P-C4' energy: -99.234 flat angles P-C4'-P energy: -58.493 tors. eta vs tors. theta energy: -131.939 Dist. restrs. and SS energy: 0.793 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1501.083797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.083797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.330323 (E_RNA) where: Base-Base interactions energy: -1076.733 where: short stacking energy: -459.686 Base-Backbone interact. energy: 1.473 local terms energy: -464.070734 where: bonds (distance) C4'-P energy: -64.929 bonds (distance) P-C4' energy: -96.327 flat angles C4'-P-C4' energy: -104.510 flat angles P-C4'-P energy: -64.470 tors. eta vs tors. theta energy: -133.835 Dist. restrs. and SS energy: 1.497 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1436.559570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.559570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.914031 (E_RNA) where: Base-Base interactions energy: -1020.858 where: short stacking energy: -434.558 Base-Backbone interact. energy: -1.559 local terms energy: -452.496910 where: bonds (distance) C4'-P energy: -92.670 bonds (distance) P-C4' energy: -93.017 flat angles C4'-P-C4' energy: -85.294 flat angles P-C4'-P energy: -64.472 tors. eta vs tors. theta energy: -117.045 Dist. restrs. and SS energy: 1.604 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1392.645751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.645751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.361811 (E_RNA) where: Base-Base interactions energy: -1027.538 where: short stacking energy: -415.930 Base-Backbone interact. energy: -1.419 local terms energy: -402.405008 where: bonds (distance) C4'-P energy: -74.901 bonds (distance) P-C4' energy: -85.852 flat angles C4'-P-C4' energy: -82.089 flat angles P-C4'-P energy: -48.605 tors. eta vs tors. theta energy: -110.957 Dist. restrs. and SS energy: 1.966 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1351.177569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.177569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.608487 (E_RNA) where: Base-Base interactions energy: -991.639 where: short stacking energy: -408.741 Base-Backbone interact. energy: -0.404 local terms energy: -397.565690 where: bonds (distance) C4'-P energy: -64.539 bonds (distance) P-C4' energy: -81.828 flat angles C4'-P-C4' energy: -89.591 flat angles P-C4'-P energy: -51.297 tors. eta vs tors. theta energy: -110.311 Dist. restrs. and SS energy: 1.681 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -1293.813176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.813176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.619932 (E_RNA) where: Base-Base interactions energy: -969.193 where: short stacking energy: -392.955 Base-Backbone interact. energy: -1.301 local terms energy: -367.125724 where: bonds (distance) C4'-P energy: -57.069 bonds (distance) P-C4' energy: -78.164 flat angles C4'-P-C4' energy: -74.982 flat angles P-C4'-P energy: -50.559 tors. eta vs tors. theta energy: -106.352 Dist. restrs. and SS energy: 7.057 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1684.090044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1684.090044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.889505 (E_RNA) where: Base-Base interactions energy: -1197.838 where: short stacking energy: -514.132 Base-Backbone interact. energy: -1.629 local terms energy: -522.422553 where: bonds (distance) C4'-P energy: -95.696 bonds (distance) P-C4' energy: -95.010 flat angles C4'-P-C4' energy: -107.405 flat angles P-C4'-P energy: -77.187 tors. eta vs tors. theta energy: -147.124 Dist. restrs. and SS energy: 1.049 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1663.945152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1663.945152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1701.430902 (E_RNA) where: Base-Base interactions energy: -1199.055 where: short stacking energy: -499.639 Base-Backbone interact. energy: -1.713 local terms energy: -500.663398 where: bonds (distance) C4'-P energy: -95.753 bonds (distance) P-C4' energy: -93.580 flat angles C4'-P-C4' energy: -112.503 flat angles P-C4'-P energy: -57.234 tors. eta vs tors. theta energy: -141.593 Dist. restrs. and SS energy: 0.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1615.632553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.632553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.882416 (E_RNA) where: Base-Base interactions energy: -1175.681 where: short stacking energy: -472.315 Base-Backbone interact. energy: -1.918 local terms energy: -476.283335 where: bonds (distance) C4'-P energy: -99.106 bonds (distance) P-C4' energy: -86.783 flat angles C4'-P-C4' energy: -99.749 flat angles P-C4'-P energy: -58.185 tors. eta vs tors. theta energy: -132.461 Dist. restrs. and SS energy: 1.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1521.740611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1521.740611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.892029 (E_RNA) where: Base-Base interactions energy: -1090.465 where: short stacking energy: -463.620 Base-Backbone interact. energy: -1.513 local terms energy: -466.913604 where: bonds (distance) C4'-P energy: -85.765 bonds (distance) P-C4' energy: -94.640 flat angles C4'-P-C4' energy: -96.208 flat angles P-C4'-P energy: -63.930 tors. eta vs tors. theta energy: -126.370 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1531.497067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.497067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.334767 (E_RNA) where: Base-Base interactions energy: -1108.642 where: short stacking energy: -455.356 Base-Backbone interact. energy: -0.085 local terms energy: -460.607789 where: bonds (distance) C4'-P energy: -81.100 bonds (distance) P-C4' energy: -80.992 flat angles C4'-P-C4' energy: -100.307 flat angles P-C4'-P energy: -62.311 tors. eta vs tors. theta energy: -135.897 Dist. restrs. and SS energy: 1.088 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1499.586527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.586527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.321800 (E_RNA) where: Base-Base interactions energy: -1092.061 where: short stacking energy: -451.732 Base-Backbone interact. energy: -0.737 local terms energy: -444.523908 where: bonds (distance) C4'-P energy: -73.692 bonds (distance) P-C4' energy: -88.907 flat angles C4'-P-C4' energy: -99.709 flat angles P-C4'-P energy: -57.708 tors. eta vs tors. theta energy: -124.508 Dist. restrs. and SS energy: 0.985 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1418.860514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.860514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.230512 (E_RNA) where: Base-Base interactions energy: -1050.750 where: short stacking energy: -451.406 Base-Backbone interact. energy: -2.950 local terms energy: -403.530809 where: bonds (distance) C4'-P energy: -72.665 bonds (distance) P-C4' energy: -67.218 flat angles C4'-P-C4' energy: -79.748 flat angles P-C4'-P energy: -60.058 tors. eta vs tors. theta energy: -123.842 Dist. restrs. and SS energy: 1.620 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1368.975342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.975342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.855985 (E_RNA) where: Base-Base interactions energy: -1015.916 where: short stacking energy: -411.237 Base-Backbone interact. energy: -2.442 local terms energy: -388.497518 where: bonds (distance) C4'-P energy: -74.097 bonds (distance) P-C4' energy: -58.477 flat angles C4'-P-C4' energy: -97.202 flat angles P-C4'-P energy: -52.035 tors. eta vs tors. theta energy: -106.686 Dist. restrs. and SS energy: 1.131 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1278.204869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.204869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.140684 (E_RNA) where: Base-Base interactions energy: -962.640 where: short stacking energy: -401.330 Base-Backbone interact. energy: 3.475 local terms energy: -365.976040 where: bonds (distance) C4'-P energy: -75.703 bonds (distance) P-C4' energy: -61.540 flat angles C4'-P-C4' energy: -82.951 flat angles P-C4'-P energy: -50.550 tors. eta vs tors. theta energy: -95.232 Dist. restrs. and SS energy: 10.186 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -1348.560632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.560632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.690237 (E_RNA) where: Base-Base interactions energy: -1000.854 where: short stacking energy: -397.510 Base-Backbone interact. energy: -1.065 local terms energy: -385.770986 where: bonds (distance) C4'-P energy: -57.699 bonds (distance) P-C4' energy: -62.578 flat angles C4'-P-C4' energy: -89.661 flat angles P-C4'-P energy: -53.583 tors. eta vs tors. theta energy: -122.250 Dist. restrs. and SS energy: 2.380 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1689.090142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.090142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.361773 (E_RNA) where: Base-Base interactions energy: -1223.753 where: short stacking energy: -510.411 Base-Backbone interact. energy: 0.776 local terms energy: -504.385141 where: bonds (distance) C4'-P energy: -89.669 bonds (distance) P-C4' energy: -93.632 flat angles C4'-P-C4' energy: -104.393 flat angles P-C4'-P energy: -73.401 tors. eta vs tors. theta energy: -143.289 Dist. restrs. and SS energy: 1.522 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1670.350579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1670.350579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.319897 (E_RNA) where: Base-Base interactions energy: -1223.564 where: short stacking energy: -507.822 Base-Backbone interact. energy: -0.863 local terms energy: -483.893118 where: bonds (distance) C4'-P energy: -92.127 bonds (distance) P-C4' energy: -86.379 flat angles C4'-P-C4' energy: -107.070 flat angles P-C4'-P energy: -58.283 tors. eta vs tors. theta energy: -140.034 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1634.883992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.883992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.570267 (E_RNA) where: Base-Base interactions energy: -1191.841 where: short stacking energy: -507.385 Base-Backbone interact. energy: -0.624 local terms energy: -481.104939 where: bonds (distance) C4'-P energy: -90.675 bonds (distance) P-C4' energy: -82.607 flat angles C4'-P-C4' energy: -103.225 flat angles P-C4'-P energy: -64.269 tors. eta vs tors. theta energy: -140.329 Dist. restrs. and SS energy: 1.936 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1565.016702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.016702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.340036 (E_RNA) where: Base-Base interactions energy: -1122.332 where: short stacking energy: -479.733 Base-Backbone interact. energy: -0.971 local terms energy: -480.037284 where: bonds (distance) C4'-P energy: -97.451 bonds (distance) P-C4' energy: -86.094 flat angles C4'-P-C4' energy: -100.300 flat angles P-C4'-P energy: -58.461 tors. eta vs tors. theta energy: -137.731 Dist. restrs. and SS energy: 1.573 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1511.293146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.293146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.865562 (E_RNA) where: Base-Base interactions energy: -1107.435 where: short stacking energy: -454.671 Base-Backbone interact. energy: -1.277 local terms energy: -440.152734 where: bonds (distance) C4'-P energy: -80.014 bonds (distance) P-C4' energy: -80.133 flat angles C4'-P-C4' energy: -101.541 flat angles P-C4'-P energy: -55.763 tors. eta vs tors. theta energy: -122.701 Dist. restrs. and SS energy: 0.822 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1465.937232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.937232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.094193 (E_RNA) where: Base-Base interactions energy: -1081.916 where: short stacking energy: -431.473 Base-Backbone interact. energy: -2.084 local terms energy: -421.094509 where: bonds (distance) C4'-P energy: -78.352 bonds (distance) P-C4' energy: -81.112 flat angles C4'-P-C4' energy: -83.569 flat angles P-C4'-P energy: -55.665 tors. eta vs tors. theta energy: -122.397 Dist. restrs. and SS energy: 2.407 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1451.084878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.084878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.042786 (E_RNA) where: Base-Base interactions energy: -1053.495 where: short stacking energy: -416.684 Base-Backbone interact. energy: 1.513 local terms energy: -438.060505 where: bonds (distance) C4'-P energy: -80.944 bonds (distance) P-C4' energy: -74.194 flat angles C4'-P-C4' energy: -93.420 flat angles P-C4'-P energy: -71.025 tors. eta vs tors. theta energy: -118.477 Dist. restrs. and SS energy: 2.208 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1407.454832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.454832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.781258 (E_RNA) where: Base-Base interactions energy: -1031.224 where: short stacking energy: -432.874 Base-Backbone interact. energy: -0.442 local terms energy: -415.115657 where: bonds (distance) C4'-P energy: -55.684 bonds (distance) P-C4' energy: -73.608 flat angles C4'-P-C4' energy: -98.017 flat angles P-C4'-P energy: -72.529 tors. eta vs tors. theta energy: -115.278 Dist. restrs. and SS energy: 2.576 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1304.068793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.068793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.384715 (E_RNA) where: Base-Base interactions energy: -966.358 where: short stacking energy: -394.992 Base-Backbone interact. energy: 0.191 local terms energy: -382.217613 where: bonds (distance) C4'-P energy: -68.568 bonds (distance) P-C4' energy: -71.473 flat angles C4'-P-C4' energy: -76.327 flat angles P-C4'-P energy: -54.817 tors. eta vs tors. theta energy: -111.032 Dist. restrs. and SS energy: 7.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -1312.379075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.379075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.838166 (E_RNA) where: Base-Base interactions energy: -987.862 where: short stacking energy: -412.775 Base-Backbone interact. energy: -1.144 local terms energy: -361.832286 where: bonds (distance) C4'-P energy: -63.632 bonds (distance) P-C4' energy: -60.870 flat angles C4'-P-C4' energy: -81.112 flat angles P-C4'-P energy: -47.420 tors. eta vs tors. theta energy: -108.798 Dist. restrs. and SS energy: 1.709 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1694.618890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.618890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.263617 (E_RNA) where: Base-Base interactions energy: -1226.344 where: short stacking energy: -518.892 Base-Backbone interact. energy: -2.319 local terms energy: -503.600580 where: bonds (distance) C4'-P energy: -90.396 bonds (distance) P-C4' energy: -96.669 flat angles C4'-P-C4' energy: -106.081 flat angles P-C4'-P energy: -70.509 tors. eta vs tors. theta energy: -139.945 Dist. restrs. and SS energy: 0.895 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1642.296757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.296757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.170932 (E_RNA) where: Base-Base interactions energy: -1189.433 where: short stacking energy: -504.855 Base-Backbone interact. energy: -1.161 local terms energy: -489.576592 where: bonds (distance) C4'-P energy: -84.373 bonds (distance) P-C4' energy: -85.427 flat angles C4'-P-C4' energy: -107.720 flat angles P-C4'-P energy: -65.264 tors. eta vs tors. theta energy: -146.792 Dist. restrs. and SS energy: 1.124 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1668.401983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.401983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1705.955631 (E_RNA) where: Base-Base interactions energy: -1204.821 where: short stacking energy: -523.577 Base-Backbone interact. energy: 0.440 local terms energy: -501.574921 where: bonds (distance) C4'-P energy: -89.691 bonds (distance) P-C4' energy: -95.344 flat angles C4'-P-C4' energy: -103.147 flat angles P-C4'-P energy: -64.053 tors. eta vs tors. theta energy: -149.340 Dist. restrs. and SS energy: 0.804 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1563.330577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.330577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.657830 (E_RNA) where: Base-Base interactions energy: -1135.788 where: short stacking energy: -462.079 Base-Backbone interact. energy: 1.857 local terms energy: -466.726837 where: bonds (distance) C4'-P energy: -87.895 bonds (distance) P-C4' energy: -84.483 flat angles C4'-P-C4' energy: -92.832 flat angles P-C4'-P energy: -63.102 tors. eta vs tors. theta energy: -138.415 Dist. restrs. and SS energy: 0.577 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1520.702743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.702743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.865656 (E_RNA) where: Base-Base interactions energy: -1112.223 where: short stacking energy: -455.872 Base-Backbone interact. energy: -0.293 local terms energy: -446.350057 where: bonds (distance) C4'-P energy: -74.859 bonds (distance) P-C4' energy: -74.369 flat angles C4'-P-C4' energy: -96.496 flat angles P-C4'-P energy: -67.412 tors. eta vs tors. theta energy: -133.214 Dist. restrs. and SS energy: 1.413 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1503.967266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.967266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1542.680423 (E_RNA) where: Base-Base interactions energy: -1084.667 where: short stacking energy: -460.309 Base-Backbone interact. energy: -0.617 local terms energy: -457.396477 where: bonds (distance) C4'-P energy: -79.500 bonds (distance) P-C4' energy: -91.631 flat angles C4'-P-C4' energy: -95.448 flat angles P-C4'-P energy: -58.617 tors. eta vs tors. theta energy: -132.200 Dist. restrs. and SS energy: 1.963 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1437.980130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.980130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.606289 (E_RNA) where: Base-Base interactions energy: -1048.641 where: short stacking energy: -420.899 Base-Backbone interact. energy: -1.213 local terms energy: -425.753117 where: bonds (distance) C4'-P energy: -80.184 bonds (distance) P-C4' energy: -83.177 flat angles C4'-P-C4' energy: -93.018 flat angles P-C4'-P energy: -46.026 tors. eta vs tors. theta energy: -123.349 Dist. restrs. and SS energy: 0.876 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1420.867171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.867171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.107487 (E_RNA) where: Base-Base interactions energy: -1041.152 where: short stacking energy: -435.452 Base-Backbone interact. energy: -0.487 local terms energy: -417.468165 where: bonds (distance) C4'-P energy: -75.449 bonds (distance) P-C4' energy: -74.176 flat angles C4'-P-C4' energy: -95.328 flat angles P-C4'-P energy: -48.930 tors. eta vs tors. theta energy: -123.585 Dist. restrs. and SS energy: 1.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1319.322640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.322640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.120997 (E_RNA) where: Base-Base interactions energy: -943.084 where: short stacking energy: -377.200 Base-Backbone interact. energy: 0.110 local terms energy: -415.146189 where: bonds (distance) C4'-P energy: -79.894 bonds (distance) P-C4' energy: -96.996 flat angles C4'-P-C4' energy: -92.687 flat angles P-C4'-P energy: -46.931 tors. eta vs tors. theta energy: -98.637 Dist. restrs. and SS energy: 2.048 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -1352.460765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.460765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.898072 (E_RNA) where: Base-Base interactions energy: -991.887 where: short stacking energy: -402.107 Base-Backbone interact. energy: -0.582 local terms energy: -398.429122 where: bonds (distance) C4'-P energy: -62.311 bonds (distance) P-C4' energy: -74.148 flat angles C4'-P-C4' energy: -92.767 flat angles P-C4'-P energy: -59.102 tors. eta vs tors. theta energy: -110.101 Dist. restrs. and SS energy: 1.687 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1693.005023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.005023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.525970 (E_RNA) where: Base-Base interactions energy: -1219.378 where: short stacking energy: -502.363 Base-Backbone interact. energy: -0.998 local terms energy: -510.149965 where: bonds (distance) C4'-P energy: -93.820 bonds (distance) P-C4' energy: -94.517 flat angles C4'-P-C4' energy: -116.464 flat angles P-C4'-P energy: -67.274 tors. eta vs tors. theta energy: -138.076 Dist. restrs. and SS energy: 0.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1649.652399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.652399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.744775 (E_RNA) where: Base-Base interactions energy: -1194.733 where: short stacking energy: -498.363 Base-Backbone interact. energy: 0.623 local terms energy: -493.634686 where: bonds (distance) C4'-P energy: -81.719 bonds (distance) P-C4' energy: -100.561 flat angles C4'-P-C4' energy: -105.714 flat angles P-C4'-P energy: -62.774 tors. eta vs tors. theta energy: -142.866 Dist. restrs. and SS energy: 1.342 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1591.880212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.880212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.866344 (E_RNA) where: Base-Base interactions energy: -1151.752 where: short stacking energy: -476.085 Base-Backbone interact. energy: -0.998 local terms energy: -477.115670 where: bonds (distance) C4'-P energy: -78.948 bonds (distance) P-C4' energy: -87.483 flat angles C4'-P-C4' energy: -101.341 flat angles P-C4'-P energy: -74.245 tors. eta vs tors. theta energy: -135.098 Dist. restrs. and SS energy: 1.236 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1598.378395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.378395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.392690 (E_RNA) where: Base-Base interactions energy: -1167.642 where: short stacking energy: -492.673 Base-Backbone interact. energy: 0.404 local terms energy: -468.154638 where: bonds (distance) C4'-P energy: -80.557 bonds (distance) P-C4' energy: -90.707 flat angles C4'-P-C4' energy: -87.572 flat angles P-C4'-P energy: -64.991 tors. eta vs tors. theta energy: -144.328 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1482.210658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.210658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.945029 (E_RNA) where: Base-Base interactions energy: -1075.785 where: short stacking energy: -436.801 Base-Backbone interact. energy: -1.300 local terms energy: -442.859672 where: bonds (distance) C4'-P energy: -77.506 bonds (distance) P-C4' energy: -80.880 flat angles C4'-P-C4' energy: -92.774 flat angles P-C4'-P energy: -60.469 tors. eta vs tors. theta energy: -131.231 Dist. restrs. and SS energy: 0.984 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1483.803133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.803133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.636453 (E_RNA) where: Base-Base interactions energy: -1091.801 where: short stacking energy: -430.561 Base-Backbone interact. energy: -2.166 local terms energy: -429.669580 where: bonds (distance) C4'-P energy: -78.997 bonds (distance) P-C4' energy: -85.195 flat angles C4'-P-C4' energy: -90.556 flat angles P-C4'-P energy: -57.669 tors. eta vs tors. theta energy: -117.253 Dist. restrs. and SS energy: 3.083 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1416.294857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.294857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.173431 (E_RNA) where: Base-Base interactions energy: -1016.907 where: short stacking energy: -413.164 Base-Backbone interact. energy: 1.199 local terms energy: -439.464994 where: bonds (distance) C4'-P energy: -78.767 bonds (distance) P-C4' energy: -93.013 flat angles C4'-P-C4' energy: -95.176 flat angles P-C4'-P energy: -60.074 tors. eta vs tors. theta energy: -112.435 Dist. restrs. and SS energy: 2.129 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1359.386607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.386607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.699374 (E_RNA) where: Base-Base interactions energy: -986.985 where: short stacking energy: -400.703 Base-Backbone interact. energy: -1.767 local terms energy: -412.947452 where: bonds (distance) C4'-P energy: -71.934 bonds (distance) P-C4' energy: -82.969 flat angles C4'-P-C4' energy: -89.378 flat angles P-C4'-P energy: -55.097 tors. eta vs tors. theta energy: -113.569 Dist. restrs. and SS energy: 5.563 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1360.020231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.020231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.953754 (E_RNA) where: Base-Base interactions energy: -988.907 where: short stacking energy: -402.096 Base-Backbone interact. energy: 1.969 local terms energy: -411.015516 where: bonds (distance) C4'-P energy: -75.121 bonds (distance) P-C4' energy: -71.877 flat angles C4'-P-C4' energy: -84.236 flat angles P-C4'-P energy: -63.784 tors. eta vs tors. theta energy: -115.997 Dist. restrs. and SS energy: 1.184 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -1335.956820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.956820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.248184 (E_RNA) where: Base-Base interactions energy: -960.764 where: short stacking energy: -383.437 Base-Backbone interact. energy: -0.163 local terms energy: -414.321504 where: bonds (distance) C4'-P energy: -72.516 bonds (distance) P-C4' energy: -75.872 flat angles C4'-P-C4' energy: -95.806 flat angles P-C4'-P energy: -68.312 tors. eta vs tors. theta energy: -101.815 Dist. restrs. and SS energy: 2.541 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1704.333317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.333317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.557750 (E_RNA) where: Base-Base interactions energy: -1235.950 where: short stacking energy: -496.082 Base-Backbone interact. energy: -1.676 local terms energy: -503.931241 where: bonds (distance) C4'-P energy: -92.266 bonds (distance) P-C4' energy: -102.559 flat angles C4'-P-C4' energy: -102.190 flat angles P-C4'-P energy: -76.197 tors. eta vs tors. theta energy: -130.719 Dist. restrs. and SS energy: 0.474 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1631.703854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.703854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.442201 (E_RNA) where: Base-Base interactions energy: -1185.975 where: short stacking energy: -506.456 Base-Backbone interact. energy: 0.006 local terms energy: -483.473645 where: bonds (distance) C4'-P energy: -92.236 bonds (distance) P-C4' energy: -90.196 flat angles C4'-P-C4' energy: -105.543 flat angles P-C4'-P energy: -55.977 tors. eta vs tors. theta energy: -139.522 Dist. restrs. and SS energy: 0.988 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1615.323262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.323262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.455713 (E_RNA) where: Base-Base interactions energy: -1171.504 where: short stacking energy: -492.876 Base-Backbone interact. energy: -1.486 local terms energy: -480.464845 where: bonds (distance) C4'-P energy: -85.942 bonds (distance) P-C4' energy: -91.600 flat angles C4'-P-C4' energy: -106.304 flat angles P-C4'-P energy: -54.574 tors. eta vs tors. theta energy: -142.044 Dist. restrs. and SS energy: 1.382 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1529.236330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.236330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.060106 (E_RNA) where: Base-Base interactions energy: -1119.608 where: short stacking energy: -454.438 Base-Backbone interact. energy: -4.357 local terms energy: -444.095369 where: bonds (distance) C4'-P energy: -67.944 bonds (distance) P-C4' energy: -96.757 flat angles C4'-P-C4' energy: -87.466 flat angles P-C4'-P energy: -66.465 tors. eta vs tors. theta energy: -125.463 Dist. restrs. and SS energy: 2.074 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1510.860000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.860000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.701179 (E_RNA) where: Base-Base interactions energy: -1091.311 where: short stacking energy: -470.271 Base-Backbone interact. energy: -2.276 local terms energy: -455.114682 where: bonds (distance) C4'-P energy: -89.428 bonds (distance) P-C4' energy: -85.007 flat angles C4'-P-C4' energy: -93.195 flat angles P-C4'-P energy: -63.079 tors. eta vs tors. theta energy: -124.406 Dist. restrs. and SS energy: 1.091 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1489.400617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.400617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.111372 (E_RNA) where: Base-Base interactions energy: -1071.166 where: short stacking energy: -438.813 Base-Backbone interact. energy: -5.477 local terms energy: -451.468218 where: bonds (distance) C4'-P energy: -80.420 bonds (distance) P-C4' energy: -93.742 flat angles C4'-P-C4' energy: -100.245 flat angles P-C4'-P energy: -46.326 tors. eta vs tors. theta energy: -130.735 Dist. restrs. and SS energy: 1.961 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1473.927665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.927665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.328809 (E_RNA) where: Base-Base interactions energy: -1056.573 where: short stacking energy: -442.207 Base-Backbone interact. energy: -1.087 local terms energy: -453.668415 where: bonds (distance) C4'-P energy: -83.084 bonds (distance) P-C4' energy: -86.591 flat angles C4'-P-C4' energy: -94.055 flat angles P-C4'-P energy: -62.943 tors. eta vs tors. theta energy: -126.995 Dist. restrs. and SS energy: 0.651 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1377.936741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.936741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.039149 (E_RNA) where: Base-Base interactions energy: -998.688 where: short stacking energy: -418.879 Base-Backbone interact. energy: -0.936 local terms energy: -420.415287 where: bonds (distance) C4'-P energy: -63.682 bonds (distance) P-C4' energy: -81.662 flat angles C4'-P-C4' energy: -95.889 flat angles P-C4'-P energy: -57.353 tors. eta vs tors. theta energy: -121.830 Dist. restrs. and SS energy: 5.352 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1344.285764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.285764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.595408 (E_RNA) where: Base-Base interactions energy: -1009.736 where: short stacking energy: -409.850 Base-Backbone interact. energy: -0.016 local terms energy: -372.843375 where: bonds (distance) C4'-P energy: -69.849 bonds (distance) P-C4' energy: -58.392 flat angles C4'-P-C4' energy: -86.608 flat angles P-C4'-P energy: -56.738 tors. eta vs tors. theta energy: -101.257 Dist. restrs. and SS energy: 1.560 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1322.137613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.137613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.891550 (E_RNA) where: Base-Base interactions energy: -974.402 where: short stacking energy: -393.039 Base-Backbone interact. energy: 2.374 local terms energy: -388.863221 where: bonds (distance) C4'-P energy: -73.894 bonds (distance) P-C4' energy: -74.487 flat angles C4'-P-C4' energy: -84.950 flat angles P-C4'-P energy: -39.633 tors. eta vs tors. theta energy: -115.899 Dist. restrs. and SS energy: 2.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1749.601668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1749.601668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.324336 (E_RNA) where: Base-Base interactions energy: -1283.242 where: short stacking energy: -534.121 Base-Backbone interact. energy: 0.264 local terms energy: -504.346437 where: bonds (distance) C4'-P energy: -93.698 bonds (distance) P-C4' energy: -99.369 flat angles C4'-P-C4' energy: -101.056 flat angles P-C4'-P energy: -64.420 tors. eta vs tors. theta energy: -145.803 Dist. restrs. and SS energy: 0.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1657.727760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.727760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.251700 (E_RNA) where: Base-Base interactions energy: -1199.952 where: short stacking energy: -511.542 Base-Backbone interact. energy: -0.498 local terms energy: -494.801880 where: bonds (distance) C4'-P energy: -83.846 bonds (distance) P-C4' energy: -84.399 flat angles C4'-P-C4' energy: -106.521 flat angles P-C4'-P energy: -72.067 tors. eta vs tors. theta energy: -147.969 Dist. restrs. and SS energy: 0.774 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1629.414710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.414710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.715031 (E_RNA) where: Base-Base interactions energy: -1182.665 where: short stacking energy: -504.802 Base-Backbone interact. energy: -0.099 local terms energy: -483.951328 where: bonds (distance) C4'-P energy: -91.293 bonds (distance) P-C4' energy: -83.558 flat angles C4'-P-C4' energy: -102.216 flat angles P-C4'-P energy: -67.428 tors. eta vs tors. theta energy: -139.457 Dist. restrs. and SS energy: 0.550 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1560.280838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.280838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.475530 (E_RNA) where: Base-Base interactions energy: -1120.760 where: short stacking energy: -463.308 Base-Backbone interact. energy: 0.563 local terms energy: -478.278452 where: bonds (distance) C4'-P energy: -90.441 bonds (distance) P-C4' energy: -91.753 flat angles C4'-P-C4' energy: -106.878 flat angles P-C4'-P energy: -60.659 tors. eta vs tors. theta energy: -128.547 Dist. restrs. and SS energy: 1.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1524.769760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.769760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.189829 (E_RNA) where: Base-Base interactions energy: -1108.797 where: short stacking energy: -459.870 Base-Backbone interact. energy: -1.532 local terms energy: -451.861448 where: bonds (distance) C4'-P energy: -86.373 bonds (distance) P-C4' energy: -75.041 flat angles C4'-P-C4' energy: -99.010 flat angles P-C4'-P energy: -63.119 tors. eta vs tors. theta energy: -128.319 Dist. restrs. and SS energy: 0.670 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1505.854240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.854240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.379485 (E_RNA) where: Base-Base interactions energy: -1095.989 where: short stacking energy: -449.737 Base-Backbone interact. energy: -2.594 local terms energy: -449.796344 where: bonds (distance) C4'-P energy: -80.332 bonds (distance) P-C4' energy: -91.396 flat angles C4'-P-C4' energy: -92.224 flat angles P-C4'-P energy: -52.068 tors. eta vs tors. theta energy: -133.775 Dist. restrs. and SS energy: 5.775 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1451.706515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.706515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.647833 (E_RNA) where: Base-Base interactions energy: -1068.216 where: short stacking energy: -422.413 Base-Backbone interact. energy: -0.646 local terms energy: -420.785106 where: bonds (distance) C4'-P energy: -83.795 bonds (distance) P-C4' energy: -91.511 flat angles C4'-P-C4' energy: -82.478 flat angles P-C4'-P energy: -49.647 tors. eta vs tors. theta energy: -113.354 Dist. restrs. and SS energy: 1.191 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1414.416222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.416222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.901649 (E_RNA) where: Base-Base interactions energy: -1027.800 where: short stacking energy: -428.612 Base-Backbone interact. energy: 0.362 local terms energy: -425.463911 where: bonds (distance) C4'-P energy: -80.027 bonds (distance) P-C4' energy: -71.653 flat angles C4'-P-C4' energy: -99.017 flat angles P-C4'-P energy: -53.946 tors. eta vs tors. theta energy: -120.821 Dist. restrs. and SS energy: 1.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1320.773930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.773930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.876269 (E_RNA) where: Base-Base interactions energy: -982.869 where: short stacking energy: -427.707 Base-Backbone interact. energy: -0.977 local terms energy: -379.030672 where: bonds (distance) C4'-P energy: -62.640 bonds (distance) P-C4' energy: -62.626 flat angles C4'-P-C4' energy: -94.658 flat angles P-C4'-P energy: -42.461 tors. eta vs tors. theta energy: -116.645 Dist. restrs. and SS energy: 5.352 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -1325.211672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.211672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.559765 (E_RNA) where: Base-Base interactions energy: -963.013 where: short stacking energy: -381.989 Base-Backbone interact. energy: -0.516 local terms energy: -401.031122 where: bonds (distance) C4'-P energy: -75.080 bonds (distance) P-C4' energy: -78.587 flat angles C4'-P-C4' energy: -89.355 flat angles P-C4'-P energy: -49.996 tors. eta vs tors. theta energy: -108.014 Dist. restrs. and SS energy: 2.598 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1734.983186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.983186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.666876 (E_RNA) where: Base-Base interactions energy: -1251.157 where: short stacking energy: -523.697 Base-Backbone interact. energy: -2.572 local terms energy: -518.937041 where: bonds (distance) C4'-P energy: -90.756 bonds (distance) P-C4' energy: -90.232 flat angles C4'-P-C4' energy: -116.666 flat angles P-C4'-P energy: -77.075 tors. eta vs tors. theta energy: -144.207 Dist. restrs. and SS energy: 0.934 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1658.703495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.703495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.955335 (E_RNA) where: Base-Base interactions energy: -1198.505 where: short stacking energy: -482.161 Base-Backbone interact. energy: -4.378 local terms energy: -493.072449 where: bonds (distance) C4'-P energy: -94.745 bonds (distance) P-C4' energy: -91.365 flat angles C4'-P-C4' energy: -102.636 flat angles P-C4'-P energy: -70.501 tors. eta vs tors. theta energy: -133.825 Dist. restrs. and SS energy: 0.502 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1621.778444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.778444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.881195 (E_RNA) where: Base-Base interactions energy: -1166.223 where: short stacking energy: -486.997 Base-Backbone interact. energy: 0.511 local terms energy: -494.169372 where: bonds (distance) C4'-P energy: -83.898 bonds (distance) P-C4' energy: -98.931 flat angles C4'-P-C4' energy: -104.833 flat angles P-C4'-P energy: -67.662 tors. eta vs tors. theta energy: -138.845 Dist. restrs. and SS energy: 1.353 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1545.487063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.487063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.010807 (E_RNA) where: Base-Base interactions energy: -1109.609 where: short stacking energy: -457.626 Base-Backbone interact. energy: -0.604 local terms energy: -473.797538 where: bonds (distance) C4'-P energy: -87.136 bonds (distance) P-C4' energy: -83.904 flat angles C4'-P-C4' energy: -99.187 flat angles P-C4'-P energy: -67.896 tors. eta vs tors. theta energy: -135.675 Dist. restrs. and SS energy: 1.774 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1522.964358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.964358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.912368 (E_RNA) where: Base-Base interactions energy: -1099.559 where: short stacking energy: -441.916 Base-Backbone interact. energy: -0.146 local terms energy: -463.207513 where: bonds (distance) C4'-P energy: -84.215 bonds (distance) P-C4' energy: -85.527 flat angles C4'-P-C4' energy: -97.086 flat angles P-C4'-P energy: -64.950 tors. eta vs tors. theta energy: -131.429 Dist. restrs. and SS energy: 3.198 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1456.635358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.635358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.857024 (E_RNA) where: Base-Base interactions energy: -1056.685 where: short stacking energy: -453.666 Base-Backbone interact. energy: -0.852 local terms energy: -437.320155 where: bonds (distance) C4'-P energy: -76.079 bonds (distance) P-C4' energy: -79.331 flat angles C4'-P-C4' energy: -102.042 flat angles P-C4'-P energy: -59.670 tors. eta vs tors. theta energy: -120.197 Dist. restrs. and SS energy: 1.472 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1439.140926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.140926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.231799 (E_RNA) where: Base-Base interactions energy: -1052.598 where: short stacking energy: -442.628 Base-Backbone interact. energy: -0.446 local terms energy: -424.188106 where: bonds (distance) C4'-P energy: -77.649 bonds (distance) P-C4' energy: -82.246 flat angles C4'-P-C4' energy: -78.476 flat angles P-C4'-P energy: -61.158 tors. eta vs tors. theta energy: -124.659 Dist. restrs. and SS energy: 1.341 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1422.295835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.295835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.501326 (E_RNA) where: Base-Base interactions energy: -1023.771 where: short stacking energy: -419.161 Base-Backbone interact. energy: -0.130 local terms energy: -436.599977 where: bonds (distance) C4'-P energy: -88.637 bonds (distance) P-C4' energy: -86.059 flat angles C4'-P-C4' energy: -86.453 flat angles P-C4'-P energy: -71.559 tors. eta vs tors. theta energy: -103.892 Dist. restrs. and SS energy: 1.455 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1388.865077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.865077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.255053 (E_RNA) where: Base-Base interactions energy: -996.265 where: short stacking energy: -411.480 Base-Backbone interact. energy: -0.607 local terms energy: -431.383118 where: bonds (distance) C4'-P energy: -77.118 bonds (distance) P-C4' energy: -83.998 flat angles C4'-P-C4' energy: -92.754 flat angles P-C4'-P energy: -57.044 tors. eta vs tors. theta energy: -120.469 Dist. restrs. and SS energy: 2.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1278.091022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.091022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.375312 (E_RNA) where: Base-Base interactions energy: -952.890 where: short stacking energy: -403.850 Base-Backbone interact. energy: -0.135 local terms energy: -370.350936 where: bonds (distance) C4'-P energy: -63.530 bonds (distance) P-C4' energy: -66.909 flat angles C4'-P-C4' energy: -80.423 flat angles P-C4'-P energy: -51.942 tors. eta vs tors. theta energy: -107.547 Dist. restrs. and SS energy: 8.534 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1719.457225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1719.457225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.255585 (E_RNA) where: Base-Base interactions energy: -1236.817 where: short stacking energy: -518.026 Base-Backbone interact. energy: -2.871 local terms energy: -517.568052 where: bonds (distance) C4'-P energy: -96.915 bonds (distance) P-C4' energy: -98.067 flat angles C4'-P-C4' energy: -107.571 flat angles P-C4'-P energy: -68.839 tors. eta vs tors. theta energy: -146.176 Dist. restrs. and SS energy: 1.048 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1645.312131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.312131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.510040 (E_RNA) where: Base-Base interactions energy: -1166.716 where: short stacking energy: -489.540 Base-Backbone interact. energy: -0.067 local terms energy: -516.727006 where: bonds (distance) C4'-P energy: -93.805 bonds (distance) P-C4' energy: -102.610 flat angles C4'-P-C4' energy: -107.486 flat angles P-C4'-P energy: -70.216 tors. eta vs tors. theta energy: -142.611 Dist. restrs. and SS energy: 1.448 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1607.335492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.335492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.257115 (E_RNA) where: Base-Base interactions energy: -1157.062 where: short stacking energy: -482.217 Base-Backbone interact. energy: -0.043 local terms energy: -488.152370 where: bonds (distance) C4'-P energy: -86.931 bonds (distance) P-C4' energy: -92.424 flat angles C4'-P-C4' energy: -96.881 flat angles P-C4'-P energy: -71.208 tors. eta vs tors. theta energy: -140.707 Dist. restrs. and SS energy: 1.172 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1546.158438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.158438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.116982 (E_RNA) where: Base-Base interactions energy: -1130.856 where: short stacking energy: -454.512 Base-Backbone interact. energy: -3.250 local terms energy: -450.011307 where: bonds (distance) C4'-P energy: -76.157 bonds (distance) P-C4' energy: -86.122 flat angles C4'-P-C4' energy: -96.323 flat angles P-C4'-P energy: -65.434 tors. eta vs tors. theta energy: -125.975 Dist. restrs. and SS energy: 1.209 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1529.682585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.682585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.289836 (E_RNA) where: Base-Base interactions energy: -1118.963 where: short stacking energy: -465.016 Base-Backbone interact. energy: 2.775 local terms energy: -452.102761 where: bonds (distance) C4'-P energy: -66.910 bonds (distance) P-C4' energy: -87.622 flat angles C4'-P-C4' energy: -97.187 flat angles P-C4'-P energy: -69.816 tors. eta vs tors. theta energy: -130.567 Dist. restrs. and SS energy: 1.857 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1459.702043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.702043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.393223 (E_RNA) where: Base-Base interactions energy: -1084.687 where: short stacking energy: -447.958 Base-Backbone interact. energy: -1.234 local terms energy: -412.471453 where: bonds (distance) C4'-P energy: -66.022 bonds (distance) P-C4' energy: -87.503 flat angles C4'-P-C4' energy: -90.877 flat angles P-C4'-P energy: -47.485 tors. eta vs tors. theta energy: -120.584 Dist. restrs. and SS energy: 1.941 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1428.726466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.726466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.824367 (E_RNA) where: Base-Base interactions energy: -1039.489 where: short stacking energy: -441.155 Base-Backbone interact. energy: 0.708 local terms energy: -429.043495 where: bonds (distance) C4'-P energy: -74.335 bonds (distance) P-C4' energy: -63.088 flat angles C4'-P-C4' energy: -101.677 flat angles P-C4'-P energy: -64.829 tors. eta vs tors. theta energy: -125.115 Dist. restrs. and SS energy: 2.348 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1421.867973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.867973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.235658 (E_RNA) where: Base-Base interactions energy: -1042.632 where: short stacking energy: -452.503 Base-Backbone interact. energy: -2.365 local terms energy: -415.239501 where: bonds (distance) C4'-P energy: -74.969 bonds (distance) P-C4' energy: -70.329 flat angles C4'-P-C4' energy: -90.202 flat angles P-C4'-P energy: -54.527 tors. eta vs tors. theta energy: -125.212 Dist. restrs. and SS energy: 1.618 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1357.370537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.370537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.100513 (E_RNA) where: Base-Base interactions energy: -981.031 where: short stacking energy: -411.134 Base-Backbone interact. energy: -2.234 local terms energy: -412.835367 where: bonds (distance) C4'-P energy: -85.089 bonds (distance) P-C4' energy: -64.423 flat angles C4'-P-C4' energy: -87.569 flat angles P-C4'-P energy: -57.066 tors. eta vs tors. theta energy: -118.689 Dist. restrs. and SS energy: 1.980 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1261.925616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1261.925616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.266548 (E_RNA) where: Base-Base interactions energy: -931.992 where: short stacking energy: -380.336 Base-Backbone interact. energy: -0.620 local terms energy: -376.654291 where: bonds (distance) C4'-P energy: -57.350 bonds (distance) P-C4' energy: -73.487 flat angles C4'-P-C4' energy: -87.468 flat angles P-C4'-P energy: -49.807 tors. eta vs tors. theta energy: -108.542 Dist. restrs. and SS energy: 10.591 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1723.808223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1723.808223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1761.390241 (E_RNA) where: Base-Base interactions energy: -1250.259 where: short stacking energy: -518.837 Base-Backbone interact. energy: -0.801 local terms energy: -510.330544 where: bonds (distance) C4'-P energy: -91.385 bonds (distance) P-C4' energy: -89.260 flat angles C4'-P-C4' energy: -110.247 flat angles P-C4'-P energy: -71.730 tors. eta vs tors. theta energy: -147.708 Dist. restrs. and SS energy: 0.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1634.655030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.655030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.483910 (E_RNA) where: Base-Base interactions energy: -1173.949 where: short stacking energy: -503.974 Base-Backbone interact. energy: -1.194 local terms energy: -497.340926 where: bonds (distance) C4'-P energy: -81.495 bonds (distance) P-C4' energy: -90.243 flat angles C4'-P-C4' energy: -106.749 flat angles P-C4'-P energy: -72.634 tors. eta vs tors. theta energy: -146.220 Dist. restrs. and SS energy: 1.079 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1584.973610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.973610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.128257 (E_RNA) where: Base-Base interactions energy: -1140.785 where: short stacking energy: -480.066 Base-Backbone interact. energy: 0.632 local terms energy: -482.975403 where: bonds (distance) C4'-P energy: -86.162 bonds (distance) P-C4' energy: -78.107 flat angles C4'-P-C4' energy: -105.333 flat angles P-C4'-P energy: -71.167 tors. eta vs tors. theta energy: -142.206 Dist. restrs. and SS energy: 1.405 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1514.996212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.996212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.370289 (E_RNA) where: Base-Base interactions energy: -1084.381 where: short stacking energy: -441.529 Base-Backbone interact. energy: -1.819 local terms energy: -467.169633 where: bonds (distance) C4'-P energy: -81.071 bonds (distance) P-C4' energy: -92.900 flat angles C4'-P-C4' energy: -99.262 flat angles P-C4'-P energy: -79.313 tors. eta vs tors. theta energy: -114.623 Dist. restrs. and SS energy: 1.624 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1537.293041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.293041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.525812 (E_RNA) where: Base-Base interactions energy: -1098.453 where: short stacking energy: -453.236 Base-Backbone interact. energy: -0.538 local terms energy: -476.534525 where: bonds (distance) C4'-P energy: -86.041 bonds (distance) P-C4' energy: -83.762 flat angles C4'-P-C4' energy: -109.492 flat angles P-C4'-P energy: -63.741 tors. eta vs tors. theta energy: -133.498 Dist. restrs. and SS energy: 1.483 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1450.907890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.907890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.110243 (E_RNA) where: Base-Base interactions energy: -1052.184 where: short stacking energy: -438.482 Base-Backbone interact. energy: -2.049 local terms energy: -434.877293 where: bonds (distance) C4'-P energy: -76.789 bonds (distance) P-C4' energy: -76.159 flat angles C4'-P-C4' energy: -99.126 flat angles P-C4'-P energy: -53.246 tors. eta vs tors. theta energy: -129.557 Dist. restrs. and SS energy: 1.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1460.810217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.810217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.399224 (E_RNA) where: Base-Base interactions energy: -1056.604 where: short stacking energy: -437.413 Base-Backbone interact. energy: -0.944 local terms energy: -440.851404 where: bonds (distance) C4'-P energy: -77.768 bonds (distance) P-C4' energy: -86.376 flat angles C4'-P-C4' energy: -93.052 flat angles P-C4'-P energy: -60.201 tors. eta vs tors. theta energy: -123.454 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1422.713346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.713346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.367143 (E_RNA) where: Base-Base interactions energy: -1036.498 where: short stacking energy: -443.493 Base-Backbone interact. energy: 0.841 local terms energy: -425.710192 where: bonds (distance) C4'-P energy: -66.701 bonds (distance) P-C4' energy: -69.301 flat angles C4'-P-C4' energy: -93.263 flat angles P-C4'-P energy: -69.037 tors. eta vs tors. theta energy: -127.408 Dist. restrs. and SS energy: 1.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1355.335350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.335350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.555069 (E_RNA) where: Base-Base interactions energy: -1003.654 where: short stacking energy: -413.403 Base-Backbone interact. energy: 1.057 local terms energy: -390.958703 where: bonds (distance) C4'-P energy: -58.098 bonds (distance) P-C4' energy: -73.743 flat angles C4'-P-C4' energy: -89.901 flat angles P-C4'-P energy: -62.131 tors. eta vs tors. theta energy: -107.086 Dist. restrs. and SS energy: 1.470 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -1250.714561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.714561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.966001 (E_RNA) where: Base-Base interactions energy: -946.817 where: short stacking energy: -368.083 Base-Backbone interact. energy: 2.866 local terms energy: -355.014705 where: bonds (distance) C4'-P energy: -68.518 bonds (distance) P-C4' energy: -67.781 flat angles C4'-P-C4' energy: -80.452 flat angles P-C4'-P energy: -53.243 tors. eta vs tors. theta energy: -85.020 Dist. restrs. and SS energy: 11.501 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1717.723377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.723377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1755.518299 (E_RNA) where: Base-Base interactions energy: -1241.072 where: short stacking energy: -501.051 Base-Backbone interact. energy: -0.290 local terms energy: -514.156198 where: bonds (distance) C4'-P energy: -85.231 bonds (distance) P-C4' energy: -92.229 flat angles C4'-P-C4' energy: -111.351 flat angles P-C4'-P energy: -79.258 tors. eta vs tors. theta energy: -146.087 Dist. restrs. and SS energy: 1.045 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1624.452550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.452550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.884636 (E_RNA) where: Base-Base interactions energy: -1164.289 where: short stacking energy: -485.777 Base-Backbone interact. energy: 0.982 local terms energy: -498.577733 where: bonds (distance) C4'-P energy: -90.561 bonds (distance) P-C4' energy: -94.112 flat angles C4'-P-C4' energy: -102.446 flat angles P-C4'-P energy: -73.245 tors. eta vs tors. theta energy: -138.213 Dist. restrs. and SS energy: 0.682 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1618.333495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.333495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.154266 (E_RNA) where: Base-Base interactions energy: -1164.441 where: short stacking energy: -479.626 Base-Backbone interact. energy: 1.087 local terms energy: -492.800118 where: bonds (distance) C4'-P energy: -88.194 bonds (distance) P-C4' energy: -98.774 flat angles C4'-P-C4' energy: -88.899 flat angles P-C4'-P energy: -76.778 tors. eta vs tors. theta energy: -140.155 Dist. restrs. and SS energy: 1.071 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1545.751870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.751870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.627941 (E_RNA) where: Base-Base interactions energy: -1131.931 where: short stacking energy: -457.860 Base-Backbone interact. energy: 1.352 local terms energy: -453.049479 where: bonds (distance) C4'-P energy: -74.262 bonds (distance) P-C4' energy: -90.354 flat angles C4'-P-C4' energy: -95.036 flat angles P-C4'-P energy: -68.041 tors. eta vs tors. theta energy: -125.358 Dist. restrs. and SS energy: 1.126 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1566.239515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.239515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.757795 (E_RNA) where: Base-Base interactions energy: -1118.730 where: short stacking energy: -465.891 Base-Backbone interact. energy: -0.489 local terms energy: -485.538800 where: bonds (distance) C4'-P energy: -83.945 bonds (distance) P-C4' energy: -90.444 flat angles C4'-P-C4' energy: -102.800 flat angles P-C4'-P energy: -69.722 tors. eta vs tors. theta energy: -138.628 Dist. restrs. and SS energy: 1.768 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1455.516712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.516712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.427301 (E_RNA) where: Base-Base interactions energy: -1050.590 where: short stacking energy: -434.501 Base-Backbone interact. energy: -1.326 local terms energy: -442.510783 where: bonds (distance) C4'-P energy: -84.259 bonds (distance) P-C4' energy: -73.698 flat angles C4'-P-C4' energy: -94.490 flat angles P-C4'-P energy: -64.057 tors. eta vs tors. theta energy: -126.007 Dist. restrs. and SS energy: 2.161 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1451.157993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.157993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.062417 (E_RNA) where: Base-Base interactions energy: -1079.946 where: short stacking energy: -455.677 Base-Backbone interact. energy: -2.131 local terms energy: -406.985216 where: bonds (distance) C4'-P energy: -67.143 bonds (distance) P-C4' energy: -67.673 flat angles C4'-P-C4' energy: -86.112 flat angles P-C4'-P energy: -58.190 tors. eta vs tors. theta energy: -127.866 Dist. restrs. and SS energy: 1.154 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1368.786913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.786913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.416598 (E_RNA) where: Base-Base interactions energy: -1002.662 where: short stacking energy: -400.589 Base-Backbone interact. energy: 4.927 local terms energy: -410.682273 where: bonds (distance) C4'-P energy: -72.256 bonds (distance) P-C4' energy: -86.003 flat angles C4'-P-C4' energy: -94.026 flat angles P-C4'-P energy: -52.137 tors. eta vs tors. theta energy: -106.260 Dist. restrs. and SS energy: 2.880 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1364.448113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.448113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.931189 (E_RNA) where: Base-Base interactions energy: -988.461 where: short stacking energy: -397.891 Base-Backbone interact. energy: -0.711 local terms energy: -413.759545 where: bonds (distance) C4'-P energy: -76.063 bonds (distance) P-C4' energy: -72.785 flat angles C4'-P-C4' energy: -92.592 flat angles P-C4'-P energy: -50.989 tors. eta vs tors. theta energy: -121.330 Dist. restrs. and SS energy: 1.733 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1250.558919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.558919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.032271 (E_RNA) where: Base-Base interactions energy: -936.657 where: short stacking energy: -392.111 Base-Backbone interact. energy: -0.717 local terms energy: -357.657859 where: bonds (distance) C4'-P energy: -54.877 bonds (distance) P-C4' energy: -72.511 flat angles C4'-P-C4' energy: -80.463 flat angles P-C4'-P energy: -46.078 tors. eta vs tors. theta energy: -103.728 Dist. restrs. and SS energy: 7.723 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1716.795954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1716.795954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.515099 (E_RNA) where: Base-Base interactions energy: -1241.935 where: short stacking energy: -512.018 Base-Backbone interact. energy: -3.077 local terms energy: -509.503731 where: bonds (distance) C4'-P energy: -88.356 bonds (distance) P-C4' energy: -102.365 flat angles C4'-P-C4' energy: -107.978 flat angles P-C4'-P energy: -64.187 tors. eta vs tors. theta energy: -146.618 Dist. restrs. and SS energy: 0.969 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1641.923158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1641.923158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.879902 (E_RNA) where: Base-Base interactions energy: -1193.443 where: short stacking energy: -515.179 Base-Backbone interact. energy: 0.617 local terms energy: -487.053743 where: bonds (distance) C4'-P energy: -75.996 bonds (distance) P-C4' energy: -85.505 flat angles C4'-P-C4' energy: -110.825 flat angles P-C4'-P energy: -70.484 tors. eta vs tors. theta energy: -144.244 Dist. restrs. and SS energy: 1.207 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1629.756535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.756535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.616508 (E_RNA) where: Base-Base interactions energy: -1186.344 where: short stacking energy: -501.556 Base-Backbone interact. energy: -0.685 local terms energy: -480.586982 where: bonds (distance) C4'-P energy: -74.006 bonds (distance) P-C4' energy: -92.204 flat angles C4'-P-C4' energy: -103.124 flat angles P-C4'-P energy: -67.986 tors. eta vs tors. theta energy: -143.268 Dist. restrs. and SS energy: 1.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1528.258134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.258134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.183040 (E_RNA) where: Base-Base interactions energy: -1080.762 where: short stacking energy: -458.100 Base-Backbone interact. energy: -1.877 local terms energy: -483.543900 where: bonds (distance) C4'-P energy: -85.913 bonds (distance) P-C4' energy: -91.465 flat angles C4'-P-C4' energy: -102.012 flat angles P-C4'-P energy: -71.693 tors. eta vs tors. theta energy: -132.461 Dist. restrs. and SS energy: 1.175 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1562.441557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.441557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.312801 (E_RNA) where: Base-Base interactions energy: -1137.012 where: short stacking energy: -483.372 Base-Backbone interact. energy: -0.592 local terms energy: -462.709214 where: bonds (distance) C4'-P energy: -92.697 bonds (distance) P-C4' energy: -71.924 flat angles C4'-P-C4' energy: -98.159 flat angles P-C4'-P energy: -57.382 tors. eta vs tors. theta energy: -142.547 Dist. restrs. and SS energy: 1.121 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1468.146150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.146150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.830876 (E_RNA) where: Base-Base interactions energy: -1075.292 where: short stacking energy: -454.203 Base-Backbone interact. energy: -1.461 local terms energy: -430.078505 where: bonds (distance) C4'-P energy: -79.905 bonds (distance) P-C4' energy: -69.645 flat angles C4'-P-C4' energy: -96.386 flat angles P-C4'-P energy: -53.676 tors. eta vs tors. theta energy: -130.467 Dist. restrs. and SS energy: 1.935 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1464.259090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.259090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.532272 (E_RNA) where: Base-Base interactions energy: -1071.044 where: short stacking energy: -439.440 Base-Backbone interact. energy: 1.704 local terms energy: -433.192644 where: bonds (distance) C4'-P energy: -88.896 bonds (distance) P-C4' energy: -70.605 flat angles C4'-P-C4' energy: -93.308 flat angles P-C4'-P energy: -51.618 tors. eta vs tors. theta energy: -128.764 Dist. restrs. and SS energy: 1.523 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1399.131465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.131465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.959207 (E_RNA) where: Base-Base interactions energy: -1016.310 where: short stacking energy: -409.973 Base-Backbone interact. energy: -1.309 local terms energy: -419.340229 where: bonds (distance) C4'-P energy: -76.302 bonds (distance) P-C4' energy: -72.599 flat angles C4'-P-C4' energy: -91.175 flat angles P-C4'-P energy: -59.003 tors. eta vs tors. theta energy: -120.261 Dist. restrs. and SS energy: 1.078 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1289.016545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.016545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.886905 (E_RNA) where: Base-Base interactions energy: -971.102 where: short stacking energy: -377.621 Base-Backbone interact. energy: -0.230 local terms energy: -360.554560 where: bonds (distance) C4'-P energy: -77.334 bonds (distance) P-C4' energy: -68.857 flat angles C4'-P-C4' energy: -77.594 flat angles P-C4'-P energy: -43.278 tors. eta vs tors. theta energy: -93.491 Dist. restrs. and SS energy: 6.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1344.403472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.403472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.558734 (E_RNA) where: Base-Base interactions energy: -951.483 where: short stacking energy: -391.080 Base-Backbone interact. energy: -0.931 local terms energy: -431.144905 where: bonds (distance) C4'-P energy: -88.228 bonds (distance) P-C4' energy: -83.875 flat angles C4'-P-C4' energy: -76.040 flat angles P-C4'-P energy: -61.599 tors. eta vs tors. theta energy: -121.403 Dist. restrs. and SS energy: 2.405 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1714.423049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.423049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1752.055599 (E_RNA) where: Base-Base interactions energy: -1246.298 where: short stacking energy: -514.865 Base-Backbone interact. energy: -0.710 local terms energy: -505.048236 where: bonds (distance) C4'-P energy: -88.335 bonds (distance) P-C4' energy: -92.032 flat angles C4'-P-C4' energy: -113.727 flat angles P-C4'-P energy: -69.223 tors. eta vs tors. theta energy: -141.731 Dist. restrs. and SS energy: 0.883 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1651.391563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.391563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.086639 (E_RNA) where: Base-Base interactions energy: -1192.782 where: short stacking energy: -505.251 Base-Backbone interact. energy: -2.315 local terms energy: -493.989068 where: bonds (distance) C4'-P energy: -91.773 bonds (distance) P-C4' energy: -90.250 flat angles C4'-P-C4' energy: -102.130 flat angles P-C4'-P energy: -61.440 tors. eta vs tors. theta energy: -148.396 Dist. restrs. and SS energy: 0.945 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1587.908318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.908318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.638045 (E_RNA) where: Base-Base interactions energy: -1129.779 where: short stacking energy: -477.785 Base-Backbone interact. energy: -0.234 local terms energy: -495.625512 where: bonds (distance) C4'-P energy: -96.518 bonds (distance) P-C4' energy: -87.489 flat angles C4'-P-C4' energy: -101.418 flat angles P-C4'-P energy: -69.647 tors. eta vs tors. theta energy: -140.554 Dist. restrs. and SS energy: 0.980 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1507.874590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.874590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.273120 (E_RNA) where: Base-Base interactions energy: -1085.427 where: short stacking energy: -427.901 Base-Backbone interact. energy: -0.575 local terms energy: -462.271499 where: bonds (distance) C4'-P energy: -88.476 bonds (distance) P-C4' energy: -91.029 flat angles C4'-P-C4' energy: -97.533 flat angles P-C4'-P energy: -69.687 tors. eta vs tors. theta energy: -115.546 Dist. restrs. and SS energy: 3.649 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1551.477825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.477825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.154892 (E_RNA) where: Base-Base interactions energy: -1134.047 where: short stacking energy: -480.188 Base-Backbone interact. energy: 1.192 local terms energy: -456.300094 where: bonds (distance) C4'-P energy: -83.916 bonds (distance) P-C4' energy: -75.637 flat angles C4'-P-C4' energy: -93.743 flat angles P-C4'-P energy: -66.687 tors. eta vs tors. theta energy: -136.317 Dist. restrs. and SS energy: 0.927 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1462.995054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.995054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.480882 (E_RNA) where: Base-Base interactions energy: -1079.772 where: short stacking energy: -440.952 Base-Backbone interact. energy: 3.107 local terms energy: -423.816336 where: bonds (distance) C4'-P energy: -87.060 bonds (distance) P-C4' energy: -70.320 flat angles C4'-P-C4' energy: -83.468 flat angles P-C4'-P energy: -62.980 tors. eta vs tors. theta energy: -119.989 Dist. restrs. and SS energy: 0.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1445.949423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.949423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.871187 (E_RNA) where: Base-Base interactions energy: -1056.577 where: short stacking energy: -424.770 Base-Backbone interact. energy: -0.805 local terms energy: -427.488991 where: bonds (distance) C4'-P energy: -72.082 bonds (distance) P-C4' energy: -79.702 flat angles C4'-P-C4' energy: -96.546 flat angles P-C4'-P energy: -53.869 tors. eta vs tors. theta energy: -125.290 Dist. restrs. and SS energy: 2.172 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1392.532126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.532126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.194760 (E_RNA) where: Base-Base interactions energy: -1029.227 where: short stacking energy: -416.927 Base-Backbone interact. energy: -2.288 local terms energy: -399.680382 where: bonds (distance) C4'-P energy: -52.347 bonds (distance) P-C4' energy: -78.039 flat angles C4'-P-C4' energy: -92.280 flat angles P-C4'-P energy: -62.299 tors. eta vs tors. theta energy: -114.716 Dist. restrs. and SS energy: 1.913 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1304.667699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.667699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1349.686020 (E_RNA) where: Base-Base interactions energy: -964.706 where: short stacking energy: -375.245 Base-Backbone interact. energy: 1.157 local terms energy: -386.137351 where: bonds (distance) C4'-P energy: -69.802 bonds (distance) P-C4' energy: -80.086 flat angles C4'-P-C4' energy: -86.168 flat angles P-C4'-P energy: -43.941 tors. eta vs tors. theta energy: -106.139 Dist. restrs. and SS energy: 8.268 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -1323.767675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.767675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.085450 (E_RNA) where: Base-Base interactions energy: -964.237 where: short stacking energy: -382.762 Base-Backbone interact. energy: -2.369 local terms energy: -395.478856 where: bonds (distance) C4'-P energy: -70.950 bonds (distance) P-C4' energy: -75.694 flat angles C4'-P-C4' energy: -89.475 flat angles P-C4'-P energy: -58.097 tors. eta vs tors. theta energy: -101.263 Dist. restrs. and SS energy: 1.568 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1739.868060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.868060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.444265 (E_RNA) where: Base-Base interactions energy: -1267.164 where: short stacking energy: -534.402 Base-Backbone interact. energy: 1.750 local terms energy: -512.029798 where: bonds (distance) C4'-P energy: -87.759 bonds (distance) P-C4' energy: -101.354 flat angles C4'-P-C4' energy: -108.002 flat angles P-C4'-P energy: -70.574 tors. eta vs tors. theta energy: -144.341 Dist. restrs. and SS energy: 0.826 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1646.562633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.562633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.691040 (E_RNA) where: Base-Base interactions energy: -1202.496 where: short stacking energy: -501.719 Base-Backbone interact. energy: -0.498 local terms energy: -481.696726 where: bonds (distance) C4'-P energy: -87.730 bonds (distance) P-C4' energy: -92.619 flat angles C4'-P-C4' energy: -105.459 flat angles P-C4'-P energy: -58.648 tors. eta vs tors. theta energy: -137.240 Dist. restrs. and SS energy: 1.378 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1605.010355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.010355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.103167 (E_RNA) where: Base-Base interactions energy: -1151.275 where: short stacking energy: -466.930 Base-Backbone interact. energy: -1.201 local terms energy: -491.626998 where: bonds (distance) C4'-P energy: -99.705 bonds (distance) P-C4' energy: -83.411 flat angles C4'-P-C4' energy: -100.384 flat angles P-C4'-P energy: -68.469 tors. eta vs tors. theta energy: -139.658 Dist. restrs. and SS energy: 2.343 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1520.205650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.205650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.145183 (E_RNA) where: Base-Base interactions energy: -1084.559 where: short stacking energy: -470.060 Base-Backbone interact. energy: -2.141 local terms energy: -471.445067 where: bonds (distance) C4'-P energy: -91.067 bonds (distance) P-C4' energy: -87.776 flat angles C4'-P-C4' energy: -103.352 flat angles P-C4'-P energy: -62.130 tors. eta vs tors. theta energy: -127.120 Dist. restrs. and SS energy: 1.190 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1550.373597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1550.373597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.186804 (E_RNA) where: Base-Base interactions energy: -1133.756 where: short stacking energy: -480.412 Base-Backbone interact. energy: -1.624 local terms energy: -452.806938 where: bonds (distance) C4'-P energy: -72.316 bonds (distance) P-C4' energy: -74.680 flat angles C4'-P-C4' energy: -103.874 flat angles P-C4'-P energy: -68.180 tors. eta vs tors. theta energy: -133.757 Dist. restrs. and SS energy: 1.063 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1465.210224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.210224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1503.781797 (E_RNA) where: Base-Base interactions energy: -1070.246 where: short stacking energy: -438.740 Base-Backbone interact. energy: 3.061 local terms energy: -436.596511 where: bonds (distance) C4'-P energy: -70.090 bonds (distance) P-C4' energy: -87.377 flat angles C4'-P-C4' energy: -97.498 flat angles P-C4'-P energy: -61.628 tors. eta vs tors. theta energy: -120.003 Dist. restrs. and SS energy: 1.822 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1401.170460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.170460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.141926 (E_RNA) where: Base-Base interactions energy: -1036.336 where: short stacking energy: -428.769 Base-Backbone interact. energy: 1.249 local terms energy: -404.055300 where: bonds (distance) C4'-P energy: -67.636 bonds (distance) P-C4' energy: -70.958 flat angles C4'-P-C4' energy: -91.466 flat angles P-C4'-P energy: -54.771 tors. eta vs tors. theta energy: -119.225 Dist. restrs. and SS energy: 1.221 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1421.529442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.529442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.048245 (E_RNA) where: Base-Base interactions energy: -1030.798 where: short stacking energy: -433.118 Base-Backbone interact. energy: 0.719 local terms energy: -429.969932 where: bonds (distance) C4'-P energy: -72.692 bonds (distance) P-C4' energy: -88.752 flat angles C4'-P-C4' energy: -100.182 flat angles P-C4'-P energy: -54.710 tors. eta vs tors. theta energy: -113.634 Dist. restrs. and SS energy: 1.769 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1358.155260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.155260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.040423 (E_RNA) where: Base-Base interactions energy: -975.081 where: short stacking energy: -400.697 Base-Backbone interact. energy: 1.952 local terms energy: -423.911014 where: bonds (distance) C4'-P energy: -79.745 bonds (distance) P-C4' energy: -79.521 flat angles C4'-P-C4' energy: -88.231 flat angles P-C4'-P energy: -59.907 tors. eta vs tors. theta energy: -116.507 Dist. restrs. and SS energy: 2.135 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -1309.849364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.849364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.155750 (E_RNA) where: Base-Base interactions energy: -944.799 where: short stacking energy: -394.466 Base-Backbone interact. energy: -0.428 local terms energy: -409.928827 where: bonds (distance) C4'-P energy: -69.881 bonds (distance) P-C4' energy: -90.877 flat angles C4'-P-C4' energy: -81.689 flat angles P-C4'-P energy: -57.041 tors. eta vs tors. theta energy: -110.441 Dist. restrs. and SS energy: 8.556 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1748.496414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1748.496414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.832823 (E_RNA) where: Base-Base interactions energy: -1274.208 where: short stacking energy: -528.794 Base-Backbone interact. energy: -1.239 local terms energy: -511.386226 where: bonds (distance) C4'-P energy: -90.655 bonds (distance) P-C4' energy: -97.969 flat angles C4'-P-C4' energy: -110.757 flat angles P-C4'-P energy: -77.022 tors. eta vs tors. theta energy: -134.984 Dist. restrs. and SS energy: 1.586 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1648.748960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.748960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.958729 (E_RNA) where: Base-Base interactions energy: -1195.437 where: short stacking energy: -506.886 Base-Backbone interact. energy: -0.547 local terms energy: -490.974792 where: bonds (distance) C4'-P energy: -79.578 bonds (distance) P-C4' energy: -96.524 flat angles C4'-P-C4' energy: -100.689 flat angles P-C4'-P energy: -73.447 tors. eta vs tors. theta energy: -140.737 Dist. restrs. and SS energy: 1.460 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1610.050781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.050781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.273715 (E_RNA) where: Base-Base interactions energy: -1166.603 where: short stacking energy: -478.644 Base-Backbone interact. energy: -0.737 local terms energy: -480.934494 where: bonds (distance) C4'-P energy: -85.834 bonds (distance) P-C4' energy: -91.229 flat angles C4'-P-C4' energy: -100.722 flat angles P-C4'-P energy: -63.068 tors. eta vs tors. theta energy: -140.081 Dist. restrs. and SS energy: 1.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1532.896245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.896245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.074618 (E_RNA) where: Base-Base interactions energy: -1113.520 where: short stacking energy: -487.757 Base-Backbone interact. energy: -0.011 local terms energy: -463.543715 where: bonds (distance) C4'-P energy: -88.927 bonds (distance) P-C4' energy: -71.537 flat angles C4'-P-C4' energy: -100.850 flat angles P-C4'-P energy: -68.837 tors. eta vs tors. theta energy: -133.393 Dist. restrs. and SS energy: 7.428 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1542.056879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.056879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.832519 (E_RNA) where: Base-Base interactions energy: -1117.113 where: short stacking energy: -462.952 Base-Backbone interact. energy: -1.005 local terms energy: -462.714763 where: bonds (distance) C4'-P energy: -95.467 bonds (distance) P-C4' energy: -77.910 flat angles C4'-P-C4' energy: -96.410 flat angles P-C4'-P energy: -65.380 tors. eta vs tors. theta energy: -127.548 Dist. restrs. and SS energy: 2.026 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1478.193691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.193691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.647843 (E_RNA) where: Base-Base interactions energy: -1061.142 where: short stacking energy: -430.455 Base-Backbone interact. energy: -2.343 local terms energy: -453.162633 where: bonds (distance) C4'-P energy: -81.998 bonds (distance) P-C4' energy: -85.393 flat angles C4'-P-C4' energy: -97.377 flat angles P-C4'-P energy: -69.651 tors. eta vs tors. theta energy: -118.743 Dist. restrs. and SS energy: 1.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1411.813469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.813469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.414915 (E_RNA) where: Base-Base interactions energy: -1071.308 where: short stacking energy: -442.029 Base-Backbone interact. energy: 4.959 local terms energy: -383.066092 where: bonds (distance) C4'-P energy: -68.011 bonds (distance) P-C4' energy: -62.171 flat angles C4'-P-C4' energy: -81.341 flat angles P-C4'-P energy: -55.489 tors. eta vs tors. theta energy: -116.054 Dist. restrs. and SS energy: 0.851 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1368.102436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.102436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.910570 (E_RNA) where: Base-Base interactions energy: -1018.840 where: short stacking energy: -408.405 Base-Backbone interact. energy: 3.625 local terms energy: -390.695164 where: bonds (distance) C4'-P energy: -70.861 bonds (distance) P-C4' energy: -69.726 flat angles C4'-P-C4' energy: -84.223 flat angles P-C4'-P energy: -53.280 tors. eta vs tors. theta energy: -112.605 Dist. restrs. and SS energy: 1.058 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1393.688154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.688154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.497117 (E_RNA) where: Base-Base interactions energy: -1027.698 where: short stacking energy: -414.256 Base-Backbone interact. energy: -0.998 local terms energy: -404.801606 where: bonds (distance) C4'-P energy: -67.875 bonds (distance) P-C4' energy: -79.672 flat angles C4'-P-C4' energy: -81.505 flat angles P-C4'-P energy: -60.055 tors. eta vs tors. theta energy: -115.695 Dist. restrs. and SS energy: 3.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -1259.929246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.929246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.279688 (E_RNA) where: Base-Base interactions energy: -917.672 where: short stacking energy: -358.597 Base-Backbone interact. energy: 5.913 local terms energy: -401.520339 where: bonds (distance) C4'-P energy: -82.970 bonds (distance) P-C4' energy: -72.557 flat angles C4'-P-C4' energy: -86.025 flat angles P-C4'-P energy: -53.637 tors. eta vs tors. theta energy: -106.331 Dist. restrs. and SS energy: 16.600 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1716.082160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1716.082160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1753.864729 (E_RNA) where: Base-Base interactions energy: -1252.734 where: short stacking energy: -508.433 Base-Backbone interact. energy: -0.718 local terms energy: -500.412771 where: bonds (distance) C4'-P energy: -85.089 bonds (distance) P-C4' energy: -98.254 flat angles C4'-P-C4' energy: -103.146 flat angles P-C4'-P energy: -76.625 tors. eta vs tors. theta energy: -137.299 Dist. restrs. and SS energy: 1.033 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1638.735989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.735989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1676.810043 (E_RNA) where: Base-Base interactions energy: -1180.090 where: short stacking energy: -509.338 Base-Backbone interact. energy: -0.953 local terms energy: -495.767068 where: bonds (distance) C4'-P energy: -82.403 bonds (distance) P-C4' energy: -91.714 flat angles C4'-P-C4' energy: -108.211 flat angles P-C4'-P energy: -78.543 tors. eta vs tors. theta energy: -134.897 Dist. restrs. and SS energy: 1.324 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1623.328000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.328000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.037277 (E_RNA) where: Base-Base interactions energy: -1159.706 where: short stacking energy: -493.653 Base-Backbone interact. energy: -0.698 local terms energy: -500.632670 where: bonds (distance) C4'-P energy: -89.872 bonds (distance) P-C4' energy: -81.397 flat angles C4'-P-C4' energy: -103.354 flat angles P-C4'-P energy: -78.450 tors. eta vs tors. theta energy: -147.559 Dist. restrs. and SS energy: 0.959 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1531.716021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.716021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.781062 (E_RNA) where: Base-Base interactions energy: -1099.032 where: short stacking energy: -467.336 Base-Backbone interact. energy: -1.153 local terms energy: -469.595929 where: bonds (distance) C4'-P energy: -81.558 bonds (distance) P-C4' energy: -85.056 flat angles C4'-P-C4' energy: -93.950 flat angles P-C4'-P energy: -67.524 tors. eta vs tors. theta energy: -141.507 Dist. restrs. and SS energy: 1.315 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1567.939999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.939999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.742150 (E_RNA) where: Base-Base interactions energy: -1143.256 where: short stacking energy: -488.435 Base-Backbone interact. energy: -0.272 local terms energy: -462.214404 where: bonds (distance) C4'-P energy: -78.958 bonds (distance) P-C4' energy: -84.423 flat angles C4'-P-C4' energy: -94.637 flat angles P-C4'-P energy: -67.913 tors. eta vs tors. theta energy: -136.284 Dist. restrs. and SS energy: 1.052 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1466.065393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.065393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.365151 (E_RNA) where: Base-Base interactions energy: -1058.642 where: short stacking energy: -440.669 Base-Backbone interact. energy: -1.427 local terms energy: -444.296156 where: bonds (distance) C4'-P energy: -79.449 bonds (distance) P-C4' energy: -75.219 flat angles C4'-P-C4' energy: -95.847 flat angles P-C4'-P energy: -69.627 tors. eta vs tors. theta energy: -124.153 Dist. restrs. and SS energy: 1.550 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1424.920119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.920119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.951459 (E_RNA) where: Base-Base interactions energy: -1030.822 where: short stacking energy: -414.840 Base-Backbone interact. energy: 3.021 local terms energy: -436.150680 where: bonds (distance) C4'-P energy: -80.366 bonds (distance) P-C4' energy: -74.655 flat angles C4'-P-C4' energy: -93.454 flat angles P-C4'-P energy: -69.382 tors. eta vs tors. theta energy: -118.294 Dist. restrs. and SS energy: 2.281 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1415.902162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.902162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.972787 (E_RNA) where: Base-Base interactions energy: -1044.081 where: short stacking energy: -434.429 Base-Backbone interact. energy: -5.301 local terms energy: -405.590797 where: bonds (distance) C4'-P energy: -64.904 bonds (distance) P-C4' energy: -77.159 flat angles C4'-P-C4' energy: -93.447 flat angles P-C4'-P energy: -52.504 tors. eta vs tors. theta energy: -117.576 Dist. restrs. and SS energy: 2.321 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1301.478363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.478363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.960903 (E_RNA) where: Base-Base interactions energy: -940.531 where: short stacking energy: -361.300 Base-Backbone interact. energy: -0.904 local terms energy: -410.525882 where: bonds (distance) C4'-P energy: -80.467 bonds (distance) P-C4' energy: -87.734 flat angles C4'-P-C4' energy: -71.025 flat angles P-C4'-P energy: -68.305 tors. eta vs tors. theta energy: -102.996 Dist. restrs. and SS energy: 13.733 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -1316.638589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.638589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.394373 (E_RNA) where: Base-Base interactions energy: -992.485 where: short stacking energy: -393.967 Base-Backbone interact. energy: -2.316 local terms energy: -360.593075 where: bonds (distance) C4'-P energy: -69.886 bonds (distance) P-C4' energy: -62.023 flat angles C4'-P-C4' energy: -73.677 flat angles P-C4'-P energy: -66.168 tors. eta vs tors. theta energy: -88.839 Dist. restrs. and SS energy: 2.006 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1714.298473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.298473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.736145 (E_RNA) where: Base-Base interactions energy: -1251.215 where: short stacking energy: -519.515 Base-Backbone interact. energy: -2.727 local terms energy: -497.793867 where: bonds (distance) C4'-P energy: -84.023 bonds (distance) P-C4' energy: -91.257 flat angles C4'-P-C4' energy: -106.336 flat angles P-C4'-P energy: -74.297 tors. eta vs tors. theta energy: -141.881 Dist. restrs. and SS energy: 0.688 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1628.735091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.735091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.321555 (E_RNA) where: Base-Base interactions energy: -1172.160 where: short stacking energy: -493.846 Base-Backbone interact. energy: 0.917 local terms energy: -495.078675 where: bonds (distance) C4'-P energy: -88.009 bonds (distance) P-C4' energy: -92.730 flat angles C4'-P-C4' energy: -103.637 flat angles P-C4'-P energy: -74.151 tors. eta vs tors. theta energy: -136.551 Dist. restrs. and SS energy: 0.836 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1610.772197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.772197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.412799 (E_RNA) where: Base-Base interactions energy: -1180.505 where: short stacking energy: -502.795 Base-Backbone interact. energy: -2.779 local terms energy: -465.128892 where: bonds (distance) C4'-P energy: -72.722 bonds (distance) P-C4' energy: -84.657 flat angles C4'-P-C4' energy: -98.142 flat angles P-C4'-P energy: -67.110 tors. eta vs tors. theta energy: -142.499 Dist. restrs. and SS energy: 0.891 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1569.329831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.329831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.928526 (E_RNA) where: Base-Base interactions energy: -1142.041 where: short stacking energy: -472.484 Base-Backbone interact. energy: -1.465 local terms energy: -463.422316 where: bonds (distance) C4'-P energy: -63.772 bonds (distance) P-C4' energy: -84.585 flat angles C4'-P-C4' energy: -106.934 flat angles P-C4'-P energy: -70.418 tors. eta vs tors. theta energy: -137.713 Dist. restrs. and SS energy: 0.849 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1518.412415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.412415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.109498 (E_RNA) where: Base-Base interactions energy: -1108.059 where: short stacking energy: -457.648 Base-Backbone interact. energy: -1.654 local terms energy: -447.396578 where: bonds (distance) C4'-P energy: -86.806 bonds (distance) P-C4' energy: -79.765 flat angles C4'-P-C4' energy: -92.857 flat angles P-C4'-P energy: -57.764 tors. eta vs tors. theta energy: -130.204 Dist. restrs. and SS energy: 1.947 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1472.114338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.114338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.649910 (E_RNA) where: Base-Base interactions energy: -1081.045 where: short stacking energy: -443.076 Base-Backbone interact. energy: -1.501 local terms energy: -427.104099 where: bonds (distance) C4'-P energy: -72.309 bonds (distance) P-C4' energy: -79.339 flat angles C4'-P-C4' energy: -93.042 flat angles P-C4'-P energy: -54.019 tors. eta vs tors. theta energy: -128.395 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1442.062432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.062432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.915829 (E_RNA) where: Base-Base interactions energy: -1048.945 where: short stacking energy: -442.695 Base-Backbone interact. energy: 1.635 local terms energy: -433.606080 where: bonds (distance) C4'-P energy: -81.929 bonds (distance) P-C4' energy: -78.922 flat angles C4'-P-C4' energy: -82.193 flat angles P-C4'-P energy: -67.419 tors. eta vs tors. theta energy: -123.142 Dist. restrs. and SS energy: 2.103 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1383.544426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.544426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.886639 (E_RNA) where: Base-Base interactions energy: -1008.621 where: short stacking energy: -429.220 Base-Backbone interact. energy: -0.430 local terms energy: -419.835599 where: bonds (distance) C4'-P energy: -71.739 bonds (distance) P-C4' energy: -80.597 flat angles C4'-P-C4' energy: -76.968 flat angles P-C4'-P energy: -65.406 tors. eta vs tors. theta energy: -125.126 Dist. restrs. and SS energy: 8.592 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1374.911889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.911889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.816255 (E_RNA) where: Base-Base interactions energy: -1017.231 where: short stacking energy: -416.135 Base-Backbone interact. energy: -1.667 local terms energy: -393.918994 where: bonds (distance) C4'-P energy: -56.025 bonds (distance) P-C4' energy: -75.455 flat angles C4'-P-C4' energy: -93.302 flat angles P-C4'-P energy: -54.587 tors. eta vs tors. theta energy: -114.550 Dist. restrs. and SS energy: 1.154 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -1307.373405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.373405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.016010 (E_RNA) where: Base-Base interactions energy: -957.165 where: short stacking energy: -380.155 Base-Backbone interact. energy: -0.708 local terms energy: -388.143425 where: bonds (distance) C4'-P energy: -72.937 bonds (distance) P-C4' energy: -58.408 flat angles C4'-P-C4' energy: -89.812 flat angles P-C4'-P energy: -60.036 tors. eta vs tors. theta energy: -106.950 Dist. restrs. and SS energy: 1.893 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1715.097139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.097139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.307653 (E_RNA) where: Base-Base interactions energy: -1252.494 where: short stacking energy: -500.774 Base-Backbone interact. energy: 1.392 local terms energy: -503.205688 where: bonds (distance) C4'-P energy: -88.923 bonds (distance) P-C4' energy: -87.351 flat angles C4'-P-C4' energy: -112.676 flat angles P-C4'-P energy: -76.464 tors. eta vs tors. theta energy: -137.792 Dist. restrs. and SS energy: 2.461 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1630.325545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.325545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.043401 (E_RNA) where: Base-Base interactions energy: -1159.901 where: short stacking energy: -491.455 Base-Backbone interact. energy: 1.533 local terms energy: -509.675043 where: bonds (distance) C4'-P energy: -99.188 bonds (distance) P-C4' energy: -86.108 flat angles C4'-P-C4' energy: -114.484 flat angles P-C4'-P energy: -71.353 tors. eta vs tors. theta energy: -138.542 Dist. restrs. and SS energy: 0.968 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1600.901561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.901561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.336444 (E_RNA) where: Base-Base interactions energy: -1180.904 where: short stacking energy: -491.858 Base-Backbone interact. energy: -2.950 local terms energy: -454.482615 where: bonds (distance) C4'-P energy: -65.091 bonds (distance) P-C4' energy: -83.304 flat angles C4'-P-C4' energy: -101.677 flat angles P-C4'-P energy: -68.063 tors. eta vs tors. theta energy: -136.349 Dist. restrs. and SS energy: 0.685 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1585.522850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.522850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.938544 (E_RNA) where: Base-Base interactions energy: -1128.839 where: short stacking energy: -461.275 Base-Backbone interact. energy: -1.807 local terms energy: -493.292524 where: bonds (distance) C4'-P energy: -81.596 bonds (distance) P-C4' energy: -94.212 flat angles C4'-P-C4' energy: -108.020 flat angles P-C4'-P energy: -67.995 tors. eta vs tors. theta energy: -141.469 Dist. restrs. and SS energy: 1.666 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1525.578154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.578154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.646712 (E_RNA) where: Base-Base interactions energy: -1127.030 where: short stacking energy: -465.825 Base-Backbone interact. energy: -1.295 local terms energy: -435.321774 where: bonds (distance) C4'-P energy: -73.697 bonds (distance) P-C4' energy: -81.845 flat angles C4'-P-C4' energy: -87.772 flat angles P-C4'-P energy: -65.640 tors. eta vs tors. theta energy: -126.367 Dist. restrs. and SS energy: 1.319 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1492.619680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.619680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.159454 (E_RNA) where: Base-Base interactions energy: -1076.102 where: short stacking energy: -450.554 Base-Backbone interact. energy: -0.555 local terms energy: -454.502385 where: bonds (distance) C4'-P energy: -84.432 bonds (distance) P-C4' energy: -94.467 flat angles C4'-P-C4' energy: -97.654 flat angles P-C4'-P energy: -51.935 tors. eta vs tors. theta energy: -126.015 Dist. restrs. and SS energy: 1.790 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1470.158866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.158866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.206882 (E_RNA) where: Base-Base interactions energy: -1076.006 where: short stacking energy: -438.179 Base-Backbone interact. energy: -1.094 local terms energy: -431.107490 where: bonds (distance) C4'-P energy: -79.808 bonds (distance) P-C4' energy: -80.411 flat angles C4'-P-C4' energy: -92.131 flat angles P-C4'-P energy: -50.289 tors. eta vs tors. theta energy: -128.468 Dist. restrs. and SS energy: 1.298 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1346.203134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.203134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.813441 (E_RNA) where: Base-Base interactions energy: -983.171 where: short stacking energy: -410.827 Base-Backbone interact. energy: -1.169 local terms energy: -408.473424 where: bonds (distance) C4'-P energy: -72.746 bonds (distance) P-C4' energy: -85.808 flat angles C4'-P-C4' energy: -85.877 flat angles P-C4'-P energy: -53.676 tors. eta vs tors. theta energy: -110.367 Dist. restrs. and SS energy: 9.860 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1355.075956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.075956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.974994 (E_RNA) where: Base-Base interactions energy: -1000.537 where: short stacking energy: -395.543 Base-Backbone interact. energy: -1.433 local terms energy: -392.005046 where: bonds (distance) C4'-P energy: -72.093 bonds (distance) P-C4' energy: -72.025 flat angles C4'-P-C4' energy: -81.119 flat angles P-C4'-P energy: -43.027 tors. eta vs tors. theta energy: -123.742 Dist. restrs. and SS energy: 2.149 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -1357.886927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.886927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.433655 (E_RNA) where: Base-Base interactions energy: -1001.334 where: short stacking energy: -418.750 Base-Backbone interact. energy: -0.794 local terms energy: -396.305471 where: bonds (distance) C4'-P energy: -53.112 bonds (distance) P-C4' energy: -88.739 flat angles C4'-P-C4' energy: -85.235 flat angles P-C4'-P energy: -57.837 tors. eta vs tors. theta energy: -111.382 Dist. restrs. and SS energy: 3.797 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1692.611379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1692.611379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.580953 (E_RNA) where: Base-Base interactions energy: -1236.433 where: short stacking energy: -499.457 Base-Backbone interact. energy: -2.156 local terms energy: -491.991984 where: bonds (distance) C4'-P energy: -89.271 bonds (distance) P-C4' energy: -87.729 flat angles C4'-P-C4' energy: -105.099 flat angles P-C4'-P energy: -71.827 tors. eta vs tors. theta energy: -138.066 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1637.459569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.459569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.181304 (E_RNA) where: Base-Base interactions energy: -1183.888 where: short stacking energy: -505.185 Base-Backbone interact. energy: -1.932 local terms energy: -489.361707 where: bonds (distance) C4'-P energy: -89.166 bonds (distance) P-C4' energy: -85.207 flat angles C4'-P-C4' energy: -100.650 flat angles P-C4'-P energy: -72.127 tors. eta vs tors. theta energy: -142.211 Dist. restrs. and SS energy: 0.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1579.325007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.325007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.012364 (E_RNA) where: Base-Base interactions energy: -1138.044 where: short stacking energy: -451.522 Base-Backbone interact. energy: -1.062 local terms energy: -477.906193 where: bonds (distance) C4'-P energy: -96.553 bonds (distance) P-C4' energy: -85.562 flat angles C4'-P-C4' energy: -100.047 flat angles P-C4'-P energy: -67.137 tors. eta vs tors. theta energy: -128.607 Dist. restrs. and SS energy: 0.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1584.678559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.678559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.285000 (E_RNA) where: Base-Base interactions energy: -1154.082 where: short stacking energy: -475.377 Base-Backbone interact. energy: -1.664 local terms energy: -466.538728 where: bonds (distance) C4'-P energy: -94.101 bonds (distance) P-C4' energy: -78.880 flat angles C4'-P-C4' energy: -91.739 flat angles P-C4'-P energy: -70.598 tors. eta vs tors. theta energy: -131.221 Dist. restrs. and SS energy: 0.856 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1532.030939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.030939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.381612 (E_RNA) where: Base-Base interactions energy: -1127.212 where: short stacking energy: -472.384 Base-Backbone interact. energy: -1.631 local terms energy: -441.538726 where: bonds (distance) C4'-P energy: -76.906 bonds (distance) P-C4' energy: -81.271 flat angles C4'-P-C4' energy: -92.499 flat angles P-C4'-P energy: -54.142 tors. eta vs tors. theta energy: -136.722 Dist. restrs. and SS energy: 1.601 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1484.304032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.304032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.287702 (E_RNA) where: Base-Base interactions energy: -1071.835 where: short stacking energy: -460.943 Base-Backbone interact. energy: -0.792 local terms energy: -449.660314 where: bonds (distance) C4'-P energy: -81.531 bonds (distance) P-C4' energy: -80.176 flat angles C4'-P-C4' energy: -93.337 flat angles P-C4'-P energy: -64.511 tors. eta vs tors. theta energy: -130.107 Dist. restrs. and SS energy: 1.234 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1434.575647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.575647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.079080 (E_RNA) where: Base-Base interactions energy: -1051.232 where: short stacking energy: -442.381 Base-Backbone interact. energy: 2.159 local terms energy: -424.005781 where: bonds (distance) C4'-P energy: -69.105 bonds (distance) P-C4' energy: -84.100 flat angles C4'-P-C4' energy: -92.257 flat angles P-C4'-P energy: -52.419 tors. eta vs tors. theta energy: -126.124 Dist. restrs. and SS energy: 1.753 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1312.152301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.152301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.884128 (E_RNA) where: Base-Base interactions energy: -962.166 where: short stacking energy: -396.452 Base-Backbone interact. energy: 1.138 local terms energy: -395.855979 where: bonds (distance) C4'-P energy: -73.859 bonds (distance) P-C4' energy: -81.438 flat angles C4'-P-C4' energy: -87.421 flat angles P-C4'-P energy: -49.462 tors. eta vs tors. theta energy: -103.676 Dist. restrs. and SS energy: 7.982 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1384.320363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.320363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.274125 (E_RNA) where: Base-Base interactions energy: -1025.485 where: short stacking energy: -426.864 Base-Backbone interact. energy: -2.061 local terms energy: -394.727325 where: bonds (distance) C4'-P energy: -57.724 bonds (distance) P-C4' energy: -74.863 flat angles C4'-P-C4' energy: -80.502 flat angles P-C4'-P energy: -55.273 tors. eta vs tors. theta energy: -126.365 Dist. restrs. and SS energy: 1.204 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -1328.262315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.262315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.803689 (E_RNA) where: Base-Base interactions energy: -990.728 where: short stacking energy: -403.734 Base-Backbone interact. energy: 0.211 local terms energy: -375.286994 where: bonds (distance) C4'-P energy: -67.775 bonds (distance) P-C4' energy: -79.881 flat angles C4'-P-C4' energy: -83.270 flat angles P-C4'-P energy: -44.006 tors. eta vs tors. theta energy: -100.355 Dist. restrs. and SS energy: 0.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1717.164419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.164419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.939168 (E_RNA) where: Base-Base interactions energy: -1239.146 where: short stacking energy: -514.535 Base-Backbone interact. energy: -2.760 local terms energy: -513.033002 where: bonds (distance) C4'-P energy: -96.863 bonds (distance) P-C4' energy: -88.830 flat angles C4'-P-C4' energy: -106.187 flat angles P-C4'-P energy: -80.189 tors. eta vs tors. theta energy: -140.964 Dist. restrs. and SS energy: 1.025 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1672.214812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.214812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.987659 (E_RNA) where: Base-Base interactions energy: -1232.397 where: short stacking energy: -506.196 Base-Backbone interact. energy: -1.137 local terms energy: -476.453799 where: bonds (distance) C4'-P energy: -76.826 bonds (distance) P-C4' energy: -91.455 flat angles C4'-P-C4' energy: -100.538 flat angles P-C4'-P energy: -72.695 tors. eta vs tors. theta energy: -134.940 Dist. restrs. and SS energy: 1.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1595.083006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.083006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.733022 (E_RNA) where: Base-Base interactions energy: -1144.780 where: short stacking energy: -489.674 Base-Backbone interact. energy: -0.772 local terms energy: -487.181386 where: bonds (distance) C4'-P energy: -88.263 bonds (distance) P-C4' energy: -92.173 flat angles C4'-P-C4' energy: -104.516 flat angles P-C4'-P energy: -67.334 tors. eta vs tors. theta energy: -134.896 Dist. restrs. and SS energy: 0.900 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1551.441183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.441183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.324692 (E_RNA) where: Base-Base interactions energy: -1107.258 where: short stacking energy: -462.419 Base-Backbone interact. energy: -1.487 local terms energy: -480.579500 where: bonds (distance) C4'-P energy: -79.931 bonds (distance) P-C4' energy: -91.432 flat angles C4'-P-C4' energy: -96.069 flat angles P-C4'-P energy: -77.556 tors. eta vs tors. theta energy: -135.591 Dist. restrs. and SS energy: 1.134 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1532.369800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.369800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.164424 (E_RNA) where: Base-Base interactions energy: -1117.365 where: short stacking energy: -450.334 Base-Backbone interact. energy: -1.469 local terms energy: -451.330150 where: bonds (distance) C4'-P energy: -80.785 bonds (distance) P-C4' energy: -74.163 flat angles C4'-P-C4' energy: -93.220 flat angles P-C4'-P energy: -64.779 tors. eta vs tors. theta energy: -138.383 Dist. restrs. and SS energy: 1.045 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1477.441495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.441495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.057129 (E_RNA) where: Base-Base interactions energy: -1079.109 where: short stacking energy: -439.000 Base-Backbone interact. energy: -0.873 local terms energy: -435.075784 where: bonds (distance) C4'-P energy: -73.048 bonds (distance) P-C4' energy: -84.347 flat angles C4'-P-C4' energy: -100.009 flat angles P-C4'-P energy: -57.241 tors. eta vs tors. theta energy: -120.430 Dist. restrs. and SS energy: 0.866 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1440.360575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.360575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.406985 (E_RNA) where: Base-Base interactions energy: -1046.273 where: short stacking energy: -428.031 Base-Backbone interact. energy: -1.226 local terms energy: -430.908882 where: bonds (distance) C4'-P energy: -74.875 bonds (distance) P-C4' energy: -76.969 flat angles C4'-P-C4' energy: -98.041 flat angles P-C4'-P energy: -56.649 tors. eta vs tors. theta energy: -124.376 Dist. restrs. and SS energy: 1.296 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1328.385573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.385573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.583745 (E_RNA) where: Base-Base interactions energy: -961.945 where: short stacking energy: -363.046 Base-Backbone interact. energy: 0.003 local terms energy: -413.642543 where: bonds (distance) C4'-P energy: -78.891 bonds (distance) P-C4' energy: -86.597 flat angles C4'-P-C4' energy: -78.669 flat angles P-C4'-P energy: -66.742 tors. eta vs tors. theta energy: -102.744 Dist. restrs. and SS energy: 10.448 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1370.928165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.928165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.122584 (E_RNA) where: Base-Base interactions energy: -979.188 where: short stacking energy: -382.515 Base-Backbone interact. energy: 0.647 local terms energy: -431.581178 where: bonds (distance) C4'-P energy: -84.211 bonds (distance) P-C4' energy: -84.076 flat angles C4'-P-C4' energy: -91.974 flat angles P-C4'-P energy: -62.309 tors. eta vs tors. theta energy: -109.011 Dist. restrs. and SS energy: 2.444 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -1351.014252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.014252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.798803 (E_RNA) where: Base-Base interactions energy: -984.676 where: short stacking energy: -392.343 Base-Backbone interact. energy: -1.547 local terms energy: -403.575850 where: bonds (distance) C4'-P energy: -79.034 bonds (distance) P-C4' energy: -69.534 flat angles C4'-P-C4' energy: -83.992 flat angles P-C4'-P energy: -56.291 tors. eta vs tors. theta energy: -114.724 Dist. restrs. and SS energy: 2.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1704.391212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.391212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1744.212469 (E_RNA) where: Base-Base interactions energy: -1229.765 where: short stacking energy: -506.035 Base-Backbone interact. energy: -2.546 local terms energy: -511.900956 where: bonds (distance) C4'-P energy: -87.198 bonds (distance) P-C4' energy: -96.621 flat angles C4'-P-C4' energy: -115.948 flat angles P-C4'-P energy: -68.125 tors. eta vs tors. theta energy: -144.009 Dist. restrs. and SS energy: 3.071 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1666.564057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.564057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.264876 (E_RNA) where: Base-Base interactions energy: -1219.527 where: short stacking energy: -506.541 Base-Backbone interact. energy: -0.826 local terms energy: -483.912014 where: bonds (distance) C4'-P energy: -87.509 bonds (distance) P-C4' energy: -74.037 flat angles C4'-P-C4' energy: -114.536 flat angles P-C4'-P energy: -69.332 tors. eta vs tors. theta energy: -138.498 Dist. restrs. and SS energy: 0.951 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1606.876418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.876418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.638161 (E_RNA) where: Base-Base interactions energy: -1143.817 where: short stacking energy: -468.020 Base-Backbone interact. energy: 0.701 local terms energy: -502.522168 where: bonds (distance) C4'-P energy: -90.080 bonds (distance) P-C4' energy: -90.624 flat angles C4'-P-C4' energy: -102.202 flat angles P-C4'-P energy: -76.776 tors. eta vs tors. theta energy: -142.841 Dist. restrs. and SS energy: 2.012 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1596.981832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.981832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.710633 (E_RNA) where: Base-Base interactions energy: -1161.821 where: short stacking energy: -478.169 Base-Backbone interact. energy: -2.201 local terms energy: -470.688463 where: bonds (distance) C4'-P energy: -90.316 bonds (distance) P-C4' energy: -75.398 flat angles C4'-P-C4' energy: -101.224 flat angles P-C4'-P energy: -63.229 tors. eta vs tors. theta energy: -140.521 Dist. restrs. and SS energy: 0.979 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1520.229329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.229329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1557.766822 (E_RNA) where: Base-Base interactions energy: -1127.396 where: short stacking energy: -458.658 Base-Backbone interact. energy: -1.469 local terms energy: -428.901540 where: bonds (distance) C4'-P energy: -66.626 bonds (distance) P-C4' energy: -80.654 flat angles C4'-P-C4' energy: -99.319 flat angles P-C4'-P energy: -63.694 tors. eta vs tors. theta energy: -118.608 Dist. restrs. and SS energy: 0.787 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1489.566931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.566931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.061493 (E_RNA) where: Base-Base interactions energy: -1068.276 where: short stacking energy: -454.378 Base-Backbone interact. energy: -1.886 local terms energy: -456.900268 where: bonds (distance) C4'-P energy: -82.923 bonds (distance) P-C4' energy: -79.623 flat angles C4'-P-C4' energy: -98.150 flat angles P-C4'-P energy: -63.678 tors. eta vs tors. theta energy: -132.526 Dist. restrs. and SS energy: 0.745 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1439.314637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.314637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.567078 (E_RNA) where: Base-Base interactions energy: -1046.713 where: short stacking energy: -421.933 Base-Backbone interact. energy: 4.965 local terms energy: -436.819204 where: bonds (distance) C4'-P energy: -83.689 bonds (distance) P-C4' energy: -87.512 flat angles C4'-P-C4' energy: -93.534 flat angles P-C4'-P energy: -47.389 tors. eta vs tors. theta energy: -124.694 Dist. restrs. and SS energy: 2.502 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1347.834349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.834349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.703608 (E_RNA) where: Base-Base interactions energy: -996.299 where: short stacking energy: -407.086 Base-Backbone interact. energy: 1.840 local terms energy: -399.243717 where: bonds (distance) C4'-P energy: -89.790 bonds (distance) P-C4' energy: -70.569 flat angles C4'-P-C4' energy: -83.844 flat angles P-C4'-P energy: -42.912 tors. eta vs tors. theta energy: -112.129 Dist. restrs. and SS energy: 9.119 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1393.215938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.215938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.609732 (E_RNA) where: Base-Base interactions energy: -1014.040 where: short stacking energy: -412.930 Base-Backbone interact. energy: -0.328 local terms energy: -417.241929 where: bonds (distance) C4'-P energy: -60.993 bonds (distance) P-C4' energy: -74.502 flat angles C4'-P-C4' energy: -86.844 flat angles P-C4'-P energy: -69.795 tors. eta vs tors. theta energy: -125.107 Dist. restrs. and SS energy: 1.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -1347.249153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.249153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.273823 (E_RNA) where: Base-Base interactions energy: -1013.967 where: short stacking energy: -410.574 Base-Backbone interact. energy: -0.794 local terms energy: -370.512953 where: bonds (distance) C4'-P energy: -64.314 bonds (distance) P-C4' energy: -67.543 flat angles C4'-P-C4' energy: -76.258 flat angles P-C4'-P energy: -50.844 tors. eta vs tors. theta energy: -111.553 Dist. restrs. and SS energy: 1.275 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1703.915044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.915044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.775206 (E_RNA) where: Base-Base interactions energy: -1231.081 where: short stacking energy: -522.548 Base-Backbone interact. energy: 2.839 local terms energy: -513.533327 where: bonds (distance) C4'-P energy: -86.928 bonds (distance) P-C4' energy: -99.831 flat angles C4'-P-C4' energy: -107.843 flat angles P-C4'-P energy: -76.047 tors. eta vs tors. theta energy: -142.884 Dist. restrs. and SS energy: 1.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1647.546117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.546117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.023047 (E_RNA) where: Base-Base interactions energy: -1192.173 where: short stacking energy: -491.128 Base-Backbone interact. energy: 0.014 local terms energy: -493.863999 where: bonds (distance) C4'-P energy: -82.277 bonds (distance) P-C4' energy: -93.221 flat angles C4'-P-C4' energy: -113.793 flat angles P-C4'-P energy: -65.764 tors. eta vs tors. theta energy: -138.809 Dist. restrs. and SS energy: 1.727 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1598.735806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.735806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.094948 (E_RNA) where: Base-Base interactions energy: -1168.503 where: short stacking energy: -488.725 Base-Backbone interact. energy: -1.392 local terms energy: -467.200069 where: bonds (distance) C4'-P energy: -89.221 bonds (distance) P-C4' energy: -81.957 flat angles C4'-P-C4' energy: -104.815 flat angles P-C4'-P energy: -62.532 tors. eta vs tors. theta energy: -128.676 Dist. restrs. and SS energy: 1.609 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1602.590372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.590372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.621283 (E_RNA) where: Base-Base interactions energy: -1152.124 where: short stacking energy: -478.395 Base-Backbone interact. energy: -0.268 local terms energy: -488.229127 where: bonds (distance) C4'-P energy: -90.371 bonds (distance) P-C4' energy: -90.376 flat angles C4'-P-C4' energy: -104.559 flat angles P-C4'-P energy: -68.133 tors. eta vs tors. theta energy: -134.791 Dist. restrs. and SS energy: 1.281 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1543.558291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.558291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.957981 (E_RNA) where: Base-Base interactions energy: -1112.028 where: short stacking energy: -451.902 Base-Backbone interact. energy: -2.635 local terms energy: -467.295022 where: bonds (distance) C4'-P energy: -88.520 bonds (distance) P-C4' energy: -85.216 flat angles C4'-P-C4' energy: -92.816 flat angles P-C4'-P energy: -73.041 tors. eta vs tors. theta energy: -127.702 Dist. restrs. and SS energy: 1.650 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1503.549191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.549191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.178039 (E_RNA) where: Base-Base interactions energy: -1110.639 where: short stacking energy: -468.363 Base-Backbone interact. energy: 0.816 local terms energy: -431.355488 where: bonds (distance) C4'-P energy: -69.804 bonds (distance) P-C4' energy: -84.130 flat angles C4'-P-C4' energy: -92.998 flat angles P-C4'-P energy: -55.361 tors. eta vs tors. theta energy: -129.062 Dist. restrs. and SS energy: 0.879 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1457.945394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.945394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.128216 (E_RNA) where: Base-Base interactions energy: -1067.408 where: short stacking energy: -461.084 Base-Backbone interact. energy: 2.450 local terms energy: -431.171074 where: bonds (distance) C4'-P energy: -68.368 bonds (distance) P-C4' energy: -81.785 flat angles C4'-P-C4' energy: -97.882 flat angles P-C4'-P energy: -54.216 tors. eta vs tors. theta energy: -128.920 Dist. restrs. and SS energy: 1.433 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1364.357878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.357878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.227565 (E_RNA) where: Base-Base interactions energy: -1007.762 where: short stacking energy: -411.751 Base-Backbone interact. energy: 2.305 local terms energy: -404.770090 where: bonds (distance) C4'-P energy: -79.190 bonds (distance) P-C4' energy: -76.224 flat angles C4'-P-C4' energy: -88.079 flat angles P-C4'-P energy: -60.073 tors. eta vs tors. theta energy: -101.204 Dist. restrs. and SS energy: 9.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1373.817523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.817523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.050760 (E_RNA) where: Base-Base interactions energy: -1005.397 where: short stacking energy: -404.900 Base-Backbone interact. energy: 1.311 local terms energy: -408.964676 where: bonds (distance) C4'-P energy: -64.334 bonds (distance) P-C4' energy: -82.264 flat angles C4'-P-C4' energy: -84.749 flat angles P-C4'-P energy: -52.912 tors. eta vs tors. theta energy: -124.705 Dist. restrs. and SS energy: 2.483 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -1323.442304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.442304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.875209 (E_RNA) where: Base-Base interactions energy: -962.335 where: short stacking energy: -390.323 Base-Backbone interact. energy: -1.563 local terms energy: -398.977333 where: bonds (distance) C4'-P energy: -74.491 bonds (distance) P-C4' energy: -65.367 flat angles C4'-P-C4' energy: -102.699 flat angles P-C4'-P energy: -50.608 tors. eta vs tors. theta energy: -105.813 Dist. restrs. and SS energy: 2.683 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1696.675379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.675379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.203441 (E_RNA) where: Base-Base interactions energy: -1214.827 where: short stacking energy: -494.589 Base-Backbone interact. energy: -0.254 local terms energy: -519.122871 where: bonds (distance) C4'-P energy: -89.449 bonds (distance) P-C4' energy: -102.068 flat angles C4'-P-C4' energy: -109.148 flat angles P-C4'-P energy: -79.922 tors. eta vs tors. theta energy: -138.535 Dist. restrs. and SS energy: 0.778 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1669.490329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.490329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.625646 (E_RNA) where: Base-Base interactions energy: -1210.376 where: short stacking energy: -492.222 Base-Backbone interact. energy: -2.626 local terms energy: -494.623929 where: bonds (distance) C4'-P energy: -90.144 bonds (distance) P-C4' energy: -96.814 flat angles C4'-P-C4' energy: -95.778 flat angles P-C4'-P energy: -70.469 tors. eta vs tors. theta energy: -141.418 Dist. restrs. and SS energy: 1.385 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1612.865266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.865266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.841288 (E_RNA) where: Base-Base interactions energy: -1164.841 where: short stacking energy: -486.955 Base-Backbone interact. energy: -1.465 local terms energy: -484.534947 where: bonds (distance) C4'-P energy: -83.803 bonds (distance) P-C4' energy: -93.363 flat angles C4'-P-C4' energy: -98.084 flat angles P-C4'-P energy: -72.258 tors. eta vs tors. theta energy: -137.028 Dist. restrs. and SS energy: 1.226 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1554.317136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.317136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.950422 (E_RNA) where: Base-Base interactions energy: -1118.970 where: short stacking energy: -482.314 Base-Backbone interact. energy: -0.931 local terms energy: -472.049636 where: bonds (distance) C4'-P energy: -77.267 bonds (distance) P-C4' energy: -100.804 flat angles C4'-P-C4' energy: -96.424 flat angles P-C4'-P energy: -62.670 tors. eta vs tors. theta energy: -134.884 Dist. restrs. and SS energy: 0.883 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1578.365617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.365617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.384156 (E_RNA) where: Base-Base interactions energy: -1148.614 where: short stacking energy: -483.848 Base-Backbone interact. energy: -0.639 local terms energy: -467.130911 where: bonds (distance) C4'-P energy: -77.593 bonds (distance) P-C4' energy: -90.873 flat angles C4'-P-C4' energy: -96.634 flat angles P-C4'-P energy: -71.386 tors. eta vs tors. theta energy: -130.644 Dist. restrs. and SS energy: 1.269 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1459.919749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.919749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.484729 (E_RNA) where: Base-Base interactions energy: -1061.952 where: short stacking energy: -420.294 Base-Backbone interact. energy: -2.303 local terms energy: -433.230245 where: bonds (distance) C4'-P energy: -72.376 bonds (distance) P-C4' energy: -78.434 flat angles C4'-P-C4' energy: -95.537 flat angles P-C4'-P energy: -66.714 tors. eta vs tors. theta energy: -120.169 Dist. restrs. and SS energy: 0.815 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1424.944962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.944962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.587878 (E_RNA) where: Base-Base interactions energy: -1028.474 where: short stacking energy: -421.473 Base-Backbone interact. energy: -0.751 local terms energy: -434.362981 where: bonds (distance) C4'-P energy: -89.290 bonds (distance) P-C4' energy: -88.668 flat angles C4'-P-C4' energy: -80.897 flat angles P-C4'-P energy: -55.850 tors. eta vs tors. theta energy: -119.657 Dist. restrs. and SS energy: 1.893 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1401.126493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.126493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.279628 (E_RNA) where: Base-Base interactions energy: -1031.387 where: short stacking energy: -426.434 Base-Backbone interact. energy: -3.403 local terms energy: -405.490037 where: bonds (distance) C4'-P energy: -74.909 bonds (distance) P-C4' energy: -80.176 flat angles C4'-P-C4' energy: -86.013 flat angles P-C4'-P energy: -53.544 tors. eta vs tors. theta energy: -110.848 Dist. restrs. and SS energy: 2.403 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1310.578523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.578523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.195752 (E_RNA) where: Base-Base interactions energy: -960.641 where: short stacking energy: -390.469 Base-Backbone interact. energy: 4.139 local terms energy: -400.694144 where: bonds (distance) C4'-P energy: -75.239 bonds (distance) P-C4' energy: -55.947 flat angles C4'-P-C4' energy: -93.848 flat angles P-C4'-P energy: -63.555 tors. eta vs tors. theta energy: -112.106 Dist. restrs. and SS energy: 9.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -1322.796312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.796312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.968408 (E_RNA) where: Base-Base interactions energy: -959.609 where: short stacking energy: -383.411 Base-Backbone interact. energy: -1.803 local terms energy: -399.557320 where: bonds (distance) C4'-P energy: -68.420 bonds (distance) P-C4' energy: -80.535 flat angles C4'-P-C4' energy: -101.951 flat angles P-C4'-P energy: -46.179 tors. eta vs tors. theta energy: -102.472 Dist. restrs. and SS energy: 1.422 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1679.323581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.323581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.986006 (E_RNA) where: Base-Base interactions energy: -1215.632 where: short stacking energy: -516.022 Base-Backbone interact. energy: -0.566 local terms energy: -500.787974 where: bonds (distance) C4'-P energy: -86.235 bonds (distance) P-C4' energy: -91.371 flat angles C4'-P-C4' energy: -99.650 flat angles P-C4'-P energy: -74.606 tors. eta vs tors. theta energy: -148.926 Dist. restrs. and SS energy: 0.912 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1674.115570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.115570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.639526 (E_RNA) where: Base-Base interactions energy: -1227.076 where: short stacking energy: -514.037 Base-Backbone interact. energy: 1.454 local terms energy: -488.016581 where: bonds (distance) C4'-P energy: -93.645 bonds (distance) P-C4' energy: -87.747 flat angles C4'-P-C4' energy: -97.439 flat angles P-C4'-P energy: -66.907 tors. eta vs tors. theta energy: -142.278 Dist. restrs. and SS energy: 2.774 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1623.886473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.886473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.162285 (E_RNA) where: Base-Base interactions energy: -1165.825 where: short stacking energy: -508.384 Base-Backbone interact. energy: -1.216 local terms energy: -495.121281 where: bonds (distance) C4'-P energy: -98.025 bonds (distance) P-C4' energy: -89.207 flat angles C4'-P-C4' energy: -109.214 flat angles P-C4'-P energy: -62.536 tors. eta vs tors. theta energy: -136.139 Dist. restrs. and SS energy: 1.526 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1596.995784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.995784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.412275 (E_RNA) where: Base-Base interactions energy: -1145.742 where: short stacking energy: -468.843 Base-Backbone interact. energy: 0.373 local terms energy: -489.042848 where: bonds (distance) C4'-P energy: -89.734 bonds (distance) P-C4' energy: -90.845 flat angles C4'-P-C4' energy: -103.344 flat angles P-C4'-P energy: -64.990 tors. eta vs tors. theta energy: -140.130 Dist. restrs. and SS energy: 0.666 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1533.595318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.595318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.270138 (E_RNA) where: Base-Base interactions energy: -1112.824 where: short stacking energy: -453.722 Base-Backbone interact. energy: -0.836 local terms energy: -457.609729 where: bonds (distance) C4'-P energy: -79.143 bonds (distance) P-C4' energy: -84.176 flat angles C4'-P-C4' energy: -105.653 flat angles P-C4'-P energy: -69.397 tors. eta vs tors. theta energy: -119.240 Dist. restrs. and SS energy: 0.925 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1516.937695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.937695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1555.152602 (E_RNA) where: Base-Base interactions energy: -1114.070 where: short stacking energy: -462.140 Base-Backbone interact. energy: 1.553 local terms energy: -442.635041 where: bonds (distance) C4'-P energy: -72.892 bonds (distance) P-C4' energy: -84.442 flat angles C4'-P-C4' energy: -101.669 flat angles P-C4'-P energy: -55.846 tors. eta vs tors. theta energy: -127.786 Dist. restrs. and SS energy: 1.465 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1401.860892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.860892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.741590 (E_RNA) where: Base-Base interactions energy: -1029.380 where: short stacking energy: -411.872 Base-Backbone interact. energy: -2.273 local terms energy: -408.087863 where: bonds (distance) C4'-P energy: -69.055 bonds (distance) P-C4' energy: -73.677 flat angles C4'-P-C4' energy: -93.869 flat angles P-C4'-P energy: -60.241 tors. eta vs tors. theta energy: -111.246 Dist. restrs. and SS energy: 1.131 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1416.054650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.054650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.662564 (E_RNA) where: Base-Base interactions energy: -1020.290 where: short stacking energy: -421.583 Base-Backbone interact. energy: -0.269 local terms energy: -434.103353 where: bonds (distance) C4'-P energy: -82.494 bonds (distance) P-C4' energy: -81.537 flat angles C4'-P-C4' energy: -91.953 flat angles P-C4'-P energy: -56.868 tors. eta vs tors. theta energy: -121.252 Dist. restrs. and SS energy: 1.858 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1326.589022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.589022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.743007 (E_RNA) where: Base-Base interactions energy: -975.829 where: short stacking energy: -397.951 Base-Backbone interact. energy: -1.522 local terms energy: -392.392002 where: bonds (distance) C4'-P energy: -77.634 bonds (distance) P-C4' energy: -77.756 flat angles C4'-P-C4' energy: -82.926 flat angles P-C4'-P energy: -45.157 tors. eta vs tors. theta energy: -108.920 Dist. restrs. and SS energy: 6.404 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -1319.503719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.503719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.947232 (E_RNA) where: Base-Base interactions energy: -972.707 where: short stacking energy: -378.035 Base-Backbone interact. energy: -1.068 local terms energy: -384.172330 where: bonds (distance) C4'-P energy: -70.670 bonds (distance) P-C4' energy: -73.410 flat angles C4'-P-C4' energy: -87.573 flat angles P-C4'-P energy: -55.275 tors. eta vs tors. theta energy: -97.245 Dist. restrs. and SS energy: 1.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1680.390579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.390579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.172995 (E_RNA) where: Base-Base interactions energy: -1188.798 where: short stacking energy: -500.308 Base-Backbone interact. energy: -1.056 local terms energy: -528.319519 where: bonds (distance) C4'-P energy: -100.376 bonds (distance) P-C4' energy: -88.063 flat angles C4'-P-C4' energy: -109.998 flat angles P-C4'-P energy: -83.342 tors. eta vs tors. theta energy: -146.541 Dist. restrs. and SS energy: 1.032 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1660.220238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1660.220238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.629165 (E_RNA) where: Base-Base interactions energy: -1205.687 where: short stacking energy: -500.015 Base-Backbone interact. energy: -1.651 local terms energy: -490.291013 where: bonds (distance) C4'-P energy: -90.823 bonds (distance) P-C4' energy: -83.570 flat angles C4'-P-C4' energy: -104.772 flat angles P-C4'-P energy: -70.184 tors. eta vs tors. theta energy: -140.943 Dist. restrs. and SS energy: 0.659 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1618.521929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.521929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.080061 (E_RNA) where: Base-Base interactions energy: -1176.669 where: short stacking energy: -498.703 Base-Backbone interact. energy: -1.705 local terms energy: -478.706072 where: bonds (distance) C4'-P energy: -88.464 bonds (distance) P-C4' energy: -85.793 flat angles C4'-P-C4' energy: -106.676 flat angles P-C4'-P energy: -64.840 tors. eta vs tors. theta energy: -132.933 Dist. restrs. and SS energy: 1.808 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1590.642821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1590.642821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.562595 (E_RNA) where: Base-Base interactions energy: -1167.058 where: short stacking energy: -483.779 Base-Backbone interact. energy: -0.646 local terms energy: -460.858447 where: bonds (distance) C4'-P energy: -76.305 bonds (distance) P-C4' energy: -75.999 flat angles C4'-P-C4' energy: -100.203 flat angles P-C4'-P energy: -71.132 tors. eta vs tors. theta energy: -137.219 Dist. restrs. and SS energy: 1.170 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1510.700033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.700033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.292672 (E_RNA) where: Base-Base interactions energy: -1078.247 where: short stacking energy: -442.827 Base-Backbone interact. energy: -0.228 local terms energy: -471.818148 where: bonds (distance) C4'-P energy: -81.015 bonds (distance) P-C4' energy: -87.669 flat angles C4'-P-C4' energy: -105.083 flat angles P-C4'-P energy: -60.200 tors. eta vs tors. theta energy: -137.852 Dist. restrs. and SS energy: 2.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1515.095673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.095673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.018961 (E_RNA) where: Base-Base interactions energy: -1113.176 where: short stacking energy: -461.946 Base-Backbone interact. energy: -0.463 local terms energy: -439.379465 where: bonds (distance) C4'-P energy: -77.239 bonds (distance) P-C4' energy: -69.975 flat angles C4'-P-C4' energy: -93.659 flat angles P-C4'-P energy: -57.194 tors. eta vs tors. theta energy: -141.312 Dist. restrs. and SS energy: 1.173 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1400.117398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.117398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.941654 (E_RNA) where: Base-Base interactions energy: -1035.691 where: short stacking energy: -406.554 Base-Backbone interact. energy: 2.441 local terms energy: -404.690992 where: bonds (distance) C4'-P energy: -73.551 bonds (distance) P-C4' energy: -79.409 flat angles C4'-P-C4' energy: -80.906 flat angles P-C4'-P energy: -67.717 tors. eta vs tors. theta energy: -103.109 Dist. restrs. and SS energy: 1.074 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1416.386827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.386827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.669082 (E_RNA) where: Base-Base interactions energy: -1052.895 where: short stacking energy: -441.914 Base-Backbone interact. energy: -1.209 local terms energy: -400.564470 where: bonds (distance) C4'-P energy: -76.831 bonds (distance) P-C4' energy: -50.686 flat angles C4'-P-C4' energy: -88.107 flat angles P-C4'-P energy: -65.353 tors. eta vs tors. theta energy: -119.587 Dist. restrs. and SS energy: 1.532 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1351.360028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.360028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.058713 (E_RNA) where: Base-Base interactions energy: -978.798 where: short stacking energy: -399.170 Base-Backbone interact. energy: -3.899 local terms energy: -417.362395 where: bonds (distance) C4'-P energy: -73.744 bonds (distance) P-C4' energy: -85.353 flat angles C4'-P-C4' energy: -97.049 flat angles P-C4'-P energy: -45.169 tors. eta vs tors. theta energy: -116.047 Dist. restrs. and SS energy: 11.949 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -1294.128056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.128056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.046292 (E_RNA) where: Base-Base interactions energy: -954.231 where: short stacking energy: -376.517 Base-Backbone interact. energy: -0.555 local terms energy: -378.260722 where: bonds (distance) C4'-P energy: -77.078 bonds (distance) P-C4' energy: -82.160 flat angles C4'-P-C4' energy: -72.223 flat angles P-C4'-P energy: -45.397 tors. eta vs tors. theta energy: -101.402 Dist. restrs. and SS energy: 2.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1678.345729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1678.345729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1715.825697 (E_RNA) where: Base-Base interactions energy: -1230.903 where: short stacking energy: -499.842 Base-Backbone interact. energy: -0.045 local terms energy: -484.878304 where: bonds (distance) C4'-P energy: -90.036 bonds (distance) P-C4' energy: -88.082 flat angles C4'-P-C4' energy: -110.193 flat angles P-C4'-P energy: -57.359 tors. eta vs tors. theta energy: -139.208 Dist. restrs. and SS energy: 0.730 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1656.370413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.370413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.989415 (E_RNA) where: Base-Base interactions energy: -1200.727 where: short stacking energy: -465.229 Base-Backbone interact. energy: -2.528 local terms energy: -490.734741 where: bonds (distance) C4'-P energy: -93.235 bonds (distance) P-C4' energy: -95.037 flat angles C4'-P-C4' energy: -93.280 flat angles P-C4'-P energy: -72.678 tors. eta vs tors. theta energy: -136.505 Dist. restrs. and SS energy: 0.869 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1606.074440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.074440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.114204 (E_RNA) where: Base-Base interactions energy: -1168.721 where: short stacking energy: -496.973 Base-Backbone interact. energy: -3.473 local terms energy: -471.919765 where: bonds (distance) C4'-P energy: -76.036 bonds (distance) P-C4' energy: -92.670 flat angles C4'-P-C4' energy: -103.342 flat angles P-C4'-P energy: -63.952 tors. eta vs tors. theta energy: -135.919 Dist. restrs. and SS energy: 1.290 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1624.790176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.790176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.477484 (E_RNA) where: Base-Base interactions energy: -1184.994 where: short stacking energy: -483.505 Base-Backbone interact. energy: -2.330 local terms energy: -477.153680 where: bonds (distance) C4'-P energy: -75.321 bonds (distance) P-C4' energy: -89.692 flat angles C4'-P-C4' energy: -105.561 flat angles P-C4'-P energy: -64.022 tors. eta vs tors. theta energy: -142.558 Dist. restrs. and SS energy: 2.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1521.022142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1521.022142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.647281 (E_RNA) where: Base-Base interactions energy: -1104.851 where: short stacking energy: -462.574 Base-Backbone interact. energy: -0.996 local terms energy: -453.800158 where: bonds (distance) C4'-P energy: -86.471 bonds (distance) P-C4' energy: -79.635 flat angles C4'-P-C4' energy: -85.657 flat angles P-C4'-P energy: -61.275 tors. eta vs tors. theta energy: -140.762 Dist. restrs. and SS energy: 1.875 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1489.547521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.547521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.847848 (E_RNA) where: Base-Base interactions energy: -1067.723 where: short stacking energy: -437.282 Base-Backbone interact. energy: -1.033 local terms energy: -459.091944 where: bonds (distance) C4'-P energy: -83.858 bonds (distance) P-C4' energy: -87.395 flat angles C4'-P-C4' energy: -106.048 flat angles P-C4'-P energy: -54.263 tors. eta vs tors. theta energy: -127.527 Dist. restrs. and SS energy: 1.550 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1429.410031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.410031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.399029 (E_RNA) where: Base-Base interactions energy: -1038.455 where: short stacking energy: -425.773 Base-Backbone interact. energy: 0.654 local terms energy: -430.598254 where: bonds (distance) C4'-P energy: -77.308 bonds (distance) P-C4' energy: -90.873 flat angles C4'-P-C4' energy: -90.700 flat angles P-C4'-P energy: -59.186 tors. eta vs tors. theta energy: -112.532 Dist. restrs. and SS energy: 2.239 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1418.042290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.042290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.837479 (E_RNA) where: Base-Base interactions energy: -1033.809 where: short stacking energy: -418.010 Base-Backbone interact. energy: -2.625 local terms energy: -419.403663 where: bonds (distance) C4'-P energy: -75.294 bonds (distance) P-C4' energy: -61.865 flat angles C4'-P-C4' energy: -92.565 flat angles P-C4'-P energy: -68.191 tors. eta vs tors. theta energy: -121.489 Dist. restrs. and SS energy: 1.045 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1316.838632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.838632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.988219 (E_RNA) where: Base-Base interactions energy: -980.019 where: short stacking energy: -381.325 Base-Backbone interact. energy: -0.003 local terms energy: -381.966051 where: bonds (distance) C4'-P energy: -64.243 bonds (distance) P-C4' energy: -80.627 flat angles C4'-P-C4' energy: -78.519 flat angles P-C4'-P energy: -49.039 tors. eta vs tors. theta energy: -109.539 Dist. restrs. and SS energy: 8.400 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -1290.533329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.533329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.966665 (E_RNA) where: Base-Base interactions energy: -949.762 where: short stacking energy: -365.092 Base-Backbone interact. energy: -1.277 local terms energy: -379.927956 where: bonds (distance) C4'-P energy: -67.929 bonds (distance) P-C4' energy: -69.965 flat angles C4'-P-C4' energy: -77.761 flat angles P-C4'-P energy: -61.240 tors. eta vs tors. theta energy: -103.034 Dist. restrs. and SS energy: 3.683 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1683.750698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.750698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.343589 (E_RNA) where: Base-Base interactions energy: -1227.282 where: short stacking energy: -516.570 Base-Backbone interact. energy: -0.990 local terms energy: -493.071838 where: bonds (distance) C4'-P energy: -90.621 bonds (distance) P-C4' energy: -89.988 flat angles C4'-P-C4' energy: -101.913 flat angles P-C4'-P energy: -70.281 tors. eta vs tors. theta energy: -140.268 Dist. restrs. and SS energy: 0.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1634.445129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.445129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.107611 (E_RNA) where: Base-Base interactions energy: -1181.424 where: short stacking energy: -507.529 Base-Backbone interact. energy: 0.087 local terms energy: -490.771196 where: bonds (distance) C4'-P energy: -85.848 bonds (distance) P-C4' energy: -90.603 flat angles C4'-P-C4' energy: -108.301 flat angles P-C4'-P energy: -64.782 tors. eta vs tors. theta energy: -141.237 Dist. restrs. and SS energy: 0.912 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1607.684222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.684222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.635049 (E_RNA) where: Base-Base interactions energy: -1155.174 where: short stacking energy: -463.786 Base-Backbone interact. energy: -2.134 local terms energy: -489.326978 where: bonds (distance) C4'-P energy: -89.557 bonds (distance) P-C4' energy: -84.976 flat angles C4'-P-C4' energy: -108.655 flat angles P-C4'-P energy: -70.508 tors. eta vs tors. theta energy: -135.630 Dist. restrs. and SS energy: 2.201 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1578.981227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.981227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.817253 (E_RNA) where: Base-Base interactions energy: -1152.774 where: short stacking energy: -463.485 Base-Backbone interact. energy: -1.679 local terms energy: -462.364853 where: bonds (distance) C4'-P energy: -82.599 bonds (distance) P-C4' energy: -91.254 flat angles C4'-P-C4' energy: -95.527 flat angles P-C4'-P energy: -59.811 tors. eta vs tors. theta energy: -133.174 Dist. restrs. and SS energy: 1.086 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1546.654836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.654836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.412262 (E_RNA) where: Base-Base interactions energy: -1125.410 where: short stacking energy: -474.826 Base-Backbone interact. energy: 0.094 local terms energy: -459.095648 where: bonds (distance) C4'-P energy: -83.821 bonds (distance) P-C4' energy: -82.526 flat angles C4'-P-C4' energy: -88.011 flat angles P-C4'-P energy: -66.142 tors. eta vs tors. theta energy: -138.596 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1509.767360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.767360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.828763 (E_RNA) where: Base-Base interactions energy: -1087.721 where: short stacking energy: -453.643 Base-Backbone interact. energy: -2.302 local terms energy: -457.806260 where: bonds (distance) C4'-P energy: -85.893 bonds (distance) P-C4' energy: -76.609 flat angles C4'-P-C4' energy: -98.244 flat angles P-C4'-P energy: -69.562 tors. eta vs tors. theta energy: -127.497 Dist. restrs. and SS energy: 1.311 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1414.828970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.828970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.968756 (E_RNA) where: Base-Base interactions energy: -1038.776 where: short stacking energy: -431.755 Base-Backbone interact. energy: 1.009 local terms energy: -415.201422 where: bonds (distance) C4'-P energy: -81.178 bonds (distance) P-C4' energy: -54.053 flat angles C4'-P-C4' energy: -92.873 flat angles P-C4'-P energy: -68.194 tors. eta vs tors. theta energy: -118.904 Dist. restrs. and SS energy: 1.390 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1431.683976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1431.683976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.378516 (E_RNA) where: Base-Base interactions energy: -1035.137 where: short stacking energy: -421.144 Base-Backbone interact. energy: 2.131 local terms energy: -436.372405 where: bonds (distance) C4'-P energy: -82.019 bonds (distance) P-C4' energy: -85.473 flat angles C4'-P-C4' energy: -86.020 flat angles P-C4'-P energy: -57.622 tors. eta vs tors. theta energy: -125.239 Dist. restrs. and SS energy: 0.945 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1324.465769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.465769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.170745 (E_RNA) where: Base-Base interactions energy: -962.786 where: short stacking energy: -406.731 Base-Backbone interact. energy: 2.448 local terms energy: -412.833407 where: bonds (distance) C4'-P energy: -81.612 bonds (distance) P-C4' energy: -69.516 flat angles C4'-P-C4' energy: -77.367 flat angles P-C4'-P energy: -65.841 tors. eta vs tors. theta energy: -118.497 Dist. restrs. and SS energy: 11.955 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -1288.092116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.092116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.953650 (E_RNA) where: Base-Base interactions energy: -946.648 where: short stacking energy: -366.528 Base-Backbone interact. energy: -0.374 local terms energy: -386.931835 where: bonds (distance) C4'-P energy: -76.641 bonds (distance) P-C4' energy: -70.016 flat angles C4'-P-C4' energy: -91.030 flat angles P-C4'-P energy: -47.781 tors. eta vs tors. theta energy: -101.464 Dist. restrs. and SS energy: 9.112 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1695.705186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.705186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.095778 (E_RNA) where: Base-Base interactions energy: -1245.690 where: short stacking energy: -512.188 Base-Backbone interact. energy: 0.939 local terms energy: -488.344803 where: bonds (distance) C4'-P energy: -87.463 bonds (distance) P-C4' energy: -90.701 flat angles C4'-P-C4' energy: -104.044 flat angles P-C4'-P energy: -69.493 tors. eta vs tors. theta energy: -136.644 Dist. restrs. and SS energy: 0.641 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1674.906558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.906558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.914056 (E_RNA) where: Base-Base interactions energy: -1211.312 where: short stacking energy: -512.578 Base-Backbone interact. energy: -2.595 local terms energy: -499.006464 where: bonds (distance) C4'-P energy: -83.018 bonds (distance) P-C4' energy: -97.048 flat angles C4'-P-C4' energy: -100.619 flat angles P-C4'-P energy: -67.001 tors. eta vs tors. theta energy: -151.320 Dist. restrs. and SS energy: 1.257 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1617.708610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.708610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.344283 (E_RNA) where: Base-Base interactions energy: -1174.552 where: short stacking energy: -474.804 Base-Backbone interact. energy: -2.066 local terms energy: -481.726278 where: bonds (distance) C4'-P energy: -92.135 bonds (distance) P-C4' energy: -86.372 flat angles C4'-P-C4' energy: -97.869 flat angles P-C4'-P energy: -63.595 tors. eta vs tors. theta energy: -141.755 Dist. restrs. and SS energy: 3.886 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1614.927306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.927306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.395606 (E_RNA) where: Base-Base interactions energy: -1170.635 where: short stacking energy: -491.975 Base-Backbone interact. energy: -1.723 local terms energy: -480.037505 where: bonds (distance) C4'-P energy: -78.933 bonds (distance) P-C4' energy: -75.843 flat angles C4'-P-C4' energy: -107.501 flat angles P-C4'-P energy: -74.982 tors. eta vs tors. theta energy: -142.779 Dist. restrs. and SS energy: 0.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1512.568417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.568417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.259541 (E_RNA) where: Base-Base interactions energy: -1084.221 where: short stacking energy: -450.727 Base-Backbone interact. energy: 1.416 local terms energy: -467.454845 where: bonds (distance) C4'-P energy: -83.995 bonds (distance) P-C4' energy: -94.946 flat angles C4'-P-C4' energy: -88.415 flat angles P-C4'-P energy: -69.959 tors. eta vs tors. theta energy: -130.140 Dist. restrs. and SS energy: 0.941 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1490.859818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1490.859818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.053721 (E_RNA) where: Base-Base interactions energy: -1086.586 where: short stacking energy: -468.275 Base-Backbone interact. energy: -2.241 local terms energy: -440.226206 where: bonds (distance) C4'-P energy: -73.351 bonds (distance) P-C4' energy: -74.341 flat angles C4'-P-C4' energy: -97.210 flat angles P-C4'-P energy: -70.719 tors. eta vs tors. theta energy: -124.605 Dist. restrs. and SS energy: 1.444 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1477.344192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.344192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.894279 (E_RNA) where: Base-Base interactions energy: -1080.078 where: short stacking energy: -426.453 Base-Backbone interact. energy: 0.298 local terms energy: -436.113583 where: bonds (distance) C4'-P energy: -77.166 bonds (distance) P-C4' energy: -78.643 flat angles C4'-P-C4' energy: -90.067 flat angles P-C4'-P energy: -65.614 tors. eta vs tors. theta energy: -124.623 Dist. restrs. and SS energy: 1.800 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1370.577106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.577106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.698196 (E_RNA) where: Base-Base interactions energy: -1011.173 where: short stacking energy: -418.819 Base-Backbone interact. energy: -1.111 local terms energy: -397.414198 where: bonds (distance) C4'-P energy: -65.614 bonds (distance) P-C4' energy: -73.616 flat angles C4'-P-C4' energy: -85.736 flat angles P-C4'-P energy: -58.176 tors. eta vs tors. theta energy: -114.271 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1331.221362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.221362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.923849 (E_RNA) where: Base-Base interactions energy: -982.634 where: short stacking energy: -413.677 Base-Backbone interact. energy: -1.370 local terms energy: -392.919772 where: bonds (distance) C4'-P energy: -62.405 bonds (distance) P-C4' energy: -71.414 flat angles C4'-P-C4' energy: -98.999 flat angles P-C4'-P energy: -40.716 tors. eta vs tors. theta energy: -119.385 Dist. restrs. and SS energy: 8.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -1297.486771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.486771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.235168 (E_RNA) where: Base-Base interactions energy: -939.456 where: short stacking energy: -376.875 Base-Backbone interact. energy: -0.549 local terms energy: -397.230075 where: bonds (distance) C4'-P energy: -72.459 bonds (distance) P-C4' energy: -78.379 flat angles C4'-P-C4' energy: -91.741 flat angles P-C4'-P energy: -48.976 tors. eta vs tors. theta energy: -105.676 Dist. restrs. and SS energy: 2.998 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1664.607181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1664.607181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.257397 (E_RNA) where: Base-Base interactions energy: -1212.878 where: short stacking energy: -509.536 Base-Backbone interact. energy: -1.027 local terms energy: -488.352356 where: bonds (distance) C4'-P energy: -78.294 bonds (distance) P-C4' energy: -97.715 flat angles C4'-P-C4' energy: -99.516 flat angles P-C4'-P energy: -75.447 tors. eta vs tors. theta energy: -137.380 Dist. restrs. and SS energy: 0.900 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1675.148168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.148168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.528492 (E_RNA) where: Base-Base interactions energy: -1202.356 where: short stacking energy: -506.948 Base-Backbone interact. energy: -1.792 local terms energy: -508.380459 where: bonds (distance) C4'-P energy: -97.974 bonds (distance) P-C4' energy: -99.576 flat angles C4'-P-C4' energy: -104.370 flat angles P-C4'-P energy: -53.394 tors. eta vs tors. theta energy: -153.068 Dist. restrs. and SS energy: 0.630 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1605.423556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.423556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.167958 (E_RNA) where: Base-Base interactions energy: -1165.590 where: short stacking energy: -458.186 Base-Backbone interact. energy: -2.574 local terms energy: -475.003456 where: bonds (distance) C4'-P energy: -83.332 bonds (distance) P-C4' energy: -91.767 flat angles C4'-P-C4' energy: -96.797 flat angles P-C4'-P energy: -76.535 tors. eta vs tors. theta energy: -126.573 Dist. restrs. and SS energy: 0.994 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1593.487716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.487716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.234578 (E_RNA) where: Base-Base interactions energy: -1151.478 where: short stacking energy: -470.591 Base-Backbone interact. energy: -1.329 local terms energy: -478.427140 where: bonds (distance) C4'-P energy: -87.958 bonds (distance) P-C4' energy: -82.296 flat angles C4'-P-C4' energy: -105.731 flat angles P-C4'-P energy: -65.601 tors. eta vs tors. theta energy: -136.841 Dist. restrs. and SS energy: 0.997 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1547.550388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.550388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.852002 (E_RNA) where: Base-Base interactions energy: -1122.592 where: short stacking energy: -470.004 Base-Backbone interact. energy: -0.834 local terms energy: -461.425351 where: bonds (distance) C4'-P energy: -67.735 bonds (distance) P-C4' energy: -90.933 flat angles C4'-P-C4' energy: -100.951 flat angles P-C4'-P energy: -67.811 tors. eta vs tors. theta energy: -133.995 Dist. restrs. and SS energy: 0.552 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1516.085745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.085745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.371348 (E_RNA) where: Base-Base interactions energy: -1109.261 where: short stacking energy: -461.488 Base-Backbone interact. energy: 0.266 local terms energy: -445.376949 where: bonds (distance) C4'-P energy: -79.558 bonds (distance) P-C4' energy: -76.652 flat angles C4'-P-C4' energy: -88.459 flat angles P-C4'-P energy: -65.465 tors. eta vs tors. theta energy: -135.242 Dist. restrs. and SS energy: 1.536 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1439.773608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.773608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.756773 (E_RNA) where: Base-Base interactions energy: -1035.134 where: short stacking energy: -420.667 Base-Backbone interact. energy: 0.280 local terms energy: -443.903124 where: bonds (distance) C4'-P energy: -86.726 bonds (distance) P-C4' energy: -82.936 flat angles C4'-P-C4' energy: -91.221 flat angles P-C4'-P energy: -60.060 tors. eta vs tors. theta energy: -122.960 Dist. restrs. and SS energy: 2.233 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1385.436346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.436346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.646978 (E_RNA) where: Base-Base interactions energy: -1015.469 where: short stacking energy: -406.321 Base-Backbone interact. energy: -0.963 local terms energy: -407.214505 where: bonds (distance) C4'-P energy: -74.133 bonds (distance) P-C4' energy: -76.580 flat angles C4'-P-C4' energy: -82.176 flat angles P-C4'-P energy: -66.160 tors. eta vs tors. theta energy: -108.164 Dist. restrs. and SS energy: 1.461 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1307.713062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.713062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.535773 (E_RNA) where: Base-Base interactions energy: -975.305 where: short stacking energy: -401.327 Base-Backbone interact. energy: -2.076 local terms energy: -375.155226 where: bonds (distance) C4'-P energy: -78.467 bonds (distance) P-C4' energy: -70.726 flat angles C4'-P-C4' energy: -77.625 flat angles P-C4'-P energy: -43.412 tors. eta vs tors. theta energy: -104.925 Dist. restrs. and SS energy: 8.073 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -1293.406524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.406524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.034680 (E_RNA) where: Base-Base interactions energy: -984.810 where: short stacking energy: -406.094 Base-Backbone interact. energy: 3.155 local terms energy: -355.379715 where: bonds (distance) C4'-P energy: -65.985 bonds (distance) P-C4' energy: -74.167 flat angles C4'-P-C4' energy: -65.165 flat angles P-C4'-P energy: -49.128 tors. eta vs tors. theta energy: -100.936 Dist. restrs. and SS energy: 6.878 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1693.849936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.849936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.161518 (E_RNA) where: Base-Base interactions energy: -1228.563 where: short stacking energy: -519.583 Base-Backbone interact. energy: -2.279 local terms energy: -500.319303 where: bonds (distance) C4'-P energy: -90.806 bonds (distance) P-C4' energy: -89.652 flat angles C4'-P-C4' energy: -105.522 flat angles P-C4'-P energy: -70.991 tors. eta vs tors. theta energy: -143.348 Dist. restrs. and SS energy: 0.562 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1649.293811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.293811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.314144 (E_RNA) where: Base-Base interactions energy: -1181.893 where: short stacking energy: -497.961 Base-Backbone interact. energy: -1.294 local terms energy: -505.127058 where: bonds (distance) C4'-P energy: -88.430 bonds (distance) P-C4' energy: -95.440 flat angles C4'-P-C4' energy: -106.612 flat angles P-C4'-P energy: -68.088 tors. eta vs tors. theta energy: -146.557 Dist. restrs. and SS energy: 2.270 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1585.633125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.633125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.492967 (E_RNA) where: Base-Base interactions energy: -1151.323 where: short stacking energy: -470.001 Base-Backbone interact. energy: 3.373 local terms energy: -475.543386 where: bonds (distance) C4'-P energy: -81.842 bonds (distance) P-C4' energy: -88.361 flat angles C4'-P-C4' energy: -109.100 flat angles P-C4'-P energy: -64.461 tors. eta vs tors. theta energy: -131.780 Dist. restrs. and SS energy: 1.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1576.229234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.229234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.293438 (E_RNA) where: Base-Base interactions energy: -1152.139 where: short stacking energy: -473.682 Base-Backbone interact. energy: -2.542 local terms energy: -459.612925 where: bonds (distance) C4'-P energy: -75.790 bonds (distance) P-C4' energy: -76.831 flat angles C4'-P-C4' energy: -89.771 flat angles P-C4'-P energy: -79.601 tors. eta vs tors. theta energy: -137.619 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1508.971851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.971851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.626052 (E_RNA) where: Base-Base interactions energy: -1078.016 where: short stacking energy: -448.562 Base-Backbone interact. energy: -3.647 local terms energy: -464.963483 where: bonds (distance) C4'-P energy: -84.769 bonds (distance) P-C4' energy: -87.720 flat angles C4'-P-C4' energy: -100.665 flat angles P-C4'-P energy: -70.868 tors. eta vs tors. theta energy: -120.942 Dist. restrs. and SS energy: 0.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1450.955887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.955887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.381915 (E_RNA) where: Base-Base interactions energy: -1048.705 where: short stacking energy: -419.794 Base-Backbone interact. energy: -1.873 local terms energy: -439.804559 where: bonds (distance) C4'-P energy: -80.780 bonds (distance) P-C4' energy: -81.092 flat angles C4'-P-C4' energy: -96.462 flat angles P-C4'-P energy: -62.662 tors. eta vs tors. theta energy: -118.808 Dist. restrs. and SS energy: 2.676 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1469.961056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.961056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.671770 (E_RNA) where: Base-Base interactions energy: -1086.956 where: short stacking energy: -437.139 Base-Backbone interact. energy: 2.739 local terms energy: -423.454102 where: bonds (distance) C4'-P energy: -85.523 bonds (distance) P-C4' energy: -70.488 flat angles C4'-P-C4' energy: -81.555 flat angles P-C4'-P energy: -59.691 tors. eta vs tors. theta energy: -126.197 Dist. restrs. and SS energy: 0.961 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1387.123325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.123325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.718006 (E_RNA) where: Base-Base interactions energy: -1036.992 where: short stacking energy: -425.513 Base-Backbone interact. energy: -0.546 local terms energy: -387.179658 where: bonds (distance) C4'-P energy: -67.425 bonds (distance) P-C4' energy: -64.025 flat angles C4'-P-C4' energy: -92.730 flat angles P-C4'-P energy: -53.694 tors. eta vs tors. theta energy: -109.306 Dist. restrs. and SS energy: 0.845 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1331.872488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.872488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.949107 (E_RNA) where: Base-Base interactions energy: -990.917 where: short stacking energy: -382.874 Base-Backbone interact. energy: 1.840 local terms energy: -381.871347 where: bonds (distance) C4'-P energy: -68.398 bonds (distance) P-C4' energy: -83.797 flat angles C4'-P-C4' energy: -81.357 flat angles P-C4'-P energy: -44.966 tors. eta vs tors. theta energy: -103.353 Dist. restrs. and SS energy: 2.327 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -1275.649313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.649313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.627169 (E_RNA) where: Base-Base interactions energy: -949.720 where: short stacking energy: -387.617 Base-Backbone interact. energy: -2.940 local terms energy: -371.967190 where: bonds (distance) C4'-P energy: -43.703 bonds (distance) P-C4' energy: -82.328 flat angles C4'-P-C4' energy: -90.189 flat angles P-C4'-P energy: -53.696 tors. eta vs tors. theta energy: -102.051 Dist. restrs. and SS energy: 12.228 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1689.973325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.973325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.655365 (E_RNA) where: Base-Base interactions energy: -1242.451 where: short stacking energy: -524.002 Base-Backbone interact. energy: 0.487 local terms energy: -485.690753 where: bonds (distance) C4'-P energy: -86.791 bonds (distance) P-C4' energy: -82.881 flat angles C4'-P-C4' energy: -105.258 flat angles P-C4'-P energy: -68.776 tors. eta vs tors. theta energy: -141.985 Dist. restrs. and SS energy: 0.932 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1648.539804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.539804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.244889 (E_RNA) where: Base-Base interactions energy: -1194.954 where: short stacking energy: -506.853 Base-Backbone interact. energy: -3.013 local terms energy: -489.278047 where: bonds (distance) C4'-P energy: -90.115 bonds (distance) P-C4' energy: -86.481 flat angles C4'-P-C4' energy: -95.000 flat angles P-C4'-P energy: -76.207 tors. eta vs tors. theta energy: -141.475 Dist. restrs. and SS energy: 1.955 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1640.915049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.915049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.284811 (E_RNA) where: Base-Base interactions energy: -1193.859 where: short stacking energy: -477.493 Base-Backbone interact. energy: -1.541 local terms energy: -483.884999 where: bonds (distance) C4'-P energy: -89.784 bonds (distance) P-C4' energy: -94.486 flat angles C4'-P-C4' energy: -102.057 flat angles P-C4'-P energy: -66.995 tors. eta vs tors. theta energy: -130.563 Dist. restrs. and SS energy: 1.620 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1561.585286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.585286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.023868 (E_RNA) where: Base-Base interactions energy: -1146.430 where: short stacking energy: -469.835 Base-Backbone interact. energy: -1.178 local terms energy: -451.415572 where: bonds (distance) C4'-P energy: -72.848 bonds (distance) P-C4' energy: -84.667 flat angles C4'-P-C4' energy: -101.816 flat angles P-C4'-P energy: -57.374 tors. eta vs tors. theta energy: -134.711 Dist. restrs. and SS energy: 0.689 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1509.671798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.671798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.951181 (E_RNA) where: Base-Base interactions energy: -1084.132 where: short stacking energy: -467.700 Base-Backbone interact. energy: -1.972 local terms energy: -461.847303 where: bonds (distance) C4'-P energy: -73.911 bonds (distance) P-C4' energy: -89.356 flat angles C4'-P-C4' energy: -99.459 flat angles P-C4'-P energy: -64.339 tors. eta vs tors. theta energy: -134.781 Dist. restrs. and SS energy: 1.529 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1462.211783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.211783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.634321 (E_RNA) where: Base-Base interactions energy: -1056.305 where: short stacking energy: -430.771 Base-Backbone interact. energy: -0.568 local terms energy: -443.761279 where: bonds (distance) C4'-P energy: -75.458 bonds (distance) P-C4' energy: -83.969 flat angles C4'-P-C4' energy: -92.025 flat angles P-C4'-P energy: -65.908 tors. eta vs tors. theta energy: -126.401 Dist. restrs. and SS energy: 1.673 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1425.569402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.569402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.309956 (E_RNA) where: Base-Base interactions energy: -1049.153 where: short stacking energy: -418.203 Base-Backbone interact. energy: 7.225 local terms energy: -422.381838 where: bonds (distance) C4'-P energy: -72.703 bonds (distance) P-C4' energy: -76.551 flat angles C4'-P-C4' energy: -96.496 flat angles P-C4'-P energy: -59.193 tors. eta vs tors. theta energy: -117.439 Dist. restrs. and SS energy: 1.991 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1383.807138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.807138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.033377 (E_RNA) where: Base-Base interactions energy: -1009.618 where: short stacking energy: -406.919 Base-Backbone interact. energy: -0.160 local terms energy: -413.255662 where: bonds (distance) C4'-P energy: -74.982 bonds (distance) P-C4' energy: -72.238 flat angles C4'-P-C4' energy: -90.545 flat angles P-C4'-P energy: -58.898 tors. eta vs tors. theta energy: -116.592 Dist. restrs. and SS energy: 2.476 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1361.450347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.450347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.740193 (E_RNA) where: Base-Base interactions energy: -993.367 where: short stacking energy: -405.991 Base-Backbone interact. energy: 0.611 local terms energy: -406.984491 where: bonds (distance) C4'-P energy: -80.761 bonds (distance) P-C4' energy: -73.176 flat angles C4'-P-C4' energy: -91.204 flat angles P-C4'-P energy: -62.651 tors. eta vs tors. theta energy: -99.192 Dist. restrs. and SS energy: 1.540 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -1247.323536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.323536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.222506 (E_RNA) where: Base-Base interactions energy: -930.671 where: short stacking energy: -376.609 Base-Backbone interact. energy: 1.565 local terms energy: -367.117367 where: bonds (distance) C4'-P energy: -69.652 bonds (distance) P-C4' energy: -66.974 flat angles C4'-P-C4' energy: -78.333 flat angles P-C4'-P energy: -48.164 tors. eta vs tors. theta energy: -103.995 Dist. restrs. and SS energy: 12.149 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1697.483877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.483877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.787910 (E_RNA) where: Base-Base interactions energy: -1233.714 where: short stacking energy: -516.155 Base-Backbone interact. energy: 0.700 local terms energy: -501.774859 where: bonds (distance) C4'-P energy: -96.649 bonds (distance) P-C4' energy: -84.975 flat angles C4'-P-C4' energy: -111.158 flat angles P-C4'-P energy: -65.362 tors. eta vs tors. theta energy: -143.631 Dist. restrs. and SS energy: 0.554 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1658.700987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.700987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.038649 (E_RNA) where: Base-Base interactions energy: -1208.873 where: short stacking energy: -506.998 Base-Backbone interact. energy: -2.204 local terms energy: -485.961983 where: bonds (distance) C4'-P energy: -83.643 bonds (distance) P-C4' energy: -82.145 flat angles C4'-P-C4' energy: -97.753 flat angles P-C4'-P energy: -78.500 tors. eta vs tors. theta energy: -143.921 Dist. restrs. and SS energy: 1.588 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1610.334468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.334468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.396614 (E_RNA) where: Base-Base interactions energy: -1182.843 where: short stacking energy: -481.307 Base-Backbone interact. energy: -0.364 local terms energy: -465.189088 where: bonds (distance) C4'-P energy: -78.422 bonds (distance) P-C4' energy: -83.198 flat angles C4'-P-C4' energy: -98.918 flat angles P-C4'-P energy: -68.276 tors. eta vs tors. theta energy: -136.374 Dist. restrs. and SS energy: 1.312 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1586.430000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.430000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.248896 (E_RNA) where: Base-Base interactions energy: -1141.579 where: short stacking energy: -471.189 Base-Backbone interact. energy: -1.831 local terms energy: -480.839452 where: bonds (distance) C4'-P energy: -86.991 bonds (distance) P-C4' energy: -90.581 flat angles C4'-P-C4' energy: -107.338 flat angles P-C4'-P energy: -70.401 tors. eta vs tors. theta energy: -125.529 Dist. restrs. and SS energy: 1.069 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1510.890299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.890299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.604899 (E_RNA) where: Base-Base interactions energy: -1097.419 where: short stacking energy: -462.115 Base-Backbone interact. energy: -2.068 local terms energy: -449.118059 where: bonds (distance) C4'-P energy: -73.993 bonds (distance) P-C4' energy: -94.726 flat angles C4'-P-C4' energy: -93.832 flat angles P-C4'-P energy: -67.912 tors. eta vs tors. theta energy: -118.655 Dist. restrs. and SS energy: 0.965 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1447.603707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.603707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.835497 (E_RNA) where: Base-Base interactions energy: -1075.447 where: short stacking energy: -441.282 Base-Backbone interact. energy: -1.693 local terms energy: -408.695736 where: bonds (distance) C4'-P energy: -72.326 bonds (distance) P-C4' energy: -74.771 flat angles C4'-P-C4' energy: -85.296 flat angles P-C4'-P energy: -53.601 tors. eta vs tors. theta energy: -122.702 Dist. restrs. and SS energy: 1.482 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1436.277972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.277972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.231748 (E_RNA) where: Base-Base interactions energy: -1043.617 where: short stacking energy: -421.183 Base-Backbone interact. energy: 0.121 local terms energy: -431.735746 where: bonds (distance) C4'-P energy: -88.477 bonds (distance) P-C4' energy: -68.530 flat angles C4'-P-C4' energy: -88.263 flat angles P-C4'-P energy: -69.011 tors. eta vs tors. theta energy: -117.456 Dist. restrs. and SS energy: 2.204 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1415.535553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.535553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.940833 (E_RNA) where: Base-Base interactions energy: -1029.997 where: short stacking energy: -420.921 Base-Backbone interact. energy: 2.402 local terms energy: -427.345404 where: bonds (distance) C4'-P energy: -79.331 bonds (distance) P-C4' energy: -76.530 flat angles C4'-P-C4' energy: -94.110 flat angles P-C4'-P energy: -49.922 tors. eta vs tors. theta energy: -127.452 Dist. restrs. and SS energy: 2.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1354.418257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.418257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.341241 (E_RNA) where: Base-Base interactions energy: -1004.286 where: short stacking energy: -407.272 Base-Backbone interact. energy: -0.637 local terms energy: -388.418031 where: bonds (distance) C4'-P energy: -64.814 bonds (distance) P-C4' energy: -69.842 flat angles C4'-P-C4' energy: -84.086 flat angles P-C4'-P energy: -56.082 tors. eta vs tors. theta energy: -113.593 Dist. restrs. and SS energy: 2.173 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -1289.627441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.627441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.754115 (E_RNA) where: Base-Base interactions energy: -939.623 where: short stacking energy: -374.506 Base-Backbone interact. energy: -2.242 local terms energy: -393.889202 where: bonds (distance) C4'-P energy: -66.796 bonds (distance) P-C4' energy: -89.213 flat angles C4'-P-C4' energy: -80.332 flat angles P-C4'-P energy: -58.832 tors. eta vs tors. theta energy: -98.716 Dist. restrs. and SS energy: 9.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1700.648467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.648467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.579885 (E_RNA) where: Base-Base interactions energy: -1236.246 where: short stacking energy: -530.455 Base-Backbone interact. energy: -1.804 local terms energy: -500.529415 where: bonds (distance) C4'-P energy: -85.700 bonds (distance) P-C4' energy: -96.885 flat angles C4'-P-C4' energy: -104.065 flat angles P-C4'-P energy: -70.926 tors. eta vs tors. theta energy: -142.954 Dist. restrs. and SS energy: 1.181 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1643.509247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.509247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.625759 (E_RNA) where: Base-Base interactions energy: -1177.054 where: short stacking energy: -498.650 Base-Backbone interact. energy: 0.588 local terms energy: -506.159946 where: bonds (distance) C4'-P energy: -75.680 bonds (distance) P-C4' energy: -107.781 flat angles C4'-P-C4' energy: -105.285 flat angles P-C4'-P energy: -73.466 tors. eta vs tors. theta energy: -143.949 Dist. restrs. and SS energy: 2.367 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1652.839557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.839557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.397223 (E_RNA) where: Base-Base interactions energy: -1193.203 where: short stacking energy: -505.465 Base-Backbone interact. energy: -1.421 local terms energy: -496.773231 where: bonds (distance) C4'-P energy: -84.369 bonds (distance) P-C4' energy: -87.146 flat angles C4'-P-C4' energy: -105.630 flat angles P-C4'-P energy: -72.502 tors. eta vs tors. theta energy: -147.127 Dist. restrs. and SS energy: 1.808 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1567.646698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.646698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.519391 (E_RNA) where: Base-Base interactions energy: -1143.570 where: short stacking energy: -477.575 Base-Backbone interact. energy: -1.152 local terms energy: -460.797637 where: bonds (distance) C4'-P energy: -84.586 bonds (distance) P-C4' energy: -79.684 flat angles C4'-P-C4' energy: -94.943 flat angles P-C4'-P energy: -71.163 tors. eta vs tors. theta energy: -130.422 Dist. restrs. and SS energy: 1.123 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1539.196324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.196324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.472524 (E_RNA) where: Base-Base interactions energy: -1110.834 where: short stacking energy: -472.852 Base-Backbone interact. energy: -0.471 local terms energy: -467.167489 where: bonds (distance) C4'-P energy: -82.437 bonds (distance) P-C4' energy: -80.304 flat angles C4'-P-C4' energy: -96.383 flat angles P-C4'-P energy: -69.930 tors. eta vs tors. theta energy: -138.114 Dist. restrs. and SS energy: 2.526 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1463.277244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.277244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.323039 (E_RNA) where: Base-Base interactions energy: -1073.010 where: short stacking energy: -444.296 Base-Backbone interact. energy: 0.361 local terms energy: -428.673916 where: bonds (distance) C4'-P energy: -65.423 bonds (distance) P-C4' energy: -83.182 flat angles C4'-P-C4' energy: -102.382 flat angles P-C4'-P energy: -54.920 tors. eta vs tors. theta energy: -122.768 Dist. restrs. and SS energy: 1.296 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1451.101869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.101869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.475051 (E_RNA) where: Base-Base interactions energy: -1042.437 where: short stacking energy: -443.395 Base-Backbone interact. energy: -1.336 local terms energy: -446.701564 where: bonds (distance) C4'-P energy: -85.201 bonds (distance) P-C4' energy: -77.223 flat angles C4'-P-C4' energy: -95.220 flat angles P-C4'-P energy: -65.752 tors. eta vs tors. theta energy: -123.306 Dist. restrs. and SS energy: 2.623 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1400.997667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.997667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.220731 (E_RNA) where: Base-Base interactions energy: -1029.737 where: short stacking energy: -421.959 Base-Backbone interact. energy: -1.504 local terms energy: -408.979505 where: bonds (distance) C4'-P energy: -62.782 bonds (distance) P-C4' energy: -72.457 flat angles C4'-P-C4' energy: -93.993 flat angles P-C4'-P energy: -60.474 tors. eta vs tors. theta energy: -119.273 Dist. restrs. and SS energy: 2.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1346.486833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.486833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.457160 (E_RNA) where: Base-Base interactions energy: -1002.985 where: short stacking energy: -396.292 Base-Backbone interact. energy: 0.030 local terms energy: -383.502446 where: bonds (distance) C4'-P energy: -67.354 bonds (distance) P-C4' energy: -78.996 flat angles C4'-P-C4' energy: -84.628 flat angles P-C4'-P energy: -47.663 tors. eta vs tors. theta energy: -104.862 Dist. restrs. and SS energy: 3.220 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -1263.425965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.425965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.795444 (E_RNA) where: Base-Base interactions energy: -942.410 where: short stacking energy: -380.643 Base-Backbone interact. energy: -1.705 local terms energy: -368.680897 where: bonds (distance) C4'-P energy: -69.512 bonds (distance) P-C4' energy: -72.929 flat angles C4'-P-C4' energy: -85.571 flat angles P-C4'-P energy: -44.177 tors. eta vs tors. theta energy: -96.493 Dist. restrs. and SS energy: 12.619 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1734.808257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.808257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1773.344671 (E_RNA) where: Base-Base interactions energy: -1267.349 where: short stacking energy: -534.472 Base-Backbone interact. energy: 2.587 local terms energy: -508.582437 where: bonds (distance) C4'-P energy: -93.303 bonds (distance) P-C4' energy: -97.785 flat angles C4'-P-C4' energy: -106.640 flat angles P-C4'-P energy: -65.822 tors. eta vs tors. theta energy: -145.032 Dist. restrs. and SS energy: 1.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1645.932798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.932798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.739028 (E_RNA) where: Base-Base interactions energy: -1193.066 where: short stacking energy: -512.901 Base-Backbone interact. energy: -0.955 local terms energy: -489.717923 where: bonds (distance) C4'-P energy: -81.572 bonds (distance) P-C4' energy: -91.568 flat angles C4'-P-C4' energy: -96.896 flat angles P-C4'-P energy: -74.983 tors. eta vs tors. theta energy: -144.700 Dist. restrs. and SS energy: 1.056 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1653.723656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.723656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.602753 (E_RNA) where: Base-Base interactions energy: -1197.496 where: short stacking energy: -499.831 Base-Backbone interact. energy: -4.330 local terms energy: -489.776745 where: bonds (distance) C4'-P energy: -91.842 bonds (distance) P-C4' energy: -85.139 flat angles C4'-P-C4' energy: -93.737 flat angles P-C4'-P energy: -73.356 tors. eta vs tors. theta energy: -145.702 Dist. restrs. and SS energy: 1.129 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1586.474221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.474221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.228044 (E_RNA) where: Base-Base interactions energy: -1172.551 where: short stacking energy: -478.685 Base-Backbone interact. energy: 2.071 local terms energy: -453.747810 where: bonds (distance) C4'-P energy: -79.659 bonds (distance) P-C4' energy: -83.442 flat angles C4'-P-C4' energy: -99.526 flat angles P-C4'-P energy: -66.028 tors. eta vs tors. theta energy: -125.094 Dist. restrs. and SS energy: 1.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1516.611172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1516.611172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.965026 (E_RNA) where: Base-Base interactions energy: -1108.201 where: short stacking energy: -472.810 Base-Backbone interact. energy: -0.372 local terms energy: -446.391290 where: bonds (distance) C4'-P energy: -88.816 bonds (distance) P-C4' energy: -72.155 flat angles C4'-P-C4' energy: -100.546 flat angles P-C4'-P energy: -50.547 tors. eta vs tors. theta energy: -134.327 Dist. restrs. and SS energy: 1.604 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1484.980872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.980872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.224600 (E_RNA) where: Base-Base interactions energy: -1078.484 where: short stacking energy: -436.953 Base-Backbone interact. energy: -2.064 local terms energy: -442.677262 where: bonds (distance) C4'-P energy: -74.489 bonds (distance) P-C4' energy: -71.554 flat angles C4'-P-C4' energy: -99.932 flat angles P-C4'-P energy: -71.700 tors. eta vs tors. theta energy: -125.002 Dist. restrs. and SS energy: 1.494 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1442.821455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.821455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.237072 (E_RNA) where: Base-Base interactions energy: -1056.873 where: short stacking energy: -437.915 Base-Backbone interact. energy: -0.360 local terms energy: -424.003925 where: bonds (distance) C4'-P energy: -78.291 bonds (distance) P-C4' energy: -75.963 flat angles C4'-P-C4' energy: -96.441 flat angles P-C4'-P energy: -57.352 tors. eta vs tors. theta energy: -115.957 Dist. restrs. and SS energy: 1.666 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1447.479403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.479403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.933717 (E_RNA) where: Base-Base interactions energy: -1047.310 where: short stacking energy: -434.201 Base-Backbone interact. energy: -1.664 local terms energy: -436.959742 where: bonds (distance) C4'-P energy: -73.376 bonds (distance) P-C4' energy: -87.648 flat angles C4'-P-C4' energy: -98.151 flat angles P-C4'-P energy: -56.054 tors. eta vs tors. theta energy: -121.731 Dist. restrs. and SS energy: 1.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1407.227407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.227407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.303053 (E_RNA) where: Base-Base interactions energy: -1023.099 where: short stacking energy: -427.212 Base-Backbone interact. energy: -1.119 local terms energy: -421.084719 where: bonds (distance) C4'-P energy: -70.928 bonds (distance) P-C4' energy: -60.863 flat angles C4'-P-C4' energy: -98.164 flat angles P-C4'-P energy: -67.158 tors. eta vs tors. theta energy: -123.972 Dist. restrs. and SS energy: 1.326 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -1277.096182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.096182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.810900 (E_RNA) where: Base-Base interactions energy: -941.739 where: short stacking energy: -385.042 Base-Backbone interact. energy: 0.983 local terms energy: -383.055495 where: bonds (distance) C4'-P energy: -65.062 bonds (distance) P-C4' energy: -76.337 flat angles C4'-P-C4' energy: -88.702 flat angles P-C4'-P energy: -52.064 tors. eta vs tors. theta energy: -100.890 Dist. restrs. and SS energy: 9.965 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1722.169081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1722.169081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.664204 (E_RNA) where: Base-Base interactions energy: -1260.239 where: short stacking energy: -518.960 Base-Backbone interact. energy: -1.314 local terms energy: -498.110738 where: bonds (distance) C4'-P energy: -93.365 bonds (distance) P-C4' energy: -93.377 flat angles C4'-P-C4' energy: -101.281 flat angles P-C4'-P energy: -66.801 tors. eta vs tors. theta energy: -143.287 Dist. restrs. and SS energy: 0.745 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1700.201436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.201436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.515506 (E_RNA) where: Base-Base interactions energy: -1230.403 where: short stacking energy: -513.166 Base-Backbone interact. energy: -1.432 local terms energy: -505.679928 where: bonds (distance) C4'-P energy: -82.185 bonds (distance) P-C4' energy: -99.149 flat angles C4'-P-C4' energy: -96.538 flat angles P-C4'-P energy: -74.908 tors. eta vs tors. theta energy: -152.899 Dist. restrs. and SS energy: 0.564 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1636.274158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.274158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.957924 (E_RNA) where: Base-Base interactions energy: -1188.917 where: short stacking energy: -493.117 Base-Backbone interact. energy: 0.940 local terms energy: -485.980584 where: bonds (distance) C4'-P energy: -88.456 bonds (distance) P-C4' energy: -85.871 flat angles C4'-P-C4' energy: -103.805 flat angles P-C4'-P energy: -70.623 tors. eta vs tors. theta energy: -137.226 Dist. restrs. and SS energy: 0.934 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1582.253708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.253708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.835764 (E_RNA) where: Base-Base interactions energy: -1159.813 where: short stacking energy: -457.779 Base-Backbone interact. energy: -0.121 local terms energy: -459.901897 where: bonds (distance) C4'-P energy: -80.067 bonds (distance) P-C4' energy: -95.432 flat angles C4'-P-C4' energy: -91.313 flat angles P-C4'-P energy: -64.745 tors. eta vs tors. theta energy: -128.345 Dist. restrs. and SS energy: 0.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1560.157559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.157559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1597.734383 (E_RNA) where: Base-Base interactions energy: -1131.837 where: short stacking energy: -467.140 Base-Backbone interact. energy: -2.377 local terms energy: -463.520518 where: bonds (distance) C4'-P energy: -80.120 bonds (distance) P-C4' energy: -82.163 flat angles C4'-P-C4' energy: -102.976 flat angles P-C4'-P energy: -69.116 tors. eta vs tors. theta energy: -129.146 Dist. restrs. and SS energy: 0.827 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1502.728683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.728683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.443223 (E_RNA) where: Base-Base interactions energy: -1088.826 where: short stacking energy: -445.316 Base-Backbone interact. energy: -1.656 local terms energy: -449.961287 where: bonds (distance) C4'-P energy: -90.153 bonds (distance) P-C4' energy: -87.095 flat angles C4'-P-C4' energy: -83.310 flat angles P-C4'-P energy: -60.649 tors. eta vs tors. theta energy: -128.754 Dist. restrs. and SS energy: 0.965 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1430.179673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.179673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.477305 (E_RNA) where: Base-Base interactions energy: -1053.046 where: short stacking energy: -424.657 Base-Backbone interact. energy: -3.134 local terms energy: -415.297983 where: bonds (distance) C4'-P energy: -71.673 bonds (distance) P-C4' energy: -76.816 flat angles C4'-P-C4' energy: -91.730 flat angles P-C4'-P energy: -59.596 tors. eta vs tors. theta energy: -115.484 Dist. restrs. and SS energy: 4.548 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1421.502052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.502052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.639879 (E_RNA) where: Base-Base interactions energy: -1028.026 where: short stacking energy: -441.061 Base-Backbone interact. energy: -0.679 local terms energy: -430.935493 where: bonds (distance) C4'-P energy: -75.234 bonds (distance) P-C4' energy: -73.253 flat angles C4'-P-C4' energy: -95.705 flat angles P-C4'-P energy: -65.774 tors. eta vs tors. theta energy: -120.970 Dist. restrs. and SS energy: 1.388 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1382.926559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.926559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.397364 (E_RNA) where: Base-Base interactions energy: -1013.776 where: short stacking energy: -407.380 Base-Backbone interact. energy: -2.022 local terms energy: -405.599092 where: bonds (distance) C4'-P energy: -71.866 bonds (distance) P-C4' energy: -80.765 flat angles C4'-P-C4' energy: -85.515 flat angles P-C4'-P energy: -51.741 tors. eta vs tors. theta energy: -115.711 Dist. restrs. and SS energy: 1.721 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -1286.469874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.469874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.167852 (E_RNA) where: Base-Base interactions energy: -951.922 where: short stacking energy: -387.015 Base-Backbone interact. energy: -2.724 local terms energy: -384.521226 where: bonds (distance) C4'-P energy: -81.559 bonds (distance) P-C4' energy: -63.721 flat angles C4'-P-C4' energy: -65.305 flat angles P-C4'-P energy: -73.180 tors. eta vs tors. theta energy: -100.755 Dist. restrs. and SS energy: 15.948 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1729.532325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1729.532325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1767.402542 (E_RNA) where: Base-Base interactions energy: -1255.850 where: short stacking energy: -532.985 Base-Backbone interact. energy: 0.088 local terms energy: -511.640204 where: bonds (distance) C4'-P energy: -99.944 bonds (distance) P-C4' energy: -93.894 flat angles C4'-P-C4' energy: -111.272 flat angles P-C4'-P energy: -60.982 tors. eta vs tors. theta energy: -145.547 Dist. restrs. and SS energy: 1.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1695.550360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.550360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.703640 (E_RNA) where: Base-Base interactions energy: -1227.543 where: short stacking energy: -515.600 Base-Backbone interact. energy: -2.033 local terms energy: -503.127853 where: bonds (distance) C4'-P energy: -86.729 bonds (distance) P-C4' energy: -79.289 flat angles C4'-P-C4' energy: -111.360 flat angles P-C4'-P energy: -74.997 tors. eta vs tors. theta energy: -150.754 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1612.282947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.282947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1650.695115 (E_RNA) where: Base-Base interactions energy: -1183.526 where: short stacking energy: -484.758 Base-Backbone interact. energy: -1.071 local terms energy: -466.097512 where: bonds (distance) C4'-P energy: -81.009 bonds (distance) P-C4' energy: -92.526 flat angles C4'-P-C4' energy: -90.304 flat angles P-C4'-P energy: -64.005 tors. eta vs tors. theta energy: -138.253 Dist. restrs. and SS energy: 1.662 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1566.727700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.727700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.741400 (E_RNA) where: Base-Base interactions energy: -1154.025 where: short stacking energy: -475.550 Base-Backbone interact. energy: -1.387 local terms energy: -449.329498 where: bonds (distance) C4'-P energy: -79.248 bonds (distance) P-C4' energy: -88.172 flat angles C4'-P-C4' energy: -94.417 flat angles P-C4'-P energy: -63.658 tors. eta vs tors. theta energy: -123.835 Dist. restrs. and SS energy: 1.264 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1531.535156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.535156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.287512 (E_RNA) where: Base-Base interactions energy: -1090.842 where: short stacking energy: -444.576 Base-Backbone interact. energy: -0.823 local terms energy: -477.622089 where: bonds (distance) C4'-P energy: -93.028 bonds (distance) P-C4' energy: -86.681 flat angles C4'-P-C4' energy: -100.368 flat angles P-C4'-P energy: -64.218 tors. eta vs tors. theta energy: -133.328 Dist. restrs. and SS energy: 1.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1482.478116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.478116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.013022 (E_RNA) where: Base-Base interactions energy: -1093.669 where: short stacking energy: -457.484 Base-Backbone interact. energy: -2.340 local terms energy: -425.003149 where: bonds (distance) C4'-P energy: -73.627 bonds (distance) P-C4' energy: -73.200 flat angles C4'-P-C4' energy: -90.646 flat angles P-C4'-P energy: -68.962 tors. eta vs tors. theta energy: -118.568 Dist. restrs. and SS energy: 1.785 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1432.844364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.844364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.172044 (E_RNA) where: Base-Base interactions energy: -1043.369 where: short stacking energy: -427.560 Base-Backbone interact. energy: 0.849 local terms energy: -430.651640 where: bonds (distance) C4'-P energy: -71.212 bonds (distance) P-C4' energy: -77.007 flat angles C4'-P-C4' energy: -92.820 flat angles P-C4'-P energy: -60.660 tors. eta vs tors. theta energy: -128.953 Dist. restrs. and SS energy: 3.578 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1399.894411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.894411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.303984 (E_RNA) where: Base-Base interactions energy: -1029.951 where: short stacking energy: -424.281 Base-Backbone interact. energy: -0.078 local terms energy: -408.274632 where: bonds (distance) C4'-P energy: -77.596 bonds (distance) P-C4' energy: -72.920 flat angles C4'-P-C4' energy: -89.390 flat angles P-C4'-P energy: -52.836 tors. eta vs tors. theta energy: -115.532 Dist. restrs. and SS energy: 1.660 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1393.207614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.207614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.156142 (E_RNA) where: Base-Base interactions energy: -1024.567 where: short stacking energy: -414.273 Base-Backbone interact. energy: -0.134 local terms energy: -408.455656 where: bonds (distance) C4'-P energy: -72.208 bonds (distance) P-C4' energy: -77.809 flat angles C4'-P-C4' energy: -81.741 flat angles P-C4'-P energy: -59.124 tors. eta vs tors. theta energy: -117.573 Dist. restrs. and SS energy: 3.199 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -1284.999496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.999496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.100945 (E_RNA) where: Base-Base interactions energy: -965.361 where: short stacking energy: -381.592 Base-Backbone interact. energy: -0.842 local terms energy: -366.897222 where: bonds (distance) C4'-P energy: -47.632 bonds (distance) P-C4' energy: -87.366 flat angles C4'-P-C4' energy: -83.188 flat angles P-C4'-P energy: -49.536 tors. eta vs tors. theta energy: -99.175 Dist. restrs. and SS energy: 11.351 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1717.110807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.110807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.852369 (E_RNA) where: Base-Base interactions energy: -1259.901 where: short stacking energy: -528.470 Base-Backbone interact. energy: -1.499 local terms energy: -493.452609 where: bonds (distance) C4'-P energy: -103.170 bonds (distance) P-C4' energy: -88.602 flat angles C4'-P-C4' energy: -111.926 flat angles P-C4'-P energy: -47.653 tors. eta vs tors. theta energy: -142.100 Dist. restrs. and SS energy: 0.992 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1701.002950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.002950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.338280 (E_RNA) where: Base-Base interactions energy: -1241.257 where: short stacking energy: -505.182 Base-Backbone interact. energy: -1.200 local terms energy: -495.881603 where: bonds (distance) C4'-P energy: -91.625 bonds (distance) P-C4' energy: -83.952 flat angles C4'-P-C4' energy: -104.662 flat angles P-C4'-P energy: -65.597 tors. eta vs tors. theta energy: -150.046 Dist. restrs. and SS energy: 0.585 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1607.159697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.159697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.683662 (E_RNA) where: Base-Base interactions energy: -1189.377 where: short stacking energy: -486.410 Base-Backbone interact. energy: -2.106 local terms energy: -453.200694 where: bonds (distance) C4'-P energy: -81.822 bonds (distance) P-C4' energy: -71.478 flat angles C4'-P-C4' energy: -96.294 flat angles P-C4'-P energy: -67.902 tors. eta vs tors. theta energy: -135.704 Dist. restrs. and SS energy: 0.774 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1574.231153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1574.231153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.341970 (E_RNA) where: Base-Base interactions energy: -1184.009 where: short stacking energy: -478.784 Base-Backbone interact. energy: -0.889 local terms energy: -427.443650 where: bonds (distance) C4'-P energy: -69.275 bonds (distance) P-C4' energy: -68.454 flat angles C4'-P-C4' energy: -99.137 flat angles P-C4'-P energy: -63.354 tors. eta vs tors. theta energy: -127.222 Dist. restrs. and SS energy: 1.361 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1514.965384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.965384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.782327 (E_RNA) where: Base-Base interactions energy: -1091.298 where: short stacking energy: -450.690 Base-Backbone interact. energy: -0.989 local terms energy: -461.494873 where: bonds (distance) C4'-P energy: -84.401 bonds (distance) P-C4' energy: -87.416 flat angles C4'-P-C4' energy: -97.361 flat angles P-C4'-P energy: -62.933 tors. eta vs tors. theta energy: -129.384 Dist. restrs. and SS energy: 2.067 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1504.354288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.354288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1542.034831 (E_RNA) where: Base-Base interactions energy: -1106.741 where: short stacking energy: -463.456 Base-Backbone interact. energy: 2.753 local terms energy: -438.047110 where: bonds (distance) C4'-P energy: -73.501 bonds (distance) P-C4' energy: -71.355 flat angles C4'-P-C4' energy: -102.501 flat angles P-C4'-P energy: -61.131 tors. eta vs tors. theta energy: -129.559 Dist. restrs. and SS energy: 0.931 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1435.128981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.128981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.449781 (E_RNA) where: Base-Base interactions energy: -1065.186 where: short stacking energy: -437.346 Base-Backbone interact. energy: -1.298 local terms energy: -410.966008 where: bonds (distance) C4'-P energy: -67.487 bonds (distance) P-C4' energy: -69.429 flat angles C4'-P-C4' energy: -89.995 flat angles P-C4'-P energy: -62.312 tors. eta vs tors. theta energy: -121.743 Dist. restrs. and SS energy: 5.571 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1411.444207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.444207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.210752 (E_RNA) where: Base-Base interactions energy: -1038.756 where: short stacking energy: -433.671 Base-Backbone interact. energy: -2.258 local terms energy: -408.197304 where: bonds (distance) C4'-P energy: -74.137 bonds (distance) P-C4' energy: -71.787 flat angles C4'-P-C4' energy: -84.235 flat angles P-C4'-P energy: -62.861 tors. eta vs tors. theta energy: -115.177 Dist. restrs. and SS energy: 1.017 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1326.505411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.505411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.935108 (E_RNA) where: Base-Base interactions energy: -972.607 where: short stacking energy: -394.382 Base-Backbone interact. energy: -0.364 local terms energy: -391.963986 where: bonds (distance) C4'-P energy: -88.352 bonds (distance) P-C4' energy: -54.909 flat angles C4'-P-C4' energy: -84.924 flat angles P-C4'-P energy: -54.285 tors. eta vs tors. theta energy: -109.494 Dist. restrs. and SS energy: 1.680 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -1314.126735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.126735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.918530 (E_RNA) where: Base-Base interactions energy: -959.679 where: short stacking energy: -407.061 Base-Backbone interact. energy: -2.024 local terms energy: -399.215424 where: bonds (distance) C4'-P energy: -62.251 bonds (distance) P-C4' energy: -71.858 flat angles C4'-P-C4' energy: -90.525 flat angles P-C4'-P energy: -57.417 tors. eta vs tors. theta energy: -117.165 Dist. restrs. and SS energy: 10.042 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1726.818555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.818555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.985761 (E_RNA) where: Base-Base interactions energy: -1250.978 where: short stacking energy: -526.008 Base-Backbone interact. energy: -0.734 local terms energy: -512.273021 where: bonds (distance) C4'-P energy: -89.194 bonds (distance) P-C4' energy: -96.998 flat angles C4'-P-C4' energy: -113.383 flat angles P-C4'-P energy: -72.233 tors. eta vs tors. theta energy: -140.466 Dist. restrs. and SS energy: 0.417 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1690.467317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.467317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.859851 (E_RNA) where: Base-Base interactions energy: -1238.221 where: short stacking energy: -509.618 Base-Backbone interact. energy: -1.488 local terms energy: -488.150710 where: bonds (distance) C4'-P energy: -88.908 bonds (distance) P-C4' energy: -84.016 flat angles C4'-P-C4' energy: -107.559 flat angles P-C4'-P energy: -61.697 tors. eta vs tors. theta energy: -145.970 Dist. restrs. and SS energy: 0.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1603.816376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.816376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.506245 (E_RNA) where: Base-Base interactions energy: -1166.767 where: short stacking energy: -481.364 Base-Backbone interact. energy: -2.037 local terms energy: -472.701819 where: bonds (distance) C4'-P energy: -82.051 bonds (distance) P-C4' energy: -82.774 flat angles C4'-P-C4' energy: -106.060 flat angles P-C4'-P energy: -73.633 tors. eta vs tors. theta energy: -128.184 Dist. restrs. and SS energy: 0.940 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1566.756737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.756737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.529828 (E_RNA) where: Base-Base interactions energy: -1159.872 where: short stacking energy: -474.770 Base-Backbone interact. energy: -1.540 local terms energy: -444.117624 where: bonds (distance) C4'-P energy: -81.416 bonds (distance) P-C4' energy: -70.913 flat angles C4'-P-C4' energy: -101.997 flat angles P-C4'-P energy: -62.739 tors. eta vs tors. theta energy: -127.053 Dist. restrs. and SS energy: 2.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1553.478144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1553.478144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.586848 (E_RNA) where: Base-Base interactions energy: -1107.379 where: short stacking energy: -465.114 Base-Backbone interact. energy: 1.474 local terms energy: -485.682349 where: bonds (distance) C4'-P energy: -88.226 bonds (distance) P-C4' energy: -93.432 flat angles C4'-P-C4' energy: -101.935 flat angles P-C4'-P energy: -68.150 tors. eta vs tors. theta energy: -133.940 Dist. restrs. and SS energy: 1.359 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1476.464857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.464857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.724341 (E_RNA) where: Base-Base interactions energy: -1079.725 where: short stacking energy: -447.267 Base-Backbone interact. energy: 0.230 local terms energy: -435.229040 where: bonds (distance) C4'-P energy: -68.941 bonds (distance) P-C4' energy: -82.529 flat angles C4'-P-C4' energy: -104.875 flat angles P-C4'-P energy: -64.776 tors. eta vs tors. theta energy: -114.108 Dist. restrs. and SS energy: 1.509 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1437.349072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.349072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.475087 (E_RNA) where: Base-Base interactions energy: -1062.797 where: short stacking energy: -444.456 Base-Backbone interact. energy: -2.205 local terms energy: -410.473338 where: bonds (distance) C4'-P energy: -69.130 bonds (distance) P-C4' energy: -74.446 flat angles C4'-P-C4' energy: -91.163 flat angles P-C4'-P energy: -53.617 tors. eta vs tors. theta energy: -122.117 Dist. restrs. and SS energy: 1.376 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1389.337110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.337110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.744891 (E_RNA) where: Base-Base interactions energy: -1020.586 where: short stacking energy: -415.245 Base-Backbone interact. energy: 0.717 local terms energy: -407.875174 where: bonds (distance) C4'-P energy: -75.259 bonds (distance) P-C4' energy: -82.910 flat angles C4'-P-C4' energy: -91.731 flat angles P-C4'-P energy: -46.915 tors. eta vs tors. theta energy: -111.060 Dist. restrs. and SS energy: 1.658 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1366.374564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.374564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.226743 (E_RNA) where: Base-Base interactions energy: -984.982 where: short stacking energy: -394.828 Base-Backbone interact. energy: 2.810 local terms energy: -423.054554 where: bonds (distance) C4'-P energy: -84.123 bonds (distance) P-C4' energy: -76.695 flat angles C4'-P-C4' energy: -95.160 flat angles P-C4'-P energy: -58.474 tors. eta vs tors. theta energy: -108.603 Dist. restrs. and SS energy: 2.102 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -1307.375887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.375887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.414299 (E_RNA) where: Base-Base interactions energy: -964.774 where: short stacking energy: -386.675 Base-Backbone interact. energy: -0.862 local terms energy: -387.778617 where: bonds (distance) C4'-P energy: -60.064 bonds (distance) P-C4' energy: -72.052 flat angles C4'-P-C4' energy: -91.829 flat angles P-C4'-P energy: -55.454 tors. eta vs tors. theta energy: -108.379 Dist. restrs. and SS energy: 9.288 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1708.161672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.161672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.365051 (E_RNA) where: Base-Base interactions energy: -1257.442 where: short stacking energy: -531.400 Base-Backbone interact. energy: -1.819 local terms energy: -487.104150 where: bonds (distance) C4'-P energy: -86.549 bonds (distance) P-C4' energy: -83.808 flat angles C4'-P-C4' energy: -96.732 flat angles P-C4'-P energy: -74.207 tors. eta vs tors. theta energy: -145.809 Dist. restrs. and SS energy: 1.453 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1713.854788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.854788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1751.677030 (E_RNA) where: Base-Base interactions energy: -1225.882 where: short stacking energy: -512.418 Base-Backbone interact. energy: -1.439 local terms energy: -524.356110 where: bonds (distance) C4'-P energy: -101.063 bonds (distance) P-C4' energy: -91.993 flat angles C4'-P-C4' energy: -106.082 flat angles P-C4'-P energy: -78.098 tors. eta vs tors. theta energy: -147.121 Dist. restrs. and SS energy: 1.072 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1644.950920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.950920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.082069 (E_RNA) where: Base-Base interactions energy: -1177.452 where: short stacking energy: -497.710 Base-Backbone interact. energy: -1.794 local terms energy: -503.835477 where: bonds (distance) C4'-P energy: -89.662 bonds (distance) P-C4' energy: -97.318 flat angles C4'-P-C4' energy: -107.772 flat angles P-C4'-P energy: -71.021 tors. eta vs tors. theta energy: -138.062 Dist. restrs. and SS energy: 1.381 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1583.068515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.068515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.473828 (E_RNA) where: Base-Base interactions energy: -1134.653 where: short stacking energy: -481.113 Base-Backbone interact. energy: -4.060 local terms energy: -481.760828 where: bonds (distance) C4'-P energy: -83.456 bonds (distance) P-C4' energy: -88.187 flat angles C4'-P-C4' energy: -105.068 flat angles P-C4'-P energy: -63.650 tors. eta vs tors. theta energy: -141.400 Dist. restrs. and SS energy: 0.655 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1526.725324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1526.725324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.325353 (E_RNA) where: Base-Base interactions energy: -1087.416 where: short stacking energy: -446.353 Base-Backbone interact. energy: -0.978 local terms energy: -475.931408 where: bonds (distance) C4'-P energy: -92.608 bonds (distance) P-C4' energy: -90.003 flat angles C4'-P-C4' energy: -101.438 flat angles P-C4'-P energy: -65.283 tors. eta vs tors. theta energy: -126.600 Dist. restrs. and SS energy: 0.850 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1447.438466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.438466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.489543 (E_RNA) where: Base-Base interactions energy: -1034.396 where: short stacking energy: -430.633 Base-Backbone interact. energy: -1.958 local terms energy: -450.135730 where: bonds (distance) C4'-P energy: -81.746 bonds (distance) P-C4' energy: -86.622 flat angles C4'-P-C4' energy: -101.737 flat angles P-C4'-P energy: -62.231 tors. eta vs tors. theta energy: -117.800 Dist. restrs. and SS energy: 2.301 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1434.545335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.545335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.820222 (E_RNA) where: Base-Base interactions energy: -1039.432 where: short stacking energy: -415.729 Base-Backbone interact. energy: -1.146 local terms energy: -432.241226 where: bonds (distance) C4'-P energy: -89.473 bonds (distance) P-C4' energy: -77.737 flat angles C4'-P-C4' energy: -87.998 flat angles P-C4'-P energy: -58.041 tors. eta vs tors. theta energy: -118.992 Dist. restrs. and SS energy: 1.525 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1372.066754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.066754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.412043 (E_RNA) where: Base-Base interactions energy: -1009.615 where: short stacking energy: -425.155 Base-Backbone interact. energy: -0.198 local terms energy: -400.599166 where: bonds (distance) C4'-P energy: -77.111 bonds (distance) P-C4' energy: -72.720 flat angles C4'-P-C4' energy: -80.132 flat angles P-C4'-P energy: -59.895 tors. eta vs tors. theta energy: -110.741 Dist. restrs. and SS energy: 1.595 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1353.812456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.812456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.109418 (E_RNA) where: Base-Base interactions energy: -992.605 where: short stacking energy: -407.874 Base-Backbone interact. energy: 0.532 local terms energy: -400.036631 where: bonds (distance) C4'-P energy: -66.580 bonds (distance) P-C4' energy: -76.079 flat angles C4'-P-C4' energy: -87.420 flat angles P-C4'-P energy: -59.281 tors. eta vs tors. theta energy: -110.676 Dist. restrs. and SS energy: 1.547 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -1276.878063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.878063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.299626 (E_RNA) where: Base-Base interactions energy: -939.015 where: short stacking energy: -383.945 Base-Backbone interact. energy: 1.169 local terms energy: -389.454534 where: bonds (distance) C4'-P energy: -57.898 bonds (distance) P-C4' energy: -76.573 flat angles C4'-P-C4' energy: -92.233 flat angles P-C4'-P energy: -56.455 tors. eta vs tors. theta energy: -106.294 Dist. restrs. and SS energy: 13.672 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1739.801883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.801883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.216337 (E_RNA) where: Base-Base interactions energy: -1256.877 where: short stacking energy: -533.476 Base-Backbone interact. energy: 1.461 local terms energy: -521.800905 where: bonds (distance) C4'-P energy: -90.055 bonds (distance) P-C4' energy: -92.733 flat angles C4'-P-C4' energy: -105.843 flat angles P-C4'-P energy: -77.499 tors. eta vs tors. theta energy: -155.671 Dist. restrs. and SS energy: 0.664 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1674.194034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.194034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.744430 (E_RNA) where: Base-Base interactions energy: -1213.690 where: short stacking energy: -494.804 Base-Backbone interact. energy: -1.931 local terms energy: -496.122513 where: bonds (distance) C4'-P energy: -89.777 bonds (distance) P-C4' energy: -92.055 flat angles C4'-P-C4' energy: -103.407 flat angles P-C4'-P energy: -74.419 tors. eta vs tors. theta energy: -136.464 Dist. restrs. and SS energy: 0.800 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1610.257467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.257467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.191876 (E_RNA) where: Base-Base interactions energy: -1151.964 where: short stacking energy: -470.553 Base-Backbone interact. energy: -1.987 local terms energy: -494.241043 where: bonds (distance) C4'-P energy: -82.668 bonds (distance) P-C4' energy: -84.407 flat angles C4'-P-C4' energy: -108.917 flat angles P-C4'-P energy: -83.773 tors. eta vs tors. theta energy: -134.476 Dist. restrs. and SS energy: 1.184 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1586.390459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.390459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.984295 (E_RNA) where: Base-Base interactions energy: -1135.012 where: short stacking energy: -464.812 Base-Backbone interact. energy: 0.016 local terms energy: -490.988759 where: bonds (distance) C4'-P energy: -82.423 bonds (distance) P-C4' energy: -97.736 flat angles C4'-P-C4' energy: -96.814 flat angles P-C4'-P energy: -78.491 tors. eta vs tors. theta energy: -135.524 Dist. restrs. and SS energy: 2.844 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1554.592897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.592897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.545527 (E_RNA) where: Base-Base interactions energy: -1128.260 where: short stacking energy: -464.418 Base-Backbone interact. energy: 0.896 local terms energy: -465.182197 where: bonds (distance) C4'-P energy: -85.287 bonds (distance) P-C4' energy: -72.980 flat angles C4'-P-C4' energy: -98.983 flat angles P-C4'-P energy: -68.948 tors. eta vs tors. theta energy: -138.984 Dist. restrs. and SS energy: 1.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1478.071561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.071561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.759294 (E_RNA) where: Base-Base interactions energy: -1077.211 where: short stacking energy: -443.486 Base-Backbone interact. energy: -1.650 local terms energy: -437.898183 where: bonds (distance) C4'-P energy: -86.178 bonds (distance) P-C4' energy: -81.789 flat angles C4'-P-C4' energy: -94.057 flat angles P-C4'-P energy: -54.991 tors. eta vs tors. theta energy: -120.882 Dist. restrs. and SS energy: 1.938 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1464.934003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.934003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.905985 (E_RNA) where: Base-Base interactions energy: -1045.375 where: short stacking energy: -441.521 Base-Backbone interact. energy: -1.013 local terms energy: -456.517779 where: bonds (distance) C4'-P energy: -91.582 bonds (distance) P-C4' energy: -80.673 flat angles C4'-P-C4' energy: -93.969 flat angles P-C4'-P energy: -57.725 tors. eta vs tors. theta energy: -132.568 Dist. restrs. and SS energy: 1.222 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1390.846981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.846981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.440203 (E_RNA) where: Base-Base interactions energy: -997.553 where: short stacking energy: -402.594 Base-Backbone interact. energy: -0.877 local terms energy: -431.009663 where: bonds (distance) C4'-P energy: -80.871 bonds (distance) P-C4' energy: -82.807 flat angles C4'-P-C4' energy: -91.051 flat angles P-C4'-P energy: -57.689 tors. eta vs tors. theta energy: -118.591 Dist. restrs. and SS energy: 1.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1380.613532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.613532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.266494 (E_RNA) where: Base-Base interactions energy: -1022.220 where: short stacking energy: -423.546 Base-Backbone interact. energy: -0.320 local terms energy: -396.726357 where: bonds (distance) C4'-P energy: -74.948 bonds (distance) P-C4' energy: -79.607 flat angles C4'-P-C4' energy: -72.240 flat angles P-C4'-P energy: -49.609 tors. eta vs tors. theta energy: -120.322 Dist. restrs. and SS energy: 1.903 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -1291.295906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.295906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.919442 (E_RNA) where: Base-Base interactions energy: -972.146 where: short stacking energy: -393.300 Base-Backbone interact. energy: 3.412 local terms energy: -361.185144 where: bonds (distance) C4'-P energy: -53.392 bonds (distance) P-C4' energy: -70.619 flat angles C4'-P-C4' energy: -69.352 flat angles P-C4'-P energy: -67.876 tors. eta vs tors. theta energy: -99.945 Dist. restrs. and SS energy: 1.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1745.640266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1745.640266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.229189 (E_RNA) where: Base-Base interactions energy: -1271.678 where: short stacking energy: -527.646 Base-Backbone interact. energy: 1.159 local terms energy: -512.710314 where: bonds (distance) C4'-P energy: -92.313 bonds (distance) P-C4' energy: -88.423 flat angles C4'-P-C4' energy: -108.753 flat angles P-C4'-P energy: -75.575 tors. eta vs tors. theta energy: -147.647 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1670.491171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1670.491171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.901580 (E_RNA) where: Base-Base interactions energy: -1206.549 where: short stacking energy: -510.217 Base-Backbone interact. energy: 0.822 local terms energy: -503.174395 where: bonds (distance) C4'-P energy: -93.925 bonds (distance) P-C4' energy: -95.741 flat angles C4'-P-C4' energy: -109.603 flat angles P-C4'-P energy: -57.741 tors. eta vs tors. theta energy: -146.165 Dist. restrs. and SS energy: 1.660 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1658.643090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.643090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.993714 (E_RNA) where: Base-Base interactions energy: -1205.826 where: short stacking energy: -501.208 Base-Backbone interact. energy: -2.598 local terms energy: -487.570037 where: bonds (distance) C4'-P energy: -93.122 bonds (distance) P-C4' energy: -81.711 flat angles C4'-P-C4' energy: -103.057 flat angles P-C4'-P energy: -73.214 tors. eta vs tors. theta energy: -136.466 Dist. restrs. and SS energy: 0.601 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1594.348447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.348447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.189064 (E_RNA) where: Base-Base interactions energy: -1174.600 where: short stacking energy: -496.732 Base-Backbone interact. energy: 0.390 local terms energy: -457.978907 where: bonds (distance) C4'-P energy: -79.748 bonds (distance) P-C4' energy: -87.374 flat angles C4'-P-C4' energy: -97.966 flat angles P-C4'-P energy: -57.086 tors. eta vs tors. theta energy: -135.805 Dist. restrs. and SS energy: 1.091 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1575.075490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.075490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.016557 (E_RNA) where: Base-Base interactions energy: -1148.300 where: short stacking energy: -478.817 Base-Backbone interact. energy: -0.965 local terms energy: -463.751301 where: bonds (distance) C4'-P energy: -77.778 bonds (distance) P-C4' energy: -92.470 flat angles C4'-P-C4' energy: -97.392 flat angles P-C4'-P energy: -74.341 tors. eta vs tors. theta energy: -121.770 Dist. restrs. and SS energy: 1.191 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1470.977109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.977109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.707778 (E_RNA) where: Base-Base interactions energy: -1062.412 where: short stacking energy: -450.676 Base-Backbone interact. energy: 1.409 local terms energy: -447.704949 where: bonds (distance) C4'-P energy: -79.328 bonds (distance) P-C4' energy: -83.557 flat angles C4'-P-C4' energy: -93.180 flat angles P-C4'-P energy: -60.252 tors. eta vs tors. theta energy: -131.387 Dist. restrs. and SS energy: 0.981 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1478.040919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.040919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.484980 (E_RNA) where: Base-Base interactions energy: -1080.785 where: short stacking energy: -455.696 Base-Backbone interact. energy: -0.665 local terms energy: -434.035041 where: bonds (distance) C4'-P energy: -77.056 bonds (distance) P-C4' energy: -72.992 flat angles C4'-P-C4' energy: -93.199 flat angles P-C4'-P energy: -60.282 tors. eta vs tors. theta energy: -130.505 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1401.657462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.657462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.856769 (E_RNA) where: Base-Base interactions energy: -1009.990 where: short stacking energy: -420.539 Base-Backbone interact. energy: -2.583 local terms energy: -427.284426 where: bonds (distance) C4'-P energy: -82.236 bonds (distance) P-C4' energy: -92.709 flat angles C4'-P-C4' energy: -82.822 flat angles P-C4'-P energy: -46.376 tors. eta vs tors. theta energy: -123.142 Dist. restrs. and SS energy: 1.449 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1356.178150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.178150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.717555 (E_RNA) where: Base-Base interactions energy: -1000.868 where: short stacking energy: -403.445 Base-Backbone interact. energy: -0.870 local terms energy: -392.978989 where: bonds (distance) C4'-P energy: -58.923 bonds (distance) P-C4' energy: -83.247 flat angles C4'-P-C4' energy: -87.796 flat angles P-C4'-P energy: -45.653 tors. eta vs tors. theta energy: -117.360 Dist. restrs. and SS energy: 1.789 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -1321.288667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.288667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.060467 (E_RNA) where: Base-Base interactions energy: -1003.165 where: short stacking energy: -403.694 Base-Backbone interact. energy: 0.141 local terms energy: -357.036898 where: bonds (distance) C4'-P energy: -62.977 bonds (distance) P-C4' energy: -61.984 flat angles C4'-P-C4' energy: -69.816 flat angles P-C4'-P energy: -51.409 tors. eta vs tors. theta energy: -110.851 Dist. restrs. and SS energy: 2.022 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1730.717255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1730.717255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.960132 (E_RNA) where: Base-Base interactions energy: -1257.389 where: short stacking energy: -539.314 Base-Backbone interact. energy: -1.754 local terms energy: -509.817154 where: bonds (distance) C4'-P energy: -97.041 bonds (distance) P-C4' energy: -88.300 flat angles C4'-P-C4' energy: -105.463 flat angles P-C4'-P energy: -71.690 tors. eta vs tors. theta energy: -147.323 Dist. restrs. and SS energy: 1.493 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1720.067180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1720.067180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.736879 (E_RNA) where: Base-Base interactions energy: -1240.846 where: short stacking energy: -528.006 Base-Backbone interact. energy: -0.755 local terms energy: -517.135567 where: bonds (distance) C4'-P energy: -82.374 bonds (distance) P-C4' energy: -99.416 flat angles C4'-P-C4' energy: -102.857 flat angles P-C4'-P energy: -76.270 tors. eta vs tors. theta energy: -156.219 Dist. restrs. and SS energy: 1.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1621.116313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.116313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.352468 (E_RNA) where: Base-Base interactions energy: -1185.234 where: short stacking energy: -475.424 Base-Backbone interact. energy: -1.021 local terms energy: -472.098011 where: bonds (distance) C4'-P energy: -81.662 bonds (distance) P-C4' energy: -96.437 flat angles C4'-P-C4' energy: -101.881 flat angles P-C4'-P energy: -71.717 tors. eta vs tors. theta energy: -120.401 Dist. restrs. and SS energy: 0.486 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1597.695239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.695239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.396881 (E_RNA) where: Base-Base interactions energy: -1155.542 where: short stacking energy: -473.085 Base-Backbone interact. energy: -1.355 local terms energy: -478.499980 where: bonds (distance) C4'-P energy: -92.891 bonds (distance) P-C4' energy: -84.220 flat angles C4'-P-C4' energy: -94.460 flat angles P-C4'-P energy: -69.913 tors. eta vs tors. theta energy: -137.017 Dist. restrs. and SS energy: 0.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1549.865603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.865603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.064469 (E_RNA) where: Base-Base interactions energy: -1127.575 where: short stacking energy: -462.934 Base-Backbone interact. energy: -1.046 local terms energy: -459.443422 where: bonds (distance) C4'-P energy: -92.345 bonds (distance) P-C4' energy: -73.015 flat angles C4'-P-C4' energy: -100.168 flat angles P-C4'-P energy: -59.092 tors. eta vs tors. theta energy: -134.822 Dist. restrs. and SS energy: 1.449 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1467.811437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.811437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.613141 (E_RNA) where: Base-Base interactions energy: -1043.713 where: short stacking energy: -454.059 Base-Backbone interact. energy: -0.515 local terms energy: -461.384804 where: bonds (distance) C4'-P energy: -82.651 bonds (distance) P-C4' energy: -87.943 flat angles C4'-P-C4' energy: -103.941 flat angles P-C4'-P energy: -65.616 tors. eta vs tors. theta energy: -121.235 Dist. restrs. and SS energy: 1.052 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -1438.034103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.034103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.476095 (E_RNA) where: Base-Base interactions energy: -1037.802 where: short stacking energy: -424.168 Base-Backbone interact. energy: -1.573 local terms energy: -437.101309 where: bonds (distance) C4'-P energy: -73.908 bonds (distance) P-C4' energy: -81.897 flat angles C4'-P-C4' energy: -87.286 flat angles P-C4'-P energy: -61.452 tors. eta vs tors. theta energy: -132.557 Dist. restrs. and SS energy: 1.692 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -1396.385047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1396.385047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.045004 (E_RNA) where: Base-Base interactions energy: -1044.936 where: short stacking energy: -432.433 Base-Backbone interact. energy: 1.272 local terms energy: -395.381403 where: bonds (distance) C4'-P energy: -63.635 bonds (distance) P-C4' energy: -74.861 flat angles C4'-P-C4' energy: -81.697 flat angles P-C4'-P energy: -61.159 tors. eta vs tors. theta energy: -114.030 Dist. restrs. and SS energy: 5.910 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1363.880885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.880885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.412590 (E_RNA) where: Base-Base interactions energy: -997.933 where: short stacking energy: -404.724 Base-Backbone interact. energy: 0.651 local terms energy: -405.131062 where: bonds (distance) C4'-P energy: -62.952 bonds (distance) P-C4' energy: -80.048 flat angles C4'-P-C4' energy: -100.396 flat angles P-C4'-P energy: -58.327 tors. eta vs tors. theta energy: -103.407 Dist. restrs. and SS energy: 1.782 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -1349.968456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.968456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.476693 (E_RNA) where: Base-Base interactions energy: -994.173 where: short stacking energy: -424.119 Base-Backbone interact. energy: -0.909 local terms energy: -393.394483 where: bonds (distance) C4'-P energy: -67.017 bonds (distance) P-C4' energy: -62.902 flat angles C4'-P-C4' energy: -83.655 flat angles P-C4'-P energy: -57.428 tors. eta vs tors. theta energy: -122.393 Dist. restrs. and SS energy: 1.758 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1715.908992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.908992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1753.838038 (E_RNA) where: Base-Base interactions energy: -1253.627 where: short stacking energy: -523.032 Base-Backbone interact. energy: -1.520 local terms energy: -498.691282 where: bonds (distance) C4'-P energy: -92.437 bonds (distance) P-C4' energy: -90.137 flat angles C4'-P-C4' energy: -101.458 flat angles P-C4'-P energy: -67.646 tors. eta vs tors. theta energy: -147.013 Dist. restrs. and SS energy: 1.179 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1711.910517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1711.910517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1749.722219 (E_RNA) where: Base-Base interactions energy: -1241.181 where: short stacking energy: -502.747 Base-Backbone interact. energy: -2.832 local terms energy: -505.709473 where: bonds (distance) C4'-P energy: -90.784 bonds (distance) P-C4' energy: -92.857 flat angles C4'-P-C4' energy: -101.605 flat angles P-C4'-P energy: -69.295 tors. eta vs tors. theta energy: -151.168 Dist. restrs. and SS energy: 1.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1618.879295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.879295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.803952 (E_RNA) where: Base-Base interactions energy: -1180.750 where: short stacking energy: -493.730 Base-Backbone interact. energy: -2.140 local terms energy: -473.914193 where: bonds (distance) C4'-P energy: -78.810 bonds (distance) P-C4' energy: -91.340 flat angles C4'-P-C4' energy: -102.586 flat angles P-C4'-P energy: -57.873 tors. eta vs tors. theta energy: -143.305 Dist. restrs. and SS energy: 1.175 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1587.905922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.905922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.638562 (E_RNA) where: Base-Base interactions energy: -1175.049 where: short stacking energy: -492.550 Base-Backbone interact. energy: -2.314 local terms energy: -448.275452 where: bonds (distance) C4'-P energy: -61.134 bonds (distance) P-C4' energy: -82.789 flat angles C4'-P-C4' energy: -97.499 flat angles P-C4'-P energy: -74.420 tors. eta vs tors. theta energy: -132.433 Dist. restrs. and SS energy: 0.983 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1547.727834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.727834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.896371 (E_RNA) where: Base-Base interactions energy: -1126.021 where: short stacking energy: -473.498 Base-Backbone interact. energy: -0.653 local terms energy: -459.223105 where: bonds (distance) C4'-P energy: -85.070 bonds (distance) P-C4' energy: -83.229 flat angles C4'-P-C4' energy: -94.157 flat angles P-C4'-P energy: -64.818 tors. eta vs tors. theta energy: -131.949 Dist. restrs. and SS energy: 1.419 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1476.294596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.294596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.835331 (E_RNA) where: Base-Base interactions energy: -1064.744 where: short stacking energy: -451.487 Base-Backbone interact. energy: -0.469 local terms energy: -448.622819 where: bonds (distance) C4'-P energy: -72.552 bonds (distance) P-C4' energy: -72.950 flat angles C4'-P-C4' energy: -98.791 flat angles P-C4'-P energy: -74.033 tors. eta vs tors. theta energy: -130.296 Dist. restrs. and SS energy: 0.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1458.037678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.037678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.600089 (E_RNA) where: Base-Base interactions energy: -1019.596 where: short stacking energy: -427.365 Base-Backbone interact. energy: -1.498 local terms energy: -475.505898 where: bonds (distance) C4'-P energy: -84.257 bonds (distance) P-C4' energy: -95.191 flat angles C4'-P-C4' energy: -103.499 flat angles P-C4'-P energy: -64.640 tors. eta vs tors. theta energy: -127.918 Dist. restrs. and SS energy: 1.812 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1362.683593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.683593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.816318 (E_RNA) where: Base-Base interactions energy: -1010.208 where: short stacking energy: -425.188 Base-Backbone interact. energy: -0.425 local terms energy: -391.182979 where: bonds (distance) C4'-P energy: -77.702 bonds (distance) P-C4' energy: -74.547 flat angles C4'-P-C4' energy: -78.305 flat angles P-C4'-P energy: -52.898 tors. eta vs tors. theta energy: -107.731 Dist. restrs. and SS energy: 2.383 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1356.743455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.743455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.021103 (E_RNA) where: Base-Base interactions energy: -990.672 where: short stacking energy: -409.776 Base-Backbone interact. energy: -1.266 local terms energy: -404.083382 where: bonds (distance) C4'-P energy: -82.896 bonds (distance) P-C4' energy: -66.897 flat angles C4'-P-C4' energy: -93.539 flat angles P-C4'-P energy: -48.636 tors. eta vs tors. theta energy: -112.115 Dist. restrs. and SS energy: 2.528 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -1340.427674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.427674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.081905 (E_RNA) where: Base-Base interactions energy: -988.121 where: short stacking energy: -390.928 Base-Backbone interact. energy: -0.022 local terms energy: -390.938732 where: bonds (distance) C4'-P energy: -63.818 bonds (distance) P-C4' energy: -79.305 flat angles C4'-P-C4' energy: -84.413 flat angles P-C4'-P energy: -57.244 tors. eta vs tors. theta energy: -106.158 Dist. restrs. and SS energy: 1.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1708.481852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.481852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.265686 (E_RNA) where: Base-Base interactions energy: -1227.834 where: short stacking energy: -517.332 Base-Backbone interact. energy: -0.763 local terms energy: -517.669130 where: bonds (distance) C4'-P energy: -100.472 bonds (distance) P-C4' energy: -96.299 flat angles C4'-P-C4' energy: -105.604 flat angles P-C4'-P energy: -69.537 tors. eta vs tors. theta energy: -145.757 Dist. restrs. and SS energy: 1.034 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1697.774270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.774270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.759197 (E_RNA) where: Base-Base interactions energy: -1224.755 where: short stacking energy: -514.981 Base-Backbone interact. energy: -2.375 local terms energy: -508.629682 where: bonds (distance) C4'-P energy: -95.243 bonds (distance) P-C4' energy: -94.147 flat angles C4'-P-C4' energy: -106.818 flat angles P-C4'-P energy: -70.135 tors. eta vs tors. theta energy: -142.287 Dist. restrs. and SS energy: 1.235 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1645.935793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.935793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.744973 (E_RNA) where: Base-Base interactions energy: -1198.259 where: short stacking energy: -499.291 Base-Backbone interact. energy: 0.085 local terms energy: -485.570504 where: bonds (distance) C4'-P energy: -86.341 bonds (distance) P-C4' energy: -86.247 flat angles C4'-P-C4' energy: -102.311 flat angles P-C4'-P energy: -70.505 tors. eta vs tors. theta energy: -140.166 Dist. restrs. and SS energy: 1.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1578.048324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.048324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.521200 (E_RNA) where: Base-Base interactions energy: -1162.125 where: short stacking energy: -489.731 Base-Backbone interact. energy: 0.251 local terms energy: -453.647629 where: bonds (distance) C4'-P energy: -87.221 bonds (distance) P-C4' energy: -83.846 flat angles C4'-P-C4' energy: -91.587 flat angles P-C4'-P energy: -58.867 tors. eta vs tors. theta energy: -132.126 Dist. restrs. and SS energy: 0.723 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -1543.623358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.623358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.808350 (E_RNA) where: Base-Base interactions energy: -1121.487 where: short stacking energy: -470.117 Base-Backbone interact. energy: -1.919 local terms energy: -458.402607 where: bonds (distance) C4'-P energy: -75.487 bonds (distance) P-C4' energy: -93.294 flat angles C4'-P-C4' energy: -95.732 flat angles P-C4'-P energy: -60.240 tors. eta vs tors. theta energy: -133.651 Dist. restrs. and SS energy: 1.435 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1479.243225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.243225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.576662 (E_RNA) where: Base-Base interactions energy: -1078.552 where: short stacking energy: -442.034 Base-Backbone interact. energy: -0.782 local terms energy: -438.242520 where: bonds (distance) C4'-P energy: -84.279 bonds (distance) P-C4' energy: -79.479 flat angles C4'-P-C4' energy: -91.543 flat angles P-C4'-P energy: -61.289 tors. eta vs tors. theta energy: -121.653 Dist. restrs. and SS energy: 1.583 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -1461.000498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.000498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.797213 (E_RNA) where: Base-Base interactions energy: -1069.087 where: short stacking energy: -456.256 Base-Backbone interact. energy: -1.365 local terms energy: -428.345195 where: bonds (distance) C4'-P energy: -84.654 bonds (distance) P-C4' energy: -69.212 flat angles C4'-P-C4' energy: -85.041 flat angles P-C4'-P energy: -61.516 tors. eta vs tors. theta energy: -127.922 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1406.330067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.330067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.186805 (E_RNA) where: Base-Base interactions energy: -1053.331 where: short stacking energy: -446.861 Base-Backbone interact. energy: -0.475 local terms energy: -390.381243 where: bonds (distance) C4'-P energy: -66.397 bonds (distance) P-C4' energy: -85.130 flat angles C4'-P-C4' energy: -87.116 flat angles P-C4'-P energy: -35.983 tors. eta vs tors. theta energy: -115.755 Dist. restrs. and SS energy: 1.107 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1373.159915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.159915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.690723 (E_RNA) where: Base-Base interactions energy: -991.492 where: short stacking energy: -410.142 Base-Backbone interact. energy: -1.119 local terms energy: -419.080145 where: bonds (distance) C4'-P energy: -81.951 bonds (distance) P-C4' energy: -88.139 flat angles C4'-P-C4' energy: -90.286 flat angles P-C4'-P energy: -48.615 tors. eta vs tors. theta energy: -110.089 Dist. restrs. and SS energy: 1.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -1277.101387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.101387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.311022 (E_RNA) where: Base-Base interactions energy: -931.982 where: short stacking energy: -378.777 Base-Backbone interact. energy: -0.738 local terms energy: -386.591539 where: bonds (distance) C4'-P energy: -61.590 bonds (distance) P-C4' energy: -72.177 flat angles C4'-P-C4' energy: -87.250 flat angles P-C4'-P energy: -55.628 tors. eta vs tors. theta energy: -109.947 Dist. restrs. and SS energy: 5.460 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1705.236068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1705.236068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.202804 (E_RNA) where: Base-Base interactions energy: -1245.674 where: short stacking energy: -507.199 Base-Backbone interact. energy: -2.080 local terms energy: -495.448598 where: bonds (distance) C4'-P energy: -83.071 bonds (distance) P-C4' energy: -89.536 flat angles C4'-P-C4' energy: -105.397 flat angles P-C4'-P energy: -69.484 tors. eta vs tors. theta energy: -147.961 Dist. restrs. and SS energy: 1.217 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1710.377964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.377964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.576301 (E_RNA) where: Base-Base interactions energy: -1241.834 where: short stacking energy: -509.644 Base-Backbone interact. energy: -1.049 local terms energy: -505.692979 where: bonds (distance) C4'-P energy: -95.585 bonds (distance) P-C4' energy: -95.641 flat angles C4'-P-C4' energy: -103.987 flat angles P-C4'-P energy: -63.327 tors. eta vs tors. theta energy: -147.152 Dist. restrs. and SS energy: 1.448 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1653.754602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.754602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1691.304506 (E_RNA) where: Base-Base interactions energy: -1221.669 where: short stacking energy: -499.346 Base-Backbone interact. energy: 6.753 local terms energy: -476.388980 where: bonds (distance) C4'-P energy: -86.333 bonds (distance) P-C4' energy: -87.038 flat angles C4'-P-C4' energy: -102.259 flat angles P-C4'-P energy: -68.358 tors. eta vs tors. theta energy: -132.402 Dist. restrs. and SS energy: 0.800 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1584.083403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.083403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.786229 (E_RNA) where: Base-Base interactions energy: -1145.587 where: short stacking energy: -472.358 Base-Backbone interact. energy: 0.808 local terms energy: -478.008154 where: bonds (distance) C4'-P energy: -79.171 bonds (distance) P-C4' energy: -87.762 flat angles C4'-P-C4' energy: -100.491 flat angles P-C4'-P energy: -72.292 tors. eta vs tors. theta energy: -138.293 Dist. restrs. and SS energy: 1.953 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -1538.930011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.930011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.811068 (E_RNA) where: Base-Base interactions energy: -1114.471 where: short stacking energy: -444.663 Base-Backbone interact. energy: -2.880 local terms energy: -459.460456 where: bonds (distance) C4'-P energy: -80.081 bonds (distance) P-C4' energy: -86.879 flat angles C4'-P-C4' energy: -92.172 flat angles P-C4'-P energy: -73.178 tors. eta vs tors. theta energy: -127.151 Dist. restrs. and SS energy: 1.131 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1486.456561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.456561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.910001 (E_RNA) where: Base-Base interactions energy: -1079.785 where: short stacking energy: -462.572 Base-Backbone interact. energy: -2.289 local terms energy: -441.836575 where: bonds (distance) C4'-P energy: -75.815 bonds (distance) P-C4' energy: -87.100 flat angles C4'-P-C4' energy: -99.688 flat angles P-C4'-P energy: -52.915 tors. eta vs tors. theta energy: -126.318 Dist. restrs. and SS energy: 0.703 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1444.149419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.149419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.330772 (E_RNA) where: Base-Base interactions energy: -1060.631 where: short stacking energy: -446.770 Base-Backbone interact. energy: -0.146 local terms energy: -421.553500 where: bonds (distance) C4'-P energy: -74.524 bonds (distance) P-C4' energy: -91.984 flat angles C4'-P-C4' energy: -78.274 flat angles P-C4'-P energy: -59.166 tors. eta vs tors. theta energy: -117.604 Dist. restrs. and SS energy: 1.431 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1401.321367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.321367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.965582 (E_RNA) where: Base-Base interactions energy: -1018.827 where: short stacking energy: -418.080 Base-Backbone interact. energy: -2.098 local terms energy: -419.040659 where: bonds (distance) C4'-P energy: -64.511 bonds (distance) P-C4' energy: -86.742 flat angles C4'-P-C4' energy: -101.131 flat angles P-C4'-P energy: -46.523 tors. eta vs tors. theta energy: -120.134 Dist. restrs. and SS energy: 1.894 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1372.008744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.008744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.052406 (E_RNA) where: Base-Base interactions energy: -1003.214 where: short stacking energy: -418.899 Base-Backbone interact. energy: -2.672 local terms energy: -404.165873 where: bonds (distance) C4'-P energy: -63.811 bonds (distance) P-C4' energy: -73.244 flat angles C4'-P-C4' energy: -90.771 flat angles P-C4'-P energy: -55.460 tors. eta vs tors. theta energy: -120.880 Dist. restrs. and SS energy: 1.294 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -1282.406306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.406306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.698033 (E_RNA) where: Base-Base interactions energy: -953.801 where: short stacking energy: -386.405 Base-Backbone interact. energy: -0.779 local terms energy: -370.118119 where: bonds (distance) C4'-P energy: -55.490 bonds (distance) P-C4' energy: -85.208 flat angles C4'-P-C4' energy: -85.143 flat angles P-C4'-P energy: -46.024 tors. eta vs tors. theta energy: -98.253 Dist. restrs. and SS energy: 5.542 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1730.613377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1730.613377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1767.892186 (E_RNA) where: Base-Base interactions energy: -1251.027 where: short stacking energy: -518.019 Base-Backbone interact. energy: -0.407 local terms energy: -516.458528 where: bonds (distance) C4'-P energy: -91.969 bonds (distance) P-C4' energy: -88.238 flat angles C4'-P-C4' energy: -105.664 flat angles P-C4'-P energy: -77.593 tors. eta vs tors. theta energy: -152.995 Dist. restrs. and SS energy: 0.529 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1695.893453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.893453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.697068 (E_RNA) where: Base-Base interactions energy: -1216.300 where: short stacking energy: -505.366 Base-Backbone interact. energy: -2.763 local terms energy: -514.633989 where: bonds (distance) C4'-P energy: -93.554 bonds (distance) P-C4' energy: -101.956 flat angles C4'-P-C4' energy: -106.526 flat angles P-C4'-P energy: -61.962 tors. eta vs tors. theta energy: -150.637 Dist. restrs. and SS energy: 1.054 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1609.413024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.413024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.976485 (E_RNA) where: Base-Base interactions energy: -1156.723 where: short stacking energy: -504.911 Base-Backbone interact. energy: -2.132 local terms energy: -488.121110 where: bonds (distance) C4'-P energy: -86.332 bonds (distance) P-C4' energy: -89.227 flat angles C4'-P-C4' energy: -97.738 flat angles P-C4'-P energy: -72.355 tors. eta vs tors. theta energy: -142.469 Dist. restrs. and SS energy: 0.813 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1581.516412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.516412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.021231 (E_RNA) where: Base-Base interactions energy: -1159.484 where: short stacking energy: -481.057 Base-Backbone interact. energy: -1.038 local terms energy: -458.498688 where: bonds (distance) C4'-P energy: -76.895 bonds (distance) P-C4' energy: -90.752 flat angles C4'-P-C4' energy: -106.562 flat angles P-C4'-P energy: -55.510 tors. eta vs tors. theta energy: -128.780 Dist. restrs. and SS energy: 0.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -1544.586870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.586870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.376357 (E_RNA) where: Base-Base interactions energy: -1122.132 where: short stacking energy: -449.984 Base-Backbone interact. energy: 3.295 local terms energy: -463.539569 where: bonds (distance) C4'-P energy: -65.804 bonds (distance) P-C4' energy: -96.816 flat angles C4'-P-C4' energy: -108.731 flat angles P-C4'-P energy: -66.654 tors. eta vs tors. theta energy: -125.536 Dist. restrs. and SS energy: 1.039 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -1534.655551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.655551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.512817 (E_RNA) where: Base-Base interactions energy: -1112.516 where: short stacking energy: -451.665 Base-Backbone interact. energy: 0.233 local terms energy: -463.229289 where: bonds (distance) C4'-P energy: -65.144 bonds (distance) P-C4' energy: -95.027 flat angles C4'-P-C4' energy: -99.959 flat angles P-C4'-P energy: -67.226 tors. eta vs tors. theta energy: -135.873 Dist. restrs. and SS energy: 4.107 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1451.257596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.257596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.782412 (E_RNA) where: Base-Base interactions energy: -1046.928 where: short stacking energy: -448.829 Base-Backbone interact. energy: -0.637 local terms energy: -442.217269 where: bonds (distance) C4'-P energy: -85.148 bonds (distance) P-C4' energy: -81.947 flat angles C4'-P-C4' energy: -88.988 flat angles P-C4'-P energy: -61.018 tors. eta vs tors. theta energy: -125.117 Dist. restrs. and SS energy: 1.775 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1414.364485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.364485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.071359 (E_RNA) where: Base-Base interactions energy: -1029.773 where: short stacking energy: -427.963 Base-Backbone interact. energy: 4.182 local terms energy: -426.480193 where: bonds (distance) C4'-P energy: -75.606 bonds (distance) P-C4' energy: -75.025 flat angles C4'-P-C4' energy: -92.146 flat angles P-C4'-P energy: -57.896 tors. eta vs tors. theta energy: -125.808 Dist. restrs. and SS energy: 0.957 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -1365.017801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.017801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.274816 (E_RNA) where: Base-Base interactions energy: -1019.748 where: short stacking energy: -423.089 Base-Backbone interact. energy: -1.765 local terms energy: -382.762212 where: bonds (distance) C4'-P energy: -52.540 bonds (distance) P-C4' energy: -66.308 flat angles C4'-P-C4' energy: -91.388 flat angles P-C4'-P energy: -67.944 tors. eta vs tors. theta energy: -104.582 Dist. restrs. and SS energy: 2.507 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -1332.163660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.163660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.553259 (E_RNA) where: Base-Base interactions energy: -968.771 where: short stacking energy: -392.729 Base-Backbone interact. energy: 4.720 local terms energy: -406.502739 where: bonds (distance) C4'-P energy: -75.251 bonds (distance) P-C4' energy: -82.852 flat angles C4'-P-C4' energy: -86.832 flat angles P-C4'-P energy: -68.423 tors. eta vs tors. theta energy: -93.145 Dist. restrs. and SS energy: 1.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1771.498184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1771.498184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.468597 (E_RNA) where: Base-Base interactions energy: -1272.916 where: short stacking energy: -540.459 Base-Backbone interact. energy: -0.834 local terms energy: -535.718879 where: bonds (distance) C4'-P energy: -97.696 bonds (distance) P-C4' energy: -93.293 flat angles C4'-P-C4' energy: -110.979 flat angles P-C4'-P energy: -81.896 tors. eta vs tors. theta energy: -151.854 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1675.347118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.347118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.957967 (E_RNA) where: Base-Base interactions energy: -1216.444 where: short stacking energy: -493.436 Base-Backbone interact. energy: -0.611 local terms energy: -495.903152 where: bonds (distance) C4'-P energy: -90.175 bonds (distance) P-C4' energy: -96.061 flat angles C4'-P-C4' energy: -106.124 flat angles P-C4'-P energy: -65.016 tors. eta vs tors. theta energy: -138.527 Dist. restrs. and SS energy: 0.861 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1630.119995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.119995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.600051 (E_RNA) where: Base-Base interactions energy: -1169.239 where: short stacking energy: -470.146 Base-Backbone interact. energy: -1.639 local terms energy: -496.722101 where: bonds (distance) C4'-P energy: -85.050 bonds (distance) P-C4' energy: -105.075 flat angles C4'-P-C4' energy: -102.142 flat angles P-C4'-P energy: -65.867 tors. eta vs tors. theta energy: -138.587 Dist. restrs. and SS energy: 0.730 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1585.070874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.070874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.195374 (E_RNA) where: Base-Base interactions energy: -1147.885 where: short stacking energy: -459.551 Base-Backbone interact. energy: -2.181 local terms energy: -473.129530 where: bonds (distance) C4'-P energy: -88.746 bonds (distance) P-C4' energy: -95.334 flat angles C4'-P-C4' energy: -103.600 flat angles P-C4'-P energy: -57.007 tors. eta vs tors. theta energy: -128.442 Dist. restrs. and SS energy: 1.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -1548.716694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.716694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.634358 (E_RNA) where: Base-Base interactions energy: -1113.802 where: short stacking energy: -468.497 Base-Backbone interact. energy: -0.747 local terms energy: -474.085607 where: bonds (distance) C4'-P energy: -94.148 bonds (distance) P-C4' energy: -81.239 flat angles C4'-P-C4' energy: -100.534 flat angles P-C4'-P energy: -58.384 tors. eta vs tors. theta energy: -139.780 Dist. restrs. and SS energy: 3.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -1515.399785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.399785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.829084 (E_RNA) where: Base-Base interactions energy: -1091.421 where: short stacking energy: -474.210 Base-Backbone interact. energy: -0.594 local terms energy: -461.814560 where: bonds (distance) C4'-P energy: -68.358 bonds (distance) P-C4' energy: -88.161 flat angles C4'-P-C4' energy: -97.030 flat angles P-C4'-P energy: -72.382 tors. eta vs tors. theta energy: -135.885 Dist. restrs. and SS energy: 1.679 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -1441.598438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.598438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.991965 (E_RNA) where: Base-Base interactions energy: -1042.833 where: short stacking energy: -440.143 Base-Backbone interact. energy: -2.942 local terms energy: -434.216502 where: bonds (distance) C4'-P energy: -78.478 bonds (distance) P-C4' energy: -89.618 flat angles C4'-P-C4' energy: -86.818 flat angles P-C4'-P energy: -55.927 tors. eta vs tors. theta energy: -123.376 Dist. restrs. and SS energy: 1.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -1367.657858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.657858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.333750 (E_RNA) where: Base-Base interactions energy: -998.718 where: short stacking energy: -406.053 Base-Backbone interact. energy: 0.422 local terms energy: -407.037862 where: bonds (distance) C4'-P energy: -65.259 bonds (distance) P-C4' energy: -69.139 flat angles C4'-P-C4' energy: -99.239 flat angles P-C4'-P energy: -63.108 tors. eta vs tors. theta energy: -110.293 Dist. restrs. and SS energy: 0.926 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -1434.556042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.556042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.722779 (E_RNA) where: Base-Base interactions energy: -1059.478 where: short stacking energy: -432.486 Base-Backbone interact. energy: -1.047 local terms energy: -412.198761 where: bonds (distance) C4'-P energy: -68.444 bonds (distance) P-C4' energy: -87.207 flat angles C4'-P-C4' energy: -88.063 flat angles P-C4'-P energy: -43.664 tors. eta vs tors. theta energy: -124.820 Dist. restrs. and SS energy: 1.417 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -1333.817460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.817460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.411624 (E_RNA) where: Base-Base interactions energy: -1002.869 where: short stacking energy: -412.500 Base-Backbone interact. energy: 0.898 local terms energy: -369.440555 where: bonds (distance) C4'-P energy: -60.159 bonds (distance) P-C4' energy: -64.412 flat angles C4'-P-C4' energy: -75.701 flat angles P-C4'-P energy: -56.503 tors. eta vs tors. theta energy: -112.664 Dist. restrs. and SS energy: 0.844 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1704.668946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.668946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1742.836485 (E_RNA) where: Base-Base interactions energy: -1250.202 where: short stacking energy: -523.666 Base-Backbone interact. energy: -0.571 local terms energy: -492.063687 where: bonds (distance) C4'-P energy: -85.847 bonds (distance) P-C4' energy: -79.610 flat angles C4'-P-C4' energy: -104.316 flat angles P-C4'-P energy: -77.189 tors. eta vs tors. theta energy: -145.102 Dist. restrs. and SS energy: 1.418 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1727.202382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.202382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1765.778438 (E_RNA) where: Base-Base interactions energy: -1238.959 where: short stacking energy: -510.533 Base-Backbone interact. energy: -2.002 local terms energy: -524.817172 where: bonds (distance) C4'-P energy: -90.495 bonds (distance) P-C4' energy: -89.220 flat angles C4'-P-C4' energy: -111.201 flat angles P-C4'-P energy: -83.211 tors. eta vs tors. theta energy: -150.691 Dist. restrs. and SS energy: 1.826 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1624.711797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.711797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1663.390456 (E_RNA) where: Base-Base interactions energy: -1167.735 where: short stacking energy: -491.370 Base-Backbone interact. energy: -1.780 local terms energy: -493.875270 where: bonds (distance) C4'-P energy: -99.044 bonds (distance) P-C4' energy: -96.347 flat angles C4'-P-C4' energy: -96.797 flat angles P-C4'-P energy: -57.209 tors. eta vs tors. theta energy: -144.478 Dist. restrs. and SS energy: 1.929 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1591.480794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.480794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.435550 (E_RNA) where: Base-Base interactions energy: -1153.055 where: short stacking energy: -477.958 Base-Backbone interact. energy: 0.844 local terms energy: -477.224870 where: bonds (distance) C4'-P energy: -86.571 bonds (distance) P-C4' energy: -95.931 flat angles C4'-P-C4' energy: -107.382 flat angles P-C4'-P energy: -66.093 tors. eta vs tors. theta energy: -121.249 Dist. restrs. and SS energy: 1.205 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -1550.007191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1550.007191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.139751 (E_RNA) where: Base-Base interactions energy: -1146.254 where: short stacking energy: -475.062 Base-Backbone interact. energy: -0.807 local terms energy: -441.078712 where: bonds (distance) C4'-P energy: -73.820 bonds (distance) P-C4' energy: -77.537 flat angles C4'-P-C4' energy: -101.178 flat angles P-C4'-P energy: -57.450 tors. eta vs tors. theta energy: -131.094 Dist. restrs. and SS energy: 1.383 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -1530.522584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.522584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.296828 (E_RNA) where: Base-Base interactions energy: -1112.435 where: short stacking energy: -474.359 Base-Backbone interact. energy: -1.257 local terms energy: -454.604920 where: bonds (distance) C4'-P energy: -75.699 bonds (distance) P-C4' energy: -80.514 flat angles C4'-P-C4' energy: -104.353 flat angles P-C4'-P energy: -61.171 tors. eta vs tors. theta energy: -132.869 Dist. restrs. and SS energy: 1.024 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1448.304733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.304733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.291055 (E_RNA) where: Base-Base interactions energy: -1042.685 where: short stacking energy: -427.476 Base-Backbone interact. energy: -1.491 local terms energy: -442.115137 where: bonds (distance) C4'-P energy: -70.727 bonds (distance) P-C4' energy: -93.119 flat angles C4'-P-C4' energy: -94.862 flat angles P-C4'-P energy: -59.495 tors. eta vs tors. theta energy: -123.912 Dist. restrs. and SS energy: 1.236 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -1383.420246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.420246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.194694 (E_RNA) where: Base-Base interactions energy: -1012.987 where: short stacking energy: -410.342 Base-Backbone interact. energy: -1.873 local terms energy: -407.334163 where: bonds (distance) C4'-P energy: -74.536 bonds (distance) P-C4' energy: -71.011 flat angles C4'-P-C4' energy: -86.993 flat angles P-C4'-P energy: -53.730 tors. eta vs tors. theta energy: -121.063 Dist. restrs. and SS energy: 2.024 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -1381.926635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.926635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.286080 (E_RNA) where: Base-Base interactions energy: -1015.642 where: short stacking energy: -407.857 Base-Backbone interact. energy: 0.735 local terms energy: -405.379791 where: bonds (distance) C4'-P energy: -75.212 bonds (distance) P-C4' energy: -73.146 flat angles C4'-P-C4' energy: -84.326 flat angles P-C4'-P energy: -54.726 tors. eta vs tors. theta energy: -117.970 Dist. restrs. and SS energy: 1.609 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -1322.443779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.443779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.215816 (E_RNA) where: Base-Base interactions energy: -969.758 where: short stacking energy: -407.226 Base-Backbone interact. energy: 0.167 local terms energy: -396.624893 where: bonds (distance) C4'-P energy: -79.784 bonds (distance) P-C4' energy: -73.632 flat angles C4'-P-C4' energy: -90.906 flat angles P-C4'-P energy: -40.149 tors. eta vs tors. theta energy: -112.154 Dist. restrs. and SS energy: 7.022 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1694.821013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.821013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.631172 (E_RNA) where: Base-Base interactions energy: -1237.780 where: short stacking energy: -521.905 Base-Backbone interact. energy: -2.182 local terms energy: -495.669309 where: bonds (distance) C4'-P energy: -99.554 bonds (distance) P-C4' energy: -85.850 flat angles C4'-P-C4' energy: -110.249 flat angles P-C4'-P energy: -66.309 tors. eta vs tors. theta energy: -133.708 Dist. restrs. and SS energy: 4.060 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1728.085316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.085316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1765.883037 (E_RNA) where: Base-Base interactions energy: -1244.097 where: short stacking energy: -526.051 Base-Backbone interact. energy: -1.460 local terms energy: -520.325294 where: bonds (distance) C4'-P energy: -99.801 bonds (distance) P-C4' energy: -89.909 flat angles C4'-P-C4' energy: -105.535 flat angles P-C4'-P energy: -72.951 tors. eta vs tors. theta energy: -152.130 Dist. restrs. and SS energy: 1.048 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1639.619373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.619373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.085506 (E_RNA) where: Base-Base interactions energy: -1183.543 where: short stacking energy: -482.135 Base-Backbone interact. energy: 2.425 local terms energy: -495.967297 where: bonds (distance) C4'-P energy: -95.222 bonds (distance) P-C4' energy: -91.013 flat angles C4'-P-C4' energy: -101.131 flat angles P-C4'-P energy: -73.922 tors. eta vs tors. theta energy: -134.680 Dist. restrs. and SS energy: 0.716 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -1570.435552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.435552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.798895 (E_RNA) where: Base-Base interactions energy: -1143.300 where: short stacking energy: -470.237 Base-Backbone interact. energy: 0.945 local terms energy: -466.444115 where: bonds (distance) C4'-P energy: -81.093 bonds (distance) P-C4' energy: -88.692 flat angles C4'-P-C4' energy: -98.408 flat angles P-C4'-P energy: -61.267 tors. eta vs tors. theta energy: -136.984 Dist. restrs. and SS energy: 1.613 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -1555.328521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.328521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.917670 (E_RNA) where: Base-Base interactions energy: -1144.132 where: short stacking energy: -466.960 Base-Backbone interact. energy: 0.961 local terms energy: -449.745883 where: bonds (distance) C4'-P energy: -69.207 bonds (distance) P-C4' energy: -84.542 flat angles C4'-P-C4' energy: -104.993 flat angles P-C4'-P energy: -58.289 tors. eta vs tors. theta energy: -132.716 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -1509.499172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.499172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.790596 (E_RNA) where: Base-Base interactions energy: -1083.839 where: short stacking energy: -453.836 Base-Backbone interact. energy: -1.293 local terms energy: -462.658646 where: bonds (distance) C4'-P energy: -86.938 bonds (distance) P-C4' energy: -89.183 flat angles C4'-P-C4' energy: -93.675 flat angles P-C4'-P energy: -64.480 tors. eta vs tors. theta energy: -128.382 Dist. restrs. and SS energy: 1.541 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -1434.230537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.230537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.661141 (E_RNA) where: Base-Base interactions energy: -1045.866 where: short stacking energy: -418.780 Base-Backbone interact. energy: -0.454 local terms energy: -426.341545 where: bonds (distance) C4'-P energy: -76.077 bonds (distance) P-C4' energy: -78.794 flat angles C4'-P-C4' energy: -96.565 flat angles P-C4'-P energy: -69.685 tors. eta vs tors. theta energy: -105.221 Dist. restrs. and SS energy: 1.681 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -1405.331870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.331870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.034177 (E_RNA) where: Base-Base interactions energy: -1032.243 where: short stacking energy: -425.987 Base-Backbone interact. energy: -0.405 local terms energy: -410.386229 where: bonds (distance) C4'-P energy: -76.247 bonds (distance) P-C4' energy: -74.687 flat angles C4'-P-C4' energy: -82.775 flat angles P-C4'-P energy: -51.316 tors. eta vs tors. theta energy: -125.361 Dist. restrs. and SS energy: 0.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -1356.600966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.600966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.540897 (E_RNA) where: Base-Base interactions energy: -985.314 where: short stacking energy: -398.467 Base-Backbone interact. energy: 0.176 local terms energy: -413.402827 where: bonds (distance) C4'-P energy: -79.907 bonds (distance) P-C4' energy: -85.045 flat angles C4'-P-C4' energy: -82.469 flat angles P-C4'-P energy: -55.097 tors. eta vs tors. theta energy: -110.884 Dist. restrs. and SS energy: 5.190 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -1329.433314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.433314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.668597 (E_RNA) where: Base-Base interactions energy: -975.747 where: short stacking energy: -391.395 Base-Backbone interact. energy: -2.251 local terms energy: -389.670034 where: bonds (distance) C4'-P energy: -75.190 bonds (distance) P-C4' energy: -78.970 flat angles C4'-P-C4' energy: -87.677 flat angles P-C4'-P energy: -40.098 tors. eta vs tors. theta energy: -107.735 Dist. restrs. and SS energy: 1.485 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1751.627083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1751.627083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1789.427395 (E_RNA) where: Base-Base interactions energy: -1264.803 where: short stacking energy: -522.535 Base-Backbone interact. energy: -0.160 local terms energy: -524.464596 where: bonds (distance) C4'-P energy: -96.461 bonds (distance) P-C4' energy: -97.367 flat angles C4'-P-C4' energy: -107.808 flat angles P-C4'-P energy: -70.220 tors. eta vs tors. theta energy: -152.609 Dist. restrs. and SS energy: 1.050 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1669.933433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.933433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.824322 (E_RNA) where: Base-Base interactions energy: -1211.640 where: short stacking energy: -496.710 Base-Backbone interact. energy: -2.143 local terms energy: -495.040481 where: bonds (distance) C4'-P energy: -97.058 bonds (distance) P-C4' energy: -85.475 flat angles C4'-P-C4' energy: -103.153 flat angles P-C4'-P energy: -66.957 tors. eta vs tors. theta energy: -142.398 Dist. restrs. and SS energy: 2.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1624.127683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.127683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.742491 (E_RNA) where: Base-Base interactions energy: -1174.327 where: short stacking energy: -479.152 Base-Backbone interact. energy: 0.406 local terms energy: -487.821558 where: bonds (distance) C4'-P energy: -87.957 bonds (distance) P-C4' energy: -91.018 flat angles C4'-P-C4' energy: -103.295 flat angles P-C4'-P energy: -68.808 tors. eta vs tors. theta energy: -136.744 Dist. restrs. and SS energy: 0.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -1565.636325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.636325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.391121 (E_RNA) where: Base-Base interactions energy: -1142.546 where: short stacking energy: -455.723 Base-Backbone interact. energy: -1.786 local terms energy: -459.059082 where: bonds (distance) C4'-P energy: -89.226 bonds (distance) P-C4' energy: -87.216 flat angles C4'-P-C4' energy: -95.878 flat angles P-C4'-P energy: -59.995 tors. eta vs tors. theta energy: -126.744 Dist. restrs. and SS energy: 1.005 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -1547.354397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.354397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.302601 (E_RNA) where: Base-Base interactions energy: -1132.191 where: short stacking energy: -450.951 Base-Backbone interact. energy: -2.700 local terms energy: -450.411502 where: bonds (distance) C4'-P energy: -66.597 bonds (distance) P-C4' energy: -79.321 flat angles C4'-P-C4' energy: -105.888 flat angles P-C4'-P energy: -67.892 tors. eta vs tors. theta energy: -130.713 Dist. restrs. and SS energy: 1.198 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -1514.899701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.899701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1552.952002 (E_RNA) where: Base-Base interactions energy: -1101.340 where: short stacking energy: -436.376 Base-Backbone interact. energy: 0.284 local terms energy: -451.895842 where: bonds (distance) C4'-P energy: -78.353 bonds (distance) P-C4' energy: -73.972 flat angles C4'-P-C4' energy: -101.308 flat angles P-C4'-P energy: -59.974 tors. eta vs tors. theta energy: -138.289 Dist. restrs. and SS energy: 1.302 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -1436.575862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.575862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.279892 (E_RNA) where: Base-Base interactions energy: -1043.635 where: short stacking energy: -430.841 Base-Backbone interact. energy: -1.656 local terms energy: -428.988814 where: bonds (distance) C4'-P energy: -63.402 bonds (distance) P-C4' energy: -81.317 flat angles C4'-P-C4' energy: -92.332 flat angles P-C4'-P energy: -67.308 tors. eta vs tors. theta energy: -124.630 Dist. restrs. and SS energy: 0.954 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -1383.719902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.719902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.363466 (E_RNA) where: Base-Base interactions energy: -1031.295 where: short stacking energy: -422.448 Base-Backbone interact. energy: -1.309 local terms energy: -390.759300 where: bonds (distance) C4'-P energy: -51.641 bonds (distance) P-C4' energy: -76.063 flat angles C4'-P-C4' energy: -89.010 flat angles P-C4'-P energy: -60.284 tors. eta vs tors. theta energy: -113.761 Dist. restrs. and SS energy: 2.894 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -1397.468958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.468958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.778693 (E_RNA) where: Base-Base interactions energy: -1010.126 where: short stacking energy: -420.419 Base-Backbone interact. energy: -1.403 local terms energy: -424.250115 where: bonds (distance) C4'-P energy: -71.794 bonds (distance) P-C4' energy: -78.152 flat angles C4'-P-C4' energy: -94.375 flat angles P-C4'-P energy: -70.272 tors. eta vs tors. theta energy: -109.657 Dist. restrs. and SS energy: 1.560 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -1276.640671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.640671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.827334 (E_RNA) where: Base-Base interactions energy: -932.930 where: short stacking energy: -387.095 Base-Backbone interact. energy: -1.329 local terms energy: -381.568067 where: bonds (distance) C4'-P energy: -80.837 bonds (distance) P-C4' energy: -78.239 flat angles C4'-P-C4' energy: -71.682 flat angles P-C4'-P energy: -54.107 tors. eta vs tors. theta energy: -96.703 Dist. restrs. and SS energy: 2.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1734.840778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.840778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.174433 (E_RNA) where: Base-Base interactions energy: -1259.916 where: short stacking energy: -530.084 Base-Backbone interact. energy: -1.272 local terms energy: -510.986538 where: bonds (distance) C4'-P energy: -94.234 bonds (distance) P-C4' energy: -89.800 flat angles C4'-P-C4' energy: -100.697 flat angles P-C4'-P energy: -76.310 tors. eta vs tors. theta energy: -149.946 Dist. restrs. and SS energy: 0.584 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1654.620033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.620033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.374969 (E_RNA) where: Base-Base interactions energy: -1201.920 where: short stacking energy: -514.995 Base-Backbone interact. energy: -1.664 local terms energy: -488.791822 where: bonds (distance) C4'-P energy: -85.215 bonds (distance) P-C4' energy: -85.195 flat angles C4'-P-C4' energy: -103.853 flat angles P-C4'-P energy: -74.450 tors. eta vs tors. theta energy: -140.079 Dist. restrs. and SS energy: 1.005 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1631.222486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.222486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1670.603270 (E_RNA) where: Base-Base interactions energy: -1162.869 where: short stacking energy: -470.529 Base-Backbone interact. energy: -1.426 local terms energy: -506.307866 where: bonds (distance) C4'-P energy: -92.455 bonds (distance) P-C4' energy: -87.821 flat angles C4'-P-C4' energy: -99.388 flat angles P-C4'-P energy: -80.230 tors. eta vs tors. theta energy: -146.414 Dist. restrs. and SS energy: 2.631 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1597.601461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.601461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.065954 (E_RNA) where: Base-Base interactions energy: -1151.247 where: short stacking energy: -477.772 Base-Backbone interact. energy: -3.415 local terms energy: -480.404502 where: bonds (distance) C4'-P energy: -77.940 bonds (distance) P-C4' energy: -96.384 flat angles C4'-P-C4' energy: -104.613 flat angles P-C4'-P energy: -69.746 tors. eta vs tors. theta energy: -131.722 Dist. restrs. and SS energy: 0.714 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -1552.031354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.031354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.451010 (E_RNA) where: Base-Base interactions energy: -1134.237 where: short stacking energy: -469.002 Base-Backbone interact. energy: -1.999 local terms energy: -454.214677 where: bonds (distance) C4'-P energy: -72.431 bonds (distance) P-C4' energy: -78.071 flat angles C4'-P-C4' energy: -104.391 flat angles P-C4'-P energy: -66.455 tors. eta vs tors. theta energy: -132.867 Dist. restrs. and SS energy: 1.670 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -1500.425725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.425725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.212247 (E_RNA) where: Base-Base interactions energy: -1087.316 where: short stacking energy: -451.369 Base-Backbone interact. energy: -1.920 local terms energy: -449.976688 where: bonds (distance) C4'-P energy: -90.556 bonds (distance) P-C4' energy: -65.734 flat angles C4'-P-C4' energy: -97.035 flat angles P-C4'-P energy: -68.230 tors. eta vs tors. theta energy: -128.421 Dist. restrs. and SS energy: 2.037 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -1412.526921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.526921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.202433 (E_RNA) where: Base-Base interactions energy: -1035.791 where: short stacking energy: -411.809 Base-Backbone interact. energy: -1.083 local terms energy: -414.328266 where: bonds (distance) C4'-P energy: -83.292 bonds (distance) P-C4' energy: -73.541 flat angles C4'-P-C4' energy: -86.158 flat angles P-C4'-P energy: -58.251 tors. eta vs tors. theta energy: -113.087 Dist. restrs. and SS energy: 1.926 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -1394.276728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.276728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.005134 (E_RNA) where: Base-Base interactions energy: -1017.657 where: short stacking energy: -402.605 Base-Backbone interact. energy: 0.058 local terms energy: -415.405924 where: bonds (distance) C4'-P energy: -65.508 bonds (distance) P-C4' energy: -66.439 flat angles C4'-P-C4' energy: -91.905 flat angles P-C4'-P energy: -67.523 tors. eta vs tors. theta energy: -124.031 Dist. restrs. and SS energy: 1.978 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -1370.167413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.167413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.560671 (E_RNA) where: Base-Base interactions energy: -984.775 where: short stacking energy: -392.432 Base-Backbone interact. energy: 0.260 local terms energy: -423.045634 where: bonds (distance) C4'-P energy: -77.677 bonds (distance) P-C4' energy: -75.104 flat angles C4'-P-C4' energy: -92.157 flat angles P-C4'-P energy: -63.244 tors. eta vs tors. theta energy: -114.863 Dist. restrs. and SS energy: 0.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -1307.054670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.054670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.572112 (E_RNA) where: Base-Base interactions energy: -938.078 where: short stacking energy: -390.212 Base-Backbone interact. energy: -0.980 local terms energy: -407.514086 where: bonds (distance) C4'-P energy: -64.945 bonds (distance) P-C4' energy: -89.326 flat angles C4'-P-C4' energy: -94.975 flat angles P-C4'-P energy: -54.160 tors. eta vs tors. theta energy: -104.109 Dist. restrs. and SS energy: 2.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -1682.568473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.568473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1720.539048 (E_RNA) where: Base-Base interactions energy: -1222.175 where: short stacking energy: -524.148 Base-Backbone interact. energy: -0.368 local terms energy: -497.996746 where: bonds (distance) C4'-P energy: -89.010 bonds (distance) P-C4' energy: -95.356 flat angles C4'-P-C4' energy: -108.339 flat angles P-C4'-P energy: -68.134 tors. eta vs tors. theta energy: -137.157 Dist. restrs. and SS energy: 1.221 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -1716.891035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1716.891035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.425556 (E_RNA) where: Base-Base interactions energy: -1238.008 where: short stacking energy: -513.858 Base-Backbone interact. energy: -2.695 local terms energy: -513.722332 where: bonds (distance) C4'-P energy: -86.264 bonds (distance) P-C4' energy: -96.328 flat angles C4'-P-C4' energy: -107.772 flat angles P-C4'-P energy: -68.277 tors. eta vs tors. theta energy: -155.081 Dist. restrs. and SS energy: 0.785 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -1614.968903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.968903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.195675 (E_RNA) where: Base-Base interactions energy: -1154.053 where: short stacking energy: -485.658 Base-Backbone interact. energy: 0.441 local terms energy: -501.583453 where: bonds (distance) C4'-P energy: -92.885 bonds (distance) P-C4' energy: -87.081 flat angles C4'-P-C4' energy: -109.851 flat angles P-C4'-P energy: -68.240 tors. eta vs tors. theta energy: -143.526 Dist. restrs. and SS energy: 3.477 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -1577.070047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.070047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.501986 (E_RNA) where: Base-Base interactions energy: -1138.861 where: short stacking energy: -480.829 Base-Backbone interact. energy: -0.846 local terms energy: -475.795058 where: bonds (distance) C4'-P energy: -81.019 bonds (distance) P-C4' energy: -84.622 flat angles C4'-P-C4' energy: -105.187 flat angles P-C4'-P energy: -68.418 tors. eta vs tors. theta energy: -136.550 Dist. restrs. and SS energy: 1.682 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -1534.722000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.722000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.673805 (E_RNA) where: Base-Base interactions energy: -1123.085 where: short stacking energy: -448.245 Base-Backbone interact. energy: -0.588 local terms energy: -449.000895 where: bonds (distance) C4'-P energy: -70.677 bonds (distance) P-C4' energy: -84.340 flat angles C4'-P-C4' energy: -90.729 flat angles P-C4'-P energy: -68.735 tors. eta vs tors. theta energy: -134.520 Dist. restrs. and SS energy: 1.202 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -1513.567793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1513.567793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.340781 (E_RNA) where: Base-Base interactions energy: -1106.437 where: short stacking energy: -456.206 Base-Backbone interact. energy: -1.754 local terms energy: -443.149749 where: bonds (distance) C4'-P energy: -76.050 bonds (distance) P-C4' energy: -90.443 flat angles C4'-P-C4' energy: -91.914 flat angles P-C4'-P energy: -62.421 tors. eta vs tors. theta energy: -122.322 Dist. restrs. and SS energy: 1.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -1433.981863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.981863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.048397 (E_RNA) where: Base-Base interactions energy: -1072.684 where: short stacking energy: -436.751 Base-Backbone interact. energy: -1.641 local terms energy: -397.724121 where: bonds (distance) C4'-P energy: -66.932 bonds (distance) P-C4' energy: -73.013 flat angles C4'-P-C4' energy: -88.920 flat angles P-C4'-P energy: -47.472 tors. eta vs tors. theta energy: -121.387 Dist. restrs. and SS energy: 1.317 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -1365.263033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.263033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.158170 (E_RNA) where: Base-Base interactions energy: -1015.613 where: short stacking energy: -406.395 Base-Backbone interact. energy: 0.883 local terms energy: -388.428243 where: bonds (distance) C4'-P energy: -65.848 bonds (distance) P-C4' energy: -68.840 flat angles C4'-P-C4' energy: -81.716 flat angles P-C4'-P energy: -60.208 tors. eta vs tors. theta energy: -111.817 Dist. restrs. and SS energy: 1.145 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -1377.896712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.896712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.746006 (E_RNA) where: Base-Base interactions energy: -997.630 where: short stacking energy: -401.367 Base-Backbone interact. energy: -1.782 local terms energy: -419.334175 where: bonds (distance) C4'-P energy: -74.573 bonds (distance) P-C4' energy: -74.150 flat angles C4'-P-C4' energy: -86.348 flat angles P-C4'-P energy: -59.113 tors. eta vs tors. theta energy: -125.151 Dist. restrs. and SS energy: 4.099 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -1326.826275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.826275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.650412 (E_RNA) where: Base-Base interactions energy: -957.501 where: short stacking energy: -389.031 Base-Backbone interact. energy: -0.391 local terms energy: -406.758421 where: bonds (distance) C4'-P energy: -77.353 bonds (distance) P-C4' energy: -79.573 flat angles C4'-P-C4' energy: -87.121 flat angles P-C4'-P energy: -46.505 tors. eta vs tors. theta energy: -116.206 Dist. restrs. and SS energy: 1.074 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -1675.157720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.157720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.086407 (E_RNA) where: Base-Base interactions energy: -1196.423 where: short stacking energy: -514.676 Base-Backbone interact. energy: -1.406 local terms energy: -515.257693 where: bonds (distance) C4'-P energy: -99.720 bonds (distance) P-C4' energy: -102.361 flat angles C4'-P-C4' energy: -105.818 flat angles P-C4'-P energy: -73.433 tors. eta vs tors. theta energy: -133.926 Dist. restrs. and SS energy: 1.179 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -1715.975820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.975820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.334115 (E_RNA) where: Base-Base interactions energy: -1233.010 where: short stacking energy: -517.524 Base-Backbone interact. energy: -1.607 local terms energy: -519.716904 where: bonds (distance) C4'-P energy: -96.423 bonds (distance) P-C4' energy: -107.852 flat angles C4'-P-C4' energy: -100.990 flat angles P-C4'-P energy: -65.635 tors. eta vs tors. theta energy: -148.817 Dist. restrs. and SS energy: 1.608 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -1630.866215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.866215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.998238 (E_RNA) where: Base-Base interactions energy: -1186.736 where: short stacking energy: -491.539 Base-Backbone interact. energy: -2.941 local terms energy: -483.320989 where: bonds (distance) C4'-P energy: -91.759 bonds (distance) P-C4' energy: -90.277 flat angles C4'-P-C4' energy: -99.525 flat angles P-C4'-P energy: -62.017 tors. eta vs tors. theta energy: -139.743 Dist. restrs. and SS energy: 5.382 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -1561.025128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.025128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.885086 (E_RNA) where: Base-Base interactions energy: -1138.996 where: short stacking energy: -478.623 Base-Backbone interact. energy: -1.919 local terms energy: -457.970429 where: bonds (distance) C4'-P energy: -86.429 bonds (distance) P-C4' energy: -78.250 flat angles C4'-P-C4' energy: -91.263 flat angles P-C4'-P energy: -69.078 tors. eta vs tors. theta energy: -132.951 Dist. restrs. and SS energy: 1.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -1549.557801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.557801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.151310 (E_RNA) where: Base-Base interactions energy: -1121.913 where: short stacking energy: -447.757 Base-Backbone interact. energy: 2.553 local terms energy: -468.791363 where: bonds (distance) C4'-P energy: -82.742 bonds (distance) P-C4' energy: -94.260 flat angles C4'-P-C4' energy: -98.827 flat angles P-C4'-P energy: -63.786 tors. eta vs tors. theta energy: -129.176 Dist. restrs. and SS energy: 1.844 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -1455.084718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.084718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.173950 (E_RNA) where: Base-Base interactions energy: -1059.821 where: short stacking energy: -439.291 Base-Backbone interact. energy: -1.651 local terms energy: -431.701739 where: bonds (distance) C4'-P energy: -80.183 bonds (distance) P-C4' energy: -85.337 flat angles C4'-P-C4' energy: -91.845 flat angles P-C4'-P energy: -55.033 tors. eta vs tors. theta energy: -119.303 Dist. restrs. and SS energy: 1.339 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -1457.978520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.978520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.873112 (E_RNA) where: Base-Base interactions energy: -1047.652 where: short stacking energy: -443.138 Base-Backbone interact. energy: -0.730 local terms energy: -448.491125 where: bonds (distance) C4'-P energy: -67.498 bonds (distance) P-C4' energy: -81.483 flat angles C4'-P-C4' energy: -98.489 flat angles P-C4'-P energy: -68.685 tors. eta vs tors. theta energy: -132.336 Dist. restrs. and SS energy: 2.145 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -1388.811758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.811758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.222379 (E_RNA) where: Base-Base interactions energy: -989.324 where: short stacking energy: -417.262 Base-Backbone interact. energy: -3.181 local terms energy: -435.717177 where: bonds (distance) C4'-P energy: -80.291 bonds (distance) P-C4' energy: -80.869 flat angles C4'-P-C4' energy: -87.493 flat angles P-C4'-P energy: -65.394 tors. eta vs tors. theta energy: -121.670 Dist. restrs. and SS energy: 2.661 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -1328.311277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.311277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.780433 (E_RNA) where: Base-Base interactions energy: -996.364 where: short stacking energy: -406.808 Base-Backbone interact. energy: -2.295 local terms energy: -370.121872 where: bonds (distance) C4'-P energy: -59.767 bonds (distance) P-C4' energy: -67.352 flat angles C4'-P-C4' energy: -91.049 flat angles P-C4'-P energy: -45.003 tors. eta vs tors. theta energy: -106.950 Dist. restrs. and SS energy: 3.719 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -1348.618552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.618552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.573128 (E_RNA) where: Base-Base interactions energy: -976.158 where: short stacking energy: -406.281 Base-Backbone interact. energy: 1.856 local terms energy: -413.271059 where: bonds (distance) C4'-P energy: -76.724 bonds (distance) P-C4' energy: -73.361 flat angles C4'-P-C4' energy: -80.921 flat angles P-C4'-P energy: -63.284 tors. eta vs tors. theta energy: -118.981 Dist. restrs. and SS energy: 2.205 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -1737.213722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1737.213722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1774.852327 (E_RNA) where: Base-Base interactions energy: -1264.520 where: short stacking energy: -511.831 Base-Backbone interact. energy: -0.962 local terms energy: -509.370670 where: bonds (distance) C4'-P energy: -85.777 bonds (distance) P-C4' energy: -96.832 flat angles C4'-P-C4' energy: -112.300 flat angles P-C4'-P energy: -67.065 tors. eta vs tors. theta energy: -147.397 Dist. restrs. and SS energy: 0.889 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 104 Temperature: 0.950000 Total energy: -1644.180076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.180076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.918981 (E_RNA) where: Base-Base interactions energy: -1189.393 where: short stacking energy: -500.970 Base-Backbone interact. energy: -0.505 local terms energy: -492.021547 where: bonds (distance) C4'-P energy: -85.635 bonds (distance) P-C4' energy: -92.295 flat angles C4'-P-C4' energy: -94.954 flat angles P-C4'-P energy: -71.150 tors. eta vs tors. theta energy: -147.987 Dist. restrs. and SS energy: 0.989 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 104 Temperature: 1.000000 Total energy: -1627.838549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1627.838549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.286215 (E_RNA) where: Base-Base interactions energy: -1205.790 where: short stacking energy: -492.025 Base-Backbone interact. energy: -1.335 local terms energy: -460.160909 where: bonds (distance) C4'-P energy: -78.902 bonds (distance) P-C4' energy: -86.632 flat angles C4'-P-C4' energy: -103.924 flat angles P-C4'-P energy: -45.436 tors. eta vs tors. theta energy: -145.267 Dist. restrs. and SS energy: 2.698 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 104 Temperature: 1.050000 Total energy: -1593.906320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.906320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.374809 (E_RNA) where: Base-Base interactions energy: -1153.141 where: short stacking energy: -478.266 Base-Backbone interact. energy: -0.014 local terms energy: -478.219710 where: bonds (distance) C4'-P energy: -82.813 bonds (distance) P-C4' energy: -86.735 flat angles C4'-P-C4' energy: -103.037 flat angles P-C4'-P energy: -70.933 tors. eta vs tors. theta energy: -134.702 Dist. restrs. and SS energy: 0.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 104 Temperature: 1.100000 Total energy: -1528.444395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.444395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.931090 (E_RNA) where: Base-Base interactions energy: -1126.652 where: short stacking energy: -462.791 Base-Backbone interact. energy: -1.120 local terms energy: -438.159769 where: bonds (distance) C4'-P energy: -70.481 bonds (distance) P-C4' energy: -80.626 flat angles C4'-P-C4' energy: -97.345 flat angles P-C4'-P energy: -65.085 tors. eta vs tors. theta energy: -124.622 Dist. restrs. and SS energy: 0.737 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 104 Temperature: 1.150000 Total energy: -1508.317448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.317448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.128848 (E_RNA) where: Base-Base interactions energy: -1117.078 where: short stacking energy: -460.169 Base-Backbone interact. energy: 0.061 local terms energy: -429.111861 where: bonds (distance) C4'-P energy: -76.069 bonds (distance) P-C4' energy: -88.967 flat angles C4'-P-C4' energy: -89.209 flat angles P-C4'-P energy: -54.282 tors. eta vs tors. theta energy: -120.584 Dist. restrs. and SS energy: 1.061 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 104 Temperature: 1.200000 Total energy: -1454.608026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.608026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.869168 (E_RNA) where: Base-Base interactions energy: -1064.323 where: short stacking energy: -435.600 Base-Backbone interact. energy: 2.455 local terms energy: -430.000796 where: bonds (distance) C4'-P energy: -84.116 bonds (distance) P-C4' energy: -66.851 flat angles C4'-P-C4' energy: -95.226 flat angles P-C4'-P energy: -60.737 tors. eta vs tors. theta energy: -123.070 Dist. restrs. and SS energy: 0.511 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 104 Temperature: 1.250000 Total energy: -1389.886749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.886749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.160027 (E_RNA) where: Base-Base interactions energy: -1023.400 where: short stacking energy: -412.568 Base-Backbone interact. energy: 0.302 local terms energy: -405.062148 where: bonds (distance) C4'-P energy: -77.068 bonds (distance) P-C4' energy: -75.584 flat angles C4'-P-C4' energy: -81.481 flat angles P-C4'-P energy: -58.175 tors. eta vs tors. theta energy: -112.754 Dist. restrs. and SS energy: 1.523 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 104 Temperature: 1.300000 Total energy: -1365.975432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.975432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.133510 (E_RNA) where: Base-Base interactions energy: -997.178 where: short stacking energy: -400.923 Base-Backbone interact. energy: 3.579 local terms energy: -410.534180 where: bonds (distance) C4'-P energy: -78.861 bonds (distance) P-C4' energy: -75.646 flat angles C4'-P-C4' energy: -89.275 flat angles P-C4'-P energy: -53.318 tors. eta vs tors. theta energy: -113.435 Dist. restrs. and SS energy: 1.408 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -1342.847485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.847485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.727214 (E_RNA) where: Base-Base interactions energy: -1006.976 where: short stacking energy: -401.461 Base-Backbone interact. energy: -0.013 local terms energy: -374.738421 where: bonds (distance) C4'-P energy: -71.781 bonds (distance) P-C4' energy: -69.249 flat angles C4'-P-C4' energy: -80.128 flat angles P-C4'-P energy: -48.753 tors. eta vs tors. theta energy: -104.828 Dist. restrs. and SS energy: 2.130 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -1743.528073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1743.528073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1781.227869 (E_RNA) where: Base-Base interactions energy: -1270.224 where: short stacking energy: -539.333 Base-Backbone interact. energy: -0.950 local terms energy: -510.053656 where: bonds (distance) C4'-P energy: -94.984 bonds (distance) P-C4' energy: -93.745 flat angles C4'-P-C4' energy: -107.855 flat angles P-C4'-P energy: -62.695 tors. eta vs tors. theta energy: -150.775 Dist. restrs. and SS energy: 0.950 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 105 Temperature: 0.950000 Total energy: -1673.872032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.872032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.140749 (E_RNA) where: Base-Base interactions energy: -1210.565 where: short stacking energy: -512.931 Base-Backbone interact. energy: -2.421 local terms energy: -498.155226 where: bonds (distance) C4'-P energy: -87.685 bonds (distance) P-C4' energy: -89.720 flat angles C4'-P-C4' energy: -106.421 flat angles P-C4'-P energy: -65.313 tors. eta vs tors. theta energy: -149.015 Dist. restrs. and SS energy: 0.519 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 105 Temperature: 1.000000 Total energy: -1646.170759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.170759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.154130 (E_RNA) where: Base-Base interactions energy: -1181.679 where: short stacking energy: -491.811 Base-Backbone interact. energy: -1.689 local terms energy: -502.785256 where: bonds (distance) C4'-P energy: -96.198 bonds (distance) P-C4' energy: -99.166 flat angles C4'-P-C4' energy: -97.440 flat angles P-C4'-P energy: -65.256 tors. eta vs tors. theta energy: -144.726 Dist. restrs. and SS energy: 3.233 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 105 Temperature: 1.050000 Total energy: -1555.972657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.972657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.641737 (E_RNA) where: Base-Base interactions energy: -1128.421 where: short stacking energy: -455.832 Base-Backbone interact. energy: -2.172 local terms energy: -464.049072 where: bonds (distance) C4'-P energy: -80.765 bonds (distance) P-C4' energy: -91.558 flat angles C4'-P-C4' energy: -94.062 flat angles P-C4'-P energy: -71.948 tors. eta vs tors. theta energy: -125.716 Dist. restrs. and SS energy: 1.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 105 Temperature: 1.100000 Total energy: -1551.409619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.409619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.868833 (E_RNA) where: Base-Base interactions energy: -1145.793 where: short stacking energy: -448.145 Base-Backbone interact. energy: -2.939 local terms energy: -441.136785 where: bonds (distance) C4'-P energy: -78.906 bonds (distance) P-C4' energy: -80.442 flat angles C4'-P-C4' energy: -92.743 flat angles P-C4'-P energy: -58.387 tors. eta vs tors. theta energy: -130.659 Dist. restrs. and SS energy: 1.709 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 105 Temperature: 1.150000 Total energy: -1508.634179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.634179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.073016 (E_RNA) where: Base-Base interactions energy: -1091.732 where: short stacking energy: -457.233 Base-Backbone interact. energy: 3.331 local terms energy: -458.672169 where: bonds (distance) C4'-P energy: -76.701 bonds (distance) P-C4' energy: -82.164 flat angles C4'-P-C4' energy: -102.571 flat angles P-C4'-P energy: -73.496 tors. eta vs tors. theta energy: -123.742 Dist. restrs. and SS energy: 1.689 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 105 Temperature: 1.200000 Total energy: -1460.987187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.987187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.680172 (E_RNA) where: Base-Base interactions energy: -1041.621 where: short stacking energy: -425.854 Base-Backbone interact. energy: -1.389 local terms energy: -455.670331 where: bonds (distance) C4'-P energy: -89.799 bonds (distance) P-C4' energy: -80.003 flat angles C4'-P-C4' energy: -90.306 flat angles P-C4'-P energy: -65.907 tors. eta vs tors. theta energy: -129.655 Dist. restrs. and SS energy: 0.943 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 105 Temperature: 1.250000 Total energy: -1405.412051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.412051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.900567 (E_RNA) where: Base-Base interactions energy: -1027.053 where: short stacking energy: -434.162 Base-Backbone interact. energy: -1.480 local terms energy: -415.367694 where: bonds (distance) C4'-P energy: -67.505 bonds (distance) P-C4' energy: -86.244 flat angles C4'-P-C4' energy: -93.372 flat angles P-C4'-P energy: -45.535 tors. eta vs tors. theta energy: -122.712 Dist. restrs. and SS energy: 1.739 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 105 Temperature: 1.300000 Total energy: -1344.169467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.169467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.174617 (E_RNA) where: Base-Base interactions energy: -994.517 where: short stacking energy: -400.563 Base-Backbone interact. energy: -0.584 local terms energy: -387.073589 where: bonds (distance) C4'-P energy: -64.169 bonds (distance) P-C4' energy: -84.406 flat angles C4'-P-C4' energy: -85.623 flat angles P-C4'-P energy: -47.649 tors. eta vs tors. theta energy: -105.227 Dist. restrs. and SS energy: 1.255 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -1334.309497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.309497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.323629 (E_RNA) where: Base-Base interactions energy: -983.886 where: short stacking energy: -396.565 Base-Backbone interact. energy: -1.682 local terms energy: -386.755125 where: bonds (distance) C4'-P energy: -67.126 bonds (distance) P-C4' energy: -66.182 flat angles C4'-P-C4' energy: -92.246 flat angles P-C4'-P energy: -55.903 tors. eta vs tors. theta energy: -105.298 Dist. restrs. and SS energy: 1.264 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -1731.108143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.108143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.948056 (E_RNA) where: Base-Base interactions energy: -1247.993 where: short stacking energy: -527.423 Base-Backbone interact. energy: 0.497 local terms energy: -521.451270 where: bonds (distance) C4'-P energy: -93.992 bonds (distance) P-C4' energy: -95.513 flat angles C4'-P-C4' energy: -100.517 flat angles P-C4'-P energy: -77.748 tors. eta vs tors. theta energy: -153.682 Dist. restrs. and SS energy: 1.090 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 106 Temperature: 0.950000 Total energy: -1680.555118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.555118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.948131 (E_RNA) where: Base-Base interactions energy: -1225.967 where: short stacking energy: -504.941 Base-Backbone interact. energy: -1.449 local terms energy: -490.531557 where: bonds (distance) C4'-P energy: -86.601 bonds (distance) P-C4' energy: -93.580 flat angles C4'-P-C4' energy: -103.215 flat angles P-C4'-P energy: -62.467 tors. eta vs tors. theta energy: -144.669 Dist. restrs. and SS energy: 0.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 106 Temperature: 1.000000 Total energy: -1669.225976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.225976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.778862 (E_RNA) where: Base-Base interactions energy: -1213.770 where: short stacking energy: -508.619 Base-Backbone interact. energy: -1.105 local terms energy: -493.903790 where: bonds (distance) C4'-P energy: -89.736 bonds (distance) P-C4' energy: -84.380 flat angles C4'-P-C4' energy: -98.763 flat angles P-C4'-P energy: -67.516 tors. eta vs tors. theta energy: -153.509 Dist. restrs. and SS energy: 2.803 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 106 Temperature: 1.050000 Total energy: -1547.949059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.949059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.972682 (E_RNA) where: Base-Base interactions energy: -1127.460 where: short stacking energy: -462.168 Base-Backbone interact. energy: 0.326 local terms energy: -458.838608 where: bonds (distance) C4'-P energy: -84.056 bonds (distance) P-C4' energy: -69.259 flat angles C4'-P-C4' energy: -97.539 flat angles P-C4'-P energy: -73.012 tors. eta vs tors. theta energy: -134.972 Dist. restrs. and SS energy: 1.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 106 Temperature: 1.100000 Total energy: -1534.104227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.104227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.421160 (E_RNA) where: Base-Base interactions energy: -1134.016 where: short stacking energy: -455.895 Base-Backbone interact. energy: 1.874 local terms energy: -440.278808 where: bonds (distance) C4'-P energy: -86.142 bonds (distance) P-C4' energy: -75.326 flat angles C4'-P-C4' energy: -93.978 flat angles P-C4'-P energy: -53.315 tors. eta vs tors. theta energy: -131.518 Dist. restrs. and SS energy: 1.567 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 106 Temperature: 1.150000 Total energy: -1474.219761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.219761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.182624 (E_RNA) where: Base-Base interactions energy: -1085.654 where: short stacking energy: -457.417 Base-Backbone interact. energy: 0.185 local terms energy: -427.714054 where: bonds (distance) C4'-P energy: -76.902 bonds (distance) P-C4' energy: -66.640 flat angles C4'-P-C4' energy: -94.293 flat angles P-C4'-P energy: -63.147 tors. eta vs tors. theta energy: -126.732 Dist. restrs. and SS energy: 2.213 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 106 Temperature: 1.200000 Total energy: -1429.766755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.766755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.406086 (E_RNA) where: Base-Base interactions energy: -1049.325 where: short stacking energy: -427.438 Base-Backbone interact. energy: 2.292 local terms energy: -420.373098 where: bonds (distance) C4'-P energy: -85.900 bonds (distance) P-C4' energy: -81.893 flat angles C4'-P-C4' energy: -74.926 flat angles P-C4'-P energy: -62.068 tors. eta vs tors. theta energy: -115.586 Dist. restrs. and SS energy: 0.889 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 106 Temperature: 1.250000 Total energy: -1447.817170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.817170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.442651 (E_RNA) where: Base-Base interactions energy: -1058.075 where: short stacking energy: -436.211 Base-Backbone interact. energy: -0.103 local terms energy: -429.265407 where: bonds (distance) C4'-P energy: -71.158 bonds (distance) P-C4' energy: -83.050 flat angles C4'-P-C4' energy: -95.594 flat angles P-C4'-P energy: -56.515 tors. eta vs tors. theta energy: -122.949 Dist. restrs. and SS energy: 2.875 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 106 Temperature: 1.300000 Total energy: -1354.988774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.988774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.432437 (E_RNA) where: Base-Base interactions energy: -1000.411 where: short stacking energy: -417.991 Base-Backbone interact. energy: -0.387 local terms energy: -392.634190 where: bonds (distance) C4'-P energy: -65.308 bonds (distance) P-C4' energy: -72.728 flat angles C4'-P-C4' energy: -83.912 flat angles P-C4'-P energy: -60.482 tors. eta vs tors. theta energy: -110.204 Dist. restrs. and SS energy: 1.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -1315.335700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.335700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.772898 (E_RNA) where: Base-Base interactions energy: -949.216 where: short stacking energy: -393.466 Base-Backbone interact. energy: -1.624 local terms energy: -402.932620 where: bonds (distance) C4'-P energy: -79.152 bonds (distance) P-C4' energy: -84.096 flat angles C4'-P-C4' energy: -75.296 flat angles P-C4'-P energy: -54.429 tors. eta vs tors. theta energy: -109.959 Dist. restrs. and SS energy: 1.687 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -1741.238840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1741.238840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1778.606932 (E_RNA) where: Base-Base interactions energy: -1253.180 where: short stacking energy: -519.498 Base-Backbone interact. energy: -3.328 local terms energy: -522.099612 where: bonds (distance) C4'-P energy: -95.684 bonds (distance) P-C4' energy: -95.198 flat angles C4'-P-C4' energy: -106.326 flat angles P-C4'-P energy: -77.220 tors. eta vs tors. theta energy: -147.672 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 107 Temperature: 0.950000 Total energy: -1687.439070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.439070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.566116 (E_RNA) where: Base-Base interactions energy: -1228.250 where: short stacking energy: -504.742 Base-Backbone interact. energy: 4.706 local terms energy: -502.022547 where: bonds (distance) C4'-P energy: -92.819 bonds (distance) P-C4' energy: -89.432 flat angles C4'-P-C4' energy: -103.973 flat angles P-C4'-P energy: -67.722 tors. eta vs tors. theta energy: -148.078 Dist. restrs. and SS energy: 1.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 107 Temperature: 1.000000 Total energy: -1656.193206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.193206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.646746 (E_RNA) where: Base-Base interactions energy: -1180.390 where: short stacking energy: -494.455 Base-Backbone interact. energy: -3.280 local terms energy: -512.977197 where: bonds (distance) C4'-P energy: -85.387 bonds (distance) P-C4' energy: -93.754 flat angles C4'-P-C4' energy: -108.363 flat angles P-C4'-P energy: -74.502 tors. eta vs tors. theta energy: -150.972 Dist. restrs. and SS energy: 3.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 107 Temperature: 1.050000 Total energy: -1539.574028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.574028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.008412 (E_RNA) where: Base-Base interactions energy: -1121.472 where: short stacking energy: -472.852 Base-Backbone interact. energy: -1.248 local terms energy: -454.288394 where: bonds (distance) C4'-P energy: -74.870 bonds (distance) P-C4' energy: -84.010 flat angles C4'-P-C4' energy: -93.474 flat angles P-C4'-P energy: -73.020 tors. eta vs tors. theta energy: -128.914 Dist. restrs. and SS energy: 0.684 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 107 Temperature: 1.100000 Total energy: -1523.669226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.669226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.425280 (E_RNA) where: Base-Base interactions energy: -1093.638 where: short stacking energy: -448.194 Base-Backbone interact. energy: 1.092 local terms energy: -469.879518 where: bonds (distance) C4'-P energy: -80.964 bonds (distance) P-C4' energy: -91.558 flat angles C4'-P-C4' energy: -103.552 flat angles P-C4'-P energy: -69.798 tors. eta vs tors. theta energy: -124.007 Dist. restrs. and SS energy: 2.006 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 107 Temperature: 1.150000 Total energy: -1458.465495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.465495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.201999 (E_RNA) where: Base-Base interactions energy: -1055.082 where: short stacking energy: -431.213 Base-Backbone interact. energy: -1.921 local terms energy: -439.198859 where: bonds (distance) C4'-P energy: -77.476 bonds (distance) P-C4' energy: -82.844 flat angles C4'-P-C4' energy: -101.062 flat angles P-C4'-P energy: -61.914 tors. eta vs tors. theta energy: -115.903 Dist. restrs. and SS energy: 0.987 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 107 Temperature: 1.200000 Total energy: -1437.555962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.555962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.563948 (E_RNA) where: Base-Base interactions energy: -1055.907 where: short stacking energy: -420.895 Base-Backbone interact. energy: -3.288 local terms energy: -417.368217 where: bonds (distance) C4'-P energy: -81.429 bonds (distance) P-C4' energy: -72.683 flat angles C4'-P-C4' energy: -85.647 flat angles P-C4'-P energy: -62.105 tors. eta vs tors. theta energy: -115.504 Dist. restrs. and SS energy: 2.258 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 107 Temperature: 1.250000 Total energy: -1417.473691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.473691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.158836 (E_RNA) where: Base-Base interactions energy: -1027.533 where: short stacking energy: -432.798 Base-Backbone interact. energy: -0.927 local terms energy: -426.699641 where: bonds (distance) C4'-P energy: -75.349 bonds (distance) P-C4' energy: -83.385 flat angles C4'-P-C4' energy: -87.049 flat angles P-C4'-P energy: -51.967 tors. eta vs tors. theta energy: -128.949 Dist. restrs. and SS energy: 0.935 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 107 Temperature: 1.300000 Total energy: -1354.469798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.469798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.415795 (E_RNA) where: Base-Base interactions energy: -984.194 where: short stacking energy: -393.690 Base-Backbone interact. energy: -1.337 local terms energy: -406.885499 where: bonds (distance) C4'-P energy: -73.185 bonds (distance) P-C4' energy: -71.595 flat angles C4'-P-C4' energy: -83.823 flat angles P-C4'-P energy: -62.713 tors. eta vs tors. theta energy: -115.571 Dist. restrs. and SS energy: 1.196 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -1308.507050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.507050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.745925 (E_RNA) where: Base-Base interactions energy: -973.085 where: short stacking energy: -410.497 Base-Backbone interact. energy: -0.861 local terms energy: -373.799132 where: bonds (distance) C4'-P energy: -74.546 bonds (distance) P-C4' energy: -59.821 flat angles C4'-P-C4' energy: -68.217 flat angles P-C4'-P energy: -65.858 tors. eta vs tors. theta energy: -105.357 Dist. restrs. and SS energy: 2.489 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 108 Temperature: 0.900000 Total energy: -1745.554583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1745.554583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.212276 (E_RNA) where: Base-Base interactions energy: -1273.070 where: short stacking energy: -534.920 Base-Backbone interact. energy: -2.033 local terms energy: -508.109708 where: bonds (distance) C4'-P energy: -90.072 bonds (distance) P-C4' energy: -91.374 flat angles C4'-P-C4' energy: -100.482 flat angles P-C4'-P energy: -83.029 tors. eta vs tors. theta energy: -143.154 Dist. restrs. and SS energy: 0.908 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 108 Temperature: 0.950000 Total energy: -1679.312013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.312013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.730462 (E_RNA) where: Base-Base interactions energy: -1226.886 where: short stacking energy: -519.946 Base-Backbone interact. energy: 0.647 local terms energy: -490.491613 where: bonds (distance) C4'-P energy: -83.924 bonds (distance) P-C4' energy: -90.575 flat angles C4'-P-C4' energy: -106.887 flat angles P-C4'-P energy: -67.495 tors. eta vs tors. theta energy: -141.610 Dist. restrs. and SS energy: 0.668 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 108 Temperature: 1.000000 Total energy: -1652.707621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.707621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.601789 (E_RNA) where: Base-Base interactions energy: -1186.243 where: short stacking energy: -480.261 Base-Backbone interact. energy: -2.088 local terms energy: -504.271168 where: bonds (distance) C4'-P energy: -82.687 bonds (distance) P-C4' energy: -95.504 flat angles C4'-P-C4' energy: -102.273 flat angles P-C4'-P energy: -77.988 tors. eta vs tors. theta energy: -145.820 Dist. restrs. and SS energy: 3.144 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 108 Temperature: 1.050000 Total energy: -1541.370957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1541.370957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1579.600766 (E_RNA) where: Base-Base interactions energy: -1110.773 where: short stacking energy: -463.692 Base-Backbone interact. energy: -1.808 local terms energy: -467.020242 where: bonds (distance) C4'-P energy: -65.273 bonds (distance) P-C4' energy: -89.962 flat angles C4'-P-C4' energy: -113.336 flat angles P-C4'-P energy: -72.233 tors. eta vs tors. theta energy: -126.217 Dist. restrs. and SS energy: 1.480 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 108 Temperature: 1.100000 Total energy: -1525.572618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.572618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.121777 (E_RNA) where: Base-Base interactions energy: -1112.463 where: short stacking energy: -444.623 Base-Backbone interact. energy: 0.187 local terms energy: -450.845803 where: bonds (distance) C4'-P energy: -81.827 bonds (distance) P-C4' energy: -92.289 flat angles C4'-P-C4' energy: -100.437 flat angles P-C4'-P energy: -62.064 tors. eta vs tors. theta energy: -114.230 Dist. restrs. and SS energy: 0.799 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 108 Temperature: 1.150000 Total energy: -1463.613926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.613926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.672826 (E_RNA) where: Base-Base interactions energy: -1044.948 where: short stacking energy: -451.093 Base-Backbone interact. energy: 0.885 local terms energy: -457.609553 where: bonds (distance) C4'-P energy: -92.038 bonds (distance) P-C4' energy: -77.941 flat angles C4'-P-C4' energy: -91.973 flat angles P-C4'-P energy: -70.783 tors. eta vs tors. theta energy: -124.874 Dist. restrs. and SS energy: 1.309 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 108 Temperature: 1.200000 Total energy: -1484.172185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.172185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.724967 (E_RNA) where: Base-Base interactions energy: -1084.039 where: short stacking energy: -447.759 Base-Backbone interact. energy: -2.691 local terms energy: -434.994853 where: bonds (distance) C4'-P energy: -85.761 bonds (distance) P-C4' energy: -68.125 flat angles C4'-P-C4' energy: -93.851 flat angles P-C4'-P energy: -59.047 tors. eta vs tors. theta energy: -128.211 Dist. restrs. and SS energy: 0.803 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 108 Temperature: 1.250000 Total energy: -1417.848023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.848023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.979810 (E_RNA) where: Base-Base interactions energy: -1052.303 where: short stacking energy: -419.197 Base-Backbone interact. energy: 0.873 local terms energy: -404.549768 where: bonds (distance) C4'-P energy: -63.426 bonds (distance) P-C4' energy: -82.552 flat angles C4'-P-C4' energy: -83.823 flat angles P-C4'-P energy: -48.680 tors. eta vs tors. theta energy: -126.068 Dist. restrs. and SS energy: 1.382 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 108 Temperature: 1.300000 Total energy: -1383.594245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.594245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.222889 (E_RNA) where: Base-Base interactions energy: -997.767 where: short stacking energy: -406.785 Base-Backbone interact. energy: -1.959 local terms energy: -422.496845 where: bonds (distance) C4'-P energy: -86.583 bonds (distance) P-C4' energy: -70.095 flat angles C4'-P-C4' energy: -89.415 flat angles P-C4'-P energy: -54.652 tors. eta vs tors. theta energy: -121.750 Dist. restrs. and SS energy: 1.879 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 108 Temperature: 1.350000 Total energy: -1306.024194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.024194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.788806 (E_RNA) where: Base-Base interactions energy: -971.571 where: short stacking energy: -404.346 Base-Backbone interact. energy: 2.012 local terms energy: -374.229645 where: bonds (distance) C4'-P energy: -67.441 bonds (distance) P-C4' energy: -64.045 flat angles C4'-P-C4' energy: -83.789 flat angles P-C4'-P energy: -49.674 tors. eta vs tors. theta energy: -109.282 Dist. restrs. and SS energy: 1.015 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)