SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/T1_TA_timPR-0f5f49e5/inputs/seq.fa: 1 curr_seq: _GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGCCCUUUCCGCCGUCUCGCAAACGGGCGCUGGCUUCAGGAGAGGAUAACCCAUGGCCGUAAGCGCAGGCACACCGUAGUGCCUGCUAUCACGGCAUUAUCGCCAGCGGUGCUGCCGUGAUGCGGUCUUCGCAAGGACCGCAACAUG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 147 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 740 n_atoms_counter: 740 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _...((((((((((((((((....)))).)).)))....)))))))......((((.........((((((((......)))))))).(((((((((.(((((....))))).)))))))))((((((((....))))))))..))))_ nucl1: 18, chain1: 0, <---> nucl2: 23, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 23 nucl1: 17, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 16, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 15, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 14, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 11, chain1: 0, <---> nucl2: 32, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 32 nucl1: 10, chain1: 0, <---> nucl2: 33, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 33 nucl1: 9, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 8, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 7, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 6, chain1: 0, <---> nucl2: 41, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 41 nucl1: 5, chain1: 0, <---> nucl2: 42, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 42 nucl1: 4, chain1: 0, <---> nucl2: 43, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 43 nucl1: 3, chain1: 0, <---> nucl2: 44, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 44 nucl1: 71, chain1: 0, <---> nucl2: 78, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 78 nucl1: 70, chain1: 0, <---> nucl2: 79, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 79 nucl1: 69, chain1: 0, <---> nucl2: 80, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 80 nucl1: 68, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 68, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 67, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 67, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 66, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 66, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 65, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 65, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 64, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 64, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 101, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 101, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 100, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 100, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 99, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 99, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 98, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 98, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 97, chain1: 0, <---> nucl2: 110, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 97, chainIndex_2: 0, nuclIndex_2: 110 nucl1: 95, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 95, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 94, chain1: 0, <---> nucl2: 113, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 94, chainIndex_2: 0, nuclIndex_2: 113 nucl1: 93, chain1: 0, <---> nucl2: 114, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 114 nucl1: 92, chain1: 0, <---> nucl2: 115, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 115 nucl1: 91, chain1: 0, <---> nucl2: 116, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 116 nucl1: 90, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 89, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 88, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 87, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 128, chain1: 0, <---> nucl2: 133, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 128, chainIndex_2: 0, nuclIndex_2: 133 nucl1: 127, chain1: 0, <---> nucl2: 134, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 127, chainIndex_2: 0, nuclIndex_2: 134 nucl1: 126, chain1: 0, <---> nucl2: 135, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 126, chainIndex_2: 0, nuclIndex_2: 135 nucl1: 125, chain1: 0, <---> nucl2: 136, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 125, chainIndex_2: 0, nuclIndex_2: 136 nucl1: 124, chain1: 0, <---> nucl2: 137, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 124, chainIndex_2: 0, nuclIndex_2: 137 nucl1: 123, chain1: 0, <---> nucl2: 138, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 123, chainIndex_2: 0, nuclIndex_2: 138 nucl1: 122, chain1: 0, <---> nucl2: 139, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 122, chainIndex_2: 0, nuclIndex_2: 139 nucl1: 121, chain1: 0, <---> nucl2: 140, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 121, chainIndex_2: 0, nuclIndex_2: 140 nucl1: 54, chain1: 0, <---> nucl2: 143, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 54, chainIndex_2: 0, nuclIndex_2: 143 nucl1: 53, chain1: 0, <---> nucl2: 144, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 53, chainIndex_2: 0, nuclIndex_2: 144 nucl1: 52, chain1: 0, <---> nucl2: 145, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 52, chainIndex_2: 0, nuclIndex_2: 145 nucl1: 51, chain1: 0, <---> nucl2: 146, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 51, chainIndex_2: 0, nuclIndex_2: 146 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 147.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 3325.886573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 3325.886573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.240624 (E_RNA) where: Base-Base interactions energy: -11.963 where: short stacking energy: -11.963 Base-Backbone interact. energy: -0.000 local terms energy: -572.277077 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -132.408 flat angles C4'-P-C4' energy: -107.931 flat angles P-C4'-P energy: -123.462 tors. eta vs tors. theta energy: -65.654 Dist. restrs. and SS energy: 3873.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -942.424679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.424679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1094.931780 (E_RNA) where: Base-Base interactions energy: -704.766 where: short stacking energy: -338.686 Base-Backbone interact. energy: 5.542 local terms energy: -395.708044 where: bonds (distance) C4'-P energy: -90.120 bonds (distance) P-C4' energy: -86.553 flat angles C4'-P-C4' energy: -88.315 flat angles P-C4'-P energy: -48.216 tors. eta vs tors. theta energy: -82.504 Dist. restrs. and SS energy: 115.757 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -763.911097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.911097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.378765 (E_RNA) where: Base-Base interactions energy: -562.606 where: short stacking energy: -283.418 Base-Backbone interact. energy: -0.911 local terms energy: -367.862668 where: bonds (distance) C4'-P energy: -85.767 bonds (distance) P-C4' energy: -90.552 flat angles C4'-P-C4' energy: -87.733 flat angles P-C4'-P energy: -36.493 tors. eta vs tors. theta energy: -67.317 Dist. restrs. and SS energy: 130.718 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1021.759205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.759205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.096235 (E_RNA) where: Base-Base interactions energy: -744.113 where: short stacking energy: -321.431 Base-Backbone interact. energy: -1.122 local terms energy: -382.860745 where: bonds (distance) C4'-P energy: -82.968 bonds (distance) P-C4' energy: -84.277 flat angles C4'-P-C4' energy: -86.296 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -74.252 Dist. restrs. and SS energy: 69.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1143.816791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.816791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.011950 (E_RNA) where: Base-Base interactions energy: -849.288 where: short stacking energy: -362.345 Base-Backbone interact. energy: 0.467 local terms energy: -376.190629 where: bonds (distance) C4'-P energy: -75.970 bonds (distance) P-C4' energy: -80.390 flat angles C4'-P-C4' energy: -92.523 flat angles P-C4'-P energy: -48.293 tors. eta vs tors. theta energy: -79.014 Dist. restrs. and SS energy: 44.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -959.406718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.406718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.573247 (E_RNA) where: Base-Base interactions energy: -701.170 where: short stacking energy: -292.773 Base-Backbone interact. energy: -0.611 local terms energy: -357.792064 where: bonds (distance) C4'-P energy: -82.004 bonds (distance) P-C4' energy: -86.498 flat angles C4'-P-C4' energy: -75.058 flat angles P-C4'-P energy: -48.234 tors. eta vs tors. theta energy: -65.999 Dist. restrs. and SS energy: 63.417 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -830.519889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.519889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.588220 (E_RNA) where: Base-Base interactions energy: -587.651 where: short stacking energy: -250.886 Base-Backbone interact. energy: 0.146 local terms energy: -343.083926 where: bonds (distance) C4'-P energy: -78.035 bonds (distance) P-C4' energy: -85.640 flat angles C4'-P-C4' energy: -67.732 flat angles P-C4'-P energy: -56.409 tors. eta vs tors. theta energy: -55.268 Dist. restrs. and SS energy: 63.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -795.384900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.384900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.979442 (E_RNA) where: Base-Base interactions energy: -622.390 where: short stacking energy: -281.645 Base-Backbone interact. energy: -1.915 local terms energy: -321.673884 where: bonds (distance) C4'-P energy: -70.826 bonds (distance) P-C4' energy: -83.034 flat angles C4'-P-C4' energy: -78.020 flat angles P-C4'-P energy: -23.539 tors. eta vs tors. theta energy: -66.254 Dist. restrs. and SS energy: 113.845 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -806.874339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.874339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.366854 (E_RNA) where: Base-Base interactions energy: -617.485 where: short stacking energy: -250.218 Base-Backbone interact. energy: 1.181 local terms energy: -298.063707 where: bonds (distance) C4'-P energy: -74.177 bonds (distance) P-C4' energy: -65.043 flat angles C4'-P-C4' energy: -56.925 flat angles P-C4'-P energy: -51.683 tors. eta vs tors. theta energy: -50.235 Dist. restrs. and SS energy: 70.743 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -789.982367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.982367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.006648 (E_RNA) where: Base-Base interactions energy: -567.006 where: short stacking energy: -252.460 Base-Backbone interact. energy: -1.564 local terms energy: -305.436563 where: bonds (distance) C4'-P energy: -81.847 bonds (distance) P-C4' energy: -79.212 flat angles C4'-P-C4' energy: -57.190 flat angles P-C4'-P energy: -35.753 tors. eta vs tors. theta energy: -51.435 Dist. restrs. and SS energy: 47.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -812.038704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.038704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.122381 (E_RNA) where: Base-Base interactions energy: -582.071 where: short stacking energy: -238.267 Base-Backbone interact. energy: -1.819 local terms energy: -313.232753 where: bonds (distance) C4'-P energy: -60.002 bonds (distance) P-C4' energy: -73.807 flat angles C4'-P-C4' energy: -78.279 flat angles P-C4'-P energy: -46.183 tors. eta vs tors. theta energy: -54.962 Dist. restrs. and SS energy: 48.334 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1129.355488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.355488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.459639 (E_RNA) where: Base-Base interactions energy: -786.230 where: short stacking energy: -348.679 Base-Backbone interact. energy: -3.708 local terms energy: -425.521660 where: bonds (distance) C4'-P energy: -87.818 bonds (distance) P-C4' energy: -90.185 flat angles C4'-P-C4' energy: -100.426 flat angles P-C4'-P energy: -58.988 tors. eta vs tors. theta energy: -88.104 Dist. restrs. and SS energy: 49.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1244.623799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.623799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.297907 (E_RNA) where: Base-Base interactions energy: -926.094 where: short stacking energy: -369.587 Base-Backbone interact. energy: -1.506 local terms energy: -385.697836 where: bonds (distance) C4'-P energy: -79.202 bonds (distance) P-C4' energy: -96.117 flat angles C4'-P-C4' energy: -84.255 flat angles P-C4'-P energy: -53.278 tors. eta vs tors. theta energy: -72.846 Dist. restrs. and SS energy: 31.924 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1085.898049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.898049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.290618 (E_RNA) where: Base-Base interactions energy: -802.171 where: short stacking energy: -307.823 Base-Backbone interact. energy: -0.534 local terms energy: -351.585368 where: bonds (distance) C4'-P energy: -95.110 bonds (distance) P-C4' energy: -82.809 flat angles C4'-P-C4' energy: -72.719 flat angles P-C4'-P energy: -33.219 tors. eta vs tors. theta energy: -67.729 Dist. restrs. and SS energy: 31.643 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1267.613586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.613586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.267954 (E_RNA) where: Base-Base interactions energy: -918.549 where: short stacking energy: -370.349 Base-Backbone interact. energy: -1.073 local terms energy: -409.645336 where: bonds (distance) C4'-P energy: -85.424 bonds (distance) P-C4' energy: -85.051 flat angles C4'-P-C4' energy: -84.280 flat angles P-C4'-P energy: -61.472 tors. eta vs tors. theta energy: -93.418 Dist. restrs. and SS energy: 24.904 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1083.635692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.635692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.357267 (E_RNA) where: Base-Base interactions energy: -772.514 where: short stacking energy: -304.507 Base-Backbone interact. energy: -2.664 local terms energy: -380.179430 where: bonds (distance) C4'-P energy: -71.586 bonds (distance) P-C4' energy: -88.324 flat angles C4'-P-C4' energy: -96.097 flat angles P-C4'-P energy: -60.416 tors. eta vs tors. theta energy: -63.757 Dist. restrs. and SS energy: 34.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1107.821370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.821370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.974861 (E_RNA) where: Base-Base interactions energy: -802.661 where: short stacking energy: -328.185 Base-Backbone interact. energy: 0.747 local terms energy: -369.060462 where: bonds (distance) C4'-P energy: -91.292 bonds (distance) P-C4' energy: -70.932 flat angles C4'-P-C4' energy: -70.089 flat angles P-C4'-P energy: -50.974 tors. eta vs tors. theta energy: -85.773 Dist. restrs. and SS energy: 26.403 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -994.966860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.966860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.779293 (E_RNA) where: Base-Base interactions energy: -734.511 where: short stacking energy: -317.206 Base-Backbone interact. energy: -2.520 local terms energy: -324.748238 where: bonds (distance) C4'-P energy: -67.528 bonds (distance) P-C4' energy: -69.939 flat angles C4'-P-C4' energy: -72.363 flat angles P-C4'-P energy: -51.615 tors. eta vs tors. theta energy: -63.304 Dist. restrs. and SS energy: 30.062 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -1049.539160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.539160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.035257 (E_RNA) where: Base-Base interactions energy: -754.246 where: short stacking energy: -298.085 Base-Backbone interact. energy: -0.511 local terms energy: -346.278181 where: bonds (distance) C4'-P energy: -76.638 bonds (distance) P-C4' energy: -70.703 flat angles C4'-P-C4' energy: -82.796 flat angles P-C4'-P energy: -50.552 tors. eta vs tors. theta energy: -65.589 Dist. restrs. and SS energy: 14.746 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -1006.829431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.829431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.531671 (E_RNA) where: Base-Base interactions energy: -717.924 where: short stacking energy: -310.214 Base-Backbone interact. energy: 4.531 local terms energy: -359.138530 where: bonds (distance) C4'-P energy: -72.678 bonds (distance) P-C4' energy: -69.145 flat angles C4'-P-C4' energy: -82.473 flat angles P-C4'-P energy: -54.170 tors. eta vs tors. theta energy: -80.672 Dist. restrs. and SS energy: 28.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -1045.009204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.009204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.410720 (E_RNA) where: Base-Base interactions energy: -790.563 where: short stacking energy: -316.334 Base-Backbone interact. energy: 2.538 local terms energy: -317.385466 where: bonds (distance) C4'-P energy: -68.369 bonds (distance) P-C4' energy: -73.964 flat angles C4'-P-C4' energy: -79.185 flat angles P-C4'-P energy: -25.419 tors. eta vs tors. theta energy: -70.448 Dist. restrs. and SS energy: 23.652 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1347.051083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.051083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.271850 (E_RNA) where: Base-Base interactions energy: -986.947 where: short stacking energy: -387.352 Base-Backbone interact. energy: -0.507 local terms energy: -413.816937 where: bonds (distance) C4'-P energy: -83.226 bonds (distance) P-C4' energy: -88.371 flat angles C4'-P-C4' energy: -94.322 flat angles P-C4'-P energy: -53.740 tors. eta vs tors. theta energy: -94.158 Dist. restrs. and SS energy: 17.471 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1209.523942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.523942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.465513 (E_RNA) where: Base-Base interactions energy: -843.849 where: short stacking energy: -377.675 Base-Backbone interact. energy: -1.548 local terms energy: -436.068369 where: bonds (distance) C4'-P energy: -88.227 bonds (distance) P-C4' energy: -89.560 flat angles C4'-P-C4' energy: -102.532 flat angles P-C4'-P energy: -55.216 tors. eta vs tors. theta energy: -100.534 Dist. restrs. and SS energy: 35.192 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1370.553453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.553453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.581177 (E_RNA) where: Base-Base interactions energy: -973.328 where: short stacking energy: -388.387 Base-Backbone interact. energy: -2.116 local terms energy: -452.137318 where: bonds (distance) C4'-P energy: -80.434 bonds (distance) P-C4' energy: -92.977 flat angles C4'-P-C4' energy: -100.482 flat angles P-C4'-P energy: -69.382 tors. eta vs tors. theta energy: -108.862 Dist. restrs. and SS energy: 20.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1103.824086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.824086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.472670 (E_RNA) where: Base-Base interactions energy: -792.721 where: short stacking energy: -320.390 Base-Backbone interact. energy: -2.250 local terms energy: -378.501781 where: bonds (distance) C4'-P energy: -77.136 bonds (distance) P-C4' energy: -98.065 flat angles C4'-P-C4' energy: -89.233 flat angles P-C4'-P energy: -46.747 tors. eta vs tors. theta energy: -67.321 Dist. restrs. and SS energy: 32.899 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1243.871903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.871903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.961408 (E_RNA) where: Base-Base interactions energy: -891.049 where: short stacking energy: -387.307 Base-Backbone interact. energy: -2.163 local terms energy: -407.749222 where: bonds (distance) C4'-P energy: -90.988 bonds (distance) P-C4' energy: -78.893 flat angles C4'-P-C4' energy: -90.801 flat angles P-C4'-P energy: -41.631 tors. eta vs tors. theta energy: -105.435 Dist. restrs. and SS energy: 20.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1192.948983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.948983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.758237 (E_RNA) where: Base-Base interactions energy: -844.279 where: short stacking energy: -361.757 Base-Backbone interact. energy: -2.808 local terms energy: -408.671753 where: bonds (distance) C4'-P energy: -76.742 bonds (distance) P-C4' energy: -93.264 flat angles C4'-P-C4' energy: -102.612 flat angles P-C4'-P energy: -55.839 tors. eta vs tors. theta energy: -80.215 Dist. restrs. and SS energy: 26.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -1196.755467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.755467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.097839 (E_RNA) where: Base-Base interactions energy: -851.560 where: short stacking energy: -357.080 Base-Backbone interact. energy: 4.942 local terms energy: -407.479724 where: bonds (distance) C4'-P energy: -85.170 bonds (distance) P-C4' energy: -84.816 flat angles C4'-P-C4' energy: -90.421 flat angles P-C4'-P energy: -53.261 tors. eta vs tors. theta energy: -93.811 Dist. restrs. and SS energy: 20.592 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -1041.869784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.869784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.500359 (E_RNA) where: Base-Base interactions energy: -745.862 where: short stacking energy: -296.047 Base-Backbone interact. energy: -1.593 local terms energy: -357.045374 where: bonds (distance) C4'-P energy: -84.750 bonds (distance) P-C4' energy: -78.296 flat angles C4'-P-C4' energy: -69.616 flat angles P-C4'-P energy: -51.551 tors. eta vs tors. theta energy: -72.832 Dist. restrs. and SS energy: 25.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -1102.524962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.524962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.439875 (E_RNA) where: Base-Base interactions energy: -812.353 where: short stacking energy: -314.659 Base-Backbone interact. energy: 0.414 local terms energy: -337.500527 where: bonds (distance) C4'-P energy: -74.712 bonds (distance) P-C4' energy: -76.400 flat angles C4'-P-C4' energy: -72.822 flat angles P-C4'-P energy: -47.469 tors. eta vs tors. theta energy: -66.097 Dist. restrs. and SS energy: 10.165 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -1049.221142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.221142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.914992 (E_RNA) where: Base-Base interactions energy: -769.507 where: short stacking energy: -284.380 Base-Backbone interact. energy: -0.758 local terms energy: -329.650195 where: bonds (distance) C4'-P energy: -80.535 bonds (distance) P-C4' energy: -73.052 flat angles C4'-P-C4' energy: -55.281 flat angles P-C4'-P energy: -53.113 tors. eta vs tors. theta energy: -67.670 Dist. restrs. and SS energy: 13.944 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1357.656277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.656277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.157143 (E_RNA) where: Base-Base interactions energy: -984.693 where: short stacking energy: -387.273 Base-Backbone interact. energy: -0.002 local terms energy: -425.462174 where: bonds (distance) C4'-P energy: -87.839 bonds (distance) P-C4' energy: -94.610 flat angles C4'-P-C4' energy: -93.162 flat angles P-C4'-P energy: -61.353 tors. eta vs tors. theta energy: -88.498 Dist. restrs. and SS energy: 15.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1451.638909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.638909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.840530 (E_RNA) where: Base-Base interactions energy: -1056.744 where: short stacking energy: -442.516 Base-Backbone interact. energy: -0.920 local terms energy: -450.176303 where: bonds (distance) C4'-P energy: -89.850 bonds (distance) P-C4' energy: -100.405 flat angles C4'-P-C4' energy: -100.433 flat angles P-C4'-P energy: -55.443 tors. eta vs tors. theta energy: -104.044 Dist. restrs. and SS energy: 19.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1273.285412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.285412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.902101 (E_RNA) where: Base-Base interactions energy: -939.203 where: short stacking energy: -379.302 Base-Backbone interact. energy: 0.639 local terms energy: -397.338434 where: bonds (distance) C4'-P energy: -76.695 bonds (distance) P-C4' energy: -81.457 flat angles C4'-P-C4' energy: -94.513 flat angles P-C4'-P energy: -52.637 tors. eta vs tors. theta energy: -92.036 Dist. restrs. and SS energy: 25.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1371.476655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.476655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.961701 (E_RNA) where: Base-Base interactions energy: -986.258 where: short stacking energy: -418.472 Base-Backbone interact. energy: -2.538 local terms energy: -433.165234 where: bonds (distance) C4'-P energy: -86.976 bonds (distance) P-C4' energy: -81.603 flat angles C4'-P-C4' energy: -88.527 flat angles P-C4'-P energy: -65.088 tors. eta vs tors. theta energy: -110.971 Dist. restrs. and SS energy: 13.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1115.609361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.609361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.244300 (E_RNA) where: Base-Base interactions energy: -809.004 where: short stacking energy: -329.841 Base-Backbone interact. energy: -2.195 local terms energy: -374.045558 where: bonds (distance) C4'-P energy: -82.698 bonds (distance) P-C4' energy: -90.429 flat angles C4'-P-C4' energy: -73.558 flat angles P-C4'-P energy: -59.441 tors. eta vs tors. theta energy: -67.919 Dist. restrs. and SS energy: 32.885 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1256.154243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.154243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.907892 (E_RNA) where: Base-Base interactions energy: -926.551 where: short stacking energy: -378.542 Base-Backbone interact. energy: -1.341 local terms energy: -378.016357 where: bonds (distance) C4'-P energy: -69.469 bonds (distance) P-C4' energy: -69.877 flat angles C4'-P-C4' energy: -88.434 flat angles P-C4'-P energy: -55.657 tors. eta vs tors. theta energy: -94.580 Dist. restrs. and SS energy: 13.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -1217.173064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.173064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.988643 (E_RNA) where: Base-Base interactions energy: -883.734 where: short stacking energy: -385.585 Base-Backbone interact. energy: 0.876 local terms energy: -387.130361 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -83.038 flat angles C4'-P-C4' energy: -71.770 flat angles P-C4'-P energy: -51.467 tors. eta vs tors. theta energy: -101.773 Dist. restrs. and SS energy: 16.066 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -1228.766927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.766927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.633926 (E_RNA) where: Base-Base interactions energy: -903.393 where: short stacking energy: -360.932 Base-Backbone interact. energy: -0.786 local terms energy: -376.455077 where: bonds (distance) C4'-P energy: -72.258 bonds (distance) P-C4' energy: -70.885 flat angles C4'-P-C4' energy: -71.662 flat angles P-C4'-P energy: -63.757 tors. eta vs tors. theta energy: -97.894 Dist. restrs. and SS energy: 15.117 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -1082.194123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.194123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.138895 (E_RNA) where: Base-Base interactions energy: -796.072 where: short stacking energy: -321.149 Base-Backbone interact. energy: 4.698 local terms energy: -344.764713 where: bonds (distance) C4'-P energy: -65.221 bonds (distance) P-C4' energy: -85.861 flat angles C4'-P-C4' energy: -74.504 flat angles P-C4'-P energy: -46.596 tors. eta vs tors. theta energy: -72.582 Dist. restrs. and SS energy: 17.195 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -1179.464242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.464242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.918239 (E_RNA) where: Base-Base interactions energy: -864.221 where: short stacking energy: -358.594 Base-Backbone interact. energy: 0.310 local terms energy: -362.006675 where: bonds (distance) C4'-P energy: -52.888 bonds (distance) P-C4' energy: -82.685 flat angles C4'-P-C4' energy: -89.399 flat angles P-C4'-P energy: -49.941 tors. eta vs tors. theta energy: -87.094 Dist. restrs. and SS energy: 9.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1505.527453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.527453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.729259 (E_RNA) where: Base-Base interactions energy: -1088.661 where: short stacking energy: -456.628 Base-Backbone interact. energy: -2.082 local terms energy: -468.986101 where: bonds (distance) C4'-P energy: -88.112 bonds (distance) P-C4' energy: -94.814 flat angles C4'-P-C4' energy: -100.469 flat angles P-C4'-P energy: -66.625 tors. eta vs tors. theta energy: -118.966 Dist. restrs. and SS energy: 17.452 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1334.248255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.248255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.000669 (E_RNA) where: Base-Base interactions energy: -970.658 where: short stacking energy: -400.077 Base-Backbone interact. energy: -0.577 local terms energy: -420.765116 where: bonds (distance) C4'-P energy: -81.507 bonds (distance) P-C4' energy: -92.728 flat angles C4'-P-C4' energy: -99.258 flat angles P-C4'-P energy: -49.297 tors. eta vs tors. theta energy: -97.975 Dist. restrs. and SS energy: 21.002 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1424.869628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.869628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.064842 (E_RNA) where: Base-Base interactions energy: -1008.538 where: short stacking energy: -399.820 Base-Backbone interact. energy: -2.810 local terms energy: -466.717130 where: bonds (distance) C4'-P energy: -96.589 bonds (distance) P-C4' energy: -99.161 flat angles C4'-P-C4' energy: -97.882 flat angles P-C4'-P energy: -64.686 tors. eta vs tors. theta energy: -108.399 Dist. restrs. and SS energy: 16.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1342.340279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.340279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.861030 (E_RNA) where: Base-Base interactions energy: -979.104 where: short stacking energy: -423.868 Base-Backbone interact. energy: -2.489 local terms energy: -417.268018 where: bonds (distance) C4'-P energy: -81.163 bonds (distance) P-C4' energy: -83.883 flat angles C4'-P-C4' energy: -93.812 flat angles P-C4'-P energy: -59.318 tors. eta vs tors. theta energy: -99.091 Dist. restrs. and SS energy: 19.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1262.487594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.487594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.973337 (E_RNA) where: Base-Base interactions energy: -913.512 where: short stacking energy: -365.296 Base-Backbone interact. energy: -1.623 local terms energy: -400.837868 where: bonds (distance) C4'-P energy: -82.118 bonds (distance) P-C4' energy: -88.350 flat angles C4'-P-C4' energy: -90.173 flat angles P-C4'-P energy: -57.260 tors. eta vs tors. theta energy: -82.936 Dist. restrs. and SS energy: 16.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1125.843648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.843648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.674795 (E_RNA) where: Base-Base interactions energy: -835.620 where: short stacking energy: -343.761 Base-Backbone interact. energy: -2.096 local terms energy: -338.958552 where: bonds (distance) C4'-P energy: -56.587 bonds (distance) P-C4' energy: -84.064 flat angles C4'-P-C4' energy: -65.287 flat angles P-C4'-P energy: -55.068 tors. eta vs tors. theta energy: -77.953 Dist. restrs. and SS energy: 14.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1334.628822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.628822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.809022 (E_RNA) where: Base-Base interactions energy: -965.949 where: short stacking energy: -401.222 Base-Backbone interact. energy: -1.089 local terms energy: -412.770956 where: bonds (distance) C4'-P energy: -72.822 bonds (distance) P-C4' energy: -80.153 flat angles C4'-P-C4' energy: -91.962 flat angles P-C4'-P energy: -55.707 tors. eta vs tors. theta energy: -112.127 Dist. restrs. and SS energy: 8.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -1230.244722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.244722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.947286 (E_RNA) where: Base-Base interactions energy: -899.073 where: short stacking energy: -356.634 Base-Backbone interact. energy: -1.095 local terms energy: -378.779408 where: bonds (distance) C4'-P energy: -85.398 bonds (distance) P-C4' energy: -63.275 flat angles C4'-P-C4' energy: -83.243 flat angles P-C4'-P energy: -54.304 tors. eta vs tors. theta energy: -92.560 Dist. restrs. and SS energy: 11.953 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -1214.444823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.444823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.401888 (E_RNA) where: Base-Base interactions energy: -895.931 where: short stacking energy: -354.572 Base-Backbone interact. energy: -1.266 local terms energy: -361.205556 where: bonds (distance) C4'-P energy: -75.738 bonds (distance) P-C4' energy: -71.364 flat angles C4'-P-C4' energy: -69.654 flat angles P-C4'-P energy: -56.621 tors. eta vs tors. theta energy: -87.828 Dist. restrs. and SS energy: 7.207 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -1081.115892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.115892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.438304 (E_RNA) where: Base-Base interactions energy: -827.203 where: short stacking energy: -321.599 Base-Backbone interact. energy: 1.528 local terms energy: -300.763763 where: bonds (distance) C4'-P energy: -81.081 bonds (distance) P-C4' energy: -60.705 flat angles C4'-P-C4' energy: -62.052 flat angles P-C4'-P energy: -25.254 tors. eta vs tors. theta energy: -71.671 Dist. restrs. and SS energy: 8.572 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1537.666990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.666990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.606365 (E_RNA) where: Base-Base interactions energy: -1113.049 where: short stacking energy: -447.734 Base-Backbone interact. energy: -3.023 local terms energy: -474.534038 where: bonds (distance) C4'-P energy: -90.843 bonds (distance) P-C4' energy: -99.533 flat angles C4'-P-C4' energy: -94.591 flat angles P-C4'-P energy: -64.112 tors. eta vs tors. theta energy: -125.455 Dist. restrs. and SS energy: 16.189 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1462.532908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.532908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.755528 (E_RNA) where: Base-Base interactions energy: -1059.682 where: short stacking energy: -439.710 Base-Backbone interact. energy: -0.623 local terms energy: -458.450196 where: bonds (distance) C4'-P energy: -92.916 bonds (distance) P-C4' energy: -80.357 flat angles C4'-P-C4' energy: -98.795 flat angles P-C4'-P energy: -70.823 tors. eta vs tors. theta energy: -115.559 Dist. restrs. and SS energy: 19.473 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1315.978057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.978057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.763391 (E_RNA) where: Base-Base interactions energy: -970.080 where: short stacking energy: -393.956 Base-Backbone interact. energy: -3.035 local terms energy: -403.648609 where: bonds (distance) C4'-P energy: -80.754 bonds (distance) P-C4' energy: -83.484 flat angles C4'-P-C4' energy: -90.051 flat angles P-C4'-P energy: -54.622 tors. eta vs tors. theta energy: -94.738 Dist. restrs. and SS energy: 24.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1406.727937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.727937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.138638 (E_RNA) where: Base-Base interactions energy: -1022.228 where: short stacking energy: -431.808 Base-Backbone interact. energy: -2.453 local terms energy: -433.458070 where: bonds (distance) C4'-P energy: -83.673 bonds (distance) P-C4' energy: -87.109 flat angles C4'-P-C4' energy: -98.677 flat angles P-C4'-P energy: -59.069 tors. eta vs tors. theta energy: -104.930 Dist. restrs. and SS energy: 14.661 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1380.924900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.924900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.420948 (E_RNA) where: Base-Base interactions energy: -976.321 where: short stacking energy: -409.582 Base-Backbone interact. energy: -2.249 local terms energy: -452.851359 where: bonds (distance) C4'-P energy: -82.066 bonds (distance) P-C4' energy: -91.179 flat angles C4'-P-C4' energy: -95.709 flat angles P-C4'-P energy: -64.797 tors. eta vs tors. theta energy: -119.100 Dist. restrs. and SS energy: 13.746 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1384.287461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.287461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.412122 (E_RNA) where: Base-Base interactions energy: -1000.248 where: short stacking energy: -418.933 Base-Backbone interact. energy: -1.708 local terms energy: -424.456242 where: bonds (distance) C4'-P energy: -78.113 bonds (distance) P-C4' energy: -82.018 flat angles C4'-P-C4' energy: -84.131 flat angles P-C4'-P energy: -61.451 tors. eta vs tors. theta energy: -118.744 Dist. restrs. and SS energy: 5.375 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1180.029782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.029782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.802402 (E_RNA) where: Base-Base interactions energy: -859.202 where: short stacking energy: -346.844 Base-Backbone interact. energy: 2.954 local terms energy: -374.553675 where: bonds (distance) C4'-P energy: -77.640 bonds (distance) P-C4' energy: -81.480 flat angles C4'-P-C4' energy: -79.477 flat angles P-C4'-P energy: -49.770 tors. eta vs tors. theta energy: -86.187 Dist. restrs. and SS energy: 14.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -1273.216793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.216793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.803020 (E_RNA) where: Base-Base interactions energy: -938.442 where: short stacking energy: -380.055 Base-Backbone interact. energy: 2.374 local terms energy: -380.735445 where: bonds (distance) C4'-P energy: -75.954 bonds (distance) P-C4' energy: -59.629 flat angles C4'-P-C4' energy: -91.653 flat angles P-C4'-P energy: -58.999 tors. eta vs tors. theta energy: -94.500 Dist. restrs. and SS energy: 6.836 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -1233.881369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.881369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.741847 (E_RNA) where: Base-Base interactions energy: -898.921 where: short stacking energy: -355.052 Base-Backbone interact. energy: -1.585 local terms energy: -375.235632 where: bonds (distance) C4'-P energy: -59.957 bonds (distance) P-C4' energy: -68.762 flat angles C4'-P-C4' energy: -102.451 flat angles P-C4'-P energy: -53.715 tors. eta vs tors. theta energy: -90.351 Dist. restrs. and SS energy: 5.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -1086.912746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.912746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.464906 (E_RNA) where: Base-Base interactions energy: -782.511 where: short stacking energy: -325.627 Base-Backbone interact. energy: 0.369 local terms energy: -350.322752 where: bonds (distance) C4'-P energy: -53.594 bonds (distance) P-C4' energy: -85.278 flat angles C4'-P-C4' energy: -89.837 flat angles P-C4'-P energy: -30.553 tors. eta vs tors. theta energy: -91.060 Dist. restrs. and SS energy: 8.802 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1507.996927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.996927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.808394 (E_RNA) where: Base-Base interactions energy: -1087.516 where: short stacking energy: -462.586 Base-Backbone interact. energy: 0.896 local terms energy: -475.188154 where: bonds (distance) C4'-P energy: -97.974 bonds (distance) P-C4' energy: -83.069 flat angles C4'-P-C4' energy: -100.789 flat angles P-C4'-P energy: -62.456 tors. eta vs tors. theta energy: -130.901 Dist. restrs. and SS energy: 17.061 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1489.594345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.594345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.976261 (E_RNA) where: Base-Base interactions energy: -1068.107 where: short stacking energy: -439.790 Base-Backbone interact. energy: -1.060 local terms energy: -478.809262 where: bonds (distance) C4'-P energy: -103.420 bonds (distance) P-C4' energy: -92.352 flat angles C4'-P-C4' energy: -88.851 flat angles P-C4'-P energy: -77.718 tors. eta vs tors. theta energy: -116.468 Dist. restrs. and SS energy: 21.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1489.160694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.160694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.503951 (E_RNA) where: Base-Base interactions energy: -1082.818 where: short stacking energy: -444.189 Base-Backbone interact. energy: 0.527 local terms energy: -447.213314 where: bonds (distance) C4'-P energy: -84.505 bonds (distance) P-C4' energy: -92.884 flat angles C4'-P-C4' energy: -96.105 flat angles P-C4'-P energy: -57.291 tors. eta vs tors. theta energy: -116.427 Dist. restrs. and SS energy: 3.593 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1300.553942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.553942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.577940 (E_RNA) where: Base-Base interactions energy: -973.700 where: short stacking energy: -401.827 Base-Backbone interact. energy: -2.003 local terms energy: -387.875062 where: bonds (distance) C4'-P energy: -71.263 bonds (distance) P-C4' energy: -78.572 flat angles C4'-P-C4' energy: -90.172 flat angles P-C4'-P energy: -54.270 tors. eta vs tors. theta energy: -93.598 Dist. restrs. and SS energy: 26.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1469.117466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.117466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.658270 (E_RNA) where: Base-Base interactions energy: -1060.879 where: short stacking energy: -441.779 Base-Backbone interact. energy: -0.951 local terms energy: -446.827855 where: bonds (distance) C4'-P energy: -83.950 bonds (distance) P-C4' energy: -79.029 flat angles C4'-P-C4' energy: -86.320 flat angles P-C4'-P energy: -70.778 tors. eta vs tors. theta energy: -126.751 Dist. restrs. and SS energy: 2.791 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1366.181519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1366.181519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.368733 (E_RNA) where: Base-Base interactions energy: -983.760 where: short stacking energy: -411.774 Base-Backbone interact. energy: 1.492 local terms energy: -430.100599 where: bonds (distance) C4'-P energy: -79.870 bonds (distance) P-C4' energy: -83.560 flat angles C4'-P-C4' energy: -92.379 flat angles P-C4'-P energy: -64.594 tors. eta vs tors. theta energy: -109.697 Dist. restrs. and SS energy: 9.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1257.869144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.869144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.673356 (E_RNA) where: Base-Base interactions energy: -905.470 where: short stacking energy: -378.349 Base-Backbone interact. energy: -1.061 local terms energy: -400.142848 where: bonds (distance) C4'-P energy: -80.863 bonds (distance) P-C4' energy: -83.085 flat angles C4'-P-C4' energy: -92.249 flat angles P-C4'-P energy: -52.306 tors. eta vs tors. theta energy: -91.640 Dist. restrs. and SS energy: 12.054 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -1251.521802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.521802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.258503 (E_RNA) where: Base-Base interactions energy: -925.767 where: short stacking energy: -375.598 Base-Backbone interact. energy: -0.036 local terms energy: -375.455652 where: bonds (distance) C4'-P energy: -92.923 bonds (distance) P-C4' energy: -63.224 flat angles C4'-P-C4' energy: -78.186 flat angles P-C4'-P energy: -37.610 tors. eta vs tors. theta energy: -103.513 Dist. restrs. and SS energy: 12.987 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -1305.619332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.619332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.246665 (E_RNA) where: Base-Base interactions energy: -933.830 where: short stacking energy: -374.196 Base-Backbone interact. energy: 0.230 local terms energy: -411.646862 where: bonds (distance) C4'-P energy: -89.178 bonds (distance) P-C4' energy: -83.655 flat angles C4'-P-C4' energy: -77.387 flat angles P-C4'-P energy: -60.052 tors. eta vs tors. theta energy: -101.375 Dist. restrs. and SS energy: 2.877 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -1091.135097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.135097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.605616 (E_RNA) where: Base-Base interactions energy: -813.674 where: short stacking energy: -327.688 Base-Backbone interact. energy: -0.782 local terms energy: -339.149282 where: bonds (distance) C4'-P energy: -67.163 bonds (distance) P-C4' energy: -68.249 flat angles C4'-P-C4' energy: -75.245 flat angles P-C4'-P energy: -51.040 tors. eta vs tors. theta energy: -77.452 Dist. restrs. and SS energy: 25.721 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1540.497711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.497711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.167604 (E_RNA) where: Base-Base interactions energy: -1123.976 where: short stacking energy: -444.091 Base-Backbone interact. energy: -2.596 local terms energy: -462.595136 where: bonds (distance) C4'-P energy: -87.596 bonds (distance) P-C4' energy: -92.566 flat angles C4'-P-C4' energy: -97.932 flat angles P-C4'-P energy: -65.042 tors. eta vs tors. theta energy: -119.459 Dist. restrs. and SS energy: 11.920 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1543.370006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.370006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.895065 (E_RNA) where: Base-Base interactions energy: -1112.104 where: short stacking energy: -478.406 Base-Backbone interact. energy: -1.203 local terms energy: -467.588698 where: bonds (distance) C4'-P energy: -85.843 bonds (distance) P-C4' energy: -97.678 flat angles C4'-P-C4' energy: -101.030 flat angles P-C4'-P energy: -67.596 tors. eta vs tors. theta energy: -115.442 Dist. restrs. and SS energy: 0.775 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1485.658732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.658732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.220139 (E_RNA) where: Base-Base interactions energy: -1078.608 where: short stacking energy: -460.407 Base-Backbone interact. energy: -0.746 local terms energy: -456.866721 where: bonds (distance) C4'-P energy: -78.541 bonds (distance) P-C4' energy: -83.773 flat angles C4'-P-C4' energy: -99.562 flat angles P-C4'-P energy: -67.655 tors. eta vs tors. theta energy: -127.336 Dist. restrs. and SS energy: 13.811 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1532.755421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.755421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.626060 (E_RNA) where: Base-Base interactions energy: -1106.579 where: short stacking energy: -470.850 Base-Backbone interact. energy: -0.843 local terms energy: -463.204380 where: bonds (distance) C4'-P energy: -92.460 bonds (distance) P-C4' energy: -88.679 flat angles C4'-P-C4' energy: -97.251 flat angles P-C4'-P energy: -54.978 tors. eta vs tors. theta energy: -129.837 Dist. restrs. and SS energy: 1.121 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1294.758493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.758493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.223049 (E_RNA) where: Base-Base interactions energy: -921.981 where: short stacking energy: -383.820 Base-Backbone interact. energy: 2.250 local terms energy: -432.492490 where: bonds (distance) C4'-P energy: -83.921 bonds (distance) P-C4' energy: -78.220 flat angles C4'-P-C4' energy: -95.602 flat angles P-C4'-P energy: -68.838 tors. eta vs tors. theta energy: -105.912 Dist. restrs. and SS energy: 20.715 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1352.766107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.766107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.606538 (E_RNA) where: Base-Base interactions energy: -970.913 where: short stacking energy: -396.450 Base-Backbone interact. energy: 1.929 local terms energy: -428.622403 where: bonds (distance) C4'-P energy: -74.329 bonds (distance) P-C4' energy: -88.681 flat angles C4'-P-C4' energy: -94.455 flat angles P-C4'-P energy: -61.813 tors. eta vs tors. theta energy: -109.345 Dist. restrs. and SS energy: 8.090 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1287.751048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.751048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.739036 (E_RNA) where: Base-Base interactions energy: -947.659 where: short stacking energy: -396.605 Base-Backbone interact. energy: -3.373 local terms energy: -383.707883 where: bonds (distance) C4'-P energy: -67.641 bonds (distance) P-C4' energy: -83.058 flat angles C4'-P-C4' energy: -96.099 flat angles P-C4'-P energy: -52.266 tors. eta vs tors. theta energy: -84.645 Dist. restrs. and SS energy: 10.238 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1327.611819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.611819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.690082 (E_RNA) where: Base-Base interactions energy: -977.717 where: short stacking energy: -380.507 Base-Backbone interact. energy: 4.476 local terms energy: -393.449579 where: bonds (distance) C4'-P energy: -79.628 bonds (distance) P-C4' energy: -85.442 flat angles C4'-P-C4' energy: -81.613 flat angles P-C4'-P energy: -42.010 tors. eta vs tors. theta energy: -104.756 Dist. restrs. and SS energy: 2.328 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -1295.221065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.221065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.885704 (E_RNA) where: Base-Base interactions energy: -972.155 where: short stacking energy: -388.524 Base-Backbone interact. energy: -0.504 local terms energy: -363.226497 where: bonds (distance) C4'-P energy: -84.582 bonds (distance) P-C4' energy: -67.711 flat angles C4'-P-C4' energy: -87.067 flat angles P-C4'-P energy: -32.531 tors. eta vs tors. theta energy: -91.336 Dist. restrs. and SS energy: 3.915 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -1127.709314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1127.709314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.069230 (E_RNA) where: Base-Base interactions energy: -824.093 where: short stacking energy: -312.546 Base-Backbone interact. energy: 3.147 local terms energy: -352.122327 where: bonds (distance) C4'-P energy: -75.323 bonds (distance) P-C4' energy: -78.905 flat angles C4'-P-C4' energy: -67.825 flat angles P-C4'-P energy: -56.030 tors. eta vs tors. theta energy: -74.038 Dist. restrs. and SS energy: 8.610 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1561.901317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.901317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.417017 (E_RNA) where: Base-Base interactions energy: -1147.100 where: short stacking energy: -463.486 Base-Backbone interact. energy: -0.370 local terms energy: -463.947259 where: bonds (distance) C4'-P energy: -84.026 bonds (distance) P-C4' energy: -91.948 flat angles C4'-P-C4' energy: -101.559 flat angles P-C4'-P energy: -68.398 tors. eta vs tors. theta energy: -118.016 Dist. restrs. and SS energy: 12.766 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1585.861564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.861564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.789689 (E_RNA) where: Base-Base interactions energy: -1157.272 where: short stacking energy: -478.379 Base-Backbone interact. energy: -0.155 local terms energy: -466.362820 where: bonds (distance) C4'-P energy: -86.402 bonds (distance) P-C4' energy: -97.874 flat angles C4'-P-C4' energy: -99.207 flat angles P-C4'-P energy: -66.542 tors. eta vs tors. theta energy: -116.338 Dist. restrs. and SS energy: 1.178 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1576.609761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.609761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.736430 (E_RNA) where: Base-Base interactions energy: -1141.448 where: short stacking energy: -473.588 Base-Backbone interact. energy: -1.395 local terms energy: -471.894082 where: bonds (distance) C4'-P energy: -82.750 bonds (distance) P-C4' energy: -77.239 flat angles C4'-P-C4' energy: -108.800 flat angles P-C4'-P energy: -66.867 tors. eta vs tors. theta energy: -136.237 Dist. restrs. and SS energy: 1.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1460.626311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.626311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.407563 (E_RNA) where: Base-Base interactions energy: -1060.474 where: short stacking energy: -443.151 Base-Backbone interact. energy: -2.974 local terms energy: -444.959328 where: bonds (distance) C4'-P energy: -83.421 bonds (distance) P-C4' energy: -90.813 flat angles C4'-P-C4' energy: -95.023 flat angles P-C4'-P energy: -62.309 tors. eta vs tors. theta energy: -113.393 Dist. restrs. and SS energy: 11.031 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1389.853247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.853247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.814927 (E_RNA) where: Base-Base interactions energy: -1008.818 where: short stacking energy: -419.166 Base-Backbone interact. energy: -1.733 local terms energy: -425.263988 where: bonds (distance) C4'-P energy: -82.677 bonds (distance) P-C4' energy: -79.320 flat angles C4'-P-C4' energy: -90.912 flat angles P-C4'-P energy: -54.953 tors. eta vs tors. theta energy: -117.402 Dist. restrs. and SS energy: 9.212 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1353.818515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.818515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.715369 (E_RNA) where: Base-Base interactions energy: -985.365 where: short stacking energy: -399.494 Base-Backbone interact. energy: -1.441 local terms energy: -416.909277 where: bonds (distance) C4'-P energy: -95.118 bonds (distance) P-C4' energy: -85.520 flat angles C4'-P-C4' energy: -89.811 flat angles P-C4'-P energy: -51.605 tors. eta vs tors. theta energy: -94.856 Dist. restrs. and SS energy: 13.147 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1392.546219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.546219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.084353 (E_RNA) where: Base-Base interactions energy: -1041.603 where: short stacking energy: -440.528 Base-Backbone interact. energy: 0.104 local terms energy: -392.586226 where: bonds (distance) C4'-P energy: -54.451 bonds (distance) P-C4' energy: -80.349 flat angles C4'-P-C4' energy: -88.195 flat angles P-C4'-P energy: -52.090 tors. eta vs tors. theta energy: -117.500 Dist. restrs. and SS energy: 4.788 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -1253.301351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.301351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.832012 (E_RNA) where: Base-Base interactions energy: -935.612 where: short stacking energy: -367.485 Base-Backbone interact. energy: -2.444 local terms energy: -360.776740 where: bonds (distance) C4'-P energy: -62.674 bonds (distance) P-C4' energy: -74.489 flat angles C4'-P-C4' energy: -84.803 flat angles P-C4'-P energy: -51.988 tors. eta vs tors. theta energy: -86.823 Dist. restrs. and SS energy: 8.781 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1312.846837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.846837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.896385 (E_RNA) where: Base-Base interactions energy: -1012.128 where: short stacking energy: -397.002 Base-Backbone interact. energy: -0.732 local terms energy: -342.036087 where: bonds (distance) C4'-P energy: -61.441 bonds (distance) P-C4' energy: -75.740 flat angles C4'-P-C4' energy: -73.289 flat angles P-C4'-P energy: -33.639 tors. eta vs tors. theta energy: -97.927 Dist. restrs. and SS energy: 5.300 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -1173.412895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.412895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.303923 (E_RNA) where: Base-Base interactions energy: -882.633 where: short stacking energy: -349.146 Base-Backbone interact. energy: -1.607 local terms energy: -334.063943 where: bonds (distance) C4'-P energy: -68.614 bonds (distance) P-C4' energy: -65.480 flat angles C4'-P-C4' energy: -61.988 flat angles P-C4'-P energy: -51.847 tors. eta vs tors. theta energy: -86.134 Dist. restrs. and SS energy: 8.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1583.060751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.060751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.051092 (E_RNA) where: Base-Base interactions energy: -1141.704 where: short stacking energy: -483.165 Base-Backbone interact. energy: -1.314 local terms energy: -489.032654 where: bonds (distance) C4'-P energy: -82.514 bonds (distance) P-C4' energy: -102.061 flat angles C4'-P-C4' energy: -106.963 flat angles P-C4'-P energy: -70.630 tors. eta vs tors. theta energy: -126.865 Dist. restrs. and SS energy: 12.240 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1607.774790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.774790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.714550 (E_RNA) where: Base-Base interactions energy: -1153.350 where: short stacking energy: -487.967 Base-Backbone interact. energy: 1.644 local terms energy: -495.009178 where: bonds (distance) C4'-P energy: -101.308 bonds (distance) P-C4' energy: -93.918 flat angles C4'-P-C4' energy: -98.447 flat angles P-C4'-P energy: -68.176 tors. eta vs tors. theta energy: -133.160 Dist. restrs. and SS energy: 2.190 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1557.370336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.370336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.029716 (E_RNA) where: Base-Base interactions energy: -1141.004 where: short stacking energy: -479.093 Base-Backbone interact. energy: -1.883 local terms energy: -452.143430 where: bonds (distance) C4'-P energy: -78.283 bonds (distance) P-C4' energy: -96.270 flat angles C4'-P-C4' energy: -92.896 flat angles P-C4'-P energy: -66.302 tors. eta vs tors. theta energy: -118.392 Dist. restrs. and SS energy: 0.909 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1453.882294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.882294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.546470 (E_RNA) where: Base-Base interactions energy: -1061.913 where: short stacking energy: -442.228 Base-Backbone interact. energy: -3.079 local terms energy: -443.554332 where: bonds (distance) C4'-P energy: -86.799 bonds (distance) P-C4' energy: -83.321 flat angles C4'-P-C4' energy: -102.258 flat angles P-C4'-P energy: -58.920 tors. eta vs tors. theta energy: -112.256 Dist. restrs. and SS energy: 17.914 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1400.533372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.533372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.789551 (E_RNA) where: Base-Base interactions energy: -1008.274 where: short stacking energy: -413.050 Base-Backbone interact. energy: -1.863 local terms energy: -436.652625 where: bonds (distance) C4'-P energy: -84.826 bonds (distance) P-C4' energy: -83.225 flat angles C4'-P-C4' energy: -98.228 flat angles P-C4'-P energy: -51.888 tors. eta vs tors. theta energy: -118.484 Dist. restrs. and SS energy: 9.506 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1444.744169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.744169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.300488 (E_RNA) where: Base-Base interactions energy: -1070.642 where: short stacking energy: -440.809 Base-Backbone interact. energy: -1.187 local terms energy: -418.470684 where: bonds (distance) C4'-P energy: -61.618 bonds (distance) P-C4' energy: -80.628 flat angles C4'-P-C4' energy: -101.051 flat angles P-C4'-P energy: -54.992 tors. eta vs tors. theta energy: -120.183 Dist. restrs. and SS energy: 8.806 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1344.233789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.233789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.183643 (E_RNA) where: Base-Base interactions energy: -1009.047 where: short stacking energy: -402.492 Base-Backbone interact. energy: -1.672 local terms energy: -381.464656 where: bonds (distance) C4'-P energy: -63.245 bonds (distance) P-C4' energy: -67.698 flat angles C4'-P-C4' energy: -85.142 flat angles P-C4'-P energy: -59.246 tors. eta vs tors. theta energy: -106.134 Dist. restrs. and SS energy: 11.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1356.708421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.708421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.209667 (E_RNA) where: Base-Base interactions energy: -1008.246 where: short stacking energy: -387.316 Base-Backbone interact. energy: -0.089 local terms energy: -392.874381 where: bonds (distance) C4'-P energy: -65.178 bonds (distance) P-C4' energy: -72.627 flat angles C4'-P-C4' energy: -97.604 flat angles P-C4'-P energy: -58.236 tors. eta vs tors. theta energy: -99.230 Dist. restrs. and SS energy: 7.751 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -1233.455294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.455294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.429449 (E_RNA) where: Base-Base interactions energy: -922.938 where: short stacking energy: -360.266 Base-Backbone interact. energy: -0.613 local terms energy: -362.877976 where: bonds (distance) C4'-P energy: -53.949 bonds (distance) P-C4' energy: -78.085 flat angles C4'-P-C4' energy: -81.470 flat angles P-C4'-P energy: -59.495 tors. eta vs tors. theta energy: -89.879 Dist. restrs. and SS energy: 16.224 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -1177.012807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.012807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.252827 (E_RNA) where: Base-Base interactions energy: -888.556 where: short stacking energy: -354.810 Base-Backbone interact. energy: -1.364 local terms energy: -333.333137 where: bonds (distance) C4'-P energy: -60.667 bonds (distance) P-C4' energy: -64.829 flat angles C4'-P-C4' energy: -68.931 flat angles P-C4'-P energy: -51.206 tors. eta vs tors. theta energy: -87.700 Dist. restrs. and SS energy: 9.490 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1633.913062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.913062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.403418 (E_RNA) where: Base-Base interactions energy: -1155.052 where: short stacking energy: -504.472 Base-Backbone interact. energy: -1.772 local terms energy: -514.579962 where: bonds (distance) C4'-P energy: -103.552 bonds (distance) P-C4' energy: -96.209 flat angles C4'-P-C4' energy: -101.868 flat angles P-C4'-P energy: -73.850 tors. eta vs tors. theta energy: -139.101 Dist. restrs. and SS energy: 0.740 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1537.541227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.541227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.700753 (E_RNA) where: Base-Base interactions energy: -1103.757 where: short stacking energy: -458.504 Base-Backbone interact. energy: -0.670 local terms energy: -485.274358 where: bonds (distance) C4'-P energy: -99.353 bonds (distance) P-C4' energy: -89.770 flat angles C4'-P-C4' energy: -98.233 flat angles P-C4'-P energy: -71.457 tors. eta vs tors. theta energy: -126.461 Dist. restrs. and SS energy: 15.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1533.396826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.396826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.970101 (E_RNA) where: Base-Base interactions energy: -1130.613 where: short stacking energy: -478.059 Base-Backbone interact. energy: -2.738 local terms energy: -438.619001 where: bonds (distance) C4'-P energy: -92.288 bonds (distance) P-C4' energy: -71.953 flat angles C4'-P-C4' energy: -84.042 flat angles P-C4'-P energy: -67.775 tors. eta vs tors. theta energy: -122.560 Dist. restrs. and SS energy: 1.823 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1471.659680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.659680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.787726 (E_RNA) where: Base-Base interactions energy: -1066.245 where: short stacking energy: -449.415 Base-Backbone interact. energy: 2.241 local terms energy: -463.783600 where: bonds (distance) C4'-P energy: -81.055 bonds (distance) P-C4' energy: -88.649 flat angles C4'-P-C4' energy: -107.668 flat angles P-C4'-P energy: -61.278 tors. eta vs tors. theta energy: -125.133 Dist. restrs. and SS energy: 19.378 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1382.261981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.261981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.188661 (E_RNA) where: Base-Base interactions energy: -1020.172 where: short stacking energy: -424.731 Base-Backbone interact. energy: 1.934 local terms energy: -413.950534 where: bonds (distance) C4'-P energy: -86.760 bonds (distance) P-C4' energy: -85.871 flat angles C4'-P-C4' energy: -85.370 flat angles P-C4'-P energy: -45.476 tors. eta vs tors. theta energy: -110.473 Dist. restrs. and SS energy: 13.177 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1435.094535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.094535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.805815 (E_RNA) where: Base-Base interactions energy: -1055.502 where: short stacking energy: -451.835 Base-Backbone interact. energy: -0.840 local terms energy: -418.464115 where: bonds (distance) C4'-P energy: -66.592 bonds (distance) P-C4' energy: -78.968 flat angles C4'-P-C4' energy: -90.567 flat angles P-C4'-P energy: -65.053 tors. eta vs tors. theta energy: -117.284 Dist. restrs. and SS energy: 2.961 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1400.393131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.393131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.770999 (E_RNA) where: Base-Base interactions energy: -1031.112 where: short stacking energy: -420.530 Base-Backbone interact. energy: 7.485 local terms energy: -420.144037 where: bonds (distance) C4'-P energy: -75.705 bonds (distance) P-C4' energy: -78.676 flat angles C4'-P-C4' energy: -81.642 flat angles P-C4'-P energy: -76.101 tors. eta vs tors. theta energy: -108.018 Dist. restrs. and SS energy: 6.628 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1275.689300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.689300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.173073 (E_RNA) where: Base-Base interactions energy: -921.271 where: short stacking energy: -379.282 Base-Backbone interact. energy: 1.337 local terms energy: -402.239119 where: bonds (distance) C4'-P energy: -80.236 bonds (distance) P-C4' energy: -83.386 flat angles C4'-P-C4' energy: -76.829 flat angles P-C4'-P energy: -64.277 tors. eta vs tors. theta energy: -97.511 Dist. restrs. and SS energy: 9.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1225.835266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.835266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.998512 (E_RNA) where: Base-Base interactions energy: -920.059 where: short stacking energy: -346.626 Base-Backbone interact. energy: 0.070 local terms energy: -358.009271 where: bonds (distance) C4'-P energy: -71.676 bonds (distance) P-C4' energy: -73.063 flat angles C4'-P-C4' energy: -77.478 flat angles P-C4'-P energy: -50.819 tors. eta vs tors. theta energy: -84.973 Dist. restrs. and SS energy: 15.413 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -1193.689486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.689486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.412464 (E_RNA) where: Base-Base interactions energy: -875.365 where: short stacking energy: -346.936 Base-Backbone interact. energy: 1.709 local terms energy: -365.756933 where: bonds (distance) C4'-P energy: -77.757 bonds (distance) P-C4' energy: -73.153 flat angles C4'-P-C4' energy: -82.616 flat angles P-C4'-P energy: -41.756 tors. eta vs tors. theta energy: -90.475 Dist. restrs. and SS energy: 8.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1624.442663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.442663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1663.251025 (E_RNA) where: Base-Base interactions energy: -1153.983 where: short stacking energy: -497.386 Base-Backbone interact. energy: -1.848 local terms energy: -507.419967 where: bonds (distance) C4'-P energy: -97.230 bonds (distance) P-C4' energy: -104.626 flat angles C4'-P-C4' energy: -103.389 flat angles P-C4'-P energy: -66.129 tors. eta vs tors. theta energy: -136.045 Dist. restrs. and SS energy: 2.058 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1578.733472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.733472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.089245 (E_RNA) where: Base-Base interactions energy: -1149.748 where: short stacking energy: -469.516 Base-Backbone interact. energy: -1.469 local terms energy: -465.872724 where: bonds (distance) C4'-P energy: -85.035 bonds (distance) P-C4' energy: -97.836 flat angles C4'-P-C4' energy: -93.045 flat angles P-C4'-P energy: -65.071 tors. eta vs tors. theta energy: -124.886 Dist. restrs. and SS energy: 1.606 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1520.562453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.562453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.683580 (E_RNA) where: Base-Base interactions energy: -1120.061 where: short stacking energy: -468.807 Base-Backbone interact. energy: -1.521 local terms energy: -443.100735 where: bonds (distance) C4'-P energy: -64.798 bonds (distance) P-C4' energy: -87.484 flat angles C4'-P-C4' energy: -100.095 flat angles P-C4'-P energy: -67.329 tors. eta vs tors. theta energy: -123.395 Dist. restrs. and SS energy: 7.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1484.197502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.197502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1530.337424 (E_RNA) where: Base-Base interactions energy: -1076.058 where: short stacking energy: -444.904 Base-Backbone interact. energy: -3.325 local terms energy: -450.955022 where: bonds (distance) C4'-P energy: -84.920 bonds (distance) P-C4' energy: -85.871 flat angles C4'-P-C4' energy: -92.115 flat angles P-C4'-P energy: -64.328 tors. eta vs tors. theta energy: -123.721 Dist. restrs. and SS energy: 9.390 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1376.718295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.718295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.963835 (E_RNA) where: Base-Base interactions energy: -1000.796 where: short stacking energy: -423.416 Base-Backbone interact. energy: -1.864 local terms energy: -417.304181 where: bonds (distance) C4'-P energy: -81.472 bonds (distance) P-C4' energy: -77.898 flat angles C4'-P-C4' energy: -97.273 flat angles P-C4'-P energy: -41.964 tors. eta vs tors. theta energy: -118.697 Dist. restrs. and SS energy: 6.496 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1404.340346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.340346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.358282 (E_RNA) where: Base-Base interactions energy: -1019.864 where: short stacking energy: -442.319 Base-Backbone interact. energy: -0.547 local terms energy: -423.947209 where: bonds (distance) C4'-P energy: -75.152 bonds (distance) P-C4' energy: -80.250 flat angles C4'-P-C4' energy: -92.653 flat angles P-C4'-P energy: -60.547 tors. eta vs tors. theta energy: -115.345 Dist. restrs. and SS energy: 3.268 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1401.941012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.941012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.988754 (E_RNA) where: Base-Base interactions energy: -1026.076 where: short stacking energy: -427.282 Base-Backbone interact. energy: 1.018 local terms energy: -416.931053 where: bonds (distance) C4'-P energy: -82.663 bonds (distance) P-C4' energy: -72.122 flat angles C4'-P-C4' energy: -86.297 flat angles P-C4'-P energy: -65.463 tors. eta vs tors. theta energy: -110.387 Dist. restrs. and SS energy: 3.298 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1279.258664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.258664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.252071 (E_RNA) where: Base-Base interactions energy: -927.572 where: short stacking energy: -377.301 Base-Backbone interact. energy: -0.978 local terms energy: -400.701229 where: bonds (distance) C4'-P energy: -68.793 bonds (distance) P-C4' energy: -80.307 flat angles C4'-P-C4' energy: -79.431 flat angles P-C4'-P energy: -65.833 tors. eta vs tors. theta energy: -106.337 Dist. restrs. and SS energy: 13.243 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -1287.028386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.028386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.760664 (E_RNA) where: Base-Base interactions energy: -955.626 where: short stacking energy: -396.144 Base-Backbone interact. energy: -1.885 local terms energy: -377.249414 where: bonds (distance) C4'-P energy: -65.426 bonds (distance) P-C4' energy: -66.309 flat angles C4'-P-C4' energy: -83.333 flat angles P-C4'-P energy: -55.976 tors. eta vs tors. theta energy: -106.204 Dist. restrs. and SS energy: 10.982 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -1206.503655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.503655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.574000 (E_RNA) where: Base-Base interactions energy: -881.259 where: short stacking energy: -340.323 Base-Backbone interact. energy: -3.363 local terms energy: -368.951387 where: bonds (distance) C4'-P energy: -72.685 bonds (distance) P-C4' energy: -78.127 flat angles C4'-P-C4' energy: -74.842 flat angles P-C4'-P energy: -53.672 tors. eta vs tors. theta energy: -89.626 Dist. restrs. and SS energy: 10.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1642.590592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.590592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.460082 (E_RNA) where: Base-Base interactions energy: -1181.161 where: short stacking energy: -503.917 Base-Backbone interact. energy: -1.713 local terms energy: -497.585728 where: bonds (distance) C4'-P energy: -95.499 bonds (distance) P-C4' energy: -93.282 flat angles C4'-P-C4' energy: -102.175 flat angles P-C4'-P energy: -64.862 tors. eta vs tors. theta energy: -141.768 Dist. restrs. and SS energy: 1.119 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1570.467158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.467158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.824661 (E_RNA) where: Base-Base interactions energy: -1125.129 where: short stacking energy: -455.361 Base-Backbone interact. energy: -1.966 local terms energy: -480.729676 where: bonds (distance) C4'-P energy: -97.730 bonds (distance) P-C4' energy: -89.573 flat angles C4'-P-C4' energy: -105.009 flat angles P-C4'-P energy: -63.791 tors. eta vs tors. theta energy: -124.627 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1538.869639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1538.869639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.646447 (E_RNA) where: Base-Base interactions energy: -1112.225 where: short stacking energy: -453.557 Base-Backbone interact. energy: -1.237 local terms energy: -469.184373 where: bonds (distance) C4'-P energy: -88.316 bonds (distance) P-C4' energy: -77.489 flat angles C4'-P-C4' energy: -105.678 flat angles P-C4'-P energy: -72.546 tors. eta vs tors. theta energy: -125.156 Dist. restrs. and SS energy: 7.027 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1480.820631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.820631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.844398 (E_RNA) where: Base-Base interactions energy: -1081.659 where: short stacking energy: -468.171 Base-Backbone interact. energy: -3.320 local terms energy: -443.865813 where: bonds (distance) C4'-P energy: -69.953 bonds (distance) P-C4' energy: -84.694 flat angles C4'-P-C4' energy: -95.243 flat angles P-C4'-P energy: -60.595 tors. eta vs tors. theta energy: -133.380 Dist. restrs. and SS energy: 11.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1455.858225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.858225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.049138 (E_RNA) where: Base-Base interactions energy: -1066.883 where: short stacking energy: -437.995 Base-Backbone interact. energy: 1.847 local terms energy: -431.012858 where: bonds (distance) C4'-P energy: -82.710 bonds (distance) P-C4' energy: -69.045 flat angles C4'-P-C4' energy: -93.708 flat angles P-C4'-P energy: -63.442 tors. eta vs tors. theta energy: -122.109 Dist. restrs. and SS energy: 3.441 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1407.346063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.346063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.774304 (E_RNA) where: Base-Base interactions energy: -1009.651 where: short stacking energy: -400.617 Base-Backbone interact. energy: -1.700 local terms energy: -436.423095 where: bonds (distance) C4'-P energy: -83.249 bonds (distance) P-C4' energy: -80.489 flat angles C4'-P-C4' energy: -92.708 flat angles P-C4'-P energy: -65.460 tors. eta vs tors. theta energy: -114.518 Dist. restrs. and SS energy: 3.678 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1406.382868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.382868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.634910 (E_RNA) where: Base-Base interactions energy: -1040.358 where: short stacking energy: -419.504 Base-Backbone interact. energy: 2.190 local terms energy: -412.467075 where: bonds (distance) C4'-P energy: -64.884 bonds (distance) P-C4' energy: -64.604 flat angles C4'-P-C4' energy: -100.062 flat angles P-C4'-P energy: -61.306 tors. eta vs tors. theta energy: -121.611 Dist. restrs. and SS energy: 7.502 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1245.819274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1245.819274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.710191 (E_RNA) where: Base-Base interactions energy: -903.287 where: short stacking energy: -359.131 Base-Backbone interact. energy: 1.223 local terms energy: -398.646251 where: bonds (distance) C4'-P energy: -85.237 bonds (distance) P-C4' energy: -64.556 flat angles C4'-P-C4' energy: -90.687 flat angles P-C4'-P energy: -61.134 tors. eta vs tors. theta energy: -97.033 Dist. restrs. and SS energy: 18.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1319.636306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.636306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.744182 (E_RNA) where: Base-Base interactions energy: -1001.108 where: short stacking energy: -414.432 Base-Backbone interact. energy: 3.748 local terms energy: -372.383977 where: bonds (distance) C4'-P energy: -82.112 bonds (distance) P-C4' energy: -52.281 flat angles C4'-P-C4' energy: -79.541 flat angles P-C4'-P energy: -48.051 tors. eta vs tors. theta energy: -110.399 Dist. restrs. and SS energy: 13.358 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -1268.536809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.536809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.205545 (E_RNA) where: Base-Base interactions energy: -949.009 where: short stacking energy: -382.614 Base-Backbone interact. energy: -2.410 local terms energy: -358.787203 where: bonds (distance) C4'-P energy: -58.579 bonds (distance) P-C4' energy: -82.261 flat angles C4'-P-C4' energy: -79.265 flat angles P-C4'-P energy: -33.202 tors. eta vs tors. theta energy: -105.481 Dist. restrs. and SS energy: 4.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1664.258573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1664.258573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.156913 (E_RNA) where: Base-Base interactions energy: -1212.549 where: short stacking energy: -511.263 Base-Backbone interact. energy: -2.114 local terms energy: -487.493692 where: bonds (distance) C4'-P energy: -87.796 bonds (distance) P-C4' energy: -97.174 flat angles C4'-P-C4' energy: -97.613 flat angles P-C4'-P energy: -60.251 tors. eta vs tors. theta energy: -144.659 Dist. restrs. and SS energy: 1.148 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1574.731351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1574.731351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.485162 (E_RNA) where: Base-Base interactions energy: -1146.688 where: short stacking energy: -476.080 Base-Backbone interact. energy: -3.682 local terms energy: -462.115799 where: bonds (distance) C4'-P energy: -76.652 bonds (distance) P-C4' energy: -88.894 flat angles C4'-P-C4' energy: -102.875 flat angles P-C4'-P energy: -62.252 tors. eta vs tors. theta energy: -131.442 Dist. restrs. and SS energy: 1.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1537.678645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.678645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.195007 (E_RNA) where: Base-Base interactions energy: -1111.058 where: short stacking energy: -427.256 Base-Backbone interact. energy: -1.669 local terms energy: -468.468343 where: bonds (distance) C4'-P energy: -97.917 bonds (distance) P-C4' energy: -91.167 flat angles C4'-P-C4' energy: -90.051 flat angles P-C4'-P energy: -73.891 tors. eta vs tors. theta energy: -115.442 Dist. restrs. and SS energy: 6.766 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1518.972124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.972124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.030164 (E_RNA) where: Base-Base interactions energy: -1127.713 where: short stacking energy: -475.300 Base-Backbone interact. energy: -0.400 local terms energy: -434.917087 where: bonds (distance) C4'-P energy: -69.765 bonds (distance) P-C4' energy: -81.599 flat angles C4'-P-C4' energy: -97.304 flat angles P-C4'-P energy: -62.789 tors. eta vs tors. theta energy: -123.460 Dist. restrs. and SS energy: 7.308 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1449.790891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.790891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.837451 (E_RNA) where: Base-Base interactions energy: -1065.431 where: short stacking energy: -437.785 Base-Backbone interact. energy: -0.644 local terms energy: -424.762940 where: bonds (distance) C4'-P energy: -82.616 bonds (distance) P-C4' energy: -79.773 flat angles C4'-P-C4' energy: -89.145 flat angles P-C4'-P energy: -56.555 tors. eta vs tors. theta energy: -116.675 Dist. restrs. and SS energy: 4.297 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1461.611965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.611965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.970628 (E_RNA) where: Base-Base interactions energy: -1048.435 where: short stacking energy: -432.359 Base-Backbone interact. energy: -0.479 local terms energy: -457.056691 where: bonds (distance) C4'-P energy: -87.956 bonds (distance) P-C4' energy: -90.001 flat angles C4'-P-C4' energy: -87.701 flat angles P-C4'-P energy: -65.509 tors. eta vs tors. theta energy: -125.889 Dist. restrs. and SS energy: 7.609 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1373.926399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.926399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.864662 (E_RNA) where: Base-Base interactions energy: -1035.095 where: short stacking energy: -414.279 Base-Backbone interact. energy: -2.176 local terms energy: -378.594060 where: bonds (distance) C4'-P energy: -61.566 bonds (distance) P-C4' energy: -66.934 flat angles C4'-P-C4' energy: -89.756 flat angles P-C4'-P energy: -53.464 tors. eta vs tors. theta energy: -106.874 Dist. restrs. and SS energy: 5.188 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1363.523433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.523433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.741911 (E_RNA) where: Base-Base interactions energy: -1007.007 where: short stacking energy: -410.788 Base-Backbone interact. energy: -1.661 local terms energy: -406.074076 where: bonds (distance) C4'-P energy: -72.611 bonds (distance) P-C4' energy: -76.110 flat angles C4'-P-C4' energy: -95.850 flat angles P-C4'-P energy: -56.740 tors. eta vs tors. theta energy: -104.764 Dist. restrs. and SS energy: 14.468 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -1214.588565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.588565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.728015 (E_RNA) where: Base-Base interactions energy: -891.047 where: short stacking energy: -364.663 Base-Backbone interact. energy: -1.019 local terms energy: -380.662076 where: bonds (distance) C4'-P energy: -71.060 bonds (distance) P-C4' energy: -70.324 flat angles C4'-P-C4' energy: -84.625 flat angles P-C4'-P energy: -57.004 tors. eta vs tors. theta energy: -97.650 Dist. restrs. and SS energy: 21.389 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -1322.256985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.256985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.978005 (E_RNA) where: Base-Base interactions energy: -981.205 where: short stacking energy: -388.453 Base-Backbone interact. energy: -1.898 local terms energy: -379.875141 where: bonds (distance) C4'-P energy: -72.522 bonds (distance) P-C4' energy: -69.725 flat angles C4'-P-C4' energy: -71.385 flat angles P-C4'-P energy: -55.814 tors. eta vs tors. theta energy: -110.428 Dist. restrs. and SS energy: 3.971 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1676.045230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.045230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.401611 (E_RNA) where: Base-Base interactions energy: -1206.931 where: short stacking energy: -526.576 Base-Backbone interact. energy: 0.850 local terms energy: -507.321130 where: bonds (distance) C4'-P energy: -90.196 bonds (distance) P-C4' energy: -86.091 flat angles C4'-P-C4' energy: -103.131 flat angles P-C4'-P energy: -81.199 tors. eta vs tors. theta energy: -146.704 Dist. restrs. and SS energy: 0.606 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1600.168536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.168536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.719038 (E_RNA) where: Base-Base interactions energy: -1145.552 where: short stacking energy: -485.359 Base-Backbone interact. energy: -4.018 local terms energy: -488.148438 where: bonds (distance) C4'-P energy: -79.058 bonds (distance) P-C4' energy: -90.648 flat angles C4'-P-C4' energy: -111.616 flat angles P-C4'-P energy: -71.790 tors. eta vs tors. theta energy: -135.036 Dist. restrs. and SS energy: 0.801 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1551.118345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.118345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.729116 (E_RNA) where: Base-Base interactions energy: -1131.646 where: short stacking energy: -457.948 Base-Backbone interact. energy: -0.858 local terms energy: -461.225138 where: bonds (distance) C4'-P energy: -86.662 bonds (distance) P-C4' energy: -84.897 flat angles C4'-P-C4' energy: -95.707 flat angles P-C4'-P energy: -74.180 tors. eta vs tors. theta energy: -119.779 Dist. restrs. and SS energy: 5.861 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1533.670822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.670822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.756032 (E_RNA) where: Base-Base interactions energy: -1107.574 where: short stacking energy: -466.876 Base-Backbone interact. energy: -0.763 local terms energy: -470.418620 where: bonds (distance) C4'-P energy: -82.765 bonds (distance) P-C4' energy: -80.920 flat angles C4'-P-C4' energy: -106.174 flat angles P-C4'-P energy: -64.137 tors. eta vs tors. theta energy: -136.423 Dist. restrs. and SS energy: 8.335 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1501.663575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.663575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.670409 (E_RNA) where: Base-Base interactions energy: -1098.640 where: short stacking energy: -444.073 Base-Backbone interact. energy: -1.278 local terms energy: -444.751699 where: bonds (distance) C4'-P energy: -78.784 bonds (distance) P-C4' energy: -78.979 flat angles C4'-P-C4' energy: -106.156 flat angles P-C4'-P energy: -61.311 tors. eta vs tors. theta energy: -119.522 Dist. restrs. and SS energy: 6.257 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1447.890862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.890862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.205890 (E_RNA) where: Base-Base interactions energy: -1044.548 where: short stacking energy: -429.801 Base-Backbone interact. energy: -1.436 local terms energy: -443.221194 where: bonds (distance) C4'-P energy: -72.726 bonds (distance) P-C4' energy: -82.006 flat angles C4'-P-C4' energy: -103.120 flat angles P-C4'-P energy: -70.098 tors. eta vs tors. theta energy: -115.270 Dist. restrs. and SS energy: 4.565 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1427.313406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.313406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.497318 (E_RNA) where: Base-Base interactions energy: -1035.993 where: short stacking energy: -448.667 Base-Backbone interact. energy: -0.759 local terms energy: -434.746000 where: bonds (distance) C4'-P energy: -85.113 bonds (distance) P-C4' energy: -79.191 flat angles C4'-P-C4' energy: -97.158 flat angles P-C4'-P energy: -51.574 tors. eta vs tors. theta energy: -121.709 Dist. restrs. and SS energy: 7.434 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1365.359923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.359923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.505025 (E_RNA) where: Base-Base interactions energy: -998.118 where: short stacking energy: -419.306 Base-Backbone interact. energy: -2.158 local terms energy: -411.228836 where: bonds (distance) C4'-P energy: -64.389 bonds (distance) P-C4' energy: -82.920 flat angles C4'-P-C4' energy: -91.034 flat angles P-C4'-P energy: -53.317 tors. eta vs tors. theta energy: -119.570 Dist. restrs. and SS energy: 9.395 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -1349.952520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.952520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.933126 (E_RNA) where: Base-Base interactions energy: -1000.775 where: short stacking energy: -395.492 Base-Backbone interact. energy: -1.563 local terms energy: -385.595415 where: bonds (distance) C4'-P energy: -71.848 bonds (distance) P-C4' energy: -77.731 flat angles C4'-P-C4' energy: -80.064 flat angles P-C4'-P energy: -50.752 tors. eta vs tors. theta energy: -105.200 Dist. restrs. and SS energy: 1.231 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -1194.645258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.645258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.466653 (E_RNA) where: Base-Base interactions energy: -875.047 where: short stacking energy: -350.487 Base-Backbone interact. energy: 3.663 local terms energy: -382.082082 where: bonds (distance) C4'-P energy: -73.581 bonds (distance) P-C4' energy: -77.582 flat angles C4'-P-C4' energy: -81.709 flat angles P-C4'-P energy: -47.858 tors. eta vs tors. theta energy: -101.353 Dist. restrs. and SS energy: 22.071 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1679.426836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.426836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.991663 (E_RNA) where: Base-Base interactions energy: -1209.217 where: short stacking energy: -528.241 Base-Backbone interact. energy: -0.198 local terms energy: -507.576477 where: bonds (distance) C4'-P energy: -81.242 bonds (distance) P-C4' energy: -91.455 flat angles C4'-P-C4' energy: -108.143 flat angles P-C4'-P energy: -75.332 tors. eta vs tors. theta energy: -151.404 Dist. restrs. and SS energy: 0.815 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1591.442164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.442164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.377080 (E_RNA) where: Base-Base interactions energy: -1147.675 where: short stacking energy: -475.419 Base-Backbone interact. energy: -1.733 local terms energy: -479.968681 where: bonds (distance) C4'-P energy: -81.087 bonds (distance) P-C4' energy: -93.906 flat angles C4'-P-C4' energy: -101.654 flat angles P-C4'-P energy: -77.190 tors. eta vs tors. theta energy: -126.132 Dist. restrs. and SS energy: 1.185 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1580.877759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.877759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1624.361621 (E_RNA) where: Base-Base interactions energy: -1156.258 where: short stacking energy: -472.130 Base-Backbone interact. energy: -0.480 local terms energy: -467.624287 where: bonds (distance) C4'-P energy: -85.778 bonds (distance) P-C4' energy: -92.741 flat angles C4'-P-C4' energy: -96.573 flat angles P-C4'-P energy: -65.933 tors. eta vs tors. theta energy: -126.600 Dist. restrs. and SS energy: 6.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1544.659011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.659011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1582.839263 (E_RNA) where: Base-Base interactions energy: -1119.302 where: short stacking energy: -471.609 Base-Backbone interact. energy: 0.408 local terms energy: -463.945316 where: bonds (distance) C4'-P energy: -73.551 bonds (distance) P-C4' energy: -86.466 flat angles C4'-P-C4' energy: -102.717 flat angles P-C4'-P energy: -69.568 tors. eta vs tors. theta energy: -131.643 Dist. restrs. and SS energy: 1.430 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1465.741044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.741044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.169486 (E_RNA) where: Base-Base interactions energy: -1089.677 where: short stacking energy: -464.040 Base-Backbone interact. energy: -0.297 local terms energy: -420.195902 where: bonds (distance) C4'-P energy: -64.900 bonds (distance) P-C4' energy: -77.388 flat angles C4'-P-C4' energy: -91.633 flat angles P-C4'-P energy: -57.429 tors. eta vs tors. theta energy: -128.846 Dist. restrs. and SS energy: 7.678 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1418.665707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.665707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.854077 (E_RNA) where: Base-Base interactions energy: -1030.316 where: short stacking energy: -423.243 Base-Backbone interact. energy: -0.532 local terms energy: -430.005953 where: bonds (distance) C4'-P energy: -87.100 bonds (distance) P-C4' energy: -91.465 flat angles C4'-P-C4' energy: -78.882 flat angles P-C4'-P energy: -62.706 tors. eta vs tors. theta energy: -109.852 Dist. restrs. and SS energy: 5.438 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1401.580479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.580479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.688331 (E_RNA) where: Base-Base interactions energy: -998.635 where: short stacking energy: -406.364 Base-Backbone interact. energy: -1.393 local terms energy: -439.659722 where: bonds (distance) C4'-P energy: -83.724 bonds (distance) P-C4' energy: -89.598 flat angles C4'-P-C4' energy: -96.075 flat angles P-C4'-P energy: -60.747 tors. eta vs tors. theta energy: -109.515 Dist. restrs. and SS energy: 1.358 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1408.668875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.668875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.984904 (E_RNA) where: Base-Base interactions energy: -1018.026 where: short stacking energy: -405.565 Base-Backbone interact. energy: -0.456 local terms energy: -428.502527 where: bonds (distance) C4'-P energy: -84.134 bonds (distance) P-C4' energy: -85.345 flat angles C4'-P-C4' energy: -91.490 flat angles P-C4'-P energy: -55.005 tors. eta vs tors. theta energy: -112.529 Dist. restrs. and SS energy: 1.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -1341.405996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.405996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.063089 (E_RNA) where: Base-Base interactions energy: -967.088 where: short stacking energy: -388.384 Base-Backbone interact. energy: 0.002 local terms energy: -417.977374 where: bonds (distance) C4'-P energy: -69.438 bonds (distance) P-C4' energy: -85.430 flat angles C4'-P-C4' energy: -91.304 flat angles P-C4'-P energy: -60.269 tors. eta vs tors. theta energy: -111.537 Dist. restrs. and SS energy: 6.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -1211.892335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.892335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.874189 (E_RNA) where: Base-Base interactions energy: -914.590 where: short stacking energy: -372.025 Base-Backbone interact. energy: -0.754 local terms energy: -343.530438 where: bonds (distance) C4'-P energy: -38.448 bonds (distance) P-C4' energy: -70.332 flat angles C4'-P-C4' energy: -84.532 flat angles P-C4'-P energy: -52.405 tors. eta vs tors. theta energy: -97.813 Dist. restrs. and SS energy: 10.232 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1683.745797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.745797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.232958 (E_RNA) where: Base-Base interactions energy: -1221.782 where: short stacking energy: -507.583 Base-Backbone interact. energy: -1.261 local terms energy: -498.189430 where: bonds (distance) C4'-P energy: -82.500 bonds (distance) P-C4' energy: -96.600 flat angles C4'-P-C4' energy: -106.544 flat angles P-C4'-P energy: -62.480 tors. eta vs tors. theta energy: -150.066 Dist. restrs. and SS energy: 0.737 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1615.667949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.667949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.570384 (E_RNA) where: Base-Base interactions energy: -1154.385 where: short stacking energy: -483.860 Base-Backbone interact. energy: -1.721 local terms energy: -497.464435 where: bonds (distance) C4'-P energy: -97.812 bonds (distance) P-C4' energy: -88.891 flat angles C4'-P-C4' energy: -106.628 flat angles P-C4'-P energy: -74.937 tors. eta vs tors. theta energy: -129.196 Dist. restrs. and SS energy: 1.152 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1569.640835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.640835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.169543 (E_RNA) where: Base-Base interactions energy: -1158.303 where: short stacking energy: -482.054 Base-Backbone interact. energy: -2.207 local terms energy: -451.659477 where: bonds (distance) C4'-P energy: -89.763 bonds (distance) P-C4' energy: -71.328 flat angles C4'-P-C4' energy: -98.462 flat angles P-C4'-P energy: -64.181 tors. eta vs tors. theta energy: -127.924 Dist. restrs. and SS energy: 5.779 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1571.733768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.733768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.217831 (E_RNA) where: Base-Base interactions energy: -1143.366 where: short stacking energy: -483.846 Base-Backbone interact. energy: -2.512 local terms energy: -464.340500 where: bonds (distance) C4'-P energy: -82.405 bonds (distance) P-C4' energy: -86.544 flat angles C4'-P-C4' energy: -88.853 flat angles P-C4'-P energy: -75.623 tors. eta vs tors. theta energy: -130.915 Dist. restrs. and SS energy: 1.734 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1462.508630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.508630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.410220 (E_RNA) where: Base-Base interactions energy: -1057.696 where: short stacking energy: -448.462 Base-Backbone interact. energy: -1.653 local terms energy: -449.060850 where: bonds (distance) C4'-P energy: -81.580 bonds (distance) P-C4' energy: -86.733 flat angles C4'-P-C4' energy: -83.909 flat angles P-C4'-P energy: -68.181 tors. eta vs tors. theta energy: -128.658 Dist. restrs. and SS energy: 9.152 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1394.044982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.044982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.361045 (E_RNA) where: Base-Base interactions energy: -1028.346 where: short stacking energy: -428.317 Base-Backbone interact. energy: -1.252 local terms energy: -409.763469 where: bonds (distance) C4'-P energy: -80.667 bonds (distance) P-C4' energy: -84.336 flat angles C4'-P-C4' energy: -87.833 flat angles P-C4'-P energy: -39.825 tors. eta vs tors. theta energy: -117.102 Dist. restrs. and SS energy: 8.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1424.445216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.445216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.986796 (E_RNA) where: Base-Base interactions energy: -1034.670 where: short stacking energy: -414.332 Base-Backbone interact. energy: -1.641 local terms energy: -425.675844 where: bonds (distance) C4'-P energy: -77.474 bonds (distance) P-C4' energy: -85.119 flat angles C4'-P-C4' energy: -91.377 flat angles P-C4'-P energy: -57.346 tors. eta vs tors. theta energy: -114.360 Dist. restrs. and SS energy: 0.792 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1367.208780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.208780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.807521 (E_RNA) where: Base-Base interactions energy: -1001.981 where: short stacking energy: -423.948 Base-Backbone interact. energy: 0.332 local terms energy: -405.159004 where: bonds (distance) C4'-P energy: -74.647 bonds (distance) P-C4' energy: -78.224 flat angles C4'-P-C4' energy: -87.335 flat angles P-C4'-P energy: -48.357 tors. eta vs tors. theta energy: -116.596 Dist. restrs. and SS energy: 2.849 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -1354.136753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.136753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.700710 (E_RNA) where: Base-Base interactions energy: -997.276 where: short stacking energy: -393.145 Base-Backbone interact. energy: -0.644 local terms energy: -393.780563 where: bonds (distance) C4'-P energy: -65.419 bonds (distance) P-C4' energy: -75.126 flat angles C4'-P-C4' energy: -85.781 flat angles P-C4'-P energy: -62.768 tors. eta vs tors. theta energy: -104.687 Dist. restrs. and SS energy: 0.814 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -1240.163075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.163075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.050582 (E_RNA) where: Base-Base interactions energy: -898.111 where: short stacking energy: -348.254 Base-Backbone interact. energy: -0.266 local terms energy: -393.673257 where: bonds (distance) C4'-P energy: -74.767 bonds (distance) P-C4' energy: -77.123 flat angles C4'-P-C4' energy: -85.924 flat angles P-C4'-P energy: -56.393 tors. eta vs tors. theta energy: -99.466 Dist. restrs. and SS energy: 15.138 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1674.227451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.227451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.732219 (E_RNA) where: Base-Base interactions energy: -1210.786 where: short stacking energy: -514.081 Base-Backbone interact. energy: -0.824 local terms energy: -501.122887 where: bonds (distance) C4'-P energy: -84.512 bonds (distance) P-C4' energy: -100.835 flat angles C4'-P-C4' energy: -105.657 flat angles P-C4'-P energy: -62.666 tors. eta vs tors. theta energy: -147.453 Dist. restrs. and SS energy: 1.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1597.662523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1597.662523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.071199 (E_RNA) where: Base-Base interactions energy: -1148.506 where: short stacking energy: -486.587 Base-Backbone interact. energy: -0.222 local terms energy: -490.343031 where: bonds (distance) C4'-P energy: -75.944 bonds (distance) P-C4' energy: -90.182 flat angles C4'-P-C4' energy: -115.320 flat angles P-C4'-P energy: -74.444 tors. eta vs tors. theta energy: -134.454 Dist. restrs. and SS energy: 4.659 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1607.092809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.092809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.495852 (E_RNA) where: Base-Base interactions energy: -1172.838 where: short stacking energy: -504.694 Base-Backbone interact. energy: -0.971 local terms energy: -471.687025 where: bonds (distance) C4'-P energy: -83.796 bonds (distance) P-C4' energy: -80.964 flat angles C4'-P-C4' energy: -95.594 flat angles P-C4'-P energy: -67.115 tors. eta vs tors. theta energy: -144.219 Dist. restrs. and SS energy: 1.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1577.773688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.773688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.104712 (E_RNA) where: Base-Base interactions energy: -1134.257 where: short stacking energy: -481.815 Base-Backbone interact. energy: -2.709 local terms energy: -479.138094 where: bonds (distance) C4'-P energy: -94.176 bonds (distance) P-C4' energy: -88.698 flat angles C4'-P-C4' energy: -89.457 flat angles P-C4'-P energy: -68.415 tors. eta vs tors. theta energy: -138.393 Dist. restrs. and SS energy: 1.581 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1453.532622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.532622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.136215 (E_RNA) where: Base-Base interactions energy: -1066.047 where: short stacking energy: -448.912 Base-Backbone interact. energy: -0.855 local terms energy: -431.234514 where: bonds (distance) C4'-P energy: -68.763 bonds (distance) P-C4' energy: -78.567 flat angles C4'-P-C4' energy: -105.454 flat angles P-C4'-P energy: -61.321 tors. eta vs tors. theta energy: -117.129 Dist. restrs. and SS energy: 7.854 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1415.005557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.005557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.522258 (E_RNA) where: Base-Base interactions energy: -1033.155 where: short stacking energy: -426.452 Base-Backbone interact. energy: 1.699 local terms energy: -431.066408 where: bonds (distance) C4'-P energy: -81.143 bonds (distance) P-C4' energy: -74.831 flat angles C4'-P-C4' energy: -87.493 flat angles P-C4'-P energy: -67.143 tors. eta vs tors. theta energy: -120.456 Dist. restrs. and SS energy: 10.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1400.774168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.774168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.717645 (E_RNA) where: Base-Base interactions energy: -1009.550 where: short stacking energy: -399.163 Base-Backbone interact. energy: -1.409 local terms energy: -427.758696 where: bonds (distance) C4'-P energy: -73.768 bonds (distance) P-C4' energy: -95.232 flat angles C4'-P-C4' energy: -83.496 flat angles P-C4'-P energy: -61.547 tors. eta vs tors. theta energy: -113.716 Dist. restrs. and SS energy: 1.193 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1389.491834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.491834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.283896 (E_RNA) where: Base-Base interactions energy: -1013.331 where: short stacking energy: -412.370 Base-Backbone interact. energy: 3.035 local terms energy: -416.987028 where: bonds (distance) C4'-P energy: -76.493 bonds (distance) P-C4' energy: -76.062 flat angles C4'-P-C4' energy: -93.583 flat angles P-C4'-P energy: -61.820 tors. eta vs tors. theta energy: -109.028 Dist. restrs. and SS energy: 1.042 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1348.640520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.640520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.216465 (E_RNA) where: Base-Base interactions energy: -997.327 where: short stacking energy: -403.792 Base-Backbone interact. energy: 2.333 local terms energy: -392.223056 where: bonds (distance) C4'-P energy: -72.870 bonds (distance) P-C4' energy: -67.872 flat angles C4'-P-C4' energy: -84.830 flat angles P-C4'-P energy: -52.699 tors. eta vs tors. theta energy: -113.952 Dist. restrs. and SS energy: 1.826 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -1234.144208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.144208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.780466 (E_RNA) where: Base-Base interactions energy: -921.461 where: short stacking energy: -382.882 Base-Backbone interact. energy: 0.005 local terms energy: -363.324072 where: bonds (distance) C4'-P energy: -74.474 bonds (distance) P-C4' energy: -62.881 flat angles C4'-P-C4' energy: -86.980 flat angles P-C4'-P energy: -38.005 tors. eta vs tors. theta energy: -100.985 Dist. restrs. and SS energy: 13.886 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1657.117312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.117312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.327971 (E_RNA) where: Base-Base interactions energy: -1179.956 where: short stacking energy: -514.716 Base-Backbone interact. energy: -2.097 local terms energy: -512.274874 where: bonds (distance) C4'-P energy: -93.201 bonds (distance) P-C4' energy: -89.076 flat angles C4'-P-C4' energy: -111.913 flat angles P-C4'-P energy: -70.525 tors. eta vs tors. theta energy: -147.559 Dist. restrs. and SS energy: 0.461 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1594.285623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.285623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.873088 (E_RNA) where: Base-Base interactions energy: -1145.290 where: short stacking energy: -482.233 Base-Backbone interact. energy: -0.919 local terms energy: -488.665000 where: bonds (distance) C4'-P energy: -99.530 bonds (distance) P-C4' energy: -89.362 flat angles C4'-P-C4' energy: -102.710 flat angles P-C4'-P energy: -61.362 tors. eta vs tors. theta energy: -135.702 Dist. restrs. and SS energy: 3.837 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1631.327948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.327948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.943703 (E_RNA) where: Base-Base interactions energy: -1185.397 where: short stacking energy: -477.419 Base-Backbone interact. energy: -2.018 local terms energy: -481.528448 where: bonds (distance) C4'-P energy: -85.906 bonds (distance) P-C4' energy: -88.466 flat angles C4'-P-C4' energy: -107.425 flat angles P-C4'-P energy: -64.638 tors. eta vs tors. theta energy: -135.094 Dist. restrs. and SS energy: 0.866 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1579.069966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.069966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.359699 (E_RNA) where: Base-Base interactions energy: -1160.900 where: short stacking energy: -475.541 Base-Backbone interact. energy: -1.349 local terms energy: -455.110954 where: bonds (distance) C4'-P energy: -84.251 bonds (distance) P-C4' energy: -76.529 flat angles C4'-P-C4' energy: -103.443 flat angles P-C4'-P energy: -49.539 tors. eta vs tors. theta energy: -141.349 Dist. restrs. and SS energy: 1.540 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1456.795600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.795600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1503.069407 (E_RNA) where: Base-Base interactions energy: -1081.908 where: short stacking energy: -457.653 Base-Backbone interact. energy: -0.739 local terms energy: -420.422488 where: bonds (distance) C4'-P energy: -67.274 bonds (distance) P-C4' energy: -80.473 flat angles C4'-P-C4' energy: -93.138 flat angles P-C4'-P energy: -59.101 tors. eta vs tors. theta energy: -120.437 Dist. restrs. and SS energy: 9.524 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1426.824850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.824850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.877921 (E_RNA) where: Base-Base interactions energy: -1038.316 where: short stacking energy: -445.770 Base-Backbone interact. energy: 1.405 local terms energy: -435.966897 where: bonds (distance) C4'-P energy: -76.706 bonds (distance) P-C4' energy: -97.405 flat angles C4'-P-C4' energy: -88.023 flat angles P-C4'-P energy: -59.780 tors. eta vs tors. theta energy: -114.053 Dist. restrs. and SS energy: 9.303 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1440.641631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.641631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.235342 (E_RNA) where: Base-Base interactions energy: -1052.956 where: short stacking energy: -428.761 Base-Backbone interact. energy: 2.234 local terms energy: -428.513396 where: bonds (distance) C4'-P energy: -65.418 bonds (distance) P-C4' energy: -83.974 flat angles C4'-P-C4' energy: -95.478 flat angles P-C4'-P energy: -59.027 tors. eta vs tors. theta energy: -124.616 Dist. restrs. and SS energy: 1.844 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1389.787392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.787392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.481036 (E_RNA) where: Base-Base interactions energy: -1023.362 where: short stacking energy: -411.779 Base-Backbone interact. energy: 7.068 local terms energy: -411.187353 where: bonds (distance) C4'-P energy: -75.172 bonds (distance) P-C4' energy: -76.661 flat angles C4'-P-C4' energy: -87.917 flat angles P-C4'-P energy: -63.785 tors. eta vs tors. theta energy: -107.652 Dist. restrs. and SS energy: 0.944 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1326.800821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.800821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.347244 (E_RNA) where: Base-Base interactions energy: -986.465 where: short stacking energy: -415.446 Base-Backbone interact. energy: 2.430 local terms energy: -382.311681 where: bonds (distance) C4'-P energy: -67.303 bonds (distance) P-C4' energy: -70.651 flat angles C4'-P-C4' energy: -94.613 flat angles P-C4'-P energy: -45.858 tors. eta vs tors. theta energy: -103.887 Dist. restrs. and SS energy: 2.796 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -1272.754512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.754512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.455962 (E_RNA) where: Base-Base interactions energy: -928.471 where: short stacking energy: -376.756 Base-Backbone interact. energy: 4.545 local terms energy: -388.529380 where: bonds (distance) C4'-P energy: -89.829 bonds (distance) P-C4' energy: -82.929 flat angles C4'-P-C4' energy: -78.970 flat angles P-C4'-P energy: -43.034 tors. eta vs tors. theta energy: -93.767 Dist. restrs. and SS energy: 2.951 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1676.854250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.854250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.722263 (E_RNA) where: Base-Base interactions energy: -1169.247 where: short stacking energy: -511.175 Base-Backbone interact. energy: -5.336 local terms energy: -540.139731 where: bonds (distance) C4'-P energy: -96.009 bonds (distance) P-C4' energy: -101.869 flat angles C4'-P-C4' energy: -113.738 flat angles P-C4'-P energy: -80.565 tors. eta vs tors. theta energy: -147.960 Dist. restrs. and SS energy: 1.118 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1625.103334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.103334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.497798 (E_RNA) where: Base-Base interactions energy: -1184.833 where: short stacking energy: -493.638 Base-Backbone interact. energy: -2.612 local terms energy: -479.053291 where: bonds (distance) C4'-P energy: -80.404 bonds (distance) P-C4' energy: -94.604 flat angles C4'-P-C4' energy: -98.957 flat angles P-C4'-P energy: -70.373 tors. eta vs tors. theta energy: -134.715 Dist. restrs. and SS energy: 4.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1600.088350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.088350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.524214 (E_RNA) where: Base-Base interactions energy: -1150.543 where: short stacking energy: -478.299 Base-Backbone interact. energy: -1.898 local terms energy: -486.083828 where: bonds (distance) C4'-P energy: -81.311 bonds (distance) P-C4' energy: -103.290 flat angles C4'-P-C4' energy: -98.596 flat angles P-C4'-P energy: -61.604 tors. eta vs tors. theta energy: -141.283 Dist. restrs. and SS energy: 1.686 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1579.732467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.732467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.739760 (E_RNA) where: Base-Base interactions energy: -1137.505 where: short stacking energy: -480.439 Base-Backbone interact. energy: -1.063 local terms energy: -479.171847 where: bonds (distance) C4'-P energy: -82.823 bonds (distance) P-C4' energy: -98.566 flat angles C4'-P-C4' energy: -99.250 flat angles P-C4'-P energy: -62.103 tors. eta vs tors. theta energy: -136.430 Dist. restrs. and SS energy: 1.257 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1435.169328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.169328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.337543 (E_RNA) where: Base-Base interactions energy: -1050.871 where: short stacking energy: -425.364 Base-Backbone interact. energy: 0.067 local terms energy: -429.533555 where: bonds (distance) C4'-P energy: -88.251 bonds (distance) P-C4' energy: -72.584 flat angles C4'-P-C4' energy: -96.617 flat angles P-C4'-P energy: -56.435 tors. eta vs tors. theta energy: -115.646 Dist. restrs. and SS energy: 8.418 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1449.152988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.152988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.339745 (E_RNA) where: Base-Base interactions energy: -1039.145 where: short stacking energy: -435.051 Base-Backbone interact. energy: -2.034 local terms energy: -456.161218 where: bonds (distance) C4'-P energy: -91.687 bonds (distance) P-C4' energy: -72.453 flat angles C4'-P-C4' energy: -93.699 flat angles P-C4'-P energy: -71.622 tors. eta vs tors. theta energy: -126.700 Dist. restrs. and SS energy: 11.437 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1439.105609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.105609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.536996 (E_RNA) where: Base-Base interactions energy: -1056.757 where: short stacking energy: -421.585 Base-Backbone interact. energy: 2.494 local terms energy: -423.274450 where: bonds (distance) C4'-P energy: -79.689 bonds (distance) P-C4' energy: -80.893 flat angles C4'-P-C4' energy: -92.991 flat angles P-C4'-P energy: -55.873 tors. eta vs tors. theta energy: -113.828 Dist. restrs. and SS energy: 1.681 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1405.493269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.493269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.310606 (E_RNA) where: Base-Base interactions energy: -1035.597 where: short stacking energy: -438.575 Base-Backbone interact. energy: -0.092 local terms energy: -408.621927 where: bonds (distance) C4'-P energy: -66.306 bonds (distance) P-C4' energy: -68.910 flat angles C4'-P-C4' energy: -83.691 flat angles P-C4'-P energy: -61.640 tors. eta vs tors. theta energy: -128.074 Dist. restrs. and SS energy: 2.067 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1351.425542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.425542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.444629 (E_RNA) where: Base-Base interactions energy: -989.179 where: short stacking energy: -396.099 Base-Backbone interact. energy: -1.878 local terms energy: -398.388332 where: bonds (distance) C4'-P energy: -78.573 bonds (distance) P-C4' energy: -70.657 flat angles C4'-P-C4' energy: -85.359 flat angles P-C4'-P energy: -54.194 tors. eta vs tors. theta energy: -109.606 Dist. restrs. and SS energy: 1.269 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -1343.142745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.142745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.092041 (E_RNA) where: Base-Base interactions energy: -975.043 where: short stacking energy: -388.913 Base-Backbone interact. energy: -0.145 local terms energy: -406.903618 where: bonds (distance) C4'-P energy: -72.998 bonds (distance) P-C4' energy: -68.571 flat angles C4'-P-C4' energy: -95.240 flat angles P-C4'-P energy: -60.149 tors. eta vs tors. theta energy: -109.945 Dist. restrs. and SS energy: 2.199 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1656.609103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.609103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.980107 (E_RNA) where: Base-Base interactions energy: -1197.528 where: short stacking energy: -502.487 Base-Backbone interact. energy: -1.637 local terms energy: -495.815183 where: bonds (distance) C4'-P energy: -94.299 bonds (distance) P-C4' energy: -82.965 flat angles C4'-P-C4' energy: -111.871 flat angles P-C4'-P energy: -71.653 tors. eta vs tors. theta energy: -135.028 Dist. restrs. and SS energy: 1.621 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1602.531186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.531186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.382895 (E_RNA) where: Base-Base interactions energy: -1142.189 where: short stacking energy: -490.704 Base-Backbone interact. energy: -1.393 local terms energy: -500.801330 where: bonds (distance) C4'-P energy: -89.581 bonds (distance) P-C4' energy: -91.381 flat angles C4'-P-C4' energy: -108.400 flat angles P-C4'-P energy: -74.192 tors. eta vs tors. theta energy: -137.247 Dist. restrs. and SS energy: 5.102 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1582.446868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.446868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.078619 (E_RNA) where: Base-Base interactions energy: -1154.355 where: short stacking energy: -494.098 Base-Backbone interact. energy: 0.728 local terms energy: -466.451867 where: bonds (distance) C4'-P energy: -87.329 bonds (distance) P-C4' energy: -77.048 flat angles C4'-P-C4' energy: -105.619 flat angles P-C4'-P energy: -63.641 tors. eta vs tors. theta energy: -132.815 Dist. restrs. and SS energy: 0.882 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1539.313451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.313451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.107728 (E_RNA) where: Base-Base interactions energy: -1116.117 where: short stacking energy: -462.860 Base-Backbone interact. energy: -1.230 local terms energy: -459.759965 where: bonds (distance) C4'-P energy: -85.091 bonds (distance) P-C4' energy: -79.038 flat angles C4'-P-C4' energy: -99.380 flat angles P-C4'-P energy: -64.762 tors. eta vs tors. theta energy: -131.488 Dist. restrs. and SS energy: 1.044 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1442.811742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.811742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.218276 (E_RNA) where: Base-Base interactions energy: -1029.544 where: short stacking energy: -418.106 Base-Backbone interact. energy: -1.170 local terms energy: -456.503630 where: bonds (distance) C4'-P energy: -76.887 bonds (distance) P-C4' energy: -84.704 flat angles C4'-P-C4' energy: -106.545 flat angles P-C4'-P energy: -69.406 tors. eta vs tors. theta energy: -118.962 Dist. restrs. and SS energy: 7.657 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1439.629845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.629845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.880190 (E_RNA) where: Base-Base interactions energy: -1044.482 where: short stacking energy: -436.815 Base-Backbone interact. energy: -0.682 local terms energy: -437.716204 where: bonds (distance) C4'-P energy: -79.083 bonds (distance) P-C4' energy: -76.328 flat angles C4'-P-C4' energy: -93.953 flat angles P-C4'-P energy: -63.921 tors. eta vs tors. theta energy: -124.430 Dist. restrs. and SS energy: 6.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1404.622544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.622544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.233593 (E_RNA) where: Base-Base interactions energy: -1044.073 where: short stacking energy: -422.734 Base-Backbone interact. energy: 1.573 local terms energy: -400.733375 where: bonds (distance) C4'-P energy: -67.883 bonds (distance) P-C4' energy: -69.922 flat angles C4'-P-C4' energy: -83.146 flat angles P-C4'-P energy: -63.920 tors. eta vs tors. theta energy: -115.862 Dist. restrs. and SS energy: 1.861 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1376.813686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.813686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.546539 (E_RNA) where: Base-Base interactions energy: -1028.887 where: short stacking energy: -423.008 Base-Backbone interact. energy: 1.311 local terms energy: -386.970440 where: bonds (distance) C4'-P energy: -59.819 bonds (distance) P-C4' energy: -70.286 flat angles C4'-P-C4' energy: -85.945 flat angles P-C4'-P energy: -57.083 tors. eta vs tors. theta energy: -113.836 Dist. restrs. and SS energy: 0.983 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1372.262913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.262913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.427988 (E_RNA) where: Base-Base interactions energy: -997.278 where: short stacking energy: -409.375 Base-Backbone interact. energy: 3.035 local terms energy: -416.184764 where: bonds (distance) C4'-P energy: -78.588 bonds (distance) P-C4' energy: -80.979 flat angles C4'-P-C4' energy: -90.921 flat angles P-C4'-P energy: -62.329 tors. eta vs tors. theta energy: -103.368 Dist. restrs. and SS energy: 1.415 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -1303.289808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.289808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.716769 (E_RNA) where: Base-Base interactions energy: -973.278 where: short stacking energy: -386.451 Base-Backbone interact. energy: 2.966 local terms energy: -372.404812 where: bonds (distance) C4'-P energy: -75.886 bonds (distance) P-C4' energy: -69.316 flat angles C4'-P-C4' energy: -79.771 flat angles P-C4'-P energy: -46.958 tors. eta vs tors. theta energy: -100.475 Dist. restrs. and SS energy: 2.677 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1688.346588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.346588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.165834 (E_RNA) where: Base-Base interactions energy: -1221.698 where: short stacking energy: -515.815 Base-Backbone interact. energy: -1.514 local terms energy: -502.953620 where: bonds (distance) C4'-P energy: -104.114 bonds (distance) P-C4' energy: -76.732 flat angles C4'-P-C4' energy: -105.302 flat angles P-C4'-P energy: -72.071 tors. eta vs tors. theta energy: -144.735 Dist. restrs. and SS energy: 1.069 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1636.701196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.701196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.090315 (E_RNA) where: Base-Base interactions energy: -1204.619 where: short stacking energy: -504.396 Base-Backbone interact. energy: -1.303 local terms energy: -468.168154 where: bonds (distance) C4'-P energy: -83.648 bonds (distance) P-C4' energy: -84.865 flat angles C4'-P-C4' energy: -101.286 flat angles P-C4'-P energy: -64.175 tors. eta vs tors. theta energy: -134.194 Dist. restrs. and SS energy: 0.639 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1580.543195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.543195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.915986 (E_RNA) where: Base-Base interactions energy: -1151.954 where: short stacking energy: -448.338 Base-Backbone interact. energy: -3.448 local terms energy: -465.514260 where: bonds (distance) C4'-P energy: -84.787 bonds (distance) P-C4' energy: -82.904 flat angles C4'-P-C4' energy: -106.292 flat angles P-C4'-P energy: -64.315 tors. eta vs tors. theta energy: -127.216 Dist. restrs. and SS energy: 3.623 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1565.807864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.807864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.735715 (E_RNA) where: Base-Base interactions energy: -1120.577 where: short stacking energy: -462.873 Base-Backbone interact. energy: -1.289 local terms energy: -481.870263 where: bonds (distance) C4'-P energy: -93.378 bonds (distance) P-C4' energy: -82.416 flat angles C4'-P-C4' energy: -95.360 flat angles P-C4'-P energy: -73.480 tors. eta vs tors. theta energy: -137.236 Dist. restrs. and SS energy: 1.178 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1480.213448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.213448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.837475 (E_RNA) where: Base-Base interactions energy: -1082.204 where: short stacking energy: -440.682 Base-Backbone interact. energy: -3.602 local terms energy: -439.031544 where: bonds (distance) C4'-P energy: -84.644 bonds (distance) P-C4' energy: -82.133 flat angles C4'-P-C4' energy: -87.353 flat angles P-C4'-P energy: -65.917 tors. eta vs tors. theta energy: -118.984 Dist. restrs. and SS energy: 7.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1452.297650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.297650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.615392 (E_RNA) where: Base-Base interactions energy: -1050.300 where: short stacking energy: -447.609 Base-Backbone interact. energy: -0.334 local terms energy: -440.981534 where: bonds (distance) C4'-P energy: -85.207 bonds (distance) P-C4' energy: -81.154 flat angles C4'-P-C4' energy: -95.276 flat angles P-C4'-P energy: -54.531 tors. eta vs tors. theta energy: -124.814 Dist. restrs. and SS energy: 2.568 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1377.340665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.340665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.701283 (E_RNA) where: Base-Base interactions energy: -1022.459 where: short stacking energy: -426.063 Base-Backbone interact. energy: -2.530 local terms energy: -397.711894 where: bonds (distance) C4'-P energy: -73.917 bonds (distance) P-C4' energy: -67.603 flat angles C4'-P-C4' energy: -81.029 flat angles P-C4'-P energy: -58.453 tors. eta vs tors. theta energy: -116.710 Dist. restrs. and SS energy: 8.611 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1377.562471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.562471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.628003 (E_RNA) where: Base-Base interactions energy: -1001.961 where: short stacking energy: -411.065 Base-Backbone interact. energy: 0.308 local terms energy: -413.974621 where: bonds (distance) C4'-P energy: -63.313 bonds (distance) P-C4' energy: -82.149 flat angles C4'-P-C4' energy: -92.806 flat angles P-C4'-P energy: -60.855 tors. eta vs tors. theta energy: -114.851 Dist. restrs. and SS energy: 1.316 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1376.992560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.992560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.323592 (E_RNA) where: Base-Base interactions energy: -1025.509 where: short stacking energy: -407.837 Base-Backbone interact. energy: -0.552 local terms energy: -389.262611 where: bonds (distance) C4'-P energy: -80.531 bonds (distance) P-C4' energy: -56.790 flat angles C4'-P-C4' energy: -81.492 flat angles P-C4'-P energy: -49.877 tors. eta vs tors. theta energy: -120.572 Dist. restrs. and SS energy: 1.581 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -1278.839441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.839441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.247746 (E_RNA) where: Base-Base interactions energy: -951.946 where: short stacking energy: -382.787 Base-Backbone interact. energy: -1.048 local terms energy: -366.253999 where: bonds (distance) C4'-P energy: -48.841 bonds (distance) P-C4' energy: -91.019 flat angles C4'-P-C4' energy: -68.579 flat angles P-C4'-P energy: -47.355 tors. eta vs tors. theta energy: -110.459 Dist. restrs. and SS energy: 3.658 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1675.948013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.948013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.906021 (E_RNA) where: Base-Base interactions energy: -1199.839 where: short stacking energy: -489.946 Base-Backbone interact. energy: -0.629 local terms energy: -512.437326 where: bonds (distance) C4'-P energy: -97.916 bonds (distance) P-C4' energy: -88.323 flat angles C4'-P-C4' energy: -103.603 flat angles P-C4'-P energy: -85.878 tors. eta vs tors. theta energy: -136.717 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1659.273067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.273067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.888972 (E_RNA) where: Base-Base interactions energy: -1188.569 where: short stacking energy: -489.786 Base-Backbone interact. energy: -1.745 local terms energy: -506.574864 where: bonds (distance) C4'-P energy: -92.393 bonds (distance) P-C4' energy: -93.144 flat angles C4'-P-C4' energy: -110.426 flat angles P-C4'-P energy: -69.472 tors. eta vs tors. theta energy: -141.139 Dist. restrs. and SS energy: 0.866 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1581.215446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.215446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.618372 (E_RNA) where: Base-Base interactions energy: -1147.228 where: short stacking energy: -462.395 Base-Backbone interact. energy: -1.144 local terms energy: -474.246272 where: bonds (distance) C4'-P energy: -99.484 bonds (distance) P-C4' energy: -85.807 flat angles C4'-P-C4' energy: -102.671 flat angles P-C4'-P energy: -61.364 tors. eta vs tors. theta energy: -124.921 Dist. restrs. and SS energy: 4.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1580.961191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.961191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.146272 (E_RNA) where: Base-Base interactions energy: -1153.610 where: short stacking energy: -488.513 Base-Backbone interact. energy: -1.814 local terms energy: -463.722963 where: bonds (distance) C4'-P energy: -84.739 bonds (distance) P-C4' energy: -84.696 flat angles C4'-P-C4' energy: -103.009 flat angles P-C4'-P energy: -54.654 tors. eta vs tors. theta energy: -136.624 Dist. restrs. and SS energy: 1.435 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1515.862945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.862945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.520094 (E_RNA) where: Base-Base interactions energy: -1094.118 where: short stacking energy: -443.137 Base-Backbone interact. energy: -1.681 local terms energy: -457.720687 where: bonds (distance) C4'-P energy: -74.709 bonds (distance) P-C4' energy: -92.409 flat angles C4'-P-C4' energy: -105.723 flat angles P-C4'-P energy: -63.066 tors. eta vs tors. theta energy: -121.814 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1409.274739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.274739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.838719 (E_RNA) where: Base-Base interactions energy: -1045.380 where: short stacking energy: -418.625 Base-Backbone interact. energy: 0.223 local terms energy: -412.681668 where: bonds (distance) C4'-P energy: -83.226 bonds (distance) P-C4' energy: -64.634 flat angles C4'-P-C4' energy: -95.296 flat angles P-C4'-P energy: -64.977 tors. eta vs tors. theta energy: -104.548 Dist. restrs. and SS energy: 11.814 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1415.568347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.568347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.362715 (E_RNA) where: Base-Base interactions energy: -1046.236 where: short stacking energy: -432.180 Base-Backbone interact. energy: -0.793 local terms energy: -407.334023 where: bonds (distance) C4'-P energy: -67.510 bonds (distance) P-C4' energy: -79.363 flat angles C4'-P-C4' energy: -88.367 flat angles P-C4'-P energy: -57.312 tors. eta vs tors. theta energy: -114.782 Dist. restrs. and SS energy: 2.044 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1341.442265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.442265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.778803 (E_RNA) where: Base-Base interactions energy: -1007.366 where: short stacking energy: -410.054 Base-Backbone interact. energy: 0.447 local terms energy: -378.859548 where: bonds (distance) C4'-P energy: -61.693 bonds (distance) P-C4' energy: -62.350 flat angles C4'-P-C4' energy: -92.928 flat angles P-C4'-P energy: -52.516 tors. eta vs tors. theta energy: -109.374 Dist. restrs. and SS energy: 7.587 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1332.692298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.692298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.929335 (E_RNA) where: Base-Base interactions energy: -973.539 where: short stacking energy: -387.005 Base-Backbone interact. energy: 1.267 local terms energy: -398.657951 where: bonds (distance) C4'-P energy: -65.851 bonds (distance) P-C4' energy: -69.670 flat angles C4'-P-C4' energy: -95.396 flat angles P-C4'-P energy: -57.070 tors. eta vs tors. theta energy: -110.670 Dist. restrs. and SS energy: 1.487 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -1325.405727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.405727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.182860 (E_RNA) where: Base-Base interactions energy: -965.348 where: short stacking energy: -402.469 Base-Backbone interact. energy: -0.706 local terms energy: -398.129226 where: bonds (distance) C4'-P energy: -82.249 bonds (distance) P-C4' energy: -71.497 flat angles C4'-P-C4' energy: -77.035 flat angles P-C4'-P energy: -53.193 tors. eta vs tors. theta energy: -114.155 Dist. restrs. and SS energy: 2.027 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1672.531209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.531209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.653879 (E_RNA) where: Base-Base interactions energy: -1189.219 where: short stacking energy: -520.272 Base-Backbone interact. energy: -1.386 local terms energy: -519.048398 where: bonds (distance) C4'-P energy: -85.585 bonds (distance) P-C4' energy: -102.181 flat angles C4'-P-C4' energy: -106.118 flat angles P-C4'-P energy: -74.596 tors. eta vs tors. theta energy: -150.569 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1658.640704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.640704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.555803 (E_RNA) where: Base-Base interactions energy: -1177.851 where: short stacking energy: -492.041 Base-Backbone interact. energy: 0.062 local terms energy: -518.766578 where: bonds (distance) C4'-P energy: -93.029 bonds (distance) P-C4' energy: -88.331 flat angles C4'-P-C4' energy: -114.012 flat angles P-C4'-P energy: -80.997 tors. eta vs tors. theta energy: -142.398 Dist. restrs. and SS energy: 1.165 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1592.132392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.132392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.123295 (E_RNA) where: Base-Base interactions energy: -1151.879 where: short stacking energy: -476.832 Base-Backbone interact. energy: -0.719 local terms energy: -480.526159 where: bonds (distance) C4'-P energy: -93.377 bonds (distance) P-C4' energy: -83.444 flat angles C4'-P-C4' energy: -105.439 flat angles P-C4'-P energy: -64.764 tors. eta vs tors. theta energy: -133.503 Dist. restrs. and SS energy: 4.241 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1563.235248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.235248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.949076 (E_RNA) where: Base-Base interactions energy: -1137.053 where: short stacking energy: -466.765 Base-Backbone interact. energy: -2.051 local terms energy: -461.844558 where: bonds (distance) C4'-P energy: -63.822 bonds (distance) P-C4' energy: -100.375 flat angles C4'-P-C4' energy: -106.200 flat angles P-C4'-P energy: -63.527 tors. eta vs tors. theta energy: -127.921 Dist. restrs. and SS energy: 0.964 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1521.807471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1521.807471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.496633 (E_RNA) where: Base-Base interactions energy: -1093.050 where: short stacking energy: -463.540 Base-Backbone interact. energy: -2.351 local terms energy: -465.095801 where: bonds (distance) C4'-P energy: -99.269 bonds (distance) P-C4' energy: -75.663 flat angles C4'-P-C4' energy: -96.119 flat angles P-C4'-P energy: -55.194 tors. eta vs tors. theta energy: -138.851 Dist. restrs. and SS energy: 1.939 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1441.631517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.631517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.712202 (E_RNA) where: Base-Base interactions energy: -1038.671 where: short stacking energy: -427.532 Base-Backbone interact. energy: -1.468 local terms energy: -439.573389 where: bonds (distance) C4'-P energy: -75.026 bonds (distance) P-C4' energy: -88.432 flat angles C4'-P-C4' energy: -96.662 flat angles P-C4'-P energy: -65.682 tors. eta vs tors. theta energy: -113.772 Dist. restrs. and SS energy: 1.331 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1359.209245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.209245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.607861 (E_RNA) where: Base-Base interactions energy: -988.564 where: short stacking energy: -423.894 Base-Backbone interact. energy: -2.576 local terms energy: -415.468589 where: bonds (distance) C4'-P energy: -74.962 bonds (distance) P-C4' energy: -77.881 flat angles C4'-P-C4' energy: -87.780 flat angles P-C4'-P energy: -59.296 tors. eta vs tors. theta energy: -115.550 Dist. restrs. and SS energy: 10.649 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1402.059312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.059312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.137400 (E_RNA) where: Base-Base interactions energy: -1020.587 where: short stacking energy: -416.062 Base-Backbone interact. energy: -0.610 local terms energy: -418.940549 where: bonds (distance) C4'-P energy: -73.539 bonds (distance) P-C4' energy: -90.542 flat angles C4'-P-C4' energy: -89.306 flat angles P-C4'-P energy: -46.332 tors. eta vs tors. theta energy: -119.222 Dist. restrs. and SS energy: 1.328 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1312.687657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.687657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.510921 (E_RNA) where: Base-Base interactions energy: -971.703 where: short stacking energy: -383.163 Base-Backbone interact. energy: 0.408 local terms energy: -388.215502 where: bonds (distance) C4'-P energy: -56.021 bonds (distance) P-C4' energy: -66.056 flat angles C4'-P-C4' energy: -85.748 flat angles P-C4'-P energy: -66.619 tors. eta vs tors. theta energy: -113.771 Dist. restrs. and SS energy: 10.073 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 3 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -1353.616270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.616270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.402422 (E_RNA) where: Base-Base interactions energy: -1009.043 where: short stacking energy: -404.233 Base-Backbone interact. energy: 2.379 local terms energy: -384.737975 where: bonds (distance) C4'-P energy: -63.208 bonds (distance) P-C4' energy: -63.975 flat angles C4'-P-C4' energy: -90.005 flat angles P-C4'-P energy: -59.137 tors. eta vs tors. theta energy: -108.413 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1689.449454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.449454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.367752 (E_RNA) where: Base-Base interactions energy: -1215.958 where: short stacking energy: -514.398 Base-Backbone interact. energy: -0.648 local terms energy: -510.761615 where: bonds (distance) C4'-P energy: -91.760 bonds (distance) P-C4' energy: -90.580 flat angles C4'-P-C4' energy: -117.004 flat angles P-C4'-P energy: -74.180 tors. eta vs tors. theta energy: -137.239 Dist. restrs. and SS energy: 1.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1641.554389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1641.554389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.816115 (E_RNA) where: Base-Base interactions energy: -1177.142 where: short stacking energy: -485.748 Base-Backbone interact. energy: -1.363 local terms energy: -503.310897 where: bonds (distance) C4'-P energy: -88.491 bonds (distance) P-C4' energy: -94.111 flat angles C4'-P-C4' energy: -108.111 flat angles P-C4'-P energy: -75.331 tors. eta vs tors. theta energy: -137.268 Dist. restrs. and SS energy: 3.512 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1594.481582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.481582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.754063 (E_RNA) where: Base-Base interactions energy: -1154.650 where: short stacking energy: -480.430 Base-Backbone interact. energy: 1.579 local terms energy: -481.683093 where: bonds (distance) C4'-P energy: -74.875 bonds (distance) P-C4' energy: -85.081 flat angles C4'-P-C4' energy: -105.721 flat angles P-C4'-P energy: -76.749 tors. eta vs tors. theta energy: -139.256 Dist. restrs. and SS energy: 3.522 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1561.563836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.563836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.371153 (E_RNA) where: Base-Base interactions energy: -1132.927 where: short stacking energy: -460.714 Base-Backbone interact. energy: -1.000 local terms energy: -465.444203 where: bonds (distance) C4'-P energy: -83.826 bonds (distance) P-C4' energy: -75.891 flat angles C4'-P-C4' energy: -98.465 flat angles P-C4'-P energy: -76.036 tors. eta vs tors. theta energy: -131.226 Dist. restrs. and SS energy: 1.057 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1494.202981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.202981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.193928 (E_RNA) where: Base-Base interactions energy: -1073.278 where: short stacking energy: -447.293 Base-Backbone interact. energy: 0.331 local terms energy: -459.246891 where: bonds (distance) C4'-P energy: -86.873 bonds (distance) P-C4' energy: -81.045 flat angles C4'-P-C4' energy: -101.659 flat angles P-C4'-P energy: -58.176 tors. eta vs tors. theta energy: -131.494 Dist. restrs. and SS energy: 1.241 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1445.963253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.963253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.623588 (E_RNA) where: Base-Base interactions energy: -1048.571 where: short stacking energy: -429.251 Base-Backbone interact. energy: 2.987 local terms energy: -439.039945 where: bonds (distance) C4'-P energy: -80.095 bonds (distance) P-C4' energy: -94.689 flat angles C4'-P-C4' energy: -93.790 flat angles P-C4'-P energy: -47.647 tors. eta vs tors. theta energy: -122.818 Dist. restrs. and SS energy: 1.910 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1380.989688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.989688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.777327 (E_RNA) where: Base-Base interactions energy: -1021.462 where: short stacking energy: -405.211 Base-Backbone interact. energy: -0.119 local terms energy: -405.196501 where: bonds (distance) C4'-P energy: -65.952 bonds (distance) P-C4' energy: -75.291 flat angles C4'-P-C4' energy: -97.554 flat angles P-C4'-P energy: -51.311 tors. eta vs tors. theta energy: -115.088 Dist. restrs. and SS energy: 9.038 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1391.079573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.079573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.876381 (E_RNA) where: Base-Base interactions energy: -1012.414 where: short stacking energy: -406.445 Base-Backbone interact. energy: -1.778 local terms energy: -414.684419 where: bonds (distance) C4'-P energy: -72.419 bonds (distance) P-C4' energy: -72.158 flat angles C4'-P-C4' energy: -95.630 flat angles P-C4'-P energy: -62.466 tors. eta vs tors. theta energy: -112.012 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1322.660504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.660504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.022373 (E_RNA) where: Base-Base interactions energy: -967.941 where: short stacking energy: -388.824 Base-Backbone interact. energy: -0.521 local terms energy: -393.560978 where: bonds (distance) C4'-P energy: -85.473 bonds (distance) P-C4' energy: -61.682 flat angles C4'-P-C4' energy: -86.661 flat angles P-C4'-P energy: -53.133 tors. eta vs tors. theta energy: -106.611 Dist. restrs. and SS energy: 2.612 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -1262.078571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.078571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.333761 (E_RNA) where: Base-Base interactions energy: -927.459 where: short stacking energy: -382.267 Base-Backbone interact. energy: -2.002 local terms energy: -382.872239 where: bonds (distance) C4'-P energy: -70.535 bonds (distance) P-C4' energy: -74.286 flat angles C4'-P-C4' energy: -84.989 flat angles P-C4'-P energy: -48.234 tors. eta vs tors. theta energy: -104.827 Dist. restrs. and SS energy: 13.505 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1688.322299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.322299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.032392 (E_RNA) where: Base-Base interactions energy: -1237.101 where: short stacking energy: -510.694 Base-Backbone interact. energy: 2.509 local terms energy: -491.440200 where: bonds (distance) C4'-P energy: -91.458 bonds (distance) P-C4' energy: -90.247 flat angles C4'-P-C4' energy: -106.221 flat angles P-C4'-P energy: -63.711 tors. eta vs tors. theta energy: -139.804 Dist. restrs. and SS energy: 0.960 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1635.546667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.546667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.686852 (E_RNA) where: Base-Base interactions energy: -1170.637 where: short stacking energy: -469.764 Base-Backbone interact. energy: 1.286 local terms energy: -505.336327 where: bonds (distance) C4'-P energy: -96.763 bonds (distance) P-C4' energy: -92.383 flat angles C4'-P-C4' energy: -107.551 flat angles P-C4'-P energy: -75.364 tors. eta vs tors. theta energy: -133.276 Dist. restrs. and SS energy: 2.390 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1621.618402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.618402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.402319 (E_RNA) where: Base-Base interactions energy: -1167.791 where: short stacking energy: -492.005 Base-Backbone interact. energy: -3.218 local terms energy: -488.394042 where: bonds (distance) C4'-P energy: -90.785 bonds (distance) P-C4' energy: -82.285 flat angles C4'-P-C4' energy: -110.072 flat angles P-C4'-P energy: -61.863 tors. eta vs tors. theta energy: -143.389 Dist. restrs. and SS energy: 1.034 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1564.511369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.511369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.471203 (E_RNA) where: Base-Base interactions energy: -1130.340 where: short stacking energy: -487.239 Base-Backbone interact. energy: -1.934 local terms energy: -470.196947 where: bonds (distance) C4'-P energy: -76.219 bonds (distance) P-C4' energy: -85.112 flat angles C4'-P-C4' energy: -95.874 flat angles P-C4'-P energy: -73.582 tors. eta vs tors. theta energy: -139.409 Dist. restrs. and SS energy: 1.210 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1449.908232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.908232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.101766 (E_RNA) where: Base-Base interactions energy: -1070.297 where: short stacking energy: -456.310 Base-Backbone interact. energy: 0.530 local terms energy: -418.334457 where: bonds (distance) C4'-P energy: -77.775 bonds (distance) P-C4' energy: -76.217 flat angles C4'-P-C4' energy: -87.903 flat angles P-C4'-P energy: -55.395 tors. eta vs tors. theta energy: -121.045 Dist. restrs. and SS energy: 1.444 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1448.270727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.270727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.192541 (E_RNA) where: Base-Base interactions energy: -1048.813 where: short stacking energy: -433.373 Base-Backbone interact. energy: -0.830 local terms energy: -437.549821 where: bonds (distance) C4'-P energy: -78.823 bonds (distance) P-C4' energy: -81.902 flat angles C4'-P-C4' energy: -93.074 flat angles P-C4'-P energy: -59.773 tors. eta vs tors. theta energy: -123.977 Dist. restrs. and SS energy: 2.172 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1338.056420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.056420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.636378 (E_RNA) where: Base-Base interactions energy: -982.051 where: short stacking energy: -386.034 Base-Backbone interact. energy: -0.094 local terms energy: -405.491600 where: bonds (distance) C4'-P energy: -74.339 bonds (distance) P-C4' energy: -72.216 flat angles C4'-P-C4' energy: -87.587 flat angles P-C4'-P energy: -60.730 tors. eta vs tors. theta energy: -110.619 Dist. restrs. and SS energy: 12.830 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1389.420229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.420229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.975215 (E_RNA) where: Base-Base interactions energy: -1004.468 where: short stacking energy: -413.942 Base-Backbone interact. energy: 0.172 local terms energy: -423.679469 where: bonds (distance) C4'-P energy: -69.080 bonds (distance) P-C4' energy: -82.456 flat angles C4'-P-C4' energy: -100.174 flat angles P-C4'-P energy: -62.700 tors. eta vs tors. theta energy: -109.269 Dist. restrs. and SS energy: 1.805 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1355.691587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.691587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.925982 (E_RNA) where: Base-Base interactions energy: -986.489 where: short stacking energy: -394.060 Base-Backbone interact. energy: -1.204 local terms energy: -406.233348 where: bonds (distance) C4'-P energy: -67.039 bonds (distance) P-C4' energy: -81.265 flat angles C4'-P-C4' energy: -84.938 flat angles P-C4'-P energy: -55.630 tors. eta vs tors. theta energy: -117.361 Dist. restrs. and SS energy: 1.484 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -1277.468225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.468225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.968022 (E_RNA) where: Base-Base interactions energy: -964.953 where: short stacking energy: -391.263 Base-Backbone interact. energy: -3.099 local terms energy: -354.916371 where: bonds (distance) C4'-P energy: -46.739 bonds (distance) P-C4' energy: -58.424 flat angles C4'-P-C4' energy: -92.310 flat angles P-C4'-P energy: -51.899 tors. eta vs tors. theta energy: -105.544 Dist. restrs. and SS energy: 8.750 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1675.443504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.443504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.713290 (E_RNA) where: Base-Base interactions energy: -1215.414 where: short stacking energy: -490.137 Base-Backbone interact. energy: -2.236 local terms energy: -495.063582 where: bonds (distance) C4'-P energy: -84.630 bonds (distance) P-C4' energy: -97.472 flat angles C4'-P-C4' energy: -108.347 flat angles P-C4'-P energy: -70.631 tors. eta vs tors. theta energy: -133.984 Dist. restrs. and SS energy: 0.520 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1623.975280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.975280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.006844 (E_RNA) where: Base-Base interactions energy: -1194.411 where: short stacking energy: -498.617 Base-Backbone interact. energy: -1.125 local terms energy: -468.470785 where: bonds (distance) C4'-P energy: -88.218 bonds (distance) P-C4' energy: -84.860 flat angles C4'-P-C4' energy: -96.389 flat angles P-C4'-P energy: -61.468 tors. eta vs tors. theta energy: -137.537 Dist. restrs. and SS energy: 3.282 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1617.742311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.742311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.491064 (E_RNA) where: Base-Base interactions energy: -1166.891 where: short stacking energy: -474.018 Base-Backbone interact. energy: -0.609 local terms energy: -487.991603 where: bonds (distance) C4'-P energy: -86.181 bonds (distance) P-C4' energy: -96.424 flat angles C4'-P-C4' energy: -97.335 flat angles P-C4'-P energy: -73.663 tors. eta vs tors. theta energy: -134.389 Dist. restrs. and SS energy: 0.999 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1573.505008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.505008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.886587 (E_RNA) where: Base-Base interactions energy: -1145.747 where: short stacking energy: -480.640 Base-Backbone interact. energy: 3.270 local terms energy: -468.409629 where: bonds (distance) C4'-P energy: -77.613 bonds (distance) P-C4' energy: -82.804 flat angles C4'-P-C4' energy: -107.292 flat angles P-C4'-P energy: -65.068 tors. eta vs tors. theta energy: -135.633 Dist. restrs. and SS energy: 0.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1489.717287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.717287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.466767 (E_RNA) where: Base-Base interactions energy: -1070.993 where: short stacking energy: -436.943 Base-Backbone interact. energy: -0.708 local terms energy: -455.766045 where: bonds (distance) C4'-P energy: -85.413 bonds (distance) P-C4' energy: -92.337 flat angles C4'-P-C4' energy: -93.579 flat angles P-C4'-P energy: -66.467 tors. eta vs tors. theta energy: -117.969 Dist. restrs. and SS energy: 0.999 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1432.086156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.086156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.538988 (E_RNA) where: Base-Base interactions energy: -1059.889 where: short stacking energy: -437.857 Base-Backbone interact. energy: 5.355 local terms energy: -416.004431 where: bonds (distance) C4'-P energy: -62.948 bonds (distance) P-C4' energy: -67.089 flat angles C4'-P-C4' energy: -96.068 flat angles P-C4'-P energy: -70.402 tors. eta vs tors. theta energy: -119.498 Dist. restrs. and SS energy: 1.703 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1405.066965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.066965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.592739 (E_RNA) where: Base-Base interactions energy: -1003.845 where: short stacking energy: -406.999 Base-Backbone interact. energy: -0.657 local terms energy: -440.091064 where: bonds (distance) C4'-P energy: -89.987 bonds (distance) P-C4' energy: -84.762 flat angles C4'-P-C4' energy: -93.373 flat angles P-C4'-P energy: -50.367 tors. eta vs tors. theta energy: -121.602 Dist. restrs. and SS energy: 2.776 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1347.421834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.421834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.006286 (E_RNA) where: Base-Base interactions energy: -992.564 where: short stacking energy: -400.127 Base-Backbone interact. energy: -1.971 local terms energy: -397.471609 where: bonds (distance) C4'-P energy: -70.701 bonds (distance) P-C4' energy: -89.255 flat angles C4'-P-C4' energy: -85.478 flat angles P-C4'-P energy: -40.935 tors. eta vs tors. theta energy: -111.103 Dist. restrs. and SS energy: 7.834 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1371.685640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.685640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.148690 (E_RNA) where: Base-Base interactions energy: -969.806 where: short stacking energy: -402.768 Base-Backbone interact. energy: -1.827 local terms energy: -439.515417 where: bonds (distance) C4'-P energy: -84.359 bonds (distance) P-C4' energy: -83.274 flat angles C4'-P-C4' energy: -90.694 flat angles P-C4'-P energy: -57.341 tors. eta vs tors. theta energy: -123.847 Dist. restrs. and SS energy: 2.713 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -1288.275949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.275949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.209420 (E_RNA) where: Base-Base interactions energy: -942.434 where: short stacking energy: -373.962 Base-Backbone interact. energy: -1.139 local terms energy: -391.637131 where: bonds (distance) C4'-P energy: -81.993 bonds (distance) P-C4' energy: -74.802 flat angles C4'-P-C4' energy: -82.433 flat angles P-C4'-P energy: -53.817 tors. eta vs tors. theta energy: -98.592 Dist. restrs. and SS energy: 10.183 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1665.821610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.821610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.799226 (E_RNA) where: Base-Base interactions energy: -1194.093 where: short stacking energy: -502.266 Base-Backbone interact. energy: -1.393 local terms energy: -508.313297 where: bonds (distance) C4'-P energy: -80.469 bonds (distance) P-C4' energy: -95.768 flat angles C4'-P-C4' energy: -113.928 flat angles P-C4'-P energy: -71.435 tors. eta vs tors. theta energy: -146.714 Dist. restrs. and SS energy: 1.228 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1633.633579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.633579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.648433 (E_RNA) where: Base-Base interactions energy: -1184.880 where: short stacking energy: -493.258 Base-Backbone interact. energy: -2.041 local terms energy: -484.727915 where: bonds (distance) C4'-P energy: -77.501 bonds (distance) P-C4' energy: -94.466 flat angles C4'-P-C4' energy: -104.549 flat angles P-C4'-P energy: -72.184 tors. eta vs tors. theta energy: -136.028 Dist. restrs. and SS energy: 1.265 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1636.157011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.157011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1676.796029 (E_RNA) where: Base-Base interactions energy: -1192.253 where: short stacking energy: -504.252 Base-Backbone interact. energy: -1.071 local terms energy: -483.472350 where: bonds (distance) C4'-P energy: -84.123 bonds (distance) P-C4' energy: -79.063 flat angles C4'-P-C4' energy: -110.837 flat angles P-C4'-P energy: -70.342 tors. eta vs tors. theta energy: -139.107 Dist. restrs. and SS energy: 3.889 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1579.188657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.188657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1616.824475 (E_RNA) where: Base-Base interactions energy: -1152.865 where: short stacking energy: -486.543 Base-Backbone interact. energy: -0.629 local terms energy: -463.331194 where: bonds (distance) C4'-P energy: -85.589 bonds (distance) P-C4' energy: -85.358 flat angles C4'-P-C4' energy: -97.123 flat angles P-C4'-P energy: -62.889 tors. eta vs tors. theta energy: -132.373 Dist. restrs. and SS energy: 0.886 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1464.275213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.275213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.133355 (E_RNA) where: Base-Base interactions energy: -1075.339 where: short stacking energy: -446.671 Base-Backbone interact. energy: 3.393 local terms energy: -430.187383 where: bonds (distance) C4'-P energy: -85.386 bonds (distance) P-C4' energy: -76.598 flat angles C4'-P-C4' energy: -98.835 flat angles P-C4'-P energy: -51.033 tors. eta vs tors. theta energy: -118.336 Dist. restrs. and SS energy: 1.108 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1438.148597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.148597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.422530 (E_RNA) where: Base-Base interactions energy: -1043.567 where: short stacking energy: -435.648 Base-Backbone interact. energy: 0.705 local terms energy: -433.560491 where: bonds (distance) C4'-P energy: -75.249 bonds (distance) P-C4' energy: -87.878 flat angles C4'-P-C4' energy: -86.557 flat angles P-C4'-P energy: -55.428 tors. eta vs tors. theta energy: -128.447 Dist. restrs. and SS energy: 1.524 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1428.721554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.721554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.435116 (E_RNA) where: Base-Base interactions energy: -1041.641 where: short stacking energy: -437.193 Base-Backbone interact. energy: -1.546 local terms energy: -425.248347 where: bonds (distance) C4'-P energy: -83.386 bonds (distance) P-C4' energy: -74.995 flat angles C4'-P-C4' energy: -82.533 flat angles P-C4'-P energy: -58.245 tors. eta vs tors. theta energy: -126.088 Dist. restrs. and SS energy: 2.964 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1371.200232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.200232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.246951 (E_RNA) where: Base-Base interactions energy: -1014.956 where: short stacking energy: -406.708 Base-Backbone interact. energy: -0.020 local terms energy: -394.270454 where: bonds (distance) C4'-P energy: -67.562 bonds (distance) P-C4' energy: -83.651 flat angles C4'-P-C4' energy: -79.988 flat angles P-C4'-P energy: -55.835 tors. eta vs tors. theta energy: -107.234 Dist. restrs. and SS energy: 1.297 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1307.421099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.421099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.784225 (E_RNA) where: Base-Base interactions energy: -950.168 where: short stacking energy: -395.869 Base-Backbone interact. energy: -0.009 local terms energy: -402.607325 where: bonds (distance) C4'-P energy: -80.039 bonds (distance) P-C4' energy: -65.132 flat angles C4'-P-C4' energy: -98.028 flat angles P-C4'-P energy: -52.409 tors. eta vs tors. theta energy: -106.999 Dist. restrs. and SS energy: 8.613 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -1276.833508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.833508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.543743 (E_RNA) where: Base-Base interactions energy: -942.040 where: short stacking energy: -377.729 Base-Backbone interact. energy: -0.614 local terms energy: -381.889024 where: bonds (distance) C4'-P energy: -59.729 bonds (distance) P-C4' energy: -64.860 flat angles C4'-P-C4' energy: -94.418 flat angles P-C4'-P energy: -63.171 tors. eta vs tors. theta energy: -99.712 Dist. restrs. and SS energy: 10.960 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1669.651036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.651036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.436950 (E_RNA) where: Base-Base interactions energy: -1207.185 where: short stacking energy: -511.387 Base-Backbone interact. energy: -0.998 local terms energy: -499.254085 where: bonds (distance) C4'-P energy: -87.818 bonds (distance) P-C4' energy: -89.141 flat angles C4'-P-C4' energy: -104.152 flat angles P-C4'-P energy: -70.969 tors. eta vs tors. theta energy: -147.175 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1636.389734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1636.389734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.652379 (E_RNA) where: Base-Base interactions energy: -1201.484 where: short stacking energy: -493.085 Base-Backbone interact. energy: 0.459 local terms energy: -473.627761 where: bonds (distance) C4'-P energy: -77.573 bonds (distance) P-C4' energy: -86.793 flat angles C4'-P-C4' energy: -101.235 flat angles P-C4'-P energy: -74.719 tors. eta vs tors. theta energy: -133.308 Dist. restrs. and SS energy: 1.513 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1607.087394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.087394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.422900 (E_RNA) where: Base-Base interactions energy: -1170.904 where: short stacking energy: -490.908 Base-Backbone interact. energy: -0.460 local terms energy: -477.058149 where: bonds (distance) C4'-P energy: -85.995 bonds (distance) P-C4' energy: -95.110 flat angles C4'-P-C4' energy: -100.923 flat angles P-C4'-P energy: -64.293 tors. eta vs tors. theta energy: -130.736 Dist. restrs. and SS energy: 4.586 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1596.038124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.038124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.644948 (E_RNA) where: Base-Base interactions energy: -1158.032 where: short stacking energy: -492.467 Base-Backbone interact. energy: -2.506 local terms energy: -473.106620 where: bonds (distance) C4'-P energy: -82.099 bonds (distance) P-C4' energy: -82.808 flat angles C4'-P-C4' energy: -99.895 flat angles P-C4'-P energy: -70.269 tors. eta vs tors. theta energy: -138.035 Dist. restrs. and SS energy: 0.857 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1525.232168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.232168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.353656 (E_RNA) where: Base-Base interactions energy: -1102.519 where: short stacking energy: -464.089 Base-Backbone interact. energy: -0.666 local terms energy: -460.168374 where: bonds (distance) C4'-P energy: -90.741 bonds (distance) P-C4' energy: -85.890 flat angles C4'-P-C4' energy: -98.772 flat angles P-C4'-P energy: -60.718 tors. eta vs tors. theta energy: -124.048 Dist. restrs. and SS energy: 1.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1435.670213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.670213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.606458 (E_RNA) where: Base-Base interactions energy: -1055.576 where: short stacking energy: -430.464 Base-Backbone interact. energy: 1.199 local terms energy: -419.229341 where: bonds (distance) C4'-P energy: -74.084 bonds (distance) P-C4' energy: -76.886 flat angles C4'-P-C4' energy: -90.005 flat angles P-C4'-P energy: -59.561 tors. eta vs tors. theta energy: -118.693 Dist. restrs. and SS energy: 1.186 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1435.696770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.696770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.025779 (E_RNA) where: Base-Base interactions energy: -1045.798 where: short stacking energy: -437.852 Base-Backbone interact. energy: -1.596 local terms energy: -425.632013 where: bonds (distance) C4'-P energy: -70.376 bonds (distance) P-C4' energy: -82.252 flat angles C4'-P-C4' energy: -87.363 flat angles P-C4'-P energy: -62.043 tors. eta vs tors. theta energy: -123.599 Dist. restrs. and SS energy: 0.579 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1374.100200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.100200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.212074 (E_RNA) where: Base-Base interactions energy: -991.525 where: short stacking energy: -416.181 Base-Backbone interact. energy: 0.578 local terms energy: -421.264834 where: bonds (distance) C4'-P energy: -83.607 bonds (distance) P-C4' energy: -65.181 flat angles C4'-P-C4' energy: -87.538 flat angles P-C4'-P energy: -67.280 tors. eta vs tors. theta energy: -117.659 Dist. restrs. and SS energy: 1.362 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1285.482555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.482555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.411207 (E_RNA) where: Base-Base interactions energy: -944.532 where: short stacking energy: -374.403 Base-Backbone interact. energy: -0.374 local terms energy: -392.504443 where: bonds (distance) C4'-P energy: -65.214 bonds (distance) P-C4' energy: -86.156 flat angles C4'-P-C4' energy: -82.144 flat angles P-C4'-P energy: -51.052 tors. eta vs tors. theta energy: -107.938 Dist. restrs. and SS energy: 15.179 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -1239.141736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.141736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.109356 (E_RNA) where: Base-Base interactions energy: -906.880 where: short stacking energy: -366.013 Base-Backbone interact. energy: 8.741 local terms energy: -391.971276 where: bonds (distance) C4'-P energy: -76.118 bonds (distance) P-C4' energy: -62.715 flat angles C4'-P-C4' energy: -93.066 flat angles P-C4'-P energy: -58.123 tors. eta vs tors. theta energy: -101.949 Dist. restrs. and SS energy: 14.218 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1687.490697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.490697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.839573 (E_RNA) where: Base-Base interactions energy: -1209.857 where: short stacking energy: -498.923 Base-Backbone interact. energy: -2.444 local terms energy: -512.539021 where: bonds (distance) C4'-P energy: -101.004 bonds (distance) P-C4' energy: -96.550 flat angles C4'-P-C4' energy: -101.949 flat angles P-C4'-P energy: -69.670 tors. eta vs tors. theta energy: -143.365 Dist. restrs. and SS energy: 0.599 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1682.097356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.097356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1719.560689 (E_RNA) where: Base-Base interactions energy: -1231.337 where: short stacking energy: -513.320 Base-Backbone interact. energy: 0.446 local terms energy: -488.669664 where: bonds (distance) C4'-P energy: -90.251 bonds (distance) P-C4' energy: -94.416 flat angles C4'-P-C4' energy: -101.460 flat angles P-C4'-P energy: -60.219 tors. eta vs tors. theta energy: -142.325 Dist. restrs. and SS energy: 0.713 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1604.476826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.476826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.981036 (E_RNA) where: Base-Base interactions energy: -1172.527 where: short stacking energy: -490.711 Base-Backbone interact. energy: -0.624 local terms energy: -473.829817 where: bonds (distance) C4'-P energy: -74.731 bonds (distance) P-C4' energy: -86.283 flat angles C4'-P-C4' energy: -102.309 flat angles P-C4'-P energy: -71.662 tors. eta vs tors. theta energy: -138.845 Dist. restrs. and SS energy: 5.754 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1533.394513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.394513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.667669 (E_RNA) where: Base-Base interactions energy: -1125.267 where: short stacking energy: -488.989 Base-Backbone interact. energy: -1.667 local terms energy: -444.733364 where: bonds (distance) C4'-P energy: -75.479 bonds (distance) P-C4' energy: -90.345 flat angles C4'-P-C4' energy: -93.076 flat angles P-C4'-P energy: -61.108 tors. eta vs tors. theta energy: -124.725 Dist. restrs. and SS energy: 1.523 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1549.619097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.619097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.320986 (E_RNA) where: Base-Base interactions energy: -1135.194 where: short stacking energy: -466.914 Base-Backbone interact. energy: -0.775 local terms energy: -451.351548 where: bonds (distance) C4'-P energy: -66.820 bonds (distance) P-C4' energy: -89.184 flat angles C4'-P-C4' energy: -99.056 flat angles P-C4'-P energy: -70.808 tors. eta vs tors. theta energy: -125.484 Dist. restrs. and SS energy: 0.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1454.813591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.813591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.112564 (E_RNA) where: Base-Base interactions energy: -1055.956 where: short stacking energy: -442.461 Base-Backbone interact. energy: -0.178 local terms energy: -436.978779 where: bonds (distance) C4'-P energy: -81.182 bonds (distance) P-C4' energy: -84.686 flat angles C4'-P-C4' energy: -85.642 flat angles P-C4'-P energy: -64.748 tors. eta vs tors. theta energy: -120.722 Dist. restrs. and SS energy: 1.549 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1455.708501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.708501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.037375 (E_RNA) where: Base-Base interactions energy: -1041.788 where: short stacking energy: -446.255 Base-Backbone interact. energy: -0.191 local terms energy: -452.058626 where: bonds (distance) C4'-P energy: -78.823 bonds (distance) P-C4' energy: -91.007 flat angles C4'-P-C4' energy: -98.328 flat angles P-C4'-P energy: -61.019 tors. eta vs tors. theta energy: -122.882 Dist. restrs. and SS energy: 1.579 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1394.890068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.890068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.263595 (E_RNA) where: Base-Base interactions energy: -1013.675 where: short stacking energy: -408.032 Base-Backbone interact. energy: -0.609 local terms energy: -418.978854 where: bonds (distance) C4'-P energy: -77.630 bonds (distance) P-C4' energy: -79.370 flat angles C4'-P-C4' energy: -81.642 flat angles P-C4'-P energy: -65.881 tors. eta vs tors. theta energy: -114.456 Dist. restrs. and SS energy: 1.624 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1288.728030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.728030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.919966 (E_RNA) where: Base-Base interactions energy: -957.446 where: short stacking energy: -379.788 Base-Backbone interact. energy: -0.494 local terms energy: -378.979453 where: bonds (distance) C4'-P energy: -72.384 bonds (distance) P-C4' energy: -71.133 flat angles C4'-P-C4' energy: -86.795 flat angles P-C4'-P energy: -37.351 tors. eta vs tors. theta energy: -111.317 Dist. restrs. and SS energy: 11.442 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -1227.398139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.398139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.167765 (E_RNA) where: Base-Base interactions energy: -919.881 where: short stacking energy: -378.515 Base-Backbone interact. energy: 3.577 local terms energy: -363.863724 where: bonds (distance) C4'-P energy: -64.230 bonds (distance) P-C4' energy: -64.875 flat angles C4'-P-C4' energy: -75.519 flat angles P-C4'-P energy: -59.937 tors. eta vs tors. theta energy: -99.303 Dist. restrs. and SS energy: 16.020 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1703.838214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.838214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.515423 (E_RNA) where: Base-Base interactions energy: -1219.383 where: short stacking energy: -513.483 Base-Backbone interact. energy: 1.108 local terms energy: -523.240923 where: bonds (distance) C4'-P energy: -92.426 bonds (distance) P-C4' energy: -101.913 flat angles C4'-P-C4' energy: -107.764 flat angles P-C4'-P energy: -70.345 tors. eta vs tors. theta energy: -150.793 Dist. restrs. and SS energy: 0.927 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1662.097204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.097204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.920907 (E_RNA) where: Base-Base interactions energy: -1210.408 where: short stacking energy: -497.797 Base-Backbone interact. energy: -2.945 local terms energy: -486.568666 where: bonds (distance) C4'-P energy: -90.202 bonds (distance) P-C4' energy: -83.660 flat angles C4'-P-C4' energy: -93.811 flat angles P-C4'-P energy: -71.579 tors. eta vs tors. theta energy: -147.317 Dist. restrs. and SS energy: 1.074 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1596.882190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.882190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.530301 (E_RNA) where: Base-Base interactions energy: -1162.210 where: short stacking energy: -474.787 Base-Backbone interact. energy: 0.256 local terms energy: -476.576681 where: bonds (distance) C4'-P energy: -82.397 bonds (distance) P-C4' energy: -96.622 flat angles C4'-P-C4' energy: -103.998 flat angles P-C4'-P energy: -67.615 tors. eta vs tors. theta energy: -125.945 Dist. restrs. and SS energy: 4.898 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1530.240580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.240580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.774510 (E_RNA) where: Base-Base interactions energy: -1110.529 where: short stacking energy: -464.476 Base-Backbone interact. energy: -2.161 local terms energy: -455.085020 where: bonds (distance) C4'-P energy: -86.621 bonds (distance) P-C4' energy: -83.974 flat angles C4'-P-C4' energy: -95.361 flat angles P-C4'-P energy: -70.891 tors. eta vs tors. theta energy: -118.238 Dist. restrs. and SS energy: 0.784 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1552.735796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.735796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.350753 (E_RNA) where: Base-Base interactions energy: -1118.693 where: short stacking energy: -479.051 Base-Backbone interact. energy: -1.802 local terms energy: -469.855056 where: bonds (distance) C4'-P energy: -86.945 bonds (distance) P-C4' energy: -80.048 flat angles C4'-P-C4' energy: -92.614 flat angles P-C4'-P energy: -66.503 tors. eta vs tors. theta energy: -143.745 Dist. restrs. and SS energy: 0.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1484.753324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.753324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.089152 (E_RNA) where: Base-Base interactions energy: -1088.013 where: short stacking energy: -446.482 Base-Backbone interact. energy: -0.222 local terms energy: -434.854196 where: bonds (distance) C4'-P energy: -80.484 bonds (distance) P-C4' energy: -76.677 flat angles C4'-P-C4' energy: -97.019 flat angles P-C4'-P energy: -63.307 tors. eta vs tors. theta energy: -117.367 Dist. restrs. and SS energy: 1.586 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1455.417968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.417968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.513969 (E_RNA) where: Base-Base interactions energy: -1055.685 where: short stacking energy: -449.879 Base-Backbone interact. energy: -1.267 local terms energy: -436.561886 where: bonds (distance) C4'-P energy: -67.801 bonds (distance) P-C4' energy: -84.334 flat angles C4'-P-C4' energy: -94.067 flat angles P-C4'-P energy: -66.649 tors. eta vs tors. theta energy: -123.711 Dist. restrs. and SS energy: 1.346 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1361.839955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.839955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.806607 (E_RNA) where: Base-Base interactions energy: -1005.370 where: short stacking energy: -408.355 Base-Backbone interact. energy: -0.399 local terms energy: -395.038057 where: bonds (distance) C4'-P energy: -72.893 bonds (distance) P-C4' energy: -73.387 flat angles C4'-P-C4' energy: -88.365 flat angles P-C4'-P energy: -46.502 tors. eta vs tors. theta energy: -113.891 Dist. restrs. and SS energy: 2.217 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1317.964974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.964974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.197697 (E_RNA) where: Base-Base interactions energy: -976.217 where: short stacking energy: -397.363 Base-Backbone interact. energy: 1.094 local terms energy: -391.074117 where: bonds (distance) C4'-P energy: -52.281 bonds (distance) P-C4' energy: -94.683 flat angles C4'-P-C4' energy: -83.963 flat angles P-C4'-P energy: -52.418 tors. eta vs tors. theta energy: -107.729 Dist. restrs. and SS energy: 11.483 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -1214.878782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.878782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.796036 (E_RNA) where: Base-Base interactions energy: -908.251 where: short stacking energy: -366.625 Base-Backbone interact. energy: -1.716 local terms energy: -357.828847 where: bonds (distance) C4'-P energy: -66.125 bonds (distance) P-C4' energy: -65.626 flat angles C4'-P-C4' energy: -75.352 flat angles P-C4'-P energy: -49.979 tors. eta vs tors. theta energy: -100.748 Dist. restrs. and SS energy: 16.167 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1697.944936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.944936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.369164 (E_RNA) where: Base-Base interactions energy: -1236.801 where: short stacking energy: -518.886 Base-Backbone interact. energy: -2.002 local terms energy: -496.565716 where: bonds (distance) C4'-P energy: -79.286 bonds (distance) P-C4' energy: -94.841 flat angles C4'-P-C4' energy: -107.382 flat angles P-C4'-P energy: -66.882 tors. eta vs tors. theta energy: -148.174 Dist. restrs. and SS energy: 0.674 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1674.412755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.412755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.641874 (E_RNA) where: Base-Base interactions energy: -1208.822 where: short stacking energy: -499.938 Base-Backbone interact. energy: -1.962 local terms energy: -500.857767 where: bonds (distance) C4'-P energy: -84.559 bonds (distance) P-C4' energy: -93.853 flat angles C4'-P-C4' energy: -110.668 flat angles P-C4'-P energy: -74.660 tors. eta vs tors. theta energy: -137.117 Dist. restrs. and SS energy: 0.479 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1585.617432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.617432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.478885 (E_RNA) where: Base-Base interactions energy: -1170.838 where: short stacking energy: -470.392 Base-Backbone interact. energy: 0.270 local terms energy: -455.911154 where: bonds (distance) C4'-P energy: -78.342 bonds (distance) P-C4' energy: -87.080 flat angles C4'-P-C4' energy: -101.568 flat angles P-C4'-P energy: -52.349 tors. eta vs tors. theta energy: -136.572 Dist. restrs. and SS energy: 4.111 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1561.407251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1561.407251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.820560 (E_RNA) where: Base-Base interactions energy: -1130.150 where: short stacking energy: -467.058 Base-Backbone interact. energy: -1.462 local terms energy: -467.208915 where: bonds (distance) C4'-P energy: -87.249 bonds (distance) P-C4' energy: -91.537 flat angles C4'-P-C4' energy: -92.335 flat angles P-C4'-P energy: -62.970 tors. eta vs tors. theta energy: -133.118 Dist. restrs. and SS energy: 0.663 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1507.850280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.850280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.111747 (E_RNA) where: Base-Base interactions energy: -1111.270 where: short stacking energy: -468.592 Base-Backbone interact. energy: -0.897 local terms energy: -433.944529 where: bonds (distance) C4'-P energy: -79.130 bonds (distance) P-C4' energy: -77.265 flat angles C4'-P-C4' energy: -93.602 flat angles P-C4'-P energy: -58.122 tors. eta vs tors. theta energy: -125.825 Dist. restrs. and SS energy: 1.511 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1486.953527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.953527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.696640 (E_RNA) where: Base-Base interactions energy: -1088.499 where: short stacking energy: -453.987 Base-Backbone interact. energy: -1.052 local terms energy: -436.145677 where: bonds (distance) C4'-P energy: -66.792 bonds (distance) P-C4' energy: -89.919 flat angles C4'-P-C4' energy: -95.879 flat angles P-C4'-P energy: -55.233 tors. eta vs tors. theta energy: -128.323 Dist. restrs. and SS energy: 1.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1414.967016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.967016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.443149 (E_RNA) where: Base-Base interactions energy: -1027.407 where: short stacking energy: -411.819 Base-Backbone interact. energy: -1.828 local terms energy: -424.208101 where: bonds (distance) C4'-P energy: -81.222 bonds (distance) P-C4' energy: -77.926 flat angles C4'-P-C4' energy: -87.444 flat angles P-C4'-P energy: -66.352 tors. eta vs tors. theta energy: -111.264 Dist. restrs. and SS energy: 1.726 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1398.609939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.609939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.486938 (E_RNA) where: Base-Base interactions energy: -1060.387 where: short stacking energy: -434.661 Base-Backbone interact. energy: 0.021 local terms energy: -386.120752 where: bonds (distance) C4'-P energy: -60.636 bonds (distance) P-C4' energy: -64.465 flat angles C4'-P-C4' energy: -87.136 flat angles P-C4'-P energy: -50.021 tors. eta vs tors. theta energy: -123.862 Dist. restrs. and SS energy: 11.127 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1351.706418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.706418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.141794 (E_RNA) where: Base-Base interactions energy: -977.596 where: short stacking energy: -397.427 Base-Backbone interact. energy: 0.491 local terms energy: -415.036788 where: bonds (distance) C4'-P energy: -75.722 bonds (distance) P-C4' energy: -77.509 flat angles C4'-P-C4' energy: -94.730 flat angles P-C4'-P energy: -56.831 tors. eta vs tors. theta energy: -110.245 Dist. restrs. and SS energy: 3.685 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -1262.792335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.792335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.515655 (E_RNA) where: Base-Base interactions energy: -938.817 where: short stacking energy: -378.921 Base-Backbone interact. energy: 2.764 local terms energy: -375.462753 where: bonds (distance) C4'-P energy: -70.909 bonds (distance) P-C4' energy: -66.250 flat angles C4'-P-C4' energy: -85.129 flat angles P-C4'-P energy: -49.080 tors. eta vs tors. theta energy: -104.094 Dist. restrs. and SS energy: 11.973 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1704.546679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1704.546679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.898969 (E_RNA) where: Base-Base interactions energy: -1228.620 where: short stacking energy: -505.368 Base-Backbone interact. energy: -1.797 local terms energy: -511.481791 where: bonds (distance) C4'-P energy: -80.245 bonds (distance) P-C4' energy: -97.327 flat angles C4'-P-C4' energy: -109.846 flat angles P-C4'-P energy: -73.857 tors. eta vs tors. theta energy: -150.206 Dist. restrs. and SS energy: 0.602 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1647.920597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.920597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.954235 (E_RNA) where: Base-Base interactions energy: -1179.894 where: short stacking energy: -519.175 Base-Backbone interact. energy: 0.030 local terms energy: -506.089958 where: bonds (distance) C4'-P energy: -87.651 bonds (distance) P-C4' energy: -91.565 flat angles C4'-P-C4' energy: -101.753 flat angles P-C4'-P energy: -68.143 tors. eta vs tors. theta energy: -156.979 Dist. restrs. and SS energy: 1.284 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1570.542289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.542289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.523234 (E_RNA) where: Base-Base interactions energy: -1132.284 where: short stacking energy: -486.858 Base-Backbone interact. energy: -0.844 local terms energy: -475.395527 where: bonds (distance) C4'-P energy: -85.140 bonds (distance) P-C4' energy: -74.972 flat angles C4'-P-C4' energy: -93.930 flat angles P-C4'-P energy: -76.003 tors. eta vs tors. theta energy: -145.350 Dist. restrs. and SS energy: 1.231 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1554.954396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.954396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.208410 (E_RNA) where: Base-Base interactions energy: -1128.615 where: short stacking energy: -462.771 Base-Backbone interact. energy: -0.119 local terms energy: -466.473803 where: bonds (distance) C4'-P energy: -97.643 bonds (distance) P-C4' energy: -79.013 flat angles C4'-P-C4' energy: -100.219 flat angles P-C4'-P energy: -61.546 tors. eta vs tors. theta energy: -128.053 Dist. restrs. and SS energy: 3.504 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1513.948824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1513.948824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.697030 (E_RNA) where: Base-Base interactions energy: -1099.710 where: short stacking energy: -445.491 Base-Backbone interact. energy: -0.514 local terms energy: -451.472599 where: bonds (distance) C4'-P energy: -79.621 bonds (distance) P-C4' energy: -75.947 flat angles C4'-P-C4' energy: -94.340 flat angles P-C4'-P energy: -65.906 tors. eta vs tors. theta energy: -135.659 Dist. restrs. and SS energy: 0.998 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1481.338287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.338287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.908980 (E_RNA) where: Base-Base interactions energy: -1074.970 where: short stacking energy: -439.873 Base-Backbone interact. energy: -3.221 local terms energy: -440.717858 where: bonds (distance) C4'-P energy: -78.287 bonds (distance) P-C4' energy: -89.777 flat angles C4'-P-C4' energy: -98.119 flat angles P-C4'-P energy: -44.533 tors. eta vs tors. theta energy: -130.001 Dist. restrs. and SS energy: 0.821 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1410.398445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.398445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.955153 (E_RNA) where: Base-Base interactions energy: -1050.794 where: short stacking energy: -412.429 Base-Backbone interact. energy: -0.714 local terms energy: -396.447616 where: bonds (distance) C4'-P energy: -63.781 bonds (distance) P-C4' energy: -67.995 flat angles C4'-P-C4' energy: -97.944 flat angles P-C4'-P energy: -53.268 tors. eta vs tors. theta energy: -113.459 Dist. restrs. and SS energy: 0.807 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1332.937898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.937898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.645690 (E_RNA) where: Base-Base interactions energy: -981.142 where: short stacking energy: -410.192 Base-Backbone interact. energy: -1.501 local terms energy: -396.003064 where: bonds (distance) C4'-P energy: -85.358 bonds (distance) P-C4' energy: -62.718 flat angles C4'-P-C4' energy: -83.361 flat angles P-C4'-P energy: -50.196 tors. eta vs tors. theta energy: -114.370 Dist. restrs. and SS energy: 8.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1349.613616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.613616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.461033 (E_RNA) where: Base-Base interactions energy: -976.211 where: short stacking energy: -385.659 Base-Backbone interact. energy: 3.876 local terms energy: -416.126020 where: bonds (distance) C4'-P energy: -63.235 bonds (distance) P-C4' energy: -96.028 flat angles C4'-P-C4' energy: -99.432 flat angles P-C4'-P energy: -50.212 tors. eta vs tors. theta energy: -107.219 Dist. restrs. and SS energy: 2.097 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -1260.657799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.657799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.371835 (E_RNA) where: Base-Base interactions energy: -944.797 where: short stacking energy: -383.212 Base-Backbone interact. energy: 0.834 local terms energy: -370.408977 where: bonds (distance) C4'-P energy: -69.323 bonds (distance) P-C4' energy: -63.781 flat angles C4'-P-C4' energy: -88.090 flat angles P-C4'-P energy: -44.071 tors. eta vs tors. theta energy: -105.144 Dist. restrs. and SS energy: 16.964 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1697.020609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.020609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.532870 (E_RNA) where: Base-Base interactions energy: -1229.996 where: short stacking energy: -519.519 Base-Backbone interact. energy: -2.052 local terms energy: -502.485535 where: bonds (distance) C4'-P energy: -91.402 bonds (distance) P-C4' energy: -83.834 flat angles C4'-P-C4' energy: -112.095 flat angles P-C4'-P energy: -67.449 tors. eta vs tors. theta energy: -147.706 Dist. restrs. and SS energy: 0.762 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1642.472049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.472049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.443943 (E_RNA) where: Base-Base interactions energy: -1192.539 where: short stacking energy: -515.057 Base-Backbone interact. energy: -0.724 local terms energy: -487.181114 where: bonds (distance) C4'-P energy: -87.673 bonds (distance) P-C4' energy: -86.275 flat angles C4'-P-C4' energy: -103.882 flat angles P-C4'-P energy: -60.639 tors. eta vs tors. theta energy: -148.712 Dist. restrs. and SS energy: 1.222 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1603.477360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.477360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.063322 (E_RNA) where: Base-Base interactions energy: -1163.908 where: short stacking energy: -482.676 Base-Backbone interact. energy: 0.137 local terms energy: -477.291989 where: bonds (distance) C4'-P energy: -86.036 bonds (distance) P-C4' energy: -99.820 flat angles C4'-P-C4' energy: -98.761 flat angles P-C4'-P energy: -57.795 tors. eta vs tors. theta energy: -134.880 Dist. restrs. and SS energy: 0.836 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1562.255504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.255504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.505757 (E_RNA) where: Base-Base interactions energy: -1137.096 where: short stacking energy: -481.899 Base-Backbone interact. energy: -1.574 local terms energy: -464.835239 where: bonds (distance) C4'-P energy: -86.895 bonds (distance) P-C4' energy: -82.257 flat angles C4'-P-C4' energy: -94.261 flat angles P-C4'-P energy: -67.114 tors. eta vs tors. theta energy: -134.309 Dist. restrs. and SS energy: 4.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1562.871969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.871969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.202531 (E_RNA) where: Base-Base interactions energy: -1144.261 where: short stacking energy: -476.720 Base-Backbone interact. energy: -1.476 local terms energy: -455.465893 where: bonds (distance) C4'-P energy: -93.362 bonds (distance) P-C4' energy: -76.093 flat angles C4'-P-C4' energy: -87.928 flat angles P-C4'-P energy: -70.681 tors. eta vs tors. theta energy: -127.403 Dist. restrs. and SS energy: 1.581 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1468.615791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.615791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.150770 (E_RNA) where: Base-Base interactions energy: -1072.933 where: short stacking energy: -454.935 Base-Backbone interact. energy: 0.032 local terms energy: -433.250315 where: bonds (distance) C4'-P energy: -51.117 bonds (distance) P-C4' energy: -94.714 flat angles C4'-P-C4' energy: -101.393 flat angles P-C4'-P energy: -64.462 tors. eta vs tors. theta energy: -121.564 Dist. restrs. and SS energy: 0.785 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1434.305221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.305221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.357484 (E_RNA) where: Base-Base interactions energy: -1058.199 where: short stacking energy: -418.948 Base-Backbone interact. energy: -2.095 local terms energy: -412.063045 where: bonds (distance) C4'-P energy: -77.181 bonds (distance) P-C4' energy: -69.983 flat angles C4'-P-C4' energy: -96.540 flat angles P-C4'-P energy: -53.910 tors. eta vs tors. theta energy: -114.449 Dist. restrs. and SS energy: 1.302 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1363.423790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.423790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.225629 (E_RNA) where: Base-Base interactions energy: -1009.510 where: short stacking energy: -416.494 Base-Backbone interact. energy: 1.793 local terms energy: -393.508441 where: bonds (distance) C4'-P energy: -60.397 bonds (distance) P-C4' energy: -68.253 flat angles C4'-P-C4' energy: -92.201 flat angles P-C4'-P energy: -59.930 tors. eta vs tors. theta energy: -112.727 Dist. restrs. and SS energy: 1.052 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1298.522356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.522356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.518659 (E_RNA) where: Base-Base interactions energy: -967.056 where: short stacking energy: -411.243 Base-Backbone interact. energy: 0.331 local terms energy: -377.794096 where: bonds (distance) C4'-P energy: -72.052 bonds (distance) P-C4' energy: -63.172 flat angles C4'-P-C4' energy: -80.105 flat angles P-C4'-P energy: -56.260 tors. eta vs tors. theta energy: -106.205 Dist. restrs. and SS energy: 9.246 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1280.896141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.896141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.727702 (E_RNA) where: Base-Base interactions energy: -951.709 where: short stacking energy: -395.663 Base-Backbone interact. energy: -0.899 local terms energy: -381.119103 where: bonds (distance) C4'-P energy: -73.587 bonds (distance) P-C4' energy: -68.671 flat angles C4'-P-C4' energy: -82.368 flat angles P-C4'-P energy: -47.117 tors. eta vs tors. theta energy: -109.377 Dist. restrs. and SS energy: 16.082 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1682.326281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.326281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1720.919209 (E_RNA) where: Base-Base interactions energy: -1206.618 where: short stacking energy: -516.804 Base-Backbone interact. energy: -1.536 local terms energy: -512.764827 where: bonds (distance) C4'-P energy: -94.033 bonds (distance) P-C4' energy: -98.688 flat angles C4'-P-C4' energy: -101.858 flat angles P-C4'-P energy: -69.509 tors. eta vs tors. theta energy: -148.677 Dist. restrs. and SS energy: 1.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1658.983104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.983104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.079258 (E_RNA) where: Base-Base interactions energy: -1209.558 where: short stacking energy: -517.777 Base-Backbone interact. energy: -3.342 local terms energy: -484.179404 where: bonds (distance) C4'-P energy: -78.889 bonds (distance) P-C4' energy: -101.842 flat angles C4'-P-C4' energy: -93.532 flat angles P-C4'-P energy: -70.392 tors. eta vs tors. theta energy: -139.524 Dist. restrs. and SS energy: 1.346 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1613.161357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.161357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.534640 (E_RNA) where: Base-Base interactions energy: -1169.869 where: short stacking energy: -490.051 Base-Backbone interact. energy: -0.429 local terms energy: -483.236565 where: bonds (distance) C4'-P energy: -79.771 bonds (distance) P-C4' energy: -90.636 flat angles C4'-P-C4' energy: -105.260 flat angles P-C4'-P energy: -63.158 tors. eta vs tors. theta energy: -144.412 Dist. restrs. and SS energy: 3.623 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1562.238040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.238040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.332865 (E_RNA) where: Base-Base interactions energy: -1131.825 where: short stacking energy: -478.409 Base-Backbone interact. energy: 0.878 local terms energy: -469.386085 where: bonds (distance) C4'-P energy: -87.059 bonds (distance) P-C4' energy: -90.427 flat angles C4'-P-C4' energy: -98.457 flat angles P-C4'-P energy: -58.505 tors. eta vs tors. theta energy: -134.939 Dist. restrs. and SS energy: 1.345 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1564.049273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.049273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1601.982390 (E_RNA) where: Base-Base interactions energy: -1131.190 where: short stacking energy: -480.548 Base-Backbone interact. energy: 1.081 local terms energy: -471.873058 where: bonds (distance) C4'-P energy: -84.508 bonds (distance) P-C4' energy: -84.151 flat angles C4'-P-C4' energy: -96.782 flat angles P-C4'-P energy: -63.453 tors. eta vs tors. theta energy: -142.979 Dist. restrs. and SS energy: 1.183 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1453.464736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.464736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.649504 (E_RNA) where: Base-Base interactions energy: -1065.483 where: short stacking energy: -427.719 Base-Backbone interact. energy: -1.039 local terms energy: -424.127730 where: bonds (distance) C4'-P energy: -82.851 bonds (distance) P-C4' energy: -67.550 flat angles C4'-P-C4' energy: -86.506 flat angles P-C4'-P energy: -64.104 tors. eta vs tors. theta energy: -123.118 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1407.390662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.390662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.125371 (E_RNA) where: Base-Base interactions energy: -1044.283 where: short stacking energy: -430.913 Base-Backbone interact. energy: -4.353 local terms energy: -396.489086 where: bonds (distance) C4'-P energy: -70.030 bonds (distance) P-C4' energy: -79.021 flat angles C4'-P-C4' energy: -79.719 flat angles P-C4'-P energy: -61.455 tors. eta vs tors. theta energy: -106.264 Dist. restrs. and SS energy: 0.985 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1358.183018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.183018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.543246 (E_RNA) where: Base-Base interactions energy: -1008.234 where: short stacking energy: -405.011 Base-Backbone interact. energy: 1.115 local terms energy: -392.424749 where: bonds (distance) C4'-P energy: -79.568 bonds (distance) P-C4' energy: -74.740 flat angles C4'-P-C4' energy: -89.755 flat angles P-C4'-P energy: -40.993 tors. eta vs tors. theta energy: -107.369 Dist. restrs. and SS energy: 4.610 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1314.071915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.071915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.127941 (E_RNA) where: Base-Base interactions energy: -940.870 where: short stacking energy: -382.406 Base-Backbone interact. energy: -2.447 local terms energy: -418.811145 where: bonds (distance) C4'-P energy: -67.727 bonds (distance) P-C4' energy: -89.268 flat angles C4'-P-C4' energy: -87.358 flat angles P-C4'-P energy: -57.537 tors. eta vs tors. theta energy: -116.921 Dist. restrs. and SS energy: 11.306 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -1243.408684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.408684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.361519 (E_RNA) where: Base-Base interactions energy: -924.842 where: short stacking energy: -369.535 Base-Backbone interact. energy: 1.381 local terms energy: -365.900142 where: bonds (distance) C4'-P energy: -63.155 bonds (distance) P-C4' energy: -69.618 flat angles C4'-P-C4' energy: -80.734 flat angles P-C4'-P energy: -55.716 tors. eta vs tors. theta energy: -96.678 Dist. restrs. and SS energy: 9.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1696.176661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.176661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.283997 (E_RNA) where: Base-Base interactions energy: -1199.149 where: short stacking energy: -517.726 Base-Backbone interact. energy: -0.722 local terms energy: -533.413115 where: bonds (distance) C4'-P energy: -100.195 bonds (distance) P-C4' energy: -99.210 flat angles C4'-P-C4' energy: -105.441 flat angles P-C4'-P energy: -79.126 tors. eta vs tors. theta energy: -149.440 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1672.768995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.768995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.254510 (E_RNA) where: Base-Base interactions energy: -1209.333 where: short stacking energy: -514.869 Base-Backbone interact. energy: -1.778 local terms energy: -499.143313 where: bonds (distance) C4'-P energy: -84.342 bonds (distance) P-C4' energy: -83.117 flat angles C4'-P-C4' energy: -110.921 flat angles P-C4'-P energy: -72.070 tors. eta vs tors. theta energy: -148.694 Dist. restrs. and SS energy: 0.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1594.541931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.541931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.989426 (E_RNA) where: Base-Base interactions energy: -1154.166 where: short stacking energy: -482.419 Base-Backbone interact. energy: -1.927 local terms energy: -479.896390 where: bonds (distance) C4'-P energy: -102.256 bonds (distance) P-C4' energy: -76.373 flat angles C4'-P-C4' energy: -103.898 flat angles P-C4'-P energy: -59.406 tors. eta vs tors. theta energy: -137.963 Dist. restrs. and SS energy: 4.697 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1557.016958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.016958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.959910 (E_RNA) where: Base-Base interactions energy: -1155.155 where: short stacking energy: -495.540 Base-Backbone interact. energy: -3.776 local terms energy: -436.029418 where: bonds (distance) C4'-P energy: -70.088 bonds (distance) P-C4' energy: -89.739 flat angles C4'-P-C4' energy: -94.940 flat angles P-C4'-P energy: -44.866 tors. eta vs tors. theta energy: -136.397 Dist. restrs. and SS energy: 1.193 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1523.161364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.161364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.441732 (E_RNA) where: Base-Base interactions energy: -1107.934 where: short stacking energy: -452.483 Base-Backbone interact. energy: -0.758 local terms energy: -452.749233 where: bonds (distance) C4'-P energy: -73.185 bonds (distance) P-C4' energy: -88.825 flat angles C4'-P-C4' energy: -101.815 flat angles P-C4'-P energy: -64.390 tors. eta vs tors. theta energy: -124.534 Dist. restrs. and SS energy: 1.530 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1439.416439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.416439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.689616 (E_RNA) where: Base-Base interactions energy: -1055.264 where: short stacking energy: -414.381 Base-Backbone interact. energy: -1.600 local terms energy: -420.825068 where: bonds (distance) C4'-P energy: -86.891 bonds (distance) P-C4' energy: -70.900 flat angles C4'-P-C4' energy: -91.660 flat angles P-C4'-P energy: -65.698 tors. eta vs tors. theta energy: -105.675 Dist. restrs. and SS energy: 1.523 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1434.678884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.678884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.772617 (E_RNA) where: Base-Base interactions energy: -1021.898 where: short stacking energy: -439.409 Base-Backbone interact. energy: -1.800 local terms energy: -450.073954 where: bonds (distance) C4'-P energy: -62.446 bonds (distance) P-C4' energy: -92.151 flat angles C4'-P-C4' energy: -104.652 flat angles P-C4'-P energy: -64.701 tors. eta vs tors. theta energy: -126.123 Dist. restrs. and SS energy: 2.344 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1385.482198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.482198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.900168 (E_RNA) where: Base-Base interactions energy: -1023.821 where: short stacking energy: -418.784 Base-Backbone interact. energy: -0.183 local terms energy: -402.896181 where: bonds (distance) C4'-P energy: -63.736 bonds (distance) P-C4' energy: -71.134 flat angles C4'-P-C4' energy: -93.672 flat angles P-C4'-P energy: -61.103 tors. eta vs tors. theta energy: -113.252 Dist. restrs. and SS energy: 4.668 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1336.400122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.400122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.686205 (E_RNA) where: Base-Base interactions energy: -998.282 where: short stacking energy: -406.533 Base-Backbone interact. energy: -0.915 local terms energy: -378.489010 where: bonds (distance) C4'-P energy: -64.846 bonds (distance) P-C4' energy: -79.260 flat angles C4'-P-C4' energy: -88.354 flat angles P-C4'-P energy: -42.652 tors. eta vs tors. theta energy: -103.377 Dist. restrs. and SS energy: 4.536 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1287.389322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.389322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.104228 (E_RNA) where: Base-Base interactions energy: -952.477 where: short stacking energy: -382.042 Base-Backbone interact. energy: -0.510 local terms energy: -382.117018 where: bonds (distance) C4'-P energy: -66.985 bonds (distance) P-C4' energy: -83.821 flat angles C4'-P-C4' energy: -79.105 flat angles P-C4'-P energy: -49.958 tors. eta vs tors. theta energy: -102.248 Dist. restrs. and SS energy: 10.965 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1703.494482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1703.494482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.554465 (E_RNA) where: Base-Base interactions energy: -1240.181 where: short stacking energy: -525.500 Base-Backbone interact. energy: -0.973 local terms energy: -500.400507 where: bonds (distance) C4'-P energy: -97.902 bonds (distance) P-C4' energy: -85.869 flat angles C4'-P-C4' energy: -99.520 flat angles P-C4'-P energy: -67.276 tors. eta vs tors. theta energy: -149.833 Dist. restrs. and SS energy: 1.310 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1658.919640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.919640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.903655 (E_RNA) where: Base-Base interactions energy: -1203.671 where: short stacking energy: -498.492 Base-Backbone interact. energy: -0.669 local terms energy: -492.562861 where: bonds (distance) C4'-P energy: -89.032 bonds (distance) P-C4' energy: -90.496 flat angles C4'-P-C4' energy: -102.834 flat angles P-C4'-P energy: -67.656 tors. eta vs tors. theta energy: -142.544 Dist. restrs. and SS energy: 1.234 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1602.657088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.657088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.342340 (E_RNA) where: Base-Base interactions energy: -1178.102 where: short stacking energy: -496.909 Base-Backbone interact. energy: -2.080 local terms energy: -460.160469 where: bonds (distance) C4'-P energy: -85.410 bonds (distance) P-C4' energy: -85.437 flat angles C4'-P-C4' energy: -97.429 flat angles P-C4'-P energy: -56.307 tors. eta vs tors. theta energy: -135.577 Dist. restrs. and SS energy: 0.935 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1565.966703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.966703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.274493 (E_RNA) where: Base-Base interactions energy: -1124.266 where: short stacking energy: -460.753 Base-Backbone interact. energy: -2.887 local terms energy: -481.121211 where: bonds (distance) C4'-P energy: -91.319 bonds (distance) P-C4' energy: -91.990 flat angles C4'-P-C4' energy: -101.503 flat angles P-C4'-P energy: -63.051 tors. eta vs tors. theta energy: -133.259 Dist. restrs. and SS energy: 5.558 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1526.208790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1526.208790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.124778 (E_RNA) where: Base-Base interactions energy: -1121.388 where: short stacking energy: -460.562 Base-Backbone interact. energy: -1.414 local terms energy: -441.322913 where: bonds (distance) C4'-P energy: -81.734 bonds (distance) P-C4' energy: -75.045 flat angles C4'-P-C4' energy: -90.242 flat angles P-C4'-P energy: -69.464 tors. eta vs tors. theta energy: -124.838 Dist. restrs. and SS energy: 1.166 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1452.755284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.755284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.901703 (E_RNA) where: Base-Base interactions energy: -1054.522 where: short stacking energy: -453.543 Base-Backbone interact. energy: -0.869 local terms energy: -435.510849 where: bonds (distance) C4'-P energy: -84.608 bonds (distance) P-C4' energy: -78.741 flat angles C4'-P-C4' energy: -102.618 flat angles P-C4'-P energy: -50.583 tors. eta vs tors. theta energy: -118.961 Dist. restrs. and SS energy: 1.396 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1409.280162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.280162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.896453 (E_RNA) where: Base-Base interactions energy: -1033.637 where: short stacking energy: -432.883 Base-Backbone interact. energy: -1.092 local terms energy: -413.166780 where: bonds (distance) C4'-P energy: -72.436 bonds (distance) P-C4' energy: -82.413 flat angles C4'-P-C4' energy: -91.023 flat angles P-C4'-P energy: -56.015 tors. eta vs tors. theta energy: -111.280 Dist. restrs. and SS energy: 1.866 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1437.762908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.762908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.768965 (E_RNA) where: Base-Base interactions energy: -1061.600 where: short stacking energy: -443.613 Base-Backbone interact. energy: 1.285 local terms energy: -416.453891 where: bonds (distance) C4'-P energy: -74.351 bonds (distance) P-C4' energy: -72.310 flat angles C4'-P-C4' energy: -90.650 flat angles P-C4'-P energy: -57.909 tors. eta vs tors. theta energy: -121.235 Dist. restrs. and SS energy: 2.256 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1317.606805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.606805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.545198 (E_RNA) where: Base-Base interactions energy: -999.383 where: short stacking energy: -402.013 Base-Backbone interact. energy: 1.181 local terms energy: -360.343329 where: bonds (distance) C4'-P energy: -45.336 bonds (distance) P-C4' energy: -74.914 flat angles C4'-P-C4' energy: -82.174 flat angles P-C4'-P energy: -56.541 tors. eta vs tors. theta energy: -101.378 Dist. restrs. and SS energy: 4.188 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1273.594233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.594233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.136133 (E_RNA) where: Base-Base interactions energy: -942.138 where: short stacking energy: -388.389 Base-Backbone interact. energy: -1.584 local terms energy: -378.414555 where: bonds (distance) C4'-P energy: -66.064 bonds (distance) P-C4' energy: -64.387 flat angles C4'-P-C4' energy: -90.015 flat angles P-C4'-P energy: -47.756 tors. eta vs tors. theta energy: -110.192 Dist. restrs. and SS energy: 11.792 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1695.785442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.785442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.516613 (E_RNA) where: Base-Base interactions energy: -1226.982 where: short stacking energy: -516.704 Base-Backbone interact. energy: -2.830 local terms energy: -504.703818 where: bonds (distance) C4'-P energy: -96.416 bonds (distance) P-C4' energy: -77.974 flat angles C4'-P-C4' energy: -104.371 flat angles P-C4'-P energy: -81.628 tors. eta vs tors. theta energy: -144.316 Dist. restrs. and SS energy: 1.981 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1652.918654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.918654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.025419 (E_RNA) where: Base-Base interactions energy: -1192.772 where: short stacking energy: -503.671 Base-Backbone interact. energy: -0.666 local terms energy: -496.588185 where: bonds (distance) C4'-P energy: -88.952 bonds (distance) P-C4' energy: -86.732 flat angles C4'-P-C4' energy: -101.544 flat angles P-C4'-P energy: -70.549 tors. eta vs tors. theta energy: -148.811 Dist. restrs. and SS energy: 0.357 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1586.285024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.285024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1623.930827 (E_RNA) where: Base-Base interactions energy: -1143.011 where: short stacking energy: -488.297 Base-Backbone interact. energy: -0.990 local terms energy: -479.929782 where: bonds (distance) C4'-P energy: -98.421 bonds (distance) P-C4' energy: -80.912 flat angles C4'-P-C4' energy: -105.993 flat angles P-C4'-P energy: -61.618 tors. eta vs tors. theta energy: -132.986 Dist. restrs. and SS energy: 0.896 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1563.219378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.219378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.050278 (E_RNA) where: Base-Base interactions energy: -1143.055 where: short stacking energy: -454.886 Base-Backbone interact. energy: 2.860 local terms energy: -462.854938 where: bonds (distance) C4'-P energy: -80.863 bonds (distance) P-C4' energy: -86.799 flat angles C4'-P-C4' energy: -95.532 flat angles P-C4'-P energy: -69.370 tors. eta vs tors. theta energy: -130.291 Dist. restrs. and SS energy: 3.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1523.888288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.888288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.457309 (E_RNA) where: Base-Base interactions energy: -1103.802 where: short stacking energy: -483.335 Base-Backbone interact. energy: -3.286 local terms energy: -456.368530 where: bonds (distance) C4'-P energy: -77.181 bonds (distance) P-C4' energy: -81.235 flat angles C4'-P-C4' energy: -100.298 flat angles P-C4'-P energy: -63.511 tors. eta vs tors. theta energy: -134.144 Dist. restrs. and SS energy: 2.819 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1454.350489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.350489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.022463 (E_RNA) where: Base-Base interactions energy: -1071.989 where: short stacking energy: -432.035 Base-Backbone interact. energy: -2.336 local terms energy: -417.697780 where: bonds (distance) C4'-P energy: -74.424 bonds (distance) P-C4' energy: -73.026 flat angles C4'-P-C4' energy: -83.567 flat angles P-C4'-P energy: -65.197 tors. eta vs tors. theta energy: -121.484 Dist. restrs. and SS energy: 0.922 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1422.852402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.852402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.300398 (E_RNA) where: Base-Base interactions energy: -1021.772 where: short stacking energy: -431.486 Base-Backbone interact. energy: -1.778 local terms energy: -437.750345 where: bonds (distance) C4'-P energy: -70.572 bonds (distance) P-C4' energy: -88.263 flat angles C4'-P-C4' energy: -101.284 flat angles P-C4'-P energy: -56.497 tors. eta vs tors. theta energy: -121.135 Dist. restrs. and SS energy: 1.698 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1391.917320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.917320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.280083 (E_RNA) where: Base-Base interactions energy: -1033.061 where: short stacking energy: -432.821 Base-Backbone interact. energy: -1.654 local terms energy: -396.564695 where: bonds (distance) C4'-P energy: -66.329 bonds (distance) P-C4' energy: -74.665 flat angles C4'-P-C4' energy: -91.171 flat angles P-C4'-P energy: -46.101 tors. eta vs tors. theta energy: -118.299 Dist. restrs. and SS energy: 2.613 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1330.003584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.003584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.980936 (E_RNA) where: Base-Base interactions energy: -960.871 where: short stacking energy: -389.543 Base-Backbone interact. energy: -1.450 local terms energy: -406.659468 where: bonds (distance) C4'-P energy: -89.857 bonds (distance) P-C4' energy: -73.996 flat angles C4'-P-C4' energy: -90.354 flat angles P-C4'-P energy: -50.305 tors. eta vs tors. theta energy: -102.148 Dist. restrs. and SS energy: 2.227 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1289.491407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.491407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.943300 (E_RNA) where: Base-Base interactions energy: -968.608 where: short stacking energy: -410.134 Base-Backbone interact. energy: -1.316 local terms energy: -362.019404 where: bonds (distance) C4'-P energy: -59.674 bonds (distance) P-C4' energy: -70.051 flat angles C4'-P-C4' energy: -66.764 flat angles P-C4'-P energy: -47.711 tors. eta vs tors. theta energy: -117.819 Dist. restrs. and SS energy: 5.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1685.034073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.034073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1722.952585 (E_RNA) where: Base-Base interactions energy: -1220.057 where: short stacking energy: -516.130 Base-Backbone interact. energy: -1.762 local terms energy: -501.134179 where: bonds (distance) C4'-P energy: -88.836 bonds (distance) P-C4' energy: -89.500 flat angles C4'-P-C4' energy: -112.612 flat angles P-C4'-P energy: -71.038 tors. eta vs tors. theta energy: -139.148 Dist. restrs. and SS energy: 1.169 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1649.020431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.020431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.383634 (E_RNA) where: Base-Base interactions energy: -1197.787 where: short stacking energy: -495.754 Base-Backbone interact. energy: -3.233 local terms energy: -486.363833 where: bonds (distance) C4'-P energy: -88.947 bonds (distance) P-C4' energy: -84.042 flat angles C4'-P-C4' energy: -101.171 flat angles P-C4'-P energy: -64.438 tors. eta vs tors. theta energy: -147.766 Dist. restrs. and SS energy: 1.613 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1589.398023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.398023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.472963 (E_RNA) where: Base-Base interactions energy: -1157.720 where: short stacking energy: -467.392 Base-Backbone interact. energy: -2.531 local terms energy: -471.222051 where: bonds (distance) C4'-P energy: -104.419 bonds (distance) P-C4' energy: -77.840 flat angles C4'-P-C4' energy: -98.570 flat angles P-C4'-P energy: -67.793 tors. eta vs tors. theta energy: -122.600 Dist. restrs. and SS energy: 5.325 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1575.798496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.798496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.927130 (E_RNA) where: Base-Base interactions energy: -1126.266 where: short stacking energy: -464.460 Base-Backbone interact. energy: -0.799 local terms energy: -486.862228 where: bonds (distance) C4'-P energy: -83.490 bonds (distance) P-C4' energy: -102.725 flat angles C4'-P-C4' energy: -98.541 flat angles P-C4'-P energy: -69.853 tors. eta vs tors. theta energy: -132.253 Dist. restrs. and SS energy: 1.379 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1531.219082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1531.219082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.269338 (E_RNA) where: Base-Base interactions energy: -1116.312 where: short stacking energy: -475.509 Base-Backbone interact. energy: -0.152 local terms energy: -452.805170 where: bonds (distance) C4'-P energy: -83.590 bonds (distance) P-C4' energy: -85.489 flat angles C4'-P-C4' energy: -95.502 flat angles P-C4'-P energy: -62.469 tors. eta vs tors. theta energy: -125.756 Dist. restrs. and SS energy: 1.300 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1474.077730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.077730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.105655 (E_RNA) where: Base-Base interactions energy: -1082.185 where: short stacking energy: -442.998 Base-Backbone interact. energy: -2.954 local terms energy: -427.967138 where: bonds (distance) C4'-P energy: -76.849 bonds (distance) P-C4' energy: -83.272 flat angles C4'-P-C4' energy: -91.811 flat angles P-C4'-P energy: -62.329 tors. eta vs tors. theta energy: -113.706 Dist. restrs. and SS energy: 2.278 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1383.839112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.839112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.271834 (E_RNA) where: Base-Base interactions energy: -1015.174 where: short stacking energy: -417.886 Base-Backbone interact. energy: -3.359 local terms energy: -403.739234 where: bonds (distance) C4'-P energy: -68.839 bonds (distance) P-C4' energy: -72.070 flat angles C4'-P-C4' energy: -90.987 flat angles P-C4'-P energy: -59.872 tors. eta vs tors. theta energy: -111.972 Dist. restrs. and SS energy: 1.683 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1405.412820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.412820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.234740 (E_RNA) where: Base-Base interactions energy: -1028.483 where: short stacking energy: -422.551 Base-Backbone interact. energy: -0.831 local terms energy: -413.920774 where: bonds (distance) C4'-P energy: -83.890 bonds (distance) P-C4' energy: -64.849 flat angles C4'-P-C4' energy: -95.139 flat angles P-C4'-P energy: -62.569 tors. eta vs tors. theta energy: -107.473 Dist. restrs. and SS energy: 1.072 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1336.891596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.891596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.837972 (E_RNA) where: Base-Base interactions energy: -989.639 where: short stacking energy: -401.532 Base-Backbone interact. energy: -2.386 local terms energy: -382.812097 where: bonds (distance) C4'-P energy: -63.221 bonds (distance) P-C4' energy: -79.553 flat angles C4'-P-C4' energy: -72.611 flat angles P-C4'-P energy: -56.830 tors. eta vs tors. theta energy: -110.598 Dist. restrs. and SS energy: 1.196 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -1322.287723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.287723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.307137 (E_RNA) where: Base-Base interactions energy: -979.075 where: short stacking energy: -400.664 Base-Backbone interact. energy: -0.544 local terms energy: -384.687980 where: bonds (distance) C4'-P energy: -61.564 bonds (distance) P-C4' energy: -76.296 flat angles C4'-P-C4' energy: -83.058 flat angles P-C4'-P energy: -52.114 tors. eta vs tors. theta energy: -111.655 Dist. restrs. and SS energy: 5.269 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1689.358482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.358482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.345264 (E_RNA) where: Base-Base interactions energy: -1231.077 where: short stacking energy: -524.707 Base-Backbone interact. energy: 3.158 local terms energy: -499.426197 where: bonds (distance) C4'-P energy: -92.397 bonds (distance) P-C4' energy: -94.969 flat angles C4'-P-C4' energy: -105.208 flat angles P-C4'-P energy: -63.603 tors. eta vs tors. theta energy: -143.249 Dist. restrs. and SS energy: 1.237 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1669.576691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.576691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.738863 (E_RNA) where: Base-Base interactions energy: -1207.401 where: short stacking energy: -517.627 Base-Backbone interact. energy: -0.617 local terms energy: -499.720572 where: bonds (distance) C4'-P energy: -83.404 bonds (distance) P-C4' energy: -85.576 flat angles C4'-P-C4' energy: -111.099 flat angles P-C4'-P energy: -71.489 tors. eta vs tors. theta energy: -148.153 Dist. restrs. and SS energy: 1.412 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1592.335200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.335200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.820511 (E_RNA) where: Base-Base interactions energy: -1149.519 where: short stacking energy: -461.410 Base-Backbone interact. energy: 2.501 local terms energy: -485.802828 where: bonds (distance) C4'-P energy: -73.943 bonds (distance) P-C4' energy: -96.051 flat angles C4'-P-C4' energy: -109.890 flat angles P-C4'-P energy: -83.249 tors. eta vs tors. theta energy: -122.671 Dist. restrs. and SS energy: 3.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1546.975123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.975123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.969606 (E_RNA) where: Base-Base interactions energy: -1111.912 where: short stacking energy: -453.726 Base-Backbone interact. energy: -1.176 local terms energy: -471.882068 where: bonds (distance) C4'-P energy: -92.830 bonds (distance) P-C4' energy: -87.153 flat angles C4'-P-C4' energy: -90.826 flat angles P-C4'-P energy: -72.644 tors. eta vs tors. theta energy: -128.429 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1535.953331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.953331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.888465 (E_RNA) where: Base-Base interactions energy: -1129.952 where: short stacking energy: -462.293 Base-Backbone interact. energy: -2.956 local terms energy: -440.980403 where: bonds (distance) C4'-P energy: -81.762 bonds (distance) P-C4' energy: -84.740 flat angles C4'-P-C4' energy: -92.836 flat angles P-C4'-P energy: -56.764 tors. eta vs tors. theta energy: -124.878 Dist. restrs. and SS energy: 1.185 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1477.075746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.075746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.917287 (E_RNA) where: Base-Base interactions energy: -1065.055 where: short stacking energy: -430.097 Base-Backbone interact. energy: 1.136 local terms energy: -450.998583 where: bonds (distance) C4'-P energy: -82.508 bonds (distance) P-C4' energy: -86.729 flat angles C4'-P-C4' energy: -95.378 flat angles P-C4'-P energy: -72.049 tors. eta vs tors. theta energy: -114.334 Dist. restrs. and SS energy: 1.092 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1435.279007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.279007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.928888 (E_RNA) where: Base-Base interactions energy: -1049.990 where: short stacking energy: -432.037 Base-Backbone interact. energy: 0.416 local terms energy: -423.354794 where: bonds (distance) C4'-P energy: -71.704 bonds (distance) P-C4' energy: -82.331 flat angles C4'-P-C4' energy: -101.015 flat angles P-C4'-P energy: -55.890 tors. eta vs tors. theta energy: -112.415 Dist. restrs. and SS energy: 0.900 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1389.946522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.946522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.482272 (E_RNA) where: Base-Base interactions energy: -1015.198 where: short stacking energy: -417.728 Base-Backbone interact. energy: -3.299 local terms energy: -408.985826 where: bonds (distance) C4'-P energy: -76.938 bonds (distance) P-C4' energy: -76.731 flat angles C4'-P-C4' energy: -88.550 flat angles P-C4'-P energy: -51.288 tors. eta vs tors. theta energy: -115.479 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1377.175556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.175556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.473865 (E_RNA) where: Base-Base interactions energy: -997.486 where: short stacking energy: -399.461 Base-Backbone interact. energy: 2.619 local terms energy: -421.606535 where: bonds (distance) C4'-P energy: -74.088 bonds (distance) P-C4' energy: -80.987 flat angles C4'-P-C4' energy: -81.905 flat angles P-C4'-P energy: -62.723 tors. eta vs tors. theta energy: -121.903 Dist. restrs. and SS energy: 2.548 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1315.749328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.749328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.317434 (E_RNA) where: Base-Base interactions energy: -953.432 where: short stacking energy: -385.467 Base-Backbone interact. energy: -2.732 local terms energy: -402.152979 where: bonds (distance) C4'-P energy: -61.226 bonds (distance) P-C4' energy: -79.311 flat angles C4'-P-C4' energy: -85.064 flat angles P-C4'-P energy: -60.255 tors. eta vs tors. theta energy: -116.297 Dist. restrs. and SS energy: 5.818 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1681.176877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.176877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.423717 (E_RNA) where: Base-Base interactions energy: -1228.356 where: short stacking energy: -522.052 Base-Backbone interact. energy: -1.471 local terms energy: -488.597151 where: bonds (distance) C4'-P energy: -85.880 bonds (distance) P-C4' energy: -90.759 flat angles C4'-P-C4' energy: -97.768 flat angles P-C4'-P energy: -72.395 tors. eta vs tors. theta energy: -141.796 Dist. restrs. and SS energy: 0.497 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1673.253961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.253961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.037782 (E_RNA) where: Base-Base interactions energy: -1212.560 where: short stacking energy: -512.160 Base-Backbone interact. energy: -0.578 local terms energy: -497.899634 where: bonds (distance) C4'-P energy: -91.474 bonds (distance) P-C4' energy: -87.140 flat angles C4'-P-C4' energy: -111.328 flat angles P-C4'-P energy: -67.636 tors. eta vs tors. theta energy: -140.321 Dist. restrs. and SS energy: 1.034 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1569.560022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.560022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.583648 (E_RNA) where: Base-Base interactions energy: -1139.599 where: short stacking energy: -455.562 Base-Backbone interact. energy: -2.448 local terms energy: -465.535930 where: bonds (distance) C4'-P energy: -89.988 bonds (distance) P-C4' energy: -87.431 flat angles C4'-P-C4' energy: -99.765 flat angles P-C4'-P energy: -68.427 tors. eta vs tors. theta energy: -119.925 Dist. restrs. and SS energy: 1.274 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1552.725763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.725763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.282554 (E_RNA) where: Base-Base interactions energy: -1121.211 where: short stacking energy: -461.747 Base-Backbone interact. energy: -2.510 local terms energy: -466.561485 where: bonds (distance) C4'-P energy: -74.542 bonds (distance) P-C4' energy: -89.278 flat angles C4'-P-C4' energy: -96.489 flat angles P-C4'-P energy: -75.359 tors. eta vs tors. theta energy: -130.893 Dist. restrs. and SS energy: 0.807 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1540.227427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.227427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.470914 (E_RNA) where: Base-Base interactions energy: -1134.293 where: short stacking energy: -458.896 Base-Backbone interact. energy: -0.893 local terms energy: -443.284875 where: bonds (distance) C4'-P energy: -68.971 bonds (distance) P-C4' energy: -82.241 flat angles C4'-P-C4' energy: -92.850 flat angles P-C4'-P energy: -75.869 tors. eta vs tors. theta energy: -123.354 Dist. restrs. and SS energy: 1.493 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1469.020152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.020152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.208667 (E_RNA) where: Base-Base interactions energy: -1044.711 where: short stacking energy: -438.966 Base-Backbone interact. energy: 1.478 local terms energy: -463.975794 where: bonds (distance) C4'-P energy: -89.452 bonds (distance) P-C4' energy: -91.993 flat angles C4'-P-C4' energy: -109.204 flat angles P-C4'-P energy: -56.037 tors. eta vs tors. theta energy: -117.289 Dist. restrs. and SS energy: 1.439 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1426.925813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.925813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.633361 (E_RNA) where: Base-Base interactions energy: -1032.131 where: short stacking energy: -412.501 Base-Backbone interact. energy: 0.340 local terms energy: -433.842047 where: bonds (distance) C4'-P energy: -77.430 bonds (distance) P-C4' energy: -73.851 flat angles C4'-P-C4' energy: -92.487 flat angles P-C4'-P energy: -75.203 tors. eta vs tors. theta energy: -114.871 Dist. restrs. and SS energy: 1.958 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1396.935276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1396.935276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.632480 (E_RNA) where: Base-Base interactions energy: -1014.972 where: short stacking energy: -424.812 Base-Backbone interact. energy: -1.651 local terms energy: -419.009286 where: bonds (distance) C4'-P energy: -80.589 bonds (distance) P-C4' energy: -81.509 flat angles C4'-P-C4' energy: -84.324 flat angles P-C4'-P energy: -58.332 tors. eta vs tors. theta energy: -114.255 Dist. restrs. and SS energy: 1.947 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1367.510772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.510772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.425528 (E_RNA) where: Base-Base interactions energy: -999.597 where: short stacking energy: -414.729 Base-Backbone interact. energy: 1.836 local terms energy: -407.664773 where: bonds (distance) C4'-P energy: -71.562 bonds (distance) P-C4' energy: -79.082 flat angles C4'-P-C4' energy: -86.988 flat angles P-C4'-P energy: -52.191 tors. eta vs tors. theta energy: -117.842 Dist. restrs. and SS energy: 1.165 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1295.517188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.517188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.964848 (E_RNA) where: Base-Base interactions energy: -960.196 where: short stacking energy: -371.587 Base-Backbone interact. energy: 1.220 local terms energy: -374.989420 where: bonds (distance) C4'-P energy: -75.225 bonds (distance) P-C4' energy: -74.317 flat angles C4'-P-C4' energy: -86.517 flat angles P-C4'-P energy: -44.692 tors. eta vs tors. theta energy: -94.238 Dist. restrs. and SS energy: 1.698 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1669.446835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.446835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.897850 (E_RNA) where: Base-Base interactions energy: -1190.985 where: short stacking energy: -487.967 Base-Backbone interact. energy: -2.133 local terms energy: -513.779455 where: bonds (distance) C4'-P energy: -99.306 bonds (distance) P-C4' energy: -94.656 flat angles C4'-P-C4' energy: -103.768 flat angles P-C4'-P energy: -71.057 tors. eta vs tors. theta energy: -144.992 Dist. restrs. and SS energy: 0.701 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1679.885655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.885655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.152946 (E_RNA) where: Base-Base interactions energy: -1210.216 where: short stacking energy: -505.319 Base-Backbone interact. energy: -0.300 local terms energy: -506.637256 where: bonds (distance) C4'-P energy: -93.200 bonds (distance) P-C4' energy: -95.032 flat angles C4'-P-C4' energy: -108.923 flat angles P-C4'-P energy: -66.025 tors. eta vs tors. theta energy: -143.457 Dist. restrs. and SS energy: 0.517 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1576.634192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.634192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.577246 (E_RNA) where: Base-Base interactions energy: -1166.248 where: short stacking energy: -477.883 Base-Backbone interact. energy: -0.115 local terms energy: -448.214322 where: bonds (distance) C4'-P energy: -80.033 bonds (distance) P-C4' energy: -97.033 flat angles C4'-P-C4' energy: -97.076 flat angles P-C4'-P energy: -48.075 tors. eta vs tors. theta energy: -125.997 Dist. restrs. and SS energy: 1.193 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1580.511948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.511948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.728177 (E_RNA) where: Base-Base interactions energy: -1149.818 where: short stacking energy: -468.531 Base-Backbone interact. energy: -2.003 local terms energy: -465.907018 where: bonds (distance) C4'-P energy: -73.621 bonds (distance) P-C4' energy: -90.857 flat angles C4'-P-C4' energy: -102.968 flat angles P-C4'-P energy: -70.571 tors. eta vs tors. theta energy: -127.889 Dist. restrs. and SS energy: 0.466 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1548.139993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.139993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.996069 (E_RNA) where: Base-Base interactions energy: -1141.096 where: short stacking energy: -455.313 Base-Backbone interact. energy: -0.873 local terms energy: -444.026415 where: bonds (distance) C4'-P energy: -83.805 bonds (distance) P-C4' energy: -92.263 flat angles C4'-P-C4' energy: -90.604 flat angles P-C4'-P energy: -53.219 tors. eta vs tors. theta energy: -124.134 Dist. restrs. and SS energy: 1.106 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1478.525328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.525328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.684544 (E_RNA) where: Base-Base interactions energy: -1085.127 where: short stacking energy: -463.054 Base-Backbone interact. energy: -0.922 local terms energy: -430.635028 where: bonds (distance) C4'-P energy: -83.530 bonds (distance) P-C4' energy: -70.817 flat angles C4'-P-C4' energy: -91.827 flat angles P-C4'-P energy: -56.732 tors. eta vs tors. theta energy: -127.728 Dist. restrs. and SS energy: 1.409 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1405.893473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.893473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.429493 (E_RNA) where: Base-Base interactions energy: -1035.846 where: short stacking energy: -423.339 Base-Backbone interact. energy: 1.262 local terms energy: -408.845713 where: bonds (distance) C4'-P energy: -85.650 bonds (distance) P-C4' energy: -71.867 flat angles C4'-P-C4' energy: -79.515 flat angles P-C4'-P energy: -52.326 tors. eta vs tors. theta energy: -119.487 Dist. restrs. and SS energy: 0.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1383.600864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.600864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.448788 (E_RNA) where: Base-Base interactions energy: -1016.277 where: short stacking energy: -422.054 Base-Backbone interact. energy: 2.113 local terms energy: -407.285028 where: bonds (distance) C4'-P energy: -70.776 bonds (distance) P-C4' energy: -63.135 flat angles C4'-P-C4' energy: -98.044 flat angles P-C4'-P energy: -54.529 tors. eta vs tors. theta energy: -120.801 Dist. restrs. and SS energy: 1.098 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1367.659331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.659331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.803077 (E_RNA) where: Base-Base interactions energy: -1005.300 where: short stacking energy: -411.362 Base-Backbone interact. energy: -1.645 local terms energy: -398.857798 where: bonds (distance) C4'-P energy: -68.441 bonds (distance) P-C4' energy: -70.782 flat angles C4'-P-C4' energy: -89.388 flat angles P-C4'-P energy: -58.241 tors. eta vs tors. theta energy: -112.006 Dist. restrs. and SS energy: 1.394 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1309.744429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.744429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.966002 (E_RNA) where: Base-Base interactions energy: -961.709 where: short stacking energy: -396.827 Base-Backbone interact. energy: -0.143 local terms energy: -387.114035 where: bonds (distance) C4'-P energy: -64.237 bonds (distance) P-C4' energy: -68.251 flat angles C4'-P-C4' energy: -91.412 flat angles P-C4'-P energy: -65.372 tors. eta vs tors. theta energy: -97.843 Dist. restrs. and SS energy: 2.472 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1690.277685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.277685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.448471 (E_RNA) where: Base-Base interactions energy: -1220.596 where: short stacking energy: -523.552 Base-Backbone interact. energy: -3.574 local terms energy: -503.279024 where: bonds (distance) C4'-P energy: -85.836 bonds (distance) P-C4' energy: -93.687 flat angles C4'-P-C4' energy: -103.133 flat angles P-C4'-P energy: -66.929 tors. eta vs tors. theta energy: -153.694 Dist. restrs. and SS energy: 0.421 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1640.203103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.203103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.989312 (E_RNA) where: Base-Base interactions energy: -1188.891 where: short stacking energy: -479.779 Base-Backbone interact. energy: -2.070 local terms energy: -487.028158 where: bonds (distance) C4'-P energy: -88.195 bonds (distance) P-C4' energy: -91.180 flat angles C4'-P-C4' energy: -103.681 flat angles P-C4'-P energy: -68.640 tors. eta vs tors. theta energy: -135.332 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1627.823169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1627.823169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.906908 (E_RNA) where: Base-Base interactions energy: -1204.017 where: short stacking energy: -484.332 Base-Backbone interact. energy: -2.014 local terms energy: -459.876298 where: bonds (distance) C4'-P energy: -86.674 bonds (distance) P-C4' energy: -74.773 flat angles C4'-P-C4' energy: -100.918 flat angles P-C4'-P energy: -64.361 tors. eta vs tors. theta energy: -133.151 Dist. restrs. and SS energy: 1.334 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1557.348277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.348277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.979333 (E_RNA) where: Base-Base interactions energy: -1111.127 where: short stacking energy: -476.915 Base-Backbone interact. energy: -0.783 local terms energy: -483.069526 where: bonds (distance) C4'-P energy: -84.643 bonds (distance) P-C4' energy: -97.311 flat angles C4'-P-C4' energy: -94.765 flat angles P-C4'-P energy: -75.843 tors. eta vs tors. theta energy: -130.507 Dist. restrs. and SS energy: 0.881 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1555.984988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.984988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.330977 (E_RNA) where: Base-Base interactions energy: -1137.273 where: short stacking energy: -468.954 Base-Backbone interact. energy: -0.800 local terms energy: -456.258041 where: bonds (distance) C4'-P energy: -88.282 bonds (distance) P-C4' energy: -79.620 flat angles C4'-P-C4' energy: -91.888 flat angles P-C4'-P energy: -58.539 tors. eta vs tors. theta energy: -137.929 Dist. restrs. and SS energy: 1.596 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1478.440317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.440317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.861985 (E_RNA) where: Base-Base interactions energy: -1089.216 where: short stacking energy: -450.409 Base-Backbone interact. energy: -1.364 local terms energy: -427.282095 where: bonds (distance) C4'-P energy: -83.121 bonds (distance) P-C4' energy: -65.020 flat angles C4'-P-C4' energy: -99.538 flat angles P-C4'-P energy: -54.110 tors. eta vs tors. theta energy: -125.494 Dist. restrs. and SS energy: 2.672 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1434.875456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.875456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.169147 (E_RNA) where: Base-Base interactions energy: -1037.646 where: short stacking energy: -431.799 Base-Backbone interact. energy: -1.418 local terms energy: -434.105542 where: bonds (distance) C4'-P energy: -73.998 bonds (distance) P-C4' energy: -80.305 flat angles C4'-P-C4' energy: -91.629 flat angles P-C4'-P energy: -64.111 tors. eta vs tors. theta energy: -124.063 Dist. restrs. and SS energy: 1.544 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1407.600488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.600488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.203901 (E_RNA) where: Base-Base interactions energy: -1037.783 where: short stacking energy: -422.991 Base-Backbone interact. energy: -2.291 local terms energy: -405.130436 where: bonds (distance) C4'-P energy: -69.972 bonds (distance) P-C4' energy: -75.851 flat angles C4'-P-C4' energy: -101.488 flat angles P-C4'-P energy: -49.402 tors. eta vs tors. theta energy: -108.417 Dist. restrs. and SS energy: 0.853 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1349.448232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.448232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.235592 (E_RNA) where: Base-Base interactions energy: -1018.109 where: short stacking energy: -404.978 Base-Backbone interact. energy: 3.102 local terms energy: -373.227965 where: bonds (distance) C4'-P energy: -43.242 bonds (distance) P-C4' energy: -66.288 flat angles C4'-P-C4' energy: -88.204 flat angles P-C4'-P energy: -61.631 tors. eta vs tors. theta energy: -113.863 Dist. restrs. and SS energy: 2.037 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1275.226844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.226844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.627646 (E_RNA) where: Base-Base interactions energy: -963.949 where: short stacking energy: -400.547 Base-Backbone interact. energy: -0.315 local terms energy: -349.362843 where: bonds (distance) C4'-P energy: -64.231 bonds (distance) P-C4' energy: -55.939 flat angles C4'-P-C4' energy: -79.392 flat angles P-C4'-P energy: -46.149 tors. eta vs tors. theta energy: -103.652 Dist. restrs. and SS energy: 1.651 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1698.845878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1698.845878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.450550 (E_RNA) where: Base-Base interactions energy: -1223.239 where: short stacking energy: -532.675 Base-Backbone interact. energy: -1.215 local terms energy: -511.996063 where: bonds (distance) C4'-P energy: -80.744 bonds (distance) P-C4' energy: -96.974 flat angles C4'-P-C4' energy: -108.915 flat angles P-C4'-P energy: -74.339 tors. eta vs tors. theta energy: -151.024 Dist. restrs. and SS energy: 0.855 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1662.350365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.350365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.387010 (E_RNA) where: Base-Base interactions energy: -1200.038 where: short stacking energy: -516.695 Base-Backbone interact. energy: -1.297 local terms energy: -498.052083 where: bonds (distance) C4'-P energy: -93.163 bonds (distance) P-C4' energy: -91.352 flat angles C4'-P-C4' energy: -102.547 flat angles P-C4'-P energy: -68.507 tors. eta vs tors. theta energy: -142.483 Dist. restrs. and SS energy: 0.287 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1643.323872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.323872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.880471 (E_RNA) where: Base-Base interactions energy: -1228.217 where: short stacking energy: -476.185 Base-Backbone interact. energy: -1.292 local terms energy: -452.371671 where: bonds (distance) C4'-P energy: -79.603 bonds (distance) P-C4' energy: -90.706 flat angles C4'-P-C4' energy: -96.037 flat angles P-C4'-P energy: -64.538 tors. eta vs tors. theta energy: -121.487 Dist. restrs. and SS energy: 1.807 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1580.538678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.538678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1618.524638 (E_RNA) where: Base-Base interactions energy: -1163.946 where: short stacking energy: -467.899 Base-Backbone interact. energy: 2.702 local terms energy: -457.279922 where: bonds (distance) C4'-P energy: -87.549 bonds (distance) P-C4' energy: -93.757 flat angles C4'-P-C4' energy: -95.945 flat angles P-C4'-P energy: -57.366 tors. eta vs tors. theta energy: -122.662 Dist. restrs. and SS energy: 1.236 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1530.953696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.953696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.076261 (E_RNA) where: Base-Base interactions energy: -1115.797 where: short stacking energy: -444.275 Base-Backbone interact. energy: -4.084 local terms energy: -449.195349 where: bonds (distance) C4'-P energy: -85.238 bonds (distance) P-C4' energy: -80.525 flat angles C4'-P-C4' energy: -92.022 flat angles P-C4'-P energy: -61.831 tors. eta vs tors. theta energy: -129.580 Dist. restrs. and SS energy: 1.373 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1470.664572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.664572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.640284 (E_RNA) where: Base-Base interactions energy: -1077.768 where: short stacking energy: -456.800 Base-Backbone interact. energy: -0.671 local terms energy: -431.200630 where: bonds (distance) C4'-P energy: -78.926 bonds (distance) P-C4' energy: -78.089 flat angles C4'-P-C4' energy: -98.411 flat angles P-C4'-P energy: -53.400 tors. eta vs tors. theta energy: -122.374 Dist. restrs. and SS energy: 2.226 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1419.733110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.733110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.994761 (E_RNA) where: Base-Base interactions energy: -1050.377 where: short stacking energy: -424.464 Base-Backbone interact. energy: 0.029 local terms energy: -408.646821 where: bonds (distance) C4'-P energy: -56.729 bonds (distance) P-C4' energy: -78.913 flat angles C4'-P-C4' energy: -92.673 flat angles P-C4'-P energy: -57.736 tors. eta vs tors. theta energy: -122.596 Dist. restrs. and SS energy: 2.512 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1394.075470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.075470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.638054 (E_RNA) where: Base-Base interactions energy: -1012.546 where: short stacking energy: -402.351 Base-Backbone interact. energy: -0.879 local terms energy: -419.213381 where: bonds (distance) C4'-P energy: -75.028 bonds (distance) P-C4' energy: -75.916 flat angles C4'-P-C4' energy: -93.051 flat angles P-C4'-P energy: -58.983 tors. eta vs tors. theta energy: -116.236 Dist. restrs. and SS energy: 1.813 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1340.797172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.797172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.085178 (E_RNA) where: Base-Base interactions energy: -993.431 where: short stacking energy: -392.727 Base-Backbone interact. energy: -0.509 local terms energy: -385.145843 where: bonds (distance) C4'-P energy: -64.437 bonds (distance) P-C4' energy: -71.747 flat angles C4'-P-C4' energy: -73.450 flat angles P-C4'-P energy: -62.429 tors. eta vs tors. theta energy: -113.083 Dist. restrs. and SS energy: 1.538 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1271.999842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.999842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.503544 (E_RNA) where: Base-Base interactions energy: -962.900 where: short stacking energy: -378.879 Base-Backbone interact. energy: 0.362 local terms energy: -348.965044 where: bonds (distance) C4'-P energy: -71.107 bonds (distance) P-C4' energy: -84.760 flat angles C4'-P-C4' energy: -71.207 flat angles P-C4'-P energy: -34.556 tors. eta vs tors. theta energy: -87.335 Dist. restrs. and SS energy: 2.754 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1693.370660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.370660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.573667 (E_RNA) where: Base-Base interactions energy: -1214.669 where: short stacking energy: -511.058 Base-Backbone interact. energy: -0.506 local terms energy: -515.399196 where: bonds (distance) C4'-P energy: -91.318 bonds (distance) P-C4' energy: -92.203 flat angles C4'-P-C4' energy: -105.554 flat angles P-C4'-P energy: -72.125 tors. eta vs tors. theta energy: -154.199 Dist. restrs. and SS energy: 0.453 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1624.933263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1624.933263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.605687 (E_RNA) where: Base-Base interactions energy: -1161.650 where: short stacking energy: -498.306 Base-Backbone interact. energy: -1.786 local terms energy: -501.169436 where: bonds (distance) C4'-P energy: -91.136 bonds (distance) P-C4' energy: -98.643 flat angles C4'-P-C4' energy: -107.210 flat angles P-C4'-P energy: -64.579 tors. eta vs tors. theta energy: -139.601 Dist. restrs. and SS energy: 2.922 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1607.537448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.537448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.554520 (E_RNA) where: Base-Base interactions energy: -1170.647 where: short stacking energy: -473.313 Base-Backbone interact. energy: -0.465 local terms energy: -474.442975 where: bonds (distance) C4'-P energy: -91.954 bonds (distance) P-C4' energy: -96.650 flat angles C4'-P-C4' energy: -93.705 flat angles P-C4'-P energy: -65.696 tors. eta vs tors. theta energy: -126.438 Dist. restrs. and SS energy: 1.267 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1577.405656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.405656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.377734 (E_RNA) where: Base-Base interactions energy: -1162.651 where: short stacking energy: -463.000 Base-Backbone interact. energy: -0.667 local terms energy: -452.060614 where: bonds (distance) C4'-P energy: -81.542 bonds (distance) P-C4' energy: -71.155 flat angles C4'-P-C4' energy: -105.250 flat angles P-C4'-P energy: -61.897 tors. eta vs tors. theta energy: -132.218 Dist. restrs. and SS energy: 1.222 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1530.658435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.658435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.987122 (E_RNA) where: Base-Base interactions energy: -1123.764 where: short stacking energy: -474.648 Base-Backbone interact. energy: -2.311 local terms energy: -443.911821 where: bonds (distance) C4'-P energy: -89.380 bonds (distance) P-C4' energy: -72.890 flat angles C4'-P-C4' energy: -87.210 flat angles P-C4'-P energy: -55.490 tors. eta vs tors. theta energy: -138.942 Dist. restrs. and SS energy: 2.579 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1486.622720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.622720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.139800 (E_RNA) where: Base-Base interactions energy: -1051.874 where: short stacking energy: -442.941 Base-Backbone interact. energy: -0.221 local terms energy: -473.044742 where: bonds (distance) C4'-P energy: -90.966 bonds (distance) P-C4' energy: -83.992 flat angles C4'-P-C4' energy: -98.084 flat angles P-C4'-P energy: -71.257 tors. eta vs tors. theta energy: -128.746 Dist. restrs. and SS energy: 1.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1421.876536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.876536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.231785 (E_RNA) where: Base-Base interactions energy: -1034.425 where: short stacking energy: -433.300 Base-Backbone interact. energy: 0.380 local terms energy: -426.186617 where: bonds (distance) C4'-P energy: -65.321 bonds (distance) P-C4' energy: -76.211 flat angles C4'-P-C4' energy: -97.275 flat angles P-C4'-P energy: -67.667 tors. eta vs tors. theta energy: -119.713 Dist. restrs. and SS energy: 1.605 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1415.784020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.784020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.210664 (E_RNA) where: Base-Base interactions energy: -1037.362 where: short stacking energy: -427.172 Base-Backbone interact. energy: -1.181 local terms energy: -415.667585 where: bonds (distance) C4'-P energy: -77.768 bonds (distance) P-C4' energy: -79.934 flat angles C4'-P-C4' energy: -85.463 flat angles P-C4'-P energy: -59.196 tors. eta vs tors. theta energy: -113.306 Dist. restrs. and SS energy: 1.677 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1353.258880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.258880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.825088 (E_RNA) where: Base-Base interactions energy: -1000.375 where: short stacking energy: -403.593 Base-Backbone interact. energy: -3.223 local terms energy: -388.226792 where: bonds (distance) C4'-P energy: -64.067 bonds (distance) P-C4' energy: -78.304 flat angles C4'-P-C4' energy: -82.093 flat angles P-C4'-P energy: -51.278 tors. eta vs tors. theta energy: -112.484 Dist. restrs. and SS energy: 1.816 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1316.888514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.888514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.745905 (E_RNA) where: Base-Base interactions energy: -970.614 where: short stacking energy: -376.155 Base-Backbone interact. energy: 3.061 local terms energy: -388.192956 where: bonds (distance) C4'-P energy: -74.974 bonds (distance) P-C4' energy: -67.954 flat angles C4'-P-C4' energy: -96.863 flat angles P-C4'-P energy: -59.592 tors. eta vs tors. theta energy: -88.809 Dist. restrs. and SS energy: 2.107 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1686.429951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.429951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.176395 (E_RNA) where: Base-Base interactions energy: -1213.603 where: short stacking energy: -509.652 Base-Backbone interact. energy: -0.199 local terms energy: -510.373401 where: bonds (distance) C4'-P energy: -91.260 bonds (distance) P-C4' energy: -93.152 flat angles C4'-P-C4' energy: -108.209 flat angles P-C4'-P energy: -71.757 tors. eta vs tors. theta energy: -145.996 Dist. restrs. and SS energy: 0.996 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1620.660298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.660298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.622400 (E_RNA) where: Base-Base interactions energy: -1167.865 where: short stacking energy: -480.522 Base-Backbone interact. energy: -1.219 local terms energy: -489.538622 where: bonds (distance) C4'-P energy: -85.230 bonds (distance) P-C4' energy: -94.234 flat angles C4'-P-C4' energy: -100.642 flat angles P-C4'-P energy: -82.700 tors. eta vs tors. theta energy: -126.733 Dist. restrs. and SS energy: 1.212 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1600.589700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.589700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.481084 (E_RNA) where: Base-Base interactions energy: -1144.329 where: short stacking energy: -480.442 Base-Backbone interact. energy: -2.199 local terms energy: -491.954024 where: bonds (distance) C4'-P energy: -97.411 bonds (distance) P-C4' energy: -78.725 flat angles C4'-P-C4' energy: -105.822 flat angles P-C4'-P energy: -71.776 tors. eta vs tors. theta energy: -138.219 Dist. restrs. and SS energy: 1.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1607.470928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.470928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.029340 (E_RNA) where: Base-Base interactions energy: -1188.874 where: short stacking energy: -494.518 Base-Backbone interact. energy: -0.055 local terms energy: -456.100183 where: bonds (distance) C4'-P energy: -77.963 bonds (distance) P-C4' energy: -85.553 flat angles C4'-P-C4' energy: -99.507 flat angles P-C4'-P energy: -61.196 tors. eta vs tors. theta energy: -131.881 Dist. restrs. and SS energy: 0.808 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1542.941787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.941787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.340978 (E_RNA) where: Base-Base interactions energy: -1107.275 where: short stacking energy: -457.079 Base-Backbone interact. energy: 0.469 local terms energy: -473.534589 where: bonds (distance) C4'-P energy: -83.314 bonds (distance) P-C4' energy: -98.935 flat angles C4'-P-C4' energy: -95.963 flat angles P-C4'-P energy: -61.294 tors. eta vs tors. theta energy: -134.029 Dist. restrs. and SS energy: 0.649 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1487.050959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1487.050959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.383370 (E_RNA) where: Base-Base interactions energy: -1104.876 where: short stacking energy: -452.425 Base-Backbone interact. energy: -1.043 local terms energy: -418.464243 where: bonds (distance) C4'-P energy: -65.245 bonds (distance) P-C4' energy: -94.156 flat angles C4'-P-C4' energy: -96.534 flat angles P-C4'-P energy: -52.707 tors. eta vs tors. theta energy: -109.823 Dist. restrs. and SS energy: 0.582 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1440.239958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.239958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.218788 (E_RNA) where: Base-Base interactions energy: -1045.180 where: short stacking energy: -413.901 Base-Backbone interact. energy: 0.042 local terms energy: -433.080847 where: bonds (distance) C4'-P energy: -67.968 bonds (distance) P-C4' energy: -72.396 flat angles C4'-P-C4' energy: -96.594 flat angles P-C4'-P energy: -76.404 tors. eta vs tors. theta energy: -119.719 Dist. restrs. and SS energy: 1.229 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1382.943906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.943906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.753313 (E_RNA) where: Base-Base interactions energy: -1023.195 where: short stacking energy: -420.777 Base-Backbone interact. energy: 7.599 local terms energy: -406.157349 where: bonds (distance) C4'-P energy: -80.211 bonds (distance) P-C4' energy: -72.757 flat angles C4'-P-C4' energy: -93.942 flat angles P-C4'-P energy: -45.872 tors. eta vs tors. theta energy: -113.376 Dist. restrs. and SS energy: 2.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1333.562572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.562572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.654634 (E_RNA) where: Base-Base interactions energy: -965.742 where: short stacking energy: -395.374 Base-Backbone interact. energy: 1.821 local terms energy: -408.733328 where: bonds (distance) C4'-P energy: -81.485 bonds (distance) P-C4' energy: -61.167 flat angles C4'-P-C4' energy: -88.867 flat angles P-C4'-P energy: -70.887 tors. eta vs tors. theta energy: -106.326 Dist. restrs. and SS energy: 2.342 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -1312.386819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.386819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.513937 (E_RNA) where: Base-Base interactions energy: -980.233 where: short stacking energy: -395.540 Base-Backbone interact. energy: 3.162 local terms energy: -373.442998 where: bonds (distance) C4'-P energy: -61.649 bonds (distance) P-C4' energy: -72.392 flat angles C4'-P-C4' energy: -85.849 flat angles P-C4'-P energy: -40.460 tors. eta vs tors. theta energy: -113.093 Dist. restrs. and SS energy: 1.377 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1662.142002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.142002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.499417 (E_RNA) where: Base-Base interactions energy: -1177.981 where: short stacking energy: -493.066 Base-Backbone interact. energy: -3.224 local terms energy: -518.295012 where: bonds (distance) C4'-P energy: -96.067 bonds (distance) P-C4' energy: -98.996 flat angles C4'-P-C4' energy: -98.117 flat angles P-C4'-P energy: -79.517 tors. eta vs tors. theta energy: -145.598 Dist. restrs. and SS energy: 0.607 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1653.040222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.040222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.421858 (E_RNA) where: Base-Base interactions energy: -1203.945 where: short stacking energy: -497.537 Base-Backbone interact. energy: -1.506 local terms energy: -484.970556 where: bonds (distance) C4'-P energy: -92.126 bonds (distance) P-C4' energy: -93.837 flat angles C4'-P-C4' energy: -92.465 flat angles P-C4'-P energy: -61.236 tors. eta vs tors. theta energy: -145.307 Dist. restrs. and SS energy: 0.632 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1588.688401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1588.688401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.422085 (E_RNA) where: Base-Base interactions energy: -1145.116 where: short stacking energy: -486.020 Base-Backbone interact. energy: -1.130 local terms energy: -480.176620 where: bonds (distance) C4'-P energy: -83.310 bonds (distance) P-C4' energy: -80.792 flat angles C4'-P-C4' energy: -105.623 flat angles P-C4'-P energy: -66.099 tors. eta vs tors. theta energy: -144.353 Dist. restrs. and SS energy: 0.984 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1548.789589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.789589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.397439 (E_RNA) where: Base-Base interactions energy: -1146.242 where: short stacking energy: -459.999 Base-Backbone interact. energy: -1.705 local terms energy: -439.450463 where: bonds (distance) C4'-P energy: -84.403 bonds (distance) P-C4' energy: -78.260 flat angles C4'-P-C4' energy: -94.132 flat angles P-C4'-P energy: -63.605 tors. eta vs tors. theta energy: -119.051 Dist. restrs. and SS energy: 1.858 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1534.755554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.755554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.565225 (E_RNA) where: Base-Base interactions energy: -1114.349 where: short stacking energy: -462.935 Base-Backbone interact. energy: -1.118 local terms energy: -457.097868 where: bonds (distance) C4'-P energy: -82.473 bonds (distance) P-C4' energy: -78.701 flat angles C4'-P-C4' energy: -93.026 flat angles P-C4'-P energy: -67.443 tors. eta vs tors. theta energy: -135.455 Dist. restrs. and SS energy: 1.060 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1478.079557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.079557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.514814 (E_RNA) where: Base-Base interactions energy: -1075.167 where: short stacking energy: -442.488 Base-Backbone interact. energy: -1.221 local terms energy: -440.127140 where: bonds (distance) C4'-P energy: -82.147 bonds (distance) P-C4' energy: -70.792 flat angles C4'-P-C4' energy: -89.553 flat angles P-C4'-P energy: -67.165 tors. eta vs tors. theta energy: -130.471 Dist. restrs. and SS energy: 1.685 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1437.115930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.115930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.275502 (E_RNA) where: Base-Base interactions energy: -1052.162 where: short stacking energy: -441.025 Base-Backbone interact. energy: 0.719 local terms energy: -423.833005 where: bonds (distance) C4'-P energy: -78.620 bonds (distance) P-C4' energy: -76.443 flat angles C4'-P-C4' energy: -93.637 flat angles P-C4'-P energy: -55.179 tors. eta vs tors. theta energy: -119.954 Dist. restrs. and SS energy: 1.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1395.960864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.960864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.782684 (E_RNA) where: Base-Base interactions energy: -1013.325 where: short stacking energy: -419.012 Base-Backbone interact. energy: -1.390 local terms energy: -420.067268 where: bonds (distance) C4'-P energy: -67.133 bonds (distance) P-C4' energy: -74.292 flat angles C4'-P-C4' energy: -93.959 flat angles P-C4'-P energy: -64.319 tors. eta vs tors. theta energy: -120.364 Dist. restrs. and SS energy: 2.072 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1362.416179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.416179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.284250 (E_RNA) where: Base-Base interactions energy: -975.827 where: short stacking energy: -402.519 Base-Backbone interact. energy: -1.597 local terms energy: -423.859851 where: bonds (distance) C4'-P energy: -77.081 bonds (distance) P-C4' energy: -87.947 flat angles C4'-P-C4' energy: -91.904 flat angles P-C4'-P energy: -51.779 tors. eta vs tors. theta energy: -115.147 Dist. restrs. and SS energy: 2.118 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -1320.355746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.355746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.345635 (E_RNA) where: Base-Base interactions energy: -986.644 where: short stacking energy: -398.313 Base-Backbone interact. energy: 1.451 local terms energy: -374.152614 where: bonds (distance) C4'-P energy: -75.951 bonds (distance) P-C4' energy: -61.413 flat angles C4'-P-C4' energy: -87.729 flat angles P-C4'-P energy: -50.325 tors. eta vs tors. theta energy: -98.735 Dist. restrs. and SS energy: 2.240 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1670.453512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1670.453512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.602157 (E_RNA) where: Base-Base interactions energy: -1207.949 where: short stacking energy: -511.261 Base-Backbone interact. energy: -0.281 local terms energy: -499.371726 where: bonds (distance) C4'-P energy: -94.745 bonds (distance) P-C4' energy: -94.959 flat angles C4'-P-C4' energy: -105.235 flat angles P-C4'-P energy: -63.093 tors. eta vs tors. theta energy: -141.340 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1673.417036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.417036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.651886 (E_RNA) where: Base-Base interactions energy: -1211.194 where: short stacking energy: -500.218 Base-Backbone interact. energy: -0.279 local terms energy: -500.178648 where: bonds (distance) C4'-P energy: -92.767 bonds (distance) P-C4' energy: -88.671 flat angles C4'-P-C4' energy: -112.278 flat angles P-C4'-P energy: -64.232 tors. eta vs tors. theta energy: -142.230 Dist. restrs. and SS energy: 1.485 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1602.574918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.574918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.857185 (E_RNA) where: Base-Base interactions energy: -1134.760 where: short stacking energy: -490.711 Base-Backbone interact. energy: 1.184 local terms energy: -507.281217 where: bonds (distance) C4'-P energy: -97.382 bonds (distance) P-C4' energy: -88.717 flat angles C4'-P-C4' energy: -93.598 flat angles P-C4'-P energy: -79.606 tors. eta vs tors. theta energy: -147.978 Dist. restrs. and SS energy: 1.532 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1582.612223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.612223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.258743 (E_RNA) where: Base-Base interactions energy: -1166.806 where: short stacking energy: -477.199 Base-Backbone interact. energy: -0.287 local terms energy: -453.166040 where: bonds (distance) C4'-P energy: -82.312 bonds (distance) P-C4' energy: -86.884 flat angles C4'-P-C4' energy: -98.234 flat angles P-C4'-P energy: -63.610 tors. eta vs tors. theta energy: -122.126 Dist. restrs. and SS energy: 0.897 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1552.025794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.025794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.291481 (E_RNA) where: Base-Base interactions energy: -1119.104 where: short stacking energy: -454.032 Base-Backbone interact. energy: -1.794 local terms energy: -469.392933 where: bonds (distance) C4'-P energy: -88.110 bonds (distance) P-C4' energy: -97.211 flat angles C4'-P-C4' energy: -93.816 flat angles P-C4'-P energy: -57.715 tors. eta vs tors. theta energy: -132.541 Dist. restrs. and SS energy: 1.516 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1486.634080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.634080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.181851 (E_RNA) where: Base-Base interactions energy: -1088.304 where: short stacking energy: -450.441 Base-Backbone interact. energy: -0.889 local terms energy: -435.989006 where: bonds (distance) C4'-P energy: -70.325 bonds (distance) P-C4' energy: -79.715 flat angles C4'-P-C4' energy: -100.161 flat angles P-C4'-P energy: -55.306 tors. eta vs tors. theta energy: -130.482 Dist. restrs. and SS energy: 1.798 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1428.001451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.001451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.413966 (E_RNA) where: Base-Base interactions energy: -1035.788 where: short stacking energy: -419.562 Base-Backbone interact. energy: 3.729 local terms energy: -433.355377 where: bonds (distance) C4'-P energy: -82.206 bonds (distance) P-C4' energy: -68.122 flat angles C4'-P-C4' energy: -107.092 flat angles P-C4'-P energy: -57.893 tors. eta vs tors. theta energy: -118.042 Dist. restrs. and SS energy: 0.663 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1374.167571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.167571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.371042 (E_RNA) where: Base-Base interactions energy: -1001.892 where: short stacking energy: -402.749 Base-Backbone interact. energy: 0.358 local terms energy: -410.837882 where: bonds (distance) C4'-P energy: -82.515 bonds (distance) P-C4' energy: -79.642 flat angles C4'-P-C4' energy: -81.270 flat angles P-C4'-P energy: -62.148 tors. eta vs tors. theta energy: -105.261 Dist. restrs. and SS energy: 1.453 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1384.649752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.649752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.104679 (E_RNA) where: Base-Base interactions energy: -1025.378 where: short stacking energy: -419.769 Base-Backbone interact. energy: -0.717 local terms energy: -397.009602 where: bonds (distance) C4'-P energy: -74.582 bonds (distance) P-C4' energy: -76.386 flat angles C4'-P-C4' energy: -91.644 flat angles P-C4'-P energy: -44.273 tors. eta vs tors. theta energy: -110.124 Dist. restrs. and SS energy: 1.705 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -1284.796141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.796141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.508866 (E_RNA) where: Base-Base interactions energy: -955.711 where: short stacking energy: -383.053 Base-Backbone interact. energy: 3.775 local terms energy: -371.572415 where: bonds (distance) C4'-P energy: -75.322 bonds (distance) P-C4' energy: -64.735 flat angles C4'-P-C4' energy: -84.998 flat angles P-C4'-P energy: -46.301 tors. eta vs tors. theta energy: -100.217 Dist. restrs. and SS energy: 1.963 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1669.169746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.169746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.861252 (E_RNA) where: Base-Base interactions energy: -1214.295 where: short stacking energy: -502.807 Base-Backbone interact. energy: -0.433 local terms energy: -492.133492 where: bonds (distance) C4'-P energy: -94.073 bonds (distance) P-C4' energy: -78.716 flat angles C4'-P-C4' energy: -108.429 flat angles P-C4'-P energy: -69.748 tors. eta vs tors. theta energy: -141.167 Dist. restrs. and SS energy: 0.942 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1646.062383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.062383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.671984 (E_RNA) where: Base-Base interactions energy: -1196.200 where: short stacking energy: -502.477 Base-Backbone interact. energy: 0.905 local terms energy: -488.377017 where: bonds (distance) C4'-P energy: -87.511 bonds (distance) P-C4' energy: -93.554 flat angles C4'-P-C4' energy: -99.479 flat angles P-C4'-P energy: -69.935 tors. eta vs tors. theta energy: -137.898 Dist. restrs. and SS energy: 0.860 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1605.578999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.578999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.427882 (E_RNA) where: Base-Base interactions energy: -1155.279 where: short stacking energy: -469.694 Base-Backbone interact. energy: -2.678 local terms energy: -485.470686 where: bonds (distance) C4'-P energy: -81.365 bonds (distance) P-C4' energy: -92.403 flat angles C4'-P-C4' energy: -106.729 flat angles P-C4'-P energy: -71.295 tors. eta vs tors. theta energy: -133.679 Dist. restrs. and SS energy: 1.099 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1581.907837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.907837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.219006 (E_RNA) where: Base-Base interactions energy: -1158.502 where: short stacking energy: -472.148 Base-Backbone interact. energy: -1.492 local terms energy: -460.225305 where: bonds (distance) C4'-P energy: -82.031 bonds (distance) P-C4' energy: -81.888 flat angles C4'-P-C4' energy: -100.337 flat angles P-C4'-P energy: -65.250 tors. eta vs tors. theta energy: -130.719 Dist. restrs. and SS energy: 1.561 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1568.374425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.374425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.315281 (E_RNA) where: Base-Base interactions energy: -1132.135 where: short stacking energy: -471.651 Base-Backbone interact. energy: -0.713 local terms energy: -473.467241 where: bonds (distance) C4'-P energy: -77.932 bonds (distance) P-C4' energy: -76.651 flat angles C4'-P-C4' energy: -99.514 flat angles P-C4'-P energy: -75.433 tors. eta vs tors. theta energy: -143.938 Dist. restrs. and SS energy: 1.191 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1477.790376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.790376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.880162 (E_RNA) where: Base-Base interactions energy: -1095.316 where: short stacking energy: -457.470 Base-Backbone interact. energy: -1.231 local terms energy: -419.333699 where: bonds (distance) C4'-P energy: -74.930 bonds (distance) P-C4' energy: -73.776 flat angles C4'-P-C4' energy: -98.534 flat angles P-C4'-P energy: -49.677 tors. eta vs tors. theta energy: -122.417 Dist. restrs. and SS energy: 1.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1426.193144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.193144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.075420 (E_RNA) where: Base-Base interactions energy: -1053.963 where: short stacking energy: -428.090 Base-Backbone interact. energy: -0.486 local terms energy: -409.627047 where: bonds (distance) C4'-P energy: -84.856 bonds (distance) P-C4' energy: -65.507 flat angles C4'-P-C4' energy: -87.602 flat angles P-C4'-P energy: -51.970 tors. eta vs tors. theta energy: -119.692 Dist. restrs. and SS energy: 1.132 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1394.272650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.272650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.444759 (E_RNA) where: Base-Base interactions energy: -1017.249 where: short stacking energy: -402.248 Base-Backbone interact. energy: -1.056 local terms energy: -415.139765 where: bonds (distance) C4'-P energy: -80.805 bonds (distance) P-C4' energy: -81.446 flat angles C4'-P-C4' energy: -84.654 flat angles P-C4'-P energy: -49.890 tors. eta vs tors. theta energy: -118.345 Dist. restrs. and SS energy: 2.422 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1351.453692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.453692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.981437 (E_RNA) where: Base-Base interactions energy: -1002.182 where: short stacking energy: -411.000 Base-Backbone interact. energy: -0.206 local terms energy: -387.593157 where: bonds (distance) C4'-P energy: -66.137 bonds (distance) P-C4' energy: -72.288 flat angles C4'-P-C4' energy: -90.153 flat angles P-C4'-P energy: -50.545 tors. eta vs tors. theta energy: -108.471 Dist. restrs. and SS energy: 1.778 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -1309.225020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.225020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.619597 (E_RNA) where: Base-Base interactions energy: -975.458 where: short stacking energy: -390.733 Base-Backbone interact. energy: -0.474 local terms energy: -372.687586 where: bonds (distance) C4'-P energy: -58.309 bonds (distance) P-C4' energy: -69.130 flat angles C4'-P-C4' energy: -87.099 flat angles P-C4'-P energy: -55.631 tors. eta vs tors. theta energy: -102.519 Dist. restrs. and SS energy: 2.645 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1688.811023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.811023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.087770 (E_RNA) where: Base-Base interactions energy: -1223.015 where: short stacking energy: -507.555 Base-Backbone interact. energy: -3.674 local terms energy: -499.398799 where: bonds (distance) C4'-P energy: -96.527 bonds (distance) P-C4' energy: -91.153 flat angles C4'-P-C4' energy: -107.157 flat angles P-C4'-P energy: -62.676 tors. eta vs tors. theta energy: -141.886 Dist. restrs. and SS energy: 0.527 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1669.814647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.814647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.458917 (E_RNA) where: Base-Base interactions energy: -1194.644 where: short stacking energy: -503.991 Base-Backbone interact. energy: -1.652 local terms energy: -511.162627 where: bonds (distance) C4'-P energy: -88.926 bonds (distance) P-C4' energy: -101.943 flat angles C4'-P-C4' energy: -103.278 flat angles P-C4'-P energy: -70.711 tors. eta vs tors. theta energy: -146.305 Dist. restrs. and SS energy: 0.894 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1603.883855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.883855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1641.694745 (E_RNA) where: Base-Base interactions energy: -1166.330 where: short stacking energy: -494.930 Base-Backbone interact. energy: -3.613 local terms energy: -471.751086 where: bonds (distance) C4'-P energy: -80.854 bonds (distance) P-C4' energy: -87.056 flat angles C4'-P-C4' energy: -106.858 flat angles P-C4'-P energy: -68.882 tors. eta vs tors. theta energy: -128.102 Dist. restrs. and SS energy: 1.061 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1572.610340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.610340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.648843 (E_RNA) where: Base-Base interactions energy: -1174.014 where: short stacking energy: -466.949 Base-Backbone interact. energy: -0.174 local terms energy: -436.461233 where: bonds (distance) C4'-P energy: -71.519 bonds (distance) P-C4' energy: -78.745 flat angles C4'-P-C4' energy: -91.382 flat angles P-C4'-P energy: -67.424 tors. eta vs tors. theta energy: -127.391 Dist. restrs. and SS energy: 1.289 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1546.590119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1546.590119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.755377 (E_RNA) where: Base-Base interactions energy: -1114.258 where: short stacking energy: -464.339 Base-Backbone interact. energy: -2.870 local terms energy: -467.627743 where: bonds (distance) C4'-P energy: -88.915 bonds (distance) P-C4' energy: -86.586 flat angles C4'-P-C4' energy: -91.661 flat angles P-C4'-P energy: -68.754 tors. eta vs tors. theta energy: -131.712 Dist. restrs. and SS energy: 1.415 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1478.556531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.556531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1516.785578 (E_RNA) where: Base-Base interactions energy: -1077.896 where: short stacking energy: -455.241 Base-Backbone interact. energy: -1.913 local terms energy: -436.976622 where: bonds (distance) C4'-P energy: -71.252 bonds (distance) P-C4' energy: -73.813 flat angles C4'-P-C4' energy: -106.815 flat angles P-C4'-P energy: -59.292 tors. eta vs tors. theta energy: -125.805 Dist. restrs. and SS energy: 1.479 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1449.691188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.691188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.422029 (E_RNA) where: Base-Base interactions energy: -1050.411 where: short stacking energy: -433.784 Base-Backbone interact. energy: -2.131 local terms energy: -434.879922 where: bonds (distance) C4'-P energy: -72.173 bonds (distance) P-C4' energy: -82.842 flat angles C4'-P-C4' energy: -95.629 flat angles P-C4'-P energy: -54.636 tors. eta vs tors. theta energy: -129.601 Dist. restrs. and SS energy: 0.981 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1412.489588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.489588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.067034 (E_RNA) where: Base-Base interactions energy: -1021.188 where: short stacking energy: -403.831 Base-Backbone interact. energy: 0.600 local terms energy: -430.478759 where: bonds (distance) C4'-P energy: -69.145 bonds (distance) P-C4' energy: -84.231 flat angles C4'-P-C4' energy: -94.500 flat angles P-C4'-P energy: -65.877 tors. eta vs tors. theta energy: -116.725 Dist. restrs. and SS energy: 1.827 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1351.431005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.431005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.882924 (E_RNA) where: Base-Base interactions energy: -989.095 where: short stacking energy: -405.791 Base-Backbone interact. energy: -1.308 local terms energy: -399.479986 where: bonds (distance) C4'-P energy: -74.792 bonds (distance) P-C4' energy: -79.257 flat angles C4'-P-C4' energy: -76.786 flat angles P-C4'-P energy: -50.885 tors. eta vs tors. theta energy: -117.760 Dist. restrs. and SS energy: 1.702 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -1287.460111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.460111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.925683 (E_RNA) where: Base-Base interactions energy: -932.819 where: short stacking energy: -372.499 Base-Backbone interact. energy: -0.222 local terms energy: -392.884651 where: bonds (distance) C4'-P energy: -72.152 bonds (distance) P-C4' energy: -79.261 flat angles C4'-P-C4' energy: -94.529 flat angles P-C4'-P energy: -44.841 tors. eta vs tors. theta energy: -102.102 Dist. restrs. and SS energy: 1.716 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1673.918104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1673.918104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1711.088456 (E_RNA) where: Base-Base interactions energy: -1202.146 where: short stacking energy: -497.484 Base-Backbone interact. energy: -0.740 local terms energy: -508.202920 where: bonds (distance) C4'-P energy: -97.236 bonds (distance) P-C4' energy: -107.419 flat angles C4'-P-C4' energy: -106.294 flat angles P-C4'-P energy: -61.580 tors. eta vs tors. theta energy: -135.674 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1659.411514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.411514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.805038 (E_RNA) where: Base-Base interactions energy: -1218.596 where: short stacking energy: -515.655 Base-Backbone interact. energy: -2.229 local terms energy: -475.980619 where: bonds (distance) C4'-P energy: -87.226 bonds (distance) P-C4' energy: -80.047 flat angles C4'-P-C4' energy: -107.859 flat angles P-C4'-P energy: -66.192 tors. eta vs tors. theta energy: -134.657 Dist. restrs. and SS energy: 0.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1611.934391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1611.934391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.532779 (E_RNA) where: Base-Base interactions energy: -1174.885 where: short stacking energy: -484.265 Base-Backbone interact. energy: -2.067 local terms energy: -472.581268 where: bonds (distance) C4'-P energy: -84.090 bonds (distance) P-C4' energy: -81.700 flat angles C4'-P-C4' energy: -105.546 flat angles P-C4'-P energy: -69.647 tors. eta vs tors. theta energy: -131.598 Dist. restrs. and SS energy: 0.848 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1567.743030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.743030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.137393 (E_RNA) where: Base-Base interactions energy: -1148.674 where: short stacking energy: -478.123 Base-Backbone interact. energy: -2.288 local terms energy: -454.175645 where: bonds (distance) C4'-P energy: -63.530 bonds (distance) P-C4' energy: -97.977 flat angles C4'-P-C4' energy: -102.707 flat angles P-C4'-P energy: -60.197 tors. eta vs tors. theta energy: -129.765 Dist. restrs. and SS energy: 0.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1548.141484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.141484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.697365 (E_RNA) where: Base-Base interactions energy: -1136.945 where: short stacking energy: -477.591 Base-Backbone interact. energy: 2.800 local terms energy: -452.552769 where: bonds (distance) C4'-P energy: -71.395 bonds (distance) P-C4' energy: -84.912 flat angles C4'-P-C4' energy: -99.465 flat angles P-C4'-P energy: -58.455 tors. eta vs tors. theta energy: -138.326 Dist. restrs. and SS energy: 1.806 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1489.168254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.168254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.324469 (E_RNA) where: Base-Base interactions energy: -1090.722 where: short stacking energy: -469.586 Base-Backbone interact. energy: -0.630 local terms energy: -435.973298 where: bonds (distance) C4'-P energy: -79.252 bonds (distance) P-C4' energy: -67.783 flat angles C4'-P-C4' energy: -103.681 flat angles P-C4'-P energy: -60.016 tors. eta vs tors. theta energy: -125.242 Dist. restrs. and SS energy: 1.406 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1432.432828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.432828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.627064 (E_RNA) where: Base-Base interactions energy: -1032.602 where: short stacking energy: -428.293 Base-Backbone interact. energy: -1.565 local terms energy: -436.459383 where: bonds (distance) C4'-P energy: -62.537 bonds (distance) P-C4' energy: -89.531 flat angles C4'-P-C4' energy: -97.247 flat angles P-C4'-P energy: -56.499 tors. eta vs tors. theta energy: -130.645 Dist. restrs. and SS energy: 1.444 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1402.064811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.064811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.467188 (E_RNA) where: Base-Base interactions energy: -1024.201 where: short stacking energy: -424.778 Base-Backbone interact. energy: -1.694 local terms energy: -414.572293 where: bonds (distance) C4'-P energy: -59.437 bonds (distance) P-C4' energy: -87.255 flat angles C4'-P-C4' energy: -89.651 flat angles P-C4'-P energy: -52.682 tors. eta vs tors. theta energy: -125.548 Dist. restrs. and SS energy: 1.652 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1383.427349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.427349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.936366 (E_RNA) where: Base-Base interactions energy: -1026.229 where: short stacking energy: -407.343 Base-Backbone interact. energy: -2.737 local terms energy: -392.970302 where: bonds (distance) C4'-P energy: -65.328 bonds (distance) P-C4' energy: -80.073 flat angles C4'-P-C4' energy: -85.523 flat angles P-C4'-P energy: -56.053 tors. eta vs tors. theta energy: -105.994 Dist. restrs. and SS energy: 1.759 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -1296.056282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.056282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.913463 (E_RNA) where: Base-Base interactions energy: -949.532 where: short stacking energy: -387.693 Base-Backbone interact. energy: -0.951 local terms energy: -384.430780 where: bonds (distance) C4'-P energy: -74.556 bonds (distance) P-C4' energy: -63.030 flat angles C4'-P-C4' energy: -87.776 flat angles P-C4'-P energy: -57.461 tors. eta vs tors. theta energy: -101.607 Dist. restrs. and SS energy: 2.107 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1701.478343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1701.478343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.830845 (E_RNA) where: Base-Base interactions energy: -1223.589 where: short stacking energy: -508.785 Base-Backbone interact. energy: -1.048 local terms energy: -514.194232 where: bonds (distance) C4'-P energy: -87.703 bonds (distance) P-C4' energy: -99.178 flat angles C4'-P-C4' energy: -105.997 flat angles P-C4'-P energy: -76.803 tors. eta vs tors. theta energy: -144.513 Dist. restrs. and SS energy: 0.603 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1655.289570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.289570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1692.692352 (E_RNA) where: Base-Base interactions energy: -1196.861 where: short stacking energy: -497.060 Base-Backbone interact. energy: -1.433 local terms energy: -494.399149 where: bonds (distance) C4'-P energy: -88.164 bonds (distance) P-C4' energy: -91.141 flat angles C4'-P-C4' energy: -104.007 flat angles P-C4'-P energy: -71.321 tors. eta vs tors. theta energy: -139.765 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1640.393041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.393041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.603285 (E_RNA) where: Base-Base interactions energy: -1204.196 where: short stacking energy: -484.276 Base-Backbone interact. energy: -1.088 local terms energy: -473.318381 where: bonds (distance) C4'-P energy: -80.370 bonds (distance) P-C4' energy: -91.051 flat angles C4'-P-C4' energy: -101.541 flat angles P-C4'-P energy: -63.157 tors. eta vs tors. theta energy: -137.200 Dist. restrs. and SS energy: 1.460 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1587.810648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.810648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.308533 (E_RNA) where: Base-Base interactions energy: -1148.188 where: short stacking energy: -492.645 Base-Backbone interact. energy: -1.415 local terms energy: -476.705996 where: bonds (distance) C4'-P energy: -78.218 bonds (distance) P-C4' energy: -98.141 flat angles C4'-P-C4' energy: -108.457 flat angles P-C4'-P energy: -57.328 tors. eta vs tors. theta energy: -134.562 Dist. restrs. and SS energy: 1.748 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1525.360041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.360041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.677281 (E_RNA) where: Base-Base interactions energy: -1099.246 where: short stacking energy: -465.644 Base-Backbone interact. energy: 2.049 local terms energy: -466.479617 where: bonds (distance) C4'-P energy: -80.021 bonds (distance) P-C4' energy: -85.500 flat angles C4'-P-C4' energy: -100.814 flat angles P-C4'-P energy: -72.038 tors. eta vs tors. theta energy: -128.107 Dist. restrs. and SS energy: 1.567 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1475.576672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.576672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.062795 (E_RNA) where: Base-Base interactions energy: -1064.872 where: short stacking energy: -441.428 Base-Backbone interact. energy: -2.379 local terms energy: -446.811646 where: bonds (distance) C4'-P energy: -87.919 bonds (distance) P-C4' energy: -76.201 flat angles C4'-P-C4' energy: -88.141 flat angles P-C4'-P energy: -68.025 tors. eta vs tors. theta energy: -126.526 Dist. restrs. and SS energy: 1.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1418.579919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.579919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.366541 (E_RNA) where: Base-Base interactions energy: -1030.080 where: short stacking energy: -417.349 Base-Backbone interact. energy: -0.899 local terms energy: -426.387522 where: bonds (distance) C4'-P energy: -67.539 bonds (distance) P-C4' energy: -90.012 flat angles C4'-P-C4' energy: -100.160 flat angles P-C4'-P energy: -53.531 tors. eta vs tors. theta energy: -115.146 Dist. restrs. and SS energy: 2.037 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1429.794946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.794946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.915975 (E_RNA) where: Base-Base interactions energy: -1045.539 where: short stacking energy: -419.178 Base-Backbone interact. energy: -2.096 local terms energy: -421.281729 where: bonds (distance) C4'-P energy: -71.983 bonds (distance) P-C4' energy: -64.098 flat angles C4'-P-C4' energy: -96.942 flat angles P-C4'-P energy: -67.091 tors. eta vs tors. theta energy: -121.167 Dist. restrs. and SS energy: 2.371 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1365.929867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.929867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.366674 (E_RNA) where: Base-Base interactions energy: -993.495 where: short stacking energy: -410.266 Base-Backbone interact. energy: 1.568 local terms energy: -413.440477 where: bonds (distance) C4'-P energy: -77.550 bonds (distance) P-C4' energy: -71.295 flat angles C4'-P-C4' energy: -86.284 flat angles P-C4'-P energy: -65.626 tors. eta vs tors. theta energy: -112.685 Dist. restrs. and SS energy: 2.687 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -1307.571077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.571077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.416027 (E_RNA) where: Base-Base interactions energy: -974.716 where: short stacking energy: -384.366 Base-Backbone interact. energy: -0.803 local terms energy: -374.897463 where: bonds (distance) C4'-P energy: -67.443 bonds (distance) P-C4' energy: -79.933 flat angles C4'-P-C4' energy: -86.499 flat angles P-C4'-P energy: -43.282 tors. eta vs tors. theta energy: -97.741 Dist. restrs. and SS energy: 6.095 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1664.748562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1664.748562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.142311 (E_RNA) where: Base-Base interactions energy: -1197.842 where: short stacking energy: -500.676 Base-Backbone interact. energy: 1.238 local terms energy: -505.538408 where: bonds (distance) C4'-P energy: -98.100 bonds (distance) P-C4' energy: -99.561 flat angles C4'-P-C4' energy: -109.203 flat angles P-C4'-P energy: -61.564 tors. eta vs tors. theta energy: -137.111 Dist. restrs. and SS energy: 0.644 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1631.262575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.262575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.777541 (E_RNA) where: Base-Base interactions energy: -1188.795 where: short stacking energy: -504.715 Base-Backbone interact. energy: 2.232 local terms energy: -483.214524 where: bonds (distance) C4'-P energy: -88.141 bonds (distance) P-C4' energy: -82.232 flat angles C4'-P-C4' energy: -110.635 flat angles P-C4'-P energy: -65.898 tors. eta vs tors. theta energy: -136.309 Dist. restrs. and SS energy: 1.765 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1601.295073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1601.295073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.004378 (E_RNA) where: Base-Base interactions energy: -1124.242 where: short stacking energy: -474.508 Base-Backbone interact. energy: -1.051 local terms energy: -513.711192 where: bonds (distance) C4'-P energy: -96.054 bonds (distance) P-C4' energy: -90.156 flat angles C4'-P-C4' energy: -109.885 flat angles P-C4'-P energy: -76.581 tors. eta vs tors. theta energy: -141.035 Dist. restrs. and SS energy: 0.959 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1550.180383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1550.180383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1588.011716 (E_RNA) where: Base-Base interactions energy: -1132.029 where: short stacking energy: -479.059 Base-Backbone interact. energy: -0.561 local terms energy: -455.421618 where: bonds (distance) C4'-P energy: -82.627 bonds (distance) P-C4' energy: -73.016 flat angles C4'-P-C4' energy: -98.208 flat angles P-C4'-P energy: -62.443 tors. eta vs tors. theta energy: -139.127 Dist. restrs. and SS energy: 1.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1527.102594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.102594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.501370 (E_RNA) where: Base-Base interactions energy: -1126.710 where: short stacking energy: -456.306 Base-Backbone interact. energy: -1.243 local terms energy: -436.548161 where: bonds (distance) C4'-P energy: -82.277 bonds (distance) P-C4' energy: -76.177 flat angles C4'-P-C4' energy: -95.213 flat angles P-C4'-P energy: -58.501 tors. eta vs tors. theta energy: -124.379 Dist. restrs. and SS energy: 0.649 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1495.176529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1495.176529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.097772 (E_RNA) where: Base-Base interactions energy: -1072.918 where: short stacking energy: -445.711 Base-Backbone interact. energy: -2.164 local terms energy: -458.015519 where: bonds (distance) C4'-P energy: -86.906 bonds (distance) P-C4' energy: -84.947 flat angles C4'-P-C4' energy: -100.312 flat angles P-C4'-P energy: -62.338 tors. eta vs tors. theta energy: -123.513 Dist. restrs. and SS energy: 1.171 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1462.763409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.763409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.736102 (E_RNA) where: Base-Base interactions energy: -1075.766 where: short stacking energy: -439.880 Base-Backbone interact. energy: -2.430 local terms energy: -423.539483 where: bonds (distance) C4'-P energy: -69.196 bonds (distance) P-C4' energy: -86.883 flat angles C4'-P-C4' energy: -91.757 flat angles P-C4'-P energy: -54.672 tors. eta vs tors. theta energy: -121.032 Dist. restrs. and SS energy: 2.223 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1391.388677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.388677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.431362 (E_RNA) where: Base-Base interactions energy: -1029.154 where: short stacking energy: -418.179 Base-Backbone interact. energy: 0.838 local terms energy: -401.115868 where: bonds (distance) C4'-P energy: -71.941 bonds (distance) P-C4' energy: -66.705 flat angles C4'-P-C4' energy: -93.530 flat angles P-C4'-P energy: -60.481 tors. eta vs tors. theta energy: -108.458 Dist. restrs. and SS energy: 1.293 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1363.242970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.242970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.332328 (E_RNA) where: Base-Base interactions energy: -998.439 where: short stacking energy: -393.846 Base-Backbone interact. energy: -1.402 local terms energy: -403.491318 where: bonds (distance) C4'-P energy: -69.147 bonds (distance) P-C4' energy: -77.796 flat angles C4'-P-C4' energy: -89.083 flat angles P-C4'-P energy: -56.717 tors. eta vs tors. theta energy: -110.750 Dist. restrs. and SS energy: 3.339 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -1252.107633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.107633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.989843 (E_RNA) where: Base-Base interactions energy: -923.911 where: short stacking energy: -377.623 Base-Backbone interact. energy: -1.118 local terms energy: -371.961179 where: bonds (distance) C4'-P energy: -60.339 bonds (distance) P-C4' energy: -73.965 flat angles C4'-P-C4' energy: -92.325 flat angles P-C4'-P energy: -44.490 tors. eta vs tors. theta energy: -100.844 Dist. restrs. and SS energy: 8.132 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1698.429695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1698.429695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.818129 (E_RNA) where: Base-Base interactions energy: -1236.603 where: short stacking energy: -524.165 Base-Backbone interact. energy: -3.559 local terms energy: -495.656299 where: bonds (distance) C4'-P energy: -86.816 bonds (distance) P-C4' energy: -93.480 flat angles C4'-P-C4' energy: -105.627 flat angles P-C4'-P energy: -65.044 tors. eta vs tors. theta energy: -144.689 Dist. restrs. and SS energy: 0.638 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1659.172608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.172608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.848627 (E_RNA) where: Base-Base interactions energy: -1196.144 where: short stacking energy: -504.135 Base-Backbone interact. energy: -0.844 local terms energy: -500.861246 where: bonds (distance) C4'-P energy: -88.863 bonds (distance) P-C4' energy: -98.260 flat angles C4'-P-C4' energy: -111.042 flat angles P-C4'-P energy: -62.326 tors. eta vs tors. theta energy: -140.371 Dist. restrs. and SS energy: 1.926 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1610.969359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.969359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.175251 (E_RNA) where: Base-Base interactions energy: -1162.629 where: short stacking energy: -491.190 Base-Backbone interact. energy: -1.694 local terms energy: -483.851748 where: bonds (distance) C4'-P energy: -87.267 bonds (distance) P-C4' energy: -86.900 flat angles C4'-P-C4' energy: -100.177 flat angles P-C4'-P energy: -65.138 tors. eta vs tors. theta energy: -144.369 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1554.584824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.584824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.316220 (E_RNA) where: Base-Base interactions energy: -1142.285 where: short stacking energy: -467.940 Base-Backbone interact. energy: -1.644 local terms energy: -449.386504 where: bonds (distance) C4'-P energy: -86.319 bonds (distance) P-C4' energy: -78.707 flat angles C4'-P-C4' energy: -89.834 flat angles P-C4'-P energy: -64.530 tors. eta vs tors. theta energy: -129.996 Dist. restrs. and SS energy: 1.981 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1528.573935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.573935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.792529 (E_RNA) where: Base-Base interactions energy: -1095.207 where: short stacking energy: -456.043 Base-Backbone interact. energy: -2.178 local terms energy: -470.407622 where: bonds (distance) C4'-P energy: -77.986 bonds (distance) P-C4' energy: -93.748 flat angles C4'-P-C4' energy: -103.962 flat angles P-C4'-P energy: -63.395 tors. eta vs tors. theta energy: -131.316 Dist. restrs. and SS energy: 2.469 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1484.526279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.526279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.395745 (E_RNA) where: Base-Base interactions energy: -1074.702 where: short stacking energy: -450.195 Base-Backbone interact. energy: -2.142 local terms energy: -445.551451 where: bonds (distance) C4'-P energy: -83.620 bonds (distance) P-C4' energy: -76.452 flat angles C4'-P-C4' energy: -101.688 flat angles P-C4'-P energy: -64.623 tors. eta vs tors. theta energy: -119.169 Dist. restrs. and SS energy: 1.119 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1451.450642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.450642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.483287 (E_RNA) where: Base-Base interactions energy: -1069.550 where: short stacking energy: -458.018 Base-Backbone interact. energy: -1.921 local terms energy: -418.011380 where: bonds (distance) C4'-P energy: -67.336 bonds (distance) P-C4' energy: -78.778 flat angles C4'-P-C4' energy: -86.809 flat angles P-C4'-P energy: -63.180 tors. eta vs tors. theta energy: -121.909 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1427.198331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.198331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.146282 (E_RNA) where: Base-Base interactions energy: -1048.020 where: short stacking energy: -422.601 Base-Backbone interact. energy: -0.117 local terms energy: -417.009809 where: bonds (distance) C4'-P energy: -74.861 bonds (distance) P-C4' energy: -80.941 flat angles C4'-P-C4' energy: -93.830 flat angles P-C4'-P energy: -57.522 tors. eta vs tors. theta energy: -109.856 Dist. restrs. and SS energy: 1.198 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1343.091296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.091296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.114350 (E_RNA) where: Base-Base interactions energy: -1010.649 where: short stacking energy: -414.938 Base-Backbone interact. energy: -3.152 local terms energy: -370.312758 where: bonds (distance) C4'-P energy: -62.716 bonds (distance) P-C4' energy: -65.157 flat angles C4'-P-C4' energy: -83.208 flat angles P-C4'-P energy: -55.741 tors. eta vs tors. theta energy: -103.491 Dist. restrs. and SS energy: 4.273 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -1302.644214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.644214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1341.069220 (E_RNA) where: Base-Base interactions energy: -977.949 where: short stacking energy: -395.845 Base-Backbone interact. energy: -1.834 local terms energy: -361.285923 where: bonds (distance) C4'-P energy: -58.783 bonds (distance) P-C4' energy: -75.274 flat angles C4'-P-C4' energy: -78.842 flat angles P-C4'-P energy: -41.099 tors. eta vs tors. theta energy: -107.287 Dist. restrs. and SS energy: 1.675 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1685.426649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.426649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.432866 (E_RNA) where: Base-Base interactions energy: -1200.075 where: short stacking energy: -505.856 Base-Backbone interact. energy: -2.324 local terms energy: -522.034133 where: bonds (distance) C4'-P energy: -97.690 bonds (distance) P-C4' energy: -87.729 flat angles C4'-P-C4' energy: -112.622 flat angles P-C4'-P energy: -75.670 tors. eta vs tors. theta energy: -148.323 Dist. restrs. and SS energy: 2.256 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1640.880304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.880304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.947991 (E_RNA) where: Base-Base interactions energy: -1161.098 where: short stacking energy: -494.526 Base-Backbone interact. energy: -2.092 local terms energy: -515.758538 where: bonds (distance) C4'-P energy: -83.641 bonds (distance) P-C4' energy: -107.920 flat angles C4'-P-C4' energy: -108.415 flat angles P-C4'-P energy: -73.252 tors. eta vs tors. theta energy: -142.530 Dist. restrs. and SS energy: 1.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1589.435937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.435937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.226664 (E_RNA) where: Base-Base interactions energy: -1154.165 where: short stacking energy: -480.056 Base-Backbone interact. energy: -2.651 local terms energy: -471.411417 where: bonds (distance) C4'-P energy: -83.700 bonds (distance) P-C4' energy: -82.730 flat angles C4'-P-C4' energy: -99.039 flat angles P-C4'-P energy: -64.966 tors. eta vs tors. theta energy: -140.976 Dist. restrs. and SS energy: 2.041 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1553.718097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1553.718097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.816049 (E_RNA) where: Base-Base interactions energy: -1123.000 where: short stacking energy: -475.862 Base-Backbone interact. energy: -3.317 local terms energy: -465.499033 where: bonds (distance) C4'-P energy: -72.874 bonds (distance) P-C4' energy: -84.195 flat angles C4'-P-C4' energy: -98.164 flat angles P-C4'-P energy: -74.551 tors. eta vs tors. theta energy: -135.714 Dist. restrs. and SS energy: 1.348 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1518.215129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.215129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1555.937153 (E_RNA) where: Base-Base interactions energy: -1102.151 where: short stacking energy: -441.147 Base-Backbone interact. energy: -0.580 local terms energy: -453.206036 where: bonds (distance) C4'-P energy: -76.131 bonds (distance) P-C4' energy: -80.657 flat angles C4'-P-C4' energy: -108.848 flat angles P-C4'-P energy: -67.389 tors. eta vs tors. theta energy: -120.181 Dist. restrs. and SS energy: 0.972 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1508.643387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.643387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.227392 (E_RNA) where: Base-Base interactions energy: -1102.357 where: short stacking energy: -457.254 Base-Backbone interact. energy: -1.130 local terms energy: -443.741035 where: bonds (distance) C4'-P energy: -89.581 bonds (distance) P-C4' energy: -74.560 flat angles C4'-P-C4' energy: -100.411 flat angles P-C4'-P energy: -60.009 tors. eta vs tors. theta energy: -119.181 Dist. restrs. and SS energy: 1.834 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1455.260918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.260918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.213577 (E_RNA) where: Base-Base interactions energy: -1065.914 where: short stacking energy: -426.685 Base-Backbone interact. energy: -1.526 local terms energy: -425.773260 where: bonds (distance) C4'-P energy: -72.135 bonds (distance) P-C4' energy: -82.322 flat angles C4'-P-C4' energy: -87.360 flat angles P-C4'-P energy: -71.902 tors. eta vs tors. theta energy: -112.054 Dist. restrs. and SS energy: 1.203 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1388.722201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.722201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.911145 (E_RNA) where: Base-Base interactions energy: -1031.605 where: short stacking energy: -420.540 Base-Backbone interact. energy: -2.270 local terms energy: -394.037064 where: bonds (distance) C4'-P energy: -68.601 bonds (distance) P-C4' energy: -74.250 flat angles C4'-P-C4' energy: -83.101 flat angles P-C4'-P energy: -56.316 tors. eta vs tors. theta energy: -111.770 Dist. restrs. and SS energy: 2.439 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1373.741283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.741283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.459050 (E_RNA) where: Base-Base interactions energy: -1000.731 where: short stacking energy: -428.615 Base-Backbone interact. energy: -2.112 local terms energy: -408.616073 where: bonds (distance) C4'-P energy: -69.201 bonds (distance) P-C4' energy: -77.981 flat angles C4'-P-C4' energy: -86.179 flat angles P-C4'-P energy: -51.474 tors. eta vs tors. theta energy: -123.781 Dist. restrs. and SS energy: 0.968 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1289.404983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.404983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.729146 (E_RNA) where: Base-Base interactions energy: -936.619 where: short stacking energy: -370.725 Base-Backbone interact. energy: -0.393 local terms energy: -390.717087 where: bonds (distance) C4'-P energy: -69.954 bonds (distance) P-C4' energy: -69.274 flat angles C4'-P-C4' energy: -92.343 flat angles P-C4'-P energy: -58.179 tors. eta vs tors. theta energy: -100.968 Dist. restrs. and SS energy: 1.574 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1697.539254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.539254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.855225 (E_RNA) where: Base-Base interactions energy: -1225.298 where: short stacking energy: -509.093 Base-Backbone interact. energy: -0.804 local terms energy: -508.753090 where: bonds (distance) C4'-P energy: -97.604 bonds (distance) P-C4' energy: -92.624 flat angles C4'-P-C4' energy: -112.174 flat angles P-C4'-P energy: -65.583 tors. eta vs tors. theta energy: -140.768 Dist. restrs. and SS energy: 0.566 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1651.562873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.562873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.969669 (E_RNA) where: Base-Base interactions energy: -1201.506 where: short stacking energy: -526.164 Base-Backbone interact. energy: -1.842 local terms energy: -485.621137 where: bonds (distance) C4'-P energy: -73.331 bonds (distance) P-C4' energy: -90.742 flat angles C4'-P-C4' energy: -102.169 flat angles P-C4'-P energy: -72.141 tors. eta vs tors. theta energy: -147.239 Dist. restrs. and SS energy: 0.657 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1616.767215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.767215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.057003 (E_RNA) where: Base-Base interactions energy: -1184.808 where: short stacking energy: -505.681 Base-Backbone interact. energy: -2.365 local terms energy: -467.884734 where: bonds (distance) C4'-P energy: -77.128 bonds (distance) P-C4' energy: -91.509 flat angles C4'-P-C4' energy: -104.519 flat angles P-C4'-P energy: -56.749 tors. eta vs tors. theta energy: -137.980 Dist. restrs. and SS energy: 1.540 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1620.364701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.364701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.997289 (E_RNA) where: Base-Base interactions energy: -1183.815 where: short stacking energy: -485.257 Base-Backbone interact. energy: 1.008 local terms energy: -475.190236 where: bonds (distance) C4'-P energy: -91.966 bonds (distance) P-C4' energy: -85.570 flat angles C4'-P-C4' energy: -93.462 flat angles P-C4'-P energy: -65.951 tors. eta vs tors. theta energy: -138.241 Dist. restrs. and SS energy: 0.883 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1537.039120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.039120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1574.674426 (E_RNA) where: Base-Base interactions energy: -1131.587 where: short stacking energy: -448.077 Base-Backbone interact. energy: -0.137 local terms energy: -442.949838 where: bonds (distance) C4'-P energy: -80.720 bonds (distance) P-C4' energy: -89.126 flat angles C4'-P-C4' energy: -95.625 flat angles P-C4'-P energy: -54.661 tors. eta vs tors. theta energy: -122.817 Dist. restrs. and SS energy: 0.885 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1523.452694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.452694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1561.755088 (E_RNA) where: Base-Base interactions energy: -1134.802 where: short stacking energy: -483.783 Base-Backbone interact. energy: -1.932 local terms energy: -425.020781 where: bonds (distance) C4'-P energy: -74.796 bonds (distance) P-C4' energy: -63.163 flat angles C4'-P-C4' energy: -100.618 flat angles P-C4'-P energy: -56.940 tors. eta vs tors. theta energy: -129.504 Dist. restrs. and SS energy: 1.552 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1444.278052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.278052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.371770 (E_RNA) where: Base-Base interactions energy: -1071.856 where: short stacking energy: -448.431 Base-Backbone interact. energy: 0.271 local terms energy: -410.787530 where: bonds (distance) C4'-P energy: -64.414 bonds (distance) P-C4' energy: -80.029 flat angles C4'-P-C4' energy: -95.876 flat angles P-C4'-P energy: -52.454 tors. eta vs tors. theta energy: -118.014 Dist. restrs. and SS energy: 1.344 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1382.152179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.152179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.936755 (E_RNA) where: Base-Base interactions energy: -1002.709 where: short stacking energy: -407.036 Base-Backbone interact. energy: -1.571 local terms energy: -416.656456 where: bonds (distance) C4'-P energy: -69.881 bonds (distance) P-C4' energy: -66.125 flat angles C4'-P-C4' energy: -90.461 flat angles P-C4'-P energy: -77.856 tors. eta vs tors. theta energy: -112.333 Dist. restrs. and SS energy: 2.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1353.922305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.922305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.534549 (E_RNA) where: Base-Base interactions energy: -1003.424 where: short stacking energy: -396.669 Base-Backbone interact. energy: -0.171 local terms energy: -388.939303 where: bonds (distance) C4'-P energy: -58.010 bonds (distance) P-C4' energy: -86.366 flat angles C4'-P-C4' energy: -85.605 flat angles P-C4'-P energy: -42.396 tors. eta vs tors. theta energy: -116.562 Dist. restrs. and SS energy: 1.862 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -1313.206846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.206846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.164309 (E_RNA) where: Base-Base interactions energy: -969.891 where: short stacking energy: -393.286 Base-Backbone interact. energy: -1.325 local terms energy: -380.948212 where: bonds (distance) C4'-P energy: -76.810 bonds (distance) P-C4' energy: -78.748 flat angles C4'-P-C4' energy: -62.679 flat angles P-C4'-P energy: -59.523 tors. eta vs tors. theta energy: -103.189 Dist. restrs. and SS energy: 2.207 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1667.987311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1667.987311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1705.427429 (E_RNA) where: Base-Base interactions energy: -1172.494 where: short stacking energy: -487.295 Base-Backbone interact. energy: -1.034 local terms energy: -531.899774 where: bonds (distance) C4'-P energy: -103.065 bonds (distance) P-C4' energy: -94.773 flat angles C4'-P-C4' energy: -103.833 flat angles P-C4'-P energy: -82.061 tors. eta vs tors. theta energy: -148.168 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1665.874532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.874532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.934686 (E_RNA) where: Base-Base interactions energy: -1208.034 where: short stacking energy: -503.757 Base-Backbone interact. energy: -0.969 local terms energy: -494.932003 where: bonds (distance) C4'-P energy: -87.272 bonds (distance) P-C4' energy: -92.283 flat angles C4'-P-C4' energy: -110.085 flat angles P-C4'-P energy: -65.646 tors. eta vs tors. theta energy: -139.646 Dist. restrs. and SS energy: 1.310 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1605.517358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.517358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.759955 (E_RNA) where: Base-Base interactions energy: -1141.720 where: short stacking energy: -477.797 Base-Backbone interact. energy: 0.480 local terms energy: -502.519666 where: bonds (distance) C4'-P energy: -77.036 bonds (distance) P-C4' energy: -97.338 flat angles C4'-P-C4' energy: -107.326 flat angles P-C4'-P energy: -73.971 tors. eta vs tors. theta energy: -146.849 Dist. restrs. and SS energy: 1.493 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1575.731969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.731969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.503274 (E_RNA) where: Base-Base interactions energy: -1141.657 where: short stacking energy: -495.923 Base-Backbone interact. energy: 0.750 local terms energy: -472.595858 where: bonds (distance) C4'-P energy: -82.499 bonds (distance) P-C4' energy: -83.774 flat angles C4'-P-C4' energy: -94.076 flat angles P-C4'-P energy: -71.201 tors. eta vs tors. theta energy: -141.045 Dist. restrs. and SS energy: 1.021 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1579.897629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.897629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.472631 (E_RNA) where: Base-Base interactions energy: -1170.961 where: short stacking energy: -476.701 Base-Backbone interact. energy: -0.249 local terms energy: -446.263063 where: bonds (distance) C4'-P energy: -72.031 bonds (distance) P-C4' energy: -76.923 flat angles C4'-P-C4' energy: -102.504 flat angles P-C4'-P energy: -65.881 tors. eta vs tors. theta energy: -128.925 Dist. restrs. and SS energy: 0.825 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1491.829966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.829966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1529.628667 (E_RNA) where: Base-Base interactions energy: -1082.253 where: short stacking energy: -428.723 Base-Backbone interact. energy: -0.815 local terms energy: -446.561427 where: bonds (distance) C4'-P energy: -65.289 bonds (distance) P-C4' energy: -86.036 flat angles C4'-P-C4' energy: -103.725 flat angles P-C4'-P energy: -69.389 tors. eta vs tors. theta energy: -122.122 Dist. restrs. and SS energy: 1.049 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1453.788998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.788998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.631409 (E_RNA) where: Base-Base interactions energy: -1062.981 where: short stacking energy: -425.671 Base-Backbone interact. energy: 1.327 local terms energy: -430.977298 where: bonds (distance) C4'-P energy: -72.231 bonds (distance) P-C4' energy: -87.388 flat angles C4'-P-C4' energy: -86.835 flat angles P-C4'-P energy: -68.056 tors. eta vs tors. theta energy: -116.467 Dist. restrs. and SS energy: 2.092 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1382.739267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.739267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.372892 (E_RNA) where: Base-Base interactions energy: -1007.538 where: short stacking energy: -401.854 Base-Backbone interact. energy: -1.338 local terms energy: -411.496858 where: bonds (distance) C4'-P energy: -76.363 bonds (distance) P-C4' energy: -88.441 flat angles C4'-P-C4' energy: -85.272 flat angles P-C4'-P energy: -52.743 tors. eta vs tors. theta energy: -108.677 Dist. restrs. and SS energy: 0.884 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1356.798210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.798210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.457454 (E_RNA) where: Base-Base interactions energy: -987.687 where: short stacking energy: -407.170 Base-Backbone interact. energy: -1.830 local terms energy: -406.940952 where: bonds (distance) C4'-P energy: -75.373 bonds (distance) P-C4' energy: -67.978 flat angles C4'-P-C4' energy: -89.368 flat angles P-C4'-P energy: -54.150 tors. eta vs tors. theta energy: -120.072 Dist. restrs. and SS energy: 2.909 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1305.099418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.099418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.385788 (E_RNA) where: Base-Base interactions energy: -960.107 where: short stacking energy: -397.440 Base-Backbone interact. energy: 4.029 local terms energy: -388.307782 where: bonds (distance) C4'-P energy: -76.303 bonds (distance) P-C4' energy: -63.385 flat angles C4'-P-C4' energy: -86.208 flat angles P-C4'-P energy: -56.452 tors. eta vs tors. theta energy: -105.959 Dist. restrs. and SS energy: 2.536 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1679.890067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.890067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.599139 (E_RNA) where: Base-Base interactions energy: -1241.423 where: short stacking energy: -516.545 Base-Backbone interact. energy: -0.310 local terms energy: -475.866862 where: bonds (distance) C4'-P energy: -82.977 bonds (distance) P-C4' energy: -82.580 flat angles C4'-P-C4' energy: -104.829 flat angles P-C4'-P energy: -71.384 tors. eta vs tors. theta energy: -134.097 Dist. restrs. and SS energy: 0.959 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1653.837750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.837750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.131666 (E_RNA) where: Base-Base interactions energy: -1209.201 where: short stacking energy: -482.449 Base-Backbone interact. energy: -1.349 local terms energy: -482.581866 where: bonds (distance) C4'-P energy: -86.814 bonds (distance) P-C4' energy: -85.188 flat angles C4'-P-C4' energy: -103.525 flat angles P-C4'-P energy: -65.922 tors. eta vs tors. theta energy: -141.133 Dist. restrs. and SS energy: 2.544 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1628.708952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.708952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.209371 (E_RNA) where: Base-Base interactions energy: -1185.712 where: short stacking energy: -476.151 Base-Backbone interact. energy: -2.201 local terms energy: -480.296318 where: bonds (distance) C4'-P energy: -78.834 bonds (distance) P-C4' energy: -96.647 flat angles C4'-P-C4' energy: -98.836 flat angles P-C4'-P energy: -68.818 tors. eta vs tors. theta energy: -137.162 Dist. restrs. and SS energy: 2.750 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1607.151814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.151814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.196776 (E_RNA) where: Base-Base interactions energy: -1143.516 where: short stacking energy: -496.372 Base-Backbone interact. energy: -2.750 local terms energy: -498.930246 where: bonds (distance) C4'-P energy: -83.900 bonds (distance) P-C4' energy: -92.854 flat angles C4'-P-C4' energy: -98.936 flat angles P-C4'-P energy: -80.527 tors. eta vs tors. theta energy: -142.713 Dist. restrs. and SS energy: 1.295 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1547.871488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.871488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.476019 (E_RNA) where: Base-Base interactions energy: -1143.057 where: short stacking energy: -439.100 Base-Backbone interact. energy: 0.698 local terms energy: -443.116302 where: bonds (distance) C4'-P energy: -74.571 bonds (distance) P-C4' energy: -83.052 flat angles C4'-P-C4' energy: -102.479 flat angles P-C4'-P energy: -64.344 tors. eta vs tors. theta energy: -118.671 Dist. restrs. and SS energy: 0.855 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1500.187094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.187094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1538.047627 (E_RNA) where: Base-Base interactions energy: -1078.175 where: short stacking energy: -445.685 Base-Backbone interact. energy: -0.778 local terms energy: -459.094391 where: bonds (distance) C4'-P energy: -78.925 bonds (distance) P-C4' energy: -84.544 flat angles C4'-P-C4' energy: -96.037 flat angles P-C4'-P energy: -75.272 tors. eta vs tors. theta energy: -124.317 Dist. restrs. and SS energy: 1.111 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1484.285568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.285568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.730416 (E_RNA) where: Base-Base interactions energy: -1098.687 where: short stacking energy: -439.794 Base-Backbone interact. energy: -3.685 local terms energy: -419.358954 where: bonds (distance) C4'-P energy: -70.338 bonds (distance) P-C4' energy: -78.266 flat angles C4'-P-C4' energy: -85.488 flat angles P-C4'-P energy: -57.803 tors. eta vs tors. theta energy: -127.464 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1402.034582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.034582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.205998 (E_RNA) where: Base-Base interactions energy: -1014.149 where: short stacking energy: -426.827 Base-Backbone interact. energy: -1.842 local terms energy: -425.214879 where: bonds (distance) C4'-P energy: -79.053 bonds (distance) P-C4' energy: -71.984 flat angles C4'-P-C4' energy: -93.936 flat angles P-C4'-P energy: -62.173 tors. eta vs tors. theta energy: -118.070 Dist. restrs. and SS energy: 2.421 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1372.564814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.564814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.028808 (E_RNA) where: Base-Base interactions energy: -996.567 where: short stacking energy: -419.925 Base-Backbone interact. energy: 1.104 local terms energy: -414.565815 where: bonds (distance) C4'-P energy: -74.575 bonds (distance) P-C4' energy: -82.766 flat angles C4'-P-C4' energy: -87.003 flat angles P-C4'-P energy: -57.365 tors. eta vs tors. theta energy: -112.858 Dist. restrs. and SS energy: 0.714 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1291.823463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.823463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.743280 (E_RNA) where: Base-Base interactions energy: -935.115 where: short stacking energy: -391.288 Base-Backbone interact. energy: -1.966 local terms energy: -400.662115 where: bonds (distance) C4'-P energy: -76.710 bonds (distance) P-C4' energy: -78.558 flat angles C4'-P-C4' energy: -80.226 flat angles P-C4'-P energy: -49.247 tors. eta vs tors. theta energy: -115.921 Dist. restrs. and SS energy: 9.170 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1676.093124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.093124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.672480 (E_RNA) where: Base-Base interactions energy: -1214.769 where: short stacking energy: -510.112 Base-Backbone interact. energy: -1.721 local terms energy: -498.182103 where: bonds (distance) C4'-P energy: -94.332 bonds (distance) P-C4' energy: -79.416 flat angles C4'-P-C4' energy: -106.166 flat angles P-C4'-P energy: -68.498 tors. eta vs tors. theta energy: -149.770 Dist. restrs. and SS energy: 1.829 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1675.028371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.028371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.616976 (E_RNA) where: Base-Base interactions energy: -1217.832 where: short stacking energy: -505.257 Base-Backbone interact. energy: -1.708 local terms energy: -493.077094 where: bonds (distance) C4'-P energy: -94.592 bonds (distance) P-C4' energy: -88.924 flat angles C4'-P-C4' energy: -98.904 flat angles P-C4'-P energy: -72.063 tors. eta vs tors. theta energy: -138.594 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1620.429238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.429238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.635888 (E_RNA) where: Base-Base interactions energy: -1162.507 where: short stacking energy: -495.693 Base-Backbone interact. energy: 0.387 local terms energy: -496.516079 where: bonds (distance) C4'-P energy: -94.648 bonds (distance) P-C4' energy: -94.865 flat angles C4'-P-C4' energy: -105.732 flat angles P-C4'-P energy: -62.862 tors. eta vs tors. theta energy: -138.409 Dist. restrs. and SS energy: 1.457 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1582.607751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1582.607751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.272740 (E_RNA) where: Base-Base interactions energy: -1137.296 where: short stacking energy: -473.865 Base-Backbone interact. energy: -0.111 local terms energy: -482.865031 where: bonds (distance) C4'-P energy: -82.097 bonds (distance) P-C4' energy: -94.326 flat angles C4'-P-C4' energy: -96.289 flat angles P-C4'-P energy: -63.822 tors. eta vs tors. theta energy: -146.331 Dist. restrs. and SS energy: 0.915 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1548.096314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.096314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.619793 (E_RNA) where: Base-Base interactions energy: -1138.146 where: short stacking energy: -470.633 Base-Backbone interact. energy: -1.382 local terms energy: -447.092064 where: bonds (distance) C4'-P energy: -80.762 bonds (distance) P-C4' energy: -81.995 flat angles C4'-P-C4' energy: -91.501 flat angles P-C4'-P energy: -61.305 tors. eta vs tors. theta energy: -131.530 Dist. restrs. and SS energy: 1.773 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1505.686279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.686279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.055638 (E_RNA) where: Base-Base interactions energy: -1088.979 where: short stacking energy: -451.695 Base-Backbone interact. energy: -1.924 local terms energy: -453.152996 where: bonds (distance) C4'-P energy: -78.812 bonds (distance) P-C4' energy: -95.030 flat angles C4'-P-C4' energy: -92.480 flat angles P-C4'-P energy: -55.928 tors. eta vs tors. theta energy: -130.903 Dist. restrs. and SS energy: 1.619 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1462.555784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.555784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.358593 (E_RNA) where: Base-Base interactions energy: -1069.940 where: short stacking energy: -428.710 Base-Backbone interact. energy: -2.013 local terms energy: -428.405263 where: bonds (distance) C4'-P energy: -81.781 bonds (distance) P-C4' energy: -81.864 flat angles C4'-P-C4' energy: -86.985 flat angles P-C4'-P energy: -55.000 tors. eta vs tors. theta energy: -122.775 Dist. restrs. and SS energy: 1.053 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1373.034881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.034881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.111503 (E_RNA) where: Base-Base interactions energy: -979.374 where: short stacking energy: -414.211 Base-Backbone interact. energy: 0.296 local terms energy: -433.034080 where: bonds (distance) C4'-P energy: -79.732 bonds (distance) P-C4' energy: -81.726 flat angles C4'-P-C4' energy: -94.551 flat angles P-C4'-P energy: -56.240 tors. eta vs tors. theta energy: -120.786 Dist. restrs. and SS energy: 2.327 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1350.039726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.039726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.743488 (E_RNA) where: Base-Base interactions energy: -999.236 where: short stacking energy: -408.013 Base-Backbone interact. energy: 2.562 local terms energy: -392.069628 where: bonds (distance) C4'-P energy: -63.995 bonds (distance) P-C4' energy: -69.630 flat angles C4'-P-C4' energy: -85.823 flat angles P-C4'-P energy: -59.767 tors. eta vs tors. theta energy: -112.854 Dist. restrs. and SS energy: 1.954 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -1342.704599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.704599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.240598 (E_RNA) where: Base-Base interactions energy: -985.024 where: short stacking energy: -409.439 Base-Backbone interact. energy: -1.657 local terms energy: -394.560269 where: bonds (distance) C4'-P energy: -71.075 bonds (distance) P-C4' energy: -79.809 flat angles C4'-P-C4' energy: -87.484 flat angles P-C4'-P energy: -44.942 tors. eta vs tors. theta energy: -111.250 Dist. restrs. and SS energy: 1.786 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1694.423894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.423894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.164648 (E_RNA) where: Base-Base interactions energy: -1216.063 where: short stacking energy: -531.414 Base-Backbone interact. energy: -2.474 local terms energy: -513.627620 where: bonds (distance) C4'-P energy: -93.376 bonds (distance) P-C4' energy: -85.854 flat angles C4'-P-C4' energy: -111.096 flat angles P-C4'-P energy: -75.310 tors. eta vs tors. theta energy: -147.991 Dist. restrs. and SS energy: 0.991 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1648.503369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.503369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.947791 (E_RNA) where: Base-Base interactions energy: -1198.057 where: short stacking energy: -499.935 Base-Backbone interact. energy: -0.983 local terms energy: -486.907907 where: bonds (distance) C4'-P energy: -89.842 bonds (distance) P-C4' energy: -99.643 flat angles C4'-P-C4' energy: -99.104 flat angles P-C4'-P energy: -61.905 tors. eta vs tors. theta energy: -136.415 Dist. restrs. and SS energy: 0.694 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1595.864726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.864726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.974885 (E_RNA) where: Base-Base interactions energy: -1152.640 where: short stacking energy: -492.874 Base-Backbone interact. energy: -0.269 local terms energy: -481.065944 where: bonds (distance) C4'-P energy: -73.169 bonds (distance) P-C4' energy: -98.267 flat angles C4'-P-C4' energy: -98.815 flat angles P-C4'-P energy: -68.023 tors. eta vs tors. theta energy: -142.792 Dist. restrs. and SS energy: 1.360 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1587.174041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.174041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.560355 (E_RNA) where: Base-Base interactions energy: -1145.030 where: short stacking energy: -479.007 Base-Backbone interact. energy: -2.092 local terms energy: -478.438000 where: bonds (distance) C4'-P energy: -92.904 bonds (distance) P-C4' energy: -91.361 flat angles C4'-P-C4' energy: -99.009 flat angles P-C4'-P energy: -61.731 tors. eta vs tors. theta energy: -133.433 Dist. restrs. and SS energy: 1.636 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1566.132203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.132203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.378497 (E_RNA) where: Base-Base interactions energy: -1132.104 where: short stacking energy: -480.507 Base-Backbone interact. energy: 0.233 local terms energy: -472.507458 where: bonds (distance) C4'-P energy: -88.319 bonds (distance) P-C4' energy: -87.231 flat angles C4'-P-C4' energy: -100.036 flat angles P-C4'-P energy: -61.184 tors. eta vs tors. theta energy: -135.736 Dist. restrs. and SS energy: 1.496 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1499.717995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.717995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.976202 (E_RNA) where: Base-Base interactions energy: -1097.160 where: short stacking energy: -433.415 Base-Backbone interact. energy: -2.941 local terms energy: -441.875236 where: bonds (distance) C4'-P energy: -64.143 bonds (distance) P-C4' energy: -80.403 flat angles C4'-P-C4' energy: -100.885 flat angles P-C4'-P energy: -67.789 tors. eta vs tors. theta energy: -128.655 Dist. restrs. and SS energy: 5.508 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1431.232476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1431.232476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.994512 (E_RNA) where: Base-Base interactions energy: -1075.260 where: short stacking energy: -434.638 Base-Backbone interact. energy: -0.317 local terms energy: -393.417192 where: bonds (distance) C4'-P energy: -66.031 bonds (distance) P-C4' energy: -75.577 flat angles C4'-P-C4' energy: -85.884 flat angles P-C4'-P energy: -46.306 tors. eta vs tors. theta energy: -119.620 Dist. restrs. and SS energy: 1.012 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1385.096048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.096048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.782749 (E_RNA) where: Base-Base interactions energy: -989.218 where: short stacking energy: -406.257 Base-Backbone interact. energy: -1.749 local terms energy: -433.815206 where: bonds (distance) C4'-P energy: -80.696 bonds (distance) P-C4' energy: -74.587 flat angles C4'-P-C4' energy: -90.612 flat angles P-C4'-P energy: -65.362 tors. eta vs tors. theta energy: -122.559 Dist. restrs. and SS energy: 2.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1345.126827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.126827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.024883 (E_RNA) where: Base-Base interactions energy: -995.992 where: short stacking energy: -414.783 Base-Backbone interact. energy: 0.419 local terms energy: -388.452460 where: bonds (distance) C4'-P energy: -68.408 bonds (distance) P-C4' energy: -63.970 flat angles C4'-P-C4' energy: -87.270 flat angles P-C4'-P energy: -58.241 tors. eta vs tors. theta energy: -110.563 Dist. restrs. and SS energy: 2.148 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1339.291499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.291499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.978023 (E_RNA) where: Base-Base interactions energy: -972.997 where: short stacking energy: -388.326 Base-Backbone interact. energy: -0.235 local terms energy: -404.745482 where: bonds (distance) C4'-P energy: -79.540 bonds (distance) P-C4' energy: -80.634 flat angles C4'-P-C4' energy: -86.770 flat angles P-C4'-P energy: -58.430 tors. eta vs tors. theta energy: -99.371 Dist. restrs. and SS energy: 1.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1680.201094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.201094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.383237 (E_RNA) where: Base-Base interactions energy: -1200.613 where: short stacking energy: -507.462 Base-Backbone interact. energy: -0.555 local terms energy: -517.214421 where: bonds (distance) C4'-P energy: -97.545 bonds (distance) P-C4' energy: -96.847 flat angles C4'-P-C4' energy: -103.610 flat angles P-C4'-P energy: -81.113 tors. eta vs tors. theta energy: -138.099 Dist. restrs. and SS energy: 1.432 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1666.745801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.745801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1704.256428 (E_RNA) where: Base-Base interactions energy: -1197.310 where: short stacking energy: -497.963 Base-Backbone interact. energy: -1.145 local terms energy: -505.801652 where: bonds (distance) C4'-P energy: -96.150 bonds (distance) P-C4' energy: -99.254 flat angles C4'-P-C4' energy: -104.346 flat angles P-C4'-P energy: -65.952 tors. eta vs tors. theta energy: -140.100 Dist. restrs. and SS energy: 0.761 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1610.537403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.537403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.238968 (E_RNA) where: Base-Base interactions energy: -1168.056 where: short stacking energy: -482.305 Base-Backbone interact. energy: -2.025 local terms energy: -479.158569 where: bonds (distance) C4'-P energy: -99.299 bonds (distance) P-C4' energy: -83.554 flat angles C4'-P-C4' energy: -99.113 flat angles P-C4'-P energy: -68.324 tors. eta vs tors. theta energy: -128.870 Dist. restrs. and SS energy: 1.952 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1592.293346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.293346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.074590 (E_RNA) where: Base-Base interactions energy: -1180.386 where: short stacking energy: -493.694 Base-Backbone interact. energy: -1.436 local terms energy: -448.252973 where: bonds (distance) C4'-P energy: -81.824 bonds (distance) P-C4' energy: -77.218 flat angles C4'-P-C4' energy: -92.709 flat angles P-C4'-P energy: -60.274 tors. eta vs tors. theta energy: -136.228 Dist. restrs. and SS energy: 1.031 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1564.582378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.582378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.164965 (E_RNA) where: Base-Base interactions energy: -1138.259 where: short stacking energy: -484.280 Base-Backbone interact. energy: -2.025 local terms energy: -462.880633 where: bonds (distance) C4'-P energy: -92.386 bonds (distance) P-C4' energy: -82.876 flat angles C4'-P-C4' energy: -101.970 flat angles P-C4'-P energy: -48.675 tors. eta vs tors. theta energy: -136.974 Dist. restrs. and SS energy: 1.833 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1500.843872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.843872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.357709 (E_RNA) where: Base-Base interactions energy: -1080.640 where: short stacking energy: -444.848 Base-Backbone interact. energy: -1.757 local terms energy: -460.960704 where: bonds (distance) C4'-P energy: -81.708 bonds (distance) P-C4' energy: -83.977 flat angles C4'-P-C4' energy: -99.742 flat angles P-C4'-P energy: -67.485 tors. eta vs tors. theta energy: -128.049 Dist. restrs. and SS energy: 5.764 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1440.180926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.180926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.393749 (E_RNA) where: Base-Base interactions energy: -1052.509 where: short stacking energy: -443.735 Base-Backbone interact. energy: 1.531 local terms energy: -427.414909 where: bonds (distance) C4'-P energy: -74.719 bonds (distance) P-C4' energy: -84.232 flat angles C4'-P-C4' energy: -95.380 flat angles P-C4'-P energy: -55.271 tors. eta vs tors. theta energy: -117.812 Dist. restrs. and SS energy: 1.463 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1439.905299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.905299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.505048 (E_RNA) where: Base-Base interactions energy: -1060.816 where: short stacking energy: -434.351 Base-Backbone interact. energy: -1.195 local terms energy: -417.494497 where: bonds (distance) C4'-P energy: -68.583 bonds (distance) P-C4' energy: -77.059 flat angles C4'-P-C4' energy: -88.700 flat angles P-C4'-P energy: -63.888 tors. eta vs tors. theta energy: -119.265 Dist. restrs. and SS energy: 2.850 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1353.974369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.974369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.561990 (E_RNA) where: Base-Base interactions energy: -982.031 where: short stacking energy: -407.178 Base-Backbone interact. energy: -0.578 local terms energy: -409.952609 where: bonds (distance) C4'-P energy: -72.118 bonds (distance) P-C4' energy: -84.663 flat angles C4'-P-C4' energy: -90.584 flat angles P-C4'-P energy: -47.826 tors. eta vs tors. theta energy: -114.763 Dist. restrs. and SS energy: 1.838 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1296.120462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.120462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.095086 (E_RNA) where: Base-Base interactions energy: -962.715 where: short stacking energy: -386.690 Base-Backbone interact. energy: -0.174 local terms energy: -371.205724 where: bonds (distance) C4'-P energy: -83.391 bonds (distance) P-C4' energy: -67.230 flat angles C4'-P-C4' energy: -76.002 flat angles P-C4'-P energy: -42.369 tors. eta vs tors. theta energy: -102.213 Dist. restrs. and SS energy: 1.225 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1695.709678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.709678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.956702 (E_RNA) where: Base-Base interactions energy: -1215.584 where: short stacking energy: -519.000 Base-Backbone interact. energy: -1.646 local terms energy: -515.726879 where: bonds (distance) C4'-P energy: -90.955 bonds (distance) P-C4' energy: -92.633 flat angles C4'-P-C4' energy: -105.178 flat angles P-C4'-P energy: -81.285 tors. eta vs tors. theta energy: -145.677 Dist. restrs. and SS energy: 0.497 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1651.824413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.824413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.406616 (E_RNA) where: Base-Base interactions energy: -1186.840 where: short stacking energy: -495.137 Base-Backbone interact. energy: -1.810 local terms energy: -500.756273 where: bonds (distance) C4'-P energy: -89.870 bonds (distance) P-C4' energy: -97.915 flat angles C4'-P-C4' energy: -107.162 flat angles P-C4'-P energy: -66.645 tors. eta vs tors. theta energy: -139.164 Dist. restrs. and SS energy: 0.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1602.753108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.753108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.549149 (E_RNA) where: Base-Base interactions energy: -1158.368 where: short stacking energy: -457.936 Base-Backbone interact. energy: -1.943 local terms energy: -480.237772 where: bonds (distance) C4'-P energy: -86.380 bonds (distance) P-C4' energy: -98.882 flat angles C4'-P-C4' energy: -99.202 flat angles P-C4'-P energy: -66.795 tors. eta vs tors. theta energy: -128.979 Dist. restrs. and SS energy: 1.046 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1592.045939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.045939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.565325 (E_RNA) where: Base-Base interactions energy: -1150.001 where: short stacking energy: -481.455 Base-Backbone interact. energy: -0.184 local terms energy: -479.380881 where: bonds (distance) C4'-P energy: -83.541 bonds (distance) P-C4' energy: -90.518 flat angles C4'-P-C4' energy: -101.612 flat angles P-C4'-P energy: -71.223 tors. eta vs tors. theta energy: -132.486 Dist. restrs. and SS energy: 0.769 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1547.358422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.358422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.367983 (E_RNA) where: Base-Base interactions energy: -1119.152 where: short stacking energy: -472.318 Base-Backbone interact. energy: -2.907 local terms energy: -463.309426 where: bonds (distance) C4'-P energy: -83.567 bonds (distance) P-C4' energy: -75.893 flat angles C4'-P-C4' energy: -101.586 flat angles P-C4'-P energy: -67.422 tors. eta vs tors. theta energy: -134.841 Dist. restrs. and SS energy: 1.260 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1466.010209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.010209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.625549 (E_RNA) where: Base-Base interactions energy: -1067.224 where: short stacking energy: -437.473 Base-Backbone interact. energy: -0.745 local terms energy: -439.656374 where: bonds (distance) C4'-P energy: -76.238 bonds (distance) P-C4' energy: -89.881 flat angles C4'-P-C4' energy: -98.675 flat angles P-C4'-P energy: -51.610 tors. eta vs tors. theta energy: -123.253 Dist. restrs. and SS energy: 4.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1452.265246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.265246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.054910 (E_RNA) where: Base-Base interactions energy: -1076.730 where: short stacking energy: -446.934 Base-Backbone interact. energy: -0.438 local terms energy: -412.887370 where: bonds (distance) C4'-P energy: -60.230 bonds (distance) P-C4' energy: -79.556 flat angles C4'-P-C4' energy: -92.356 flat angles P-C4'-P energy: -57.518 tors. eta vs tors. theta energy: -123.227 Dist. restrs. and SS energy: 1.040 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1409.715929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.715929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.608919 (E_RNA) where: Base-Base interactions energy: -1031.842 where: short stacking energy: -416.033 Base-Backbone interact. energy: 0.298 local terms energy: -416.065662 where: bonds (distance) C4'-P energy: -83.379 bonds (distance) P-C4' energy: -72.593 flat angles C4'-P-C4' energy: -88.359 flat angles P-C4'-P energy: -52.599 tors. eta vs tors. theta energy: -119.136 Dist. restrs. and SS energy: 1.143 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1362.633888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.633888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.280809 (E_RNA) where: Base-Base interactions energy: -983.040 where: short stacking energy: -417.946 Base-Backbone interact. energy: 0.605 local terms energy: -418.845750 where: bonds (distance) C4'-P energy: -75.262 bonds (distance) P-C4' energy: -78.686 flat angles C4'-P-C4' energy: -88.087 flat angles P-C4'-P energy: -55.786 tors. eta vs tors. theta energy: -121.025 Dist. restrs. and SS energy: 1.897 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -1319.758484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.758484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.543120 (E_RNA) where: Base-Base interactions energy: -985.454 where: short stacking energy: -389.796 Base-Backbone interact. energy: 1.832 local terms energy: -374.921088 where: bonds (distance) C4'-P energy: -70.246 bonds (distance) P-C4' energy: -58.636 flat angles C4'-P-C4' energy: -82.429 flat angles P-C4'-P energy: -59.027 tors. eta vs tors. theta energy: -104.583 Dist. restrs. and SS energy: 2.035 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1672.452101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1672.452101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.440204 (E_RNA) where: Base-Base interactions energy: -1205.846 where: short stacking energy: -515.117 Base-Backbone interact. energy: -0.549 local terms energy: -504.044786 where: bonds (distance) C4'-P energy: -91.187 bonds (distance) P-C4' energy: -99.072 flat angles C4'-P-C4' energy: -105.991 flat angles P-C4'-P energy: -62.655 tors. eta vs tors. theta energy: -145.139 Dist. restrs. and SS energy: 1.238 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1658.938911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.938911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.148846 (E_RNA) where: Base-Base interactions energy: -1196.492 where: short stacking energy: -497.902 Base-Backbone interact. energy: -1.703 local terms energy: -497.953881 where: bonds (distance) C4'-P energy: -83.539 bonds (distance) P-C4' energy: -103.740 flat angles C4'-P-C4' energy: -98.356 flat angles P-C4'-P energy: -67.494 tors. eta vs tors. theta energy: -144.826 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1626.868365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.868365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.326161 (E_RNA) where: Base-Base interactions energy: -1187.861 where: short stacking energy: -493.349 Base-Backbone interact. energy: -2.767 local terms energy: -473.697834 where: bonds (distance) C4'-P energy: -76.601 bonds (distance) P-C4' energy: -88.135 flat angles C4'-P-C4' energy: -106.845 flat angles P-C4'-P energy: -62.783 tors. eta vs tors. theta energy: -139.334 Dist. restrs. and SS energy: 0.708 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1560.051071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.051071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.020974 (E_RNA) where: Base-Base interactions energy: -1128.256 where: short stacking energy: -465.571 Base-Backbone interact. energy: -3.368 local terms energy: -466.397225 where: bonds (distance) C4'-P energy: -82.857 bonds (distance) P-C4' energy: -91.051 flat angles C4'-P-C4' energy: -97.054 flat angles P-C4'-P energy: -68.533 tors. eta vs tors. theta energy: -126.902 Dist. restrs. and SS energy: 1.220 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1570.506460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.506460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.531365 (E_RNA) where: Base-Base interactions energy: -1124.354 where: short stacking energy: -459.645 Base-Backbone interact. energy: -0.939 local terms energy: -483.238406 where: bonds (distance) C4'-P energy: -92.384 bonds (distance) P-C4' energy: -93.938 flat angles C4'-P-C4' energy: -97.258 flat angles P-C4'-P energy: -63.272 tors. eta vs tors. theta energy: -136.385 Dist. restrs. and SS energy: 1.275 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1480.966605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.966605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.311969 (E_RNA) where: Base-Base interactions energy: -1080.134 where: short stacking energy: -440.492 Base-Backbone interact. energy: -1.936 local terms energy: -439.241549 where: bonds (distance) C4'-P energy: -71.144 bonds (distance) P-C4' energy: -86.528 flat angles C4'-P-C4' energy: -104.252 flat angles P-C4'-P energy: -61.687 tors. eta vs tors. theta energy: -115.630 Dist. restrs. and SS energy: 3.595 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1453.262368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.262368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.801784 (E_RNA) where: Base-Base interactions energy: -1075.795 where: short stacking energy: -438.026 Base-Backbone interact. energy: 0.040 local terms energy: -416.046477 where: bonds (distance) C4'-P energy: -81.297 bonds (distance) P-C4' energy: -69.295 flat angles C4'-P-C4' energy: -86.413 flat angles P-C4'-P energy: -59.466 tors. eta vs tors. theta energy: -119.575 Dist. restrs. and SS energy: 1.789 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1412.140482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.140482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.778509 (E_RNA) where: Base-Base interactions energy: -1038.391 where: short stacking energy: -411.847 Base-Backbone interact. energy: 1.350 local terms energy: -413.737230 where: bonds (distance) C4'-P energy: -68.463 bonds (distance) P-C4' energy: -73.007 flat angles C4'-P-C4' energy: -92.989 flat angles P-C4'-P energy: -70.550 tors. eta vs tors. theta energy: -108.728 Dist. restrs. and SS energy: 1.888 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1360.105985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.105985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.597371 (E_RNA) where: Base-Base interactions energy: -1000.088 where: short stacking energy: -402.651 Base-Backbone interact. energy: -2.591 local terms energy: -397.918612 where: bonds (distance) C4'-P energy: -70.449 bonds (distance) P-C4' energy: -77.138 flat angles C4'-P-C4' energy: -94.585 flat angles P-C4'-P energy: -42.323 tors. eta vs tors. theta energy: -113.424 Dist. restrs. and SS energy: 3.741 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -1288.778263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.778263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.614419 (E_RNA) where: Base-Base interactions energy: -962.319 where: short stacking energy: -381.977 Base-Backbone interact. energy: 0.551 local terms energy: -365.846204 where: bonds (distance) C4'-P energy: -69.018 bonds (distance) P-C4' energy: -63.311 flat angles C4'-P-C4' energy: -83.586 flat angles P-C4'-P energy: -53.697 tors. eta vs tors. theta energy: -96.234 Dist. restrs. and SS energy: 2.086 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1670.850083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1670.850083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.043966 (E_RNA) where: Base-Base interactions energy: -1231.875 where: short stacking energy: -502.749 Base-Backbone interact. energy: 1.551 local terms energy: -479.719868 where: bonds (distance) C4'-P energy: -91.617 bonds (distance) P-C4' energy: -87.371 flat angles C4'-P-C4' energy: -108.828 flat angles P-C4'-P energy: -60.750 tors. eta vs tors. theta energy: -131.154 Dist. restrs. and SS energy: 2.444 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1649.628578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.628578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.239995 (E_RNA) where: Base-Base interactions energy: -1201.572 where: short stacking energy: -517.844 Base-Backbone interact. energy: -0.839 local terms energy: -484.829078 where: bonds (distance) C4'-P energy: -94.208 bonds (distance) P-C4' energy: -86.528 flat angles C4'-P-C4' energy: -99.227 flat angles P-C4'-P energy: -61.512 tors. eta vs tors. theta energy: -143.353 Dist. restrs. and SS energy: 0.861 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1668.282476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.282476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.300978 (E_RNA) where: Base-Base interactions energy: -1205.023 where: short stacking energy: -493.989 Base-Backbone interact. energy: -0.830 local terms energy: -500.448901 where: bonds (distance) C4'-P energy: -93.110 bonds (distance) P-C4' energy: -89.839 flat angles C4'-P-C4' energy: -110.183 flat angles P-C4'-P energy: -73.422 tors. eta vs tors. theta energy: -133.895 Dist. restrs. and SS energy: 1.269 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1575.605475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.605475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.863676 (E_RNA) where: Base-Base interactions energy: -1145.703 where: short stacking energy: -466.083 Base-Backbone interact. energy: -2.093 local terms energy: -466.067854 where: bonds (distance) C4'-P energy: -81.222 bonds (distance) P-C4' energy: -82.236 flat angles C4'-P-C4' energy: -104.334 flat angles P-C4'-P energy: -68.076 tors. eta vs tors. theta energy: -130.200 Dist. restrs. and SS energy: 1.508 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1547.951937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.951937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.765738 (E_RNA) where: Base-Base interactions energy: -1117.939 where: short stacking energy: -467.544 Base-Backbone interact. energy: -1.433 local terms energy: -467.394129 where: bonds (distance) C4'-P energy: -81.078 bonds (distance) P-C4' energy: -84.144 flat angles C4'-P-C4' energy: -103.040 flat angles P-C4'-P energy: -59.972 tors. eta vs tors. theta energy: -139.159 Dist. restrs. and SS energy: 2.064 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1473.648901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.648901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.317605 (E_RNA) where: Base-Base interactions energy: -1088.444 where: short stacking energy: -430.708 Base-Backbone interact. energy: -0.628 local terms energy: -425.245898 where: bonds (distance) C4'-P energy: -80.440 bonds (distance) P-C4' energy: -75.729 flat angles C4'-P-C4' energy: -93.294 flat angles P-C4'-P energy: -60.556 tors. eta vs tors. theta energy: -115.227 Dist. restrs. and SS energy: 3.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1437.715366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.715366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.086465 (E_RNA) where: Base-Base interactions energy: -1021.847 where: short stacking energy: -410.171 Base-Backbone interact. energy: -2.979 local terms energy: -451.261127 where: bonds (distance) C4'-P energy: -98.587 bonds (distance) P-C4' energy: -88.924 flat angles C4'-P-C4' energy: -88.921 flat angles P-C4'-P energy: -60.944 tors. eta vs tors. theta energy: -113.885 Dist. restrs. and SS energy: 1.621 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1443.498079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.498079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.421865 (E_RNA) where: Base-Base interactions energy: -1072.275 where: short stacking energy: -440.752 Base-Backbone interact. energy: 2.486 local terms energy: -412.632705 where: bonds (distance) C4'-P energy: -70.984 bonds (distance) P-C4' energy: -75.911 flat angles C4'-P-C4' energy: -84.900 flat angles P-C4'-P energy: -66.433 tors. eta vs tors. theta energy: -114.405 Dist. restrs. and SS energy: 2.174 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1348.431567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.431567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.895315 (E_RNA) where: Base-Base interactions energy: -992.029 where: short stacking energy: -395.434 Base-Backbone interact. energy: -1.409 local terms energy: -395.457032 where: bonds (distance) C4'-P energy: -79.453 bonds (distance) P-C4' energy: -75.147 flat angles C4'-P-C4' energy: -80.493 flat angles P-C4'-P energy: -47.143 tors. eta vs tors. theta energy: -113.222 Dist. restrs. and SS energy: 3.714 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -1292.004564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.004564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.889029 (E_RNA) where: Base-Base interactions energy: -943.952 where: short stacking energy: -390.266 Base-Backbone interact. energy: -2.151 local terms energy: -385.786058 where: bonds (distance) C4'-P energy: -71.473 bonds (distance) P-C4' energy: -70.198 flat angles C4'-P-C4' energy: -86.710 flat angles P-C4'-P energy: -46.195 tors. eta vs tors. theta energy: -111.210 Dist. restrs. and SS energy: 3.134 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1683.980107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.980107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.710521 (E_RNA) where: Base-Base interactions energy: -1213.182 where: short stacking energy: -495.278 Base-Backbone interact. energy: -2.007 local terms energy: -506.521654 where: bonds (distance) C4'-P energy: -91.104 bonds (distance) P-C4' energy: -91.899 flat angles C4'-P-C4' energy: -111.610 flat angles P-C4'-P energy: -76.102 tors. eta vs tors. theta energy: -135.807 Dist. restrs. and SS energy: 0.980 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1656.242089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.242089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.795033 (E_RNA) where: Base-Base interactions energy: -1186.619 where: short stacking energy: -498.317 Base-Backbone interact. energy: -2.582 local terms energy: -504.594660 where: bonds (distance) C4'-P energy: -84.410 bonds (distance) P-C4' energy: -99.051 flat angles C4'-P-C4' energy: -104.129 flat angles P-C4'-P energy: -77.958 tors. eta vs tors. theta energy: -139.047 Dist. restrs. and SS energy: 0.803 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1608.400024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.400024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.767359 (E_RNA) where: Base-Base interactions energy: -1164.937 where: short stacking energy: -483.385 Base-Backbone interact. energy: -1.712 local terms energy: -481.118016 where: bonds (distance) C4'-P energy: -99.437 bonds (distance) P-C4' energy: -85.101 flat angles C4'-P-C4' energy: -98.124 flat angles P-C4'-P energy: -64.413 tors. eta vs tors. theta energy: -134.044 Dist. restrs. and SS energy: 2.617 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1629.648097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.648097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.916274 (E_RNA) where: Base-Base interactions energy: -1185.633 where: short stacking energy: -491.067 Base-Backbone interact. energy: -1.374 local terms energy: -481.909617 where: bonds (distance) C4'-P energy: -80.889 bonds (distance) P-C4' energy: -85.795 flat angles C4'-P-C4' energy: -106.193 flat angles P-C4'-P energy: -75.380 tors. eta vs tors. theta energy: -133.652 Dist. restrs. and SS energy: 2.518 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1564.044615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.044615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.044182 (E_RNA) where: Base-Base interactions energy: -1141.161 where: short stacking energy: -478.808 Base-Backbone interact. energy: -1.934 local terms energy: -458.948604 where: bonds (distance) C4'-P energy: -83.679 bonds (distance) P-C4' energy: -82.848 flat angles C4'-P-C4' energy: -102.754 flat angles P-C4'-P energy: -56.318 tors. eta vs tors. theta energy: -133.350 Dist. restrs. and SS energy: 1.250 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1505.669636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.669636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.475609 (E_RNA) where: Base-Base interactions energy: -1092.848 where: short stacking energy: -449.017 Base-Backbone interact. energy: 1.885 local terms energy: -455.513348 where: bonds (distance) C4'-P energy: -80.347 bonds (distance) P-C4' energy: -82.444 flat angles C4'-P-C4' energy: -102.382 flat angles P-C4'-P energy: -61.502 tors. eta vs tors. theta energy: -128.839 Dist. restrs. and SS energy: 4.056 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1444.755184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.755184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.237492 (E_RNA) where: Base-Base interactions energy: -1063.274 where: short stacking energy: -438.124 Base-Backbone interact. energy: -0.854 local terms energy: -420.109585 where: bonds (distance) C4'-P energy: -67.578 bonds (distance) P-C4' energy: -76.160 flat angles C4'-P-C4' energy: -96.443 flat angles P-C4'-P energy: -61.157 tors. eta vs tors. theta energy: -118.772 Dist. restrs. and SS energy: 2.732 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1410.448618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.448618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.006017 (E_RNA) where: Base-Base interactions energy: -1038.827 where: short stacking energy: -417.265 Base-Backbone interact. energy: 0.356 local terms energy: -409.534930 where: bonds (distance) C4'-P energy: -64.995 bonds (distance) P-C4' energy: -77.426 flat angles C4'-P-C4' energy: -93.341 flat angles P-C4'-P energy: -60.122 tors. eta vs tors. theta energy: -113.650 Dist. restrs. and SS energy: 0.807 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1337.054226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1337.054226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.443386 (E_RNA) where: Base-Base interactions energy: -988.149 where: short stacking energy: -408.321 Base-Backbone interact. energy: -1.188 local terms energy: -386.105720 where: bonds (distance) C4'-P energy: -61.912 bonds (distance) P-C4' energy: -73.227 flat angles C4'-P-C4' energy: -90.588 flat angles P-C4'-P energy: -50.963 tors. eta vs tors. theta energy: -109.415 Dist. restrs. and SS energy: 1.639 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -1333.557790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.557790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.619961 (E_RNA) where: Base-Base interactions energy: -980.977 where: short stacking energy: -396.762 Base-Backbone interact. energy: -0.905 local terms energy: -390.737746 where: bonds (distance) C4'-P energy: -78.895 bonds (distance) P-C4' energy: -63.126 flat angles C4'-P-C4' energy: -79.831 flat angles P-C4'-P energy: -57.599 tors. eta vs tors. theta energy: -111.287 Dist. restrs. and SS energy: 2.312 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1706.286118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.286118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.807558 (E_RNA) where: Base-Base interactions energy: -1248.661 where: short stacking energy: -515.372 Base-Backbone interact. energy: -0.218 local terms energy: -494.929088 where: bonds (distance) C4'-P energy: -86.584 bonds (distance) P-C4' energy: -90.919 flat angles C4'-P-C4' energy: -105.956 flat angles P-C4'-P energy: -70.826 tors. eta vs tors. theta energy: -140.645 Dist. restrs. and SS energy: 0.771 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1642.745454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.745454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.832560 (E_RNA) where: Base-Base interactions energy: -1167.545 where: short stacking energy: -513.027 Base-Backbone interact. energy: 0.995 local terms energy: -514.282731 where: bonds (distance) C4'-P energy: -88.847 bonds (distance) P-C4' energy: -91.275 flat angles C4'-P-C4' energy: -107.298 flat angles P-C4'-P energy: -77.500 tors. eta vs tors. theta energy: -149.363 Dist. restrs. and SS energy: 1.337 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1617.740831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.740831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.239220 (E_RNA) where: Base-Base interactions energy: -1170.938 where: short stacking energy: -475.531 Base-Backbone interact. energy: -1.383 local terms energy: -482.917803 where: bonds (distance) C4'-P energy: -88.956 bonds (distance) P-C4' energy: -93.164 flat angles C4'-P-C4' energy: -97.807 flat angles P-C4'-P energy: -68.818 tors. eta vs tors. theta energy: -134.172 Dist. restrs. and SS energy: 0.748 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1584.256537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.256537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1622.623819 (E_RNA) where: Base-Base interactions energy: -1135.494 where: short stacking energy: -472.847 Base-Backbone interact. energy: -2.816 local terms energy: -484.313826 where: bonds (distance) C4'-P energy: -82.294 bonds (distance) P-C4' energy: -97.933 flat angles C4'-P-C4' energy: -100.148 flat angles P-C4'-P energy: -64.811 tors. eta vs tors. theta energy: -139.128 Dist. restrs. and SS energy: 1.617 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1539.299914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.299914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.604358 (E_RNA) where: Base-Base interactions energy: -1110.495 where: short stacking energy: -457.784 Base-Backbone interact. energy: -1.534 local terms energy: -464.575355 where: bonds (distance) C4'-P energy: -91.682 bonds (distance) P-C4' energy: -82.568 flat angles C4'-P-C4' energy: -93.316 flat angles P-C4'-P energy: -62.801 tors. eta vs tors. theta energy: -134.208 Dist. restrs. and SS energy: 0.554 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1470.412590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.412590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.621248 (E_RNA) where: Base-Base interactions energy: -1076.942 where: short stacking energy: -458.023 Base-Backbone interact. energy: -0.601 local terms energy: -431.077554 where: bonds (distance) C4'-P energy: -71.813 bonds (distance) P-C4' energy: -71.589 flat angles C4'-P-C4' energy: -95.208 flat angles P-C4'-P energy: -61.850 tors. eta vs tors. theta energy: -130.618 Dist. restrs. and SS energy: 1.459 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1500.109461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.109461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.396094 (E_RNA) where: Base-Base interactions energy: -1130.180 where: short stacking energy: -471.085 Base-Backbone interact. energy: -1.130 local terms energy: -410.085914 where: bonds (distance) C4'-P energy: -66.570 bonds (distance) P-C4' energy: -73.808 flat angles C4'-P-C4' energy: -91.888 flat angles P-C4'-P energy: -47.863 tors. eta vs tors. theta energy: -129.958 Dist. restrs. and SS energy: 4.537 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1374.831299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.831299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.422832 (E_RNA) where: Base-Base interactions energy: -1015.294 where: short stacking energy: -400.808 Base-Backbone interact. energy: 1.844 local terms energy: -400.973255 where: bonds (distance) C4'-P energy: -81.717 bonds (distance) P-C4' energy: -71.828 flat angles C4'-P-C4' energy: -82.081 flat angles P-C4'-P energy: -54.985 tors. eta vs tors. theta energy: -110.363 Dist. restrs. and SS energy: 2.842 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1321.090824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.090824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.247620 (E_RNA) where: Base-Base interactions energy: -965.410 where: short stacking energy: -399.879 Base-Backbone interact. energy: -0.696 local terms energy: -393.141064 where: bonds (distance) C4'-P energy: -75.786 bonds (distance) P-C4' energy: -79.982 flat angles C4'-P-C4' energy: -80.638 flat angles P-C4'-P energy: -53.518 tors. eta vs tors. theta energy: -103.218 Dist. restrs. and SS energy: 1.407 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -1339.372130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.372130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.372688 (E_RNA) where: Base-Base interactions energy: -960.557 where: short stacking energy: -399.489 Base-Backbone interact. energy: -1.111 local terms energy: -416.704993 where: bonds (distance) C4'-P energy: -64.639 bonds (distance) P-C4' energy: -85.269 flat angles C4'-P-C4' energy: -100.582 flat angles P-C4'-P energy: -54.705 tors. eta vs tors. theta energy: -111.511 Dist. restrs. and SS energy: 2.251 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1720.831697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1720.831697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1758.221484 (E_RNA) where: Base-Base interactions energy: -1265.054 where: short stacking energy: -514.586 Base-Backbone interact. energy: -2.521 local terms energy: -490.646908 where: bonds (distance) C4'-P energy: -79.814 bonds (distance) P-C4' energy: -95.346 flat angles C4'-P-C4' energy: -108.721 flat angles P-C4'-P energy: -72.460 tors. eta vs tors. theta energy: -134.307 Dist. restrs. and SS energy: 0.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1645.366529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.366529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.803583 (E_RNA) where: Base-Base interactions energy: -1205.586 where: short stacking energy: -498.506 Base-Backbone interact. energy: -0.487 local terms energy: -476.730407 where: bonds (distance) C4'-P energy: -88.596 bonds (distance) P-C4' energy: -80.351 flat angles C4'-P-C4' energy: -99.451 flat angles P-C4'-P energy: -66.450 tors. eta vs tors. theta energy: -141.883 Dist. restrs. and SS energy: 0.687 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1628.986441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.986441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1667.846380 (E_RNA) where: Base-Base interactions energy: -1169.410 where: short stacking energy: -491.864 Base-Backbone interact. energy: -2.490 local terms energy: -495.947089 where: bonds (distance) C4'-P energy: -97.712 bonds (distance) P-C4' energy: -81.384 flat angles C4'-P-C4' energy: -106.881 flat angles P-C4'-P energy: -67.392 tors. eta vs tors. theta energy: -142.577 Dist. restrs. and SS energy: 2.110 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1562.292442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.292442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.999564 (E_RNA) where: Base-Base interactions energy: -1124.385 where: short stacking energy: -463.195 Base-Backbone interact. energy: -3.744 local terms energy: -471.870962 where: bonds (distance) C4'-P energy: -78.731 bonds (distance) P-C4' energy: -81.116 flat angles C4'-P-C4' energy: -106.561 flat angles P-C4'-P energy: -77.248 tors. eta vs tors. theta energy: -128.214 Dist. restrs. and SS energy: 0.957 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1557.597944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1557.597944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.751470 (E_RNA) where: Base-Base interactions energy: -1143.940 where: short stacking energy: -485.560 Base-Backbone interact. energy: -0.596 local terms energy: -451.215633 where: bonds (distance) C4'-P energy: -79.423 bonds (distance) P-C4' energy: -88.377 flat angles C4'-P-C4' energy: -95.550 flat angles P-C4'-P energy: -57.095 tors. eta vs tors. theta energy: -130.771 Dist. restrs. and SS energy: 1.404 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1503.640793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.640793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1541.024594 (E_RNA) where: Base-Base interactions energy: -1104.775 where: short stacking energy: -451.658 Base-Backbone interact. energy: -0.763 local terms energy: -435.487395 where: bonds (distance) C4'-P energy: -75.601 bonds (distance) P-C4' energy: -80.200 flat angles C4'-P-C4' energy: -95.575 flat angles P-C4'-P energy: -60.871 tors. eta vs tors. theta energy: -123.240 Dist. restrs. and SS energy: 0.634 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1478.961388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.961388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.385630 (E_RNA) where: Base-Base interactions energy: -1111.501 where: short stacking energy: -443.703 Base-Backbone interact. energy: 1.122 local terms energy: -408.006821 where: bonds (distance) C4'-P energy: -74.778 bonds (distance) P-C4' energy: -66.573 flat angles C4'-P-C4' energy: -95.503 flat angles P-C4'-P energy: -60.214 tors. eta vs tors. theta energy: -110.938 Dist. restrs. and SS energy: 2.674 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1395.427917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.427917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.186389 (E_RNA) where: Base-Base interactions energy: -1046.615 where: short stacking energy: -422.982 Base-Backbone interact. energy: -0.758 local terms energy: -385.812846 where: bonds (distance) C4'-P energy: -81.737 bonds (distance) P-C4' energy: -73.684 flat angles C4'-P-C4' energy: -76.603 flat angles P-C4'-P energy: -52.527 tors. eta vs tors. theta energy: -101.261 Dist. restrs. and SS energy: 1.008 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1355.836117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.836117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.701076 (E_RNA) where: Base-Base interactions energy: -984.953 where: short stacking energy: -383.932 Base-Backbone interact. energy: -0.940 local terms energy: -407.807574 where: bonds (distance) C4'-P energy: -77.407 bonds (distance) P-C4' energy: -81.774 flat angles C4'-P-C4' energy: -88.766 flat angles P-C4'-P energy: -50.235 tors. eta vs tors. theta energy: -109.626 Dist. restrs. and SS energy: 1.115 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -1299.460879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.460879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.442552 (E_RNA) where: Base-Base interactions energy: -954.587 where: short stacking energy: -391.524 Base-Backbone interact. energy: 0.079 local terms energy: -384.934520 where: bonds (distance) C4'-P energy: -80.551 bonds (distance) P-C4' energy: -65.926 flat angles C4'-P-C4' energy: -84.681 flat angles P-C4'-P energy: -50.110 tors. eta vs tors. theta energy: -103.667 Dist. restrs. and SS energy: 3.232 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1718.906075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1718.906075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1756.762328 (E_RNA) where: Base-Base interactions energy: -1236.312 where: short stacking energy: -497.313 Base-Backbone interact. energy: -2.088 local terms energy: -518.362447 where: bonds (distance) C4'-P energy: -93.671 bonds (distance) P-C4' energy: -102.933 flat angles C4'-P-C4' energy: -110.038 flat angles P-C4'-P energy: -70.291 tors. eta vs tors. theta energy: -141.429 Dist. restrs. and SS energy: 1.106 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1648.137365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.137365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.417007 (E_RNA) where: Base-Base interactions energy: -1194.043 where: short stacking energy: -509.407 Base-Backbone interact. energy: 1.538 local terms energy: -492.912040 where: bonds (distance) C4'-P energy: -86.085 bonds (distance) P-C4' energy: -98.920 flat angles C4'-P-C4' energy: -103.033 flat angles P-C4'-P energy: -65.752 tors. eta vs tors. theta energy: -139.122 Dist. restrs. and SS energy: 0.530 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1655.253765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.253765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.877947 (E_RNA) where: Base-Base interactions energy: -1213.153 where: short stacking energy: -499.565 Base-Backbone interact. energy: -2.598 local terms energy: -478.126778 where: bonds (distance) C4'-P energy: -85.007 bonds (distance) P-C4' energy: -87.594 flat angles C4'-P-C4' energy: -99.659 flat angles P-C4'-P energy: -67.853 tors. eta vs tors. theta energy: -138.014 Dist. restrs. and SS energy: 1.874 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1574.498825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1574.498825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.509833 (E_RNA) where: Base-Base interactions energy: -1151.854 where: short stacking energy: -482.412 Base-Backbone interact. energy: -1.979 local terms energy: -458.676016 where: bonds (distance) C4'-P energy: -82.352 bonds (distance) P-C4' energy: -80.238 flat angles C4'-P-C4' energy: -91.188 flat angles P-C4'-P energy: -62.575 tors. eta vs tors. theta energy: -142.323 Dist. restrs. and SS energy: 1.261 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1551.421735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.421735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.550294 (E_RNA) where: Base-Base interactions energy: -1135.931 where: short stacking energy: -474.458 Base-Backbone interact. energy: 3.186 local terms energy: -457.805501 where: bonds (distance) C4'-P energy: -73.641 bonds (distance) P-C4' energy: -78.044 flat angles C4'-P-C4' energy: -99.755 flat angles P-C4'-P energy: -71.339 tors. eta vs tors. theta energy: -135.026 Dist. restrs. and SS energy: 2.379 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1539.750144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.750144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.806998 (E_RNA) where: Base-Base interactions energy: -1131.763 where: short stacking energy: -449.094 Base-Backbone interact. energy: -1.918 local terms energy: -447.126249 where: bonds (distance) C4'-P energy: -71.029 bonds (distance) P-C4' energy: -72.296 flat angles C4'-P-C4' energy: -102.573 flat angles P-C4'-P energy: -72.552 tors. eta vs tors. theta energy: -128.677 Dist. restrs. and SS energy: 4.307 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1451.927530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.927530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.943512 (E_RNA) where: Base-Base interactions energy: -1041.663 where: short stacking energy: -435.285 Base-Backbone interact. energy: -0.559 local terms energy: -447.721859 where: bonds (distance) C4'-P energy: -87.827 bonds (distance) P-C4' energy: -71.928 flat angles C4'-P-C4' energy: -97.139 flat angles P-C4'-P energy: -66.319 tors. eta vs tors. theta energy: -124.509 Dist. restrs. and SS energy: 1.266 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1403.072723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1403.072723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1441.211052 (E_RNA) where: Base-Base interactions energy: -1033.255 where: short stacking energy: -421.109 Base-Backbone interact. energy: -0.291 local terms energy: -407.665549 where: bonds (distance) C4'-P energy: -68.355 bonds (distance) P-C4' energy: -83.039 flat angles C4'-P-C4' energy: -92.963 flat angles P-C4'-P energy: -56.423 tors. eta vs tors. theta energy: -106.886 Dist. restrs. and SS energy: 1.388 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1347.701259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.701259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.206092 (E_RNA) where: Base-Base interactions energy: -1009.877 where: short stacking energy: -418.050 Base-Backbone interact. energy: -1.258 local terms energy: -375.071251 where: bonds (distance) C4'-P energy: -69.310 bonds (distance) P-C4' energy: -60.468 flat angles C4'-P-C4' energy: -74.209 flat angles P-C4'-P energy: -60.708 tors. eta vs tors. theta energy: -110.378 Dist. restrs. and SS energy: 1.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -1292.070310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.070310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.415855 (E_RNA) where: Base-Base interactions energy: -938.839 where: short stacking energy: -381.655 Base-Backbone interact. energy: 0.641 local terms energy: -396.217210 where: bonds (distance) C4'-P energy: -67.762 bonds (distance) P-C4' energy: -85.995 flat angles C4'-P-C4' energy: -81.445 flat angles P-C4'-P energy: -60.577 tors. eta vs tors. theta energy: -100.438 Dist. restrs. and SS energy: 5.596 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1731.536661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.536661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.970148 (E_RNA) where: Base-Base interactions energy: -1259.580 where: short stacking energy: -520.663 Base-Backbone interact. energy: -2.318 local terms energy: -507.072149 where: bonds (distance) C4'-P energy: -99.218 bonds (distance) P-C4' energy: -94.518 flat angles C4'-P-C4' energy: -102.120 flat angles P-C4'-P energy: -72.559 tors. eta vs tors. theta energy: -138.657 Dist. restrs. and SS energy: 0.683 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1668.968188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.968188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.642373 (E_RNA) where: Base-Base interactions energy: -1194.894 where: short stacking energy: -511.066 Base-Backbone interact. energy: -1.516 local terms energy: -510.233108 where: bonds (distance) C4'-P energy: -85.054 bonds (distance) P-C4' energy: -98.598 flat angles C4'-P-C4' energy: -103.560 flat angles P-C4'-P energy: -76.869 tors. eta vs tors. theta energy: -146.152 Dist. restrs. and SS energy: 0.924 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1649.751854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.751854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.528660 (E_RNA) where: Base-Base interactions energy: -1191.071 where: short stacking energy: -498.996 Base-Backbone interact. energy: -2.509 local terms energy: -494.949247 where: bonds (distance) C4'-P energy: -89.590 bonds (distance) P-C4' energy: -80.449 flat angles C4'-P-C4' energy: -107.149 flat angles P-C4'-P energy: -80.076 tors. eta vs tors. theta energy: -137.686 Dist. restrs. and SS energy: 2.027 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1599.465486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.465486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.823192 (E_RNA) where: Base-Base interactions energy: -1166.261 where: short stacking energy: -490.554 Base-Backbone interact. energy: -0.084 local terms energy: -470.478298 where: bonds (distance) C4'-P energy: -86.593 bonds (distance) P-C4' energy: -92.360 flat angles C4'-P-C4' energy: -92.387 flat angles P-C4'-P energy: -61.037 tors. eta vs tors. theta energy: -138.102 Dist. restrs. and SS energy: 0.608 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1555.750435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.750435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.945502 (E_RNA) where: Base-Base interactions energy: -1120.893 where: short stacking energy: -452.538 Base-Backbone interact. energy: -3.447 local terms energy: -471.605476 where: bonds (distance) C4'-P energy: -86.341 bonds (distance) P-C4' energy: -102.830 flat angles C4'-P-C4' energy: -103.678 flat angles P-C4'-P energy: -50.212 tors. eta vs tors. theta energy: -128.544 Dist. restrs. and SS energy: 3.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1536.347303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.347303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1574.687445 (E_RNA) where: Base-Base interactions energy: -1137.418 where: short stacking energy: -458.992 Base-Backbone interact. energy: -1.546 local terms energy: -435.723208 where: bonds (distance) C4'-P energy: -65.391 bonds (distance) P-C4' energy: -79.782 flat angles C4'-P-C4' energy: -99.923 flat angles P-C4'-P energy: -57.394 tors. eta vs tors. theta energy: -133.232 Dist. restrs. and SS energy: 1.590 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1452.732467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.732467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1492.563514 (E_RNA) where: Base-Base interactions energy: -1041.686 where: short stacking energy: -417.801 Base-Backbone interact. energy: -2.382 local terms energy: -448.495701 where: bonds (distance) C4'-P energy: -85.883 bonds (distance) P-C4' energy: -98.368 flat angles C4'-P-C4' energy: -86.702 flat angles P-C4'-P energy: -61.331 tors. eta vs tors. theta energy: -116.211 Dist. restrs. and SS energy: 3.081 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1391.314055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.314055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.734772 (E_RNA) where: Base-Base interactions energy: -1008.121 where: short stacking energy: -397.601 Base-Backbone interact. energy: -1.190 local terms energy: -420.424539 where: bonds (distance) C4'-P energy: -89.457 bonds (distance) P-C4' energy: -76.106 flat angles C4'-P-C4' energy: -94.065 flat angles P-C4'-P energy: -55.143 tors. eta vs tors. theta energy: -105.655 Dist. restrs. and SS energy: 1.671 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1361.631000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.631000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.280461 (E_RNA) where: Base-Base interactions energy: -1006.367 where: short stacking energy: -417.489 Base-Backbone interact. energy: -2.781 local terms energy: -392.131911 where: bonds (distance) C4'-P energy: -74.191 bonds (distance) P-C4' energy: -63.156 flat angles C4'-P-C4' energy: -83.378 flat angles P-C4'-P energy: -61.610 tors. eta vs tors. theta energy: -109.798 Dist. restrs. and SS energy: 2.899 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -1299.917083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.917083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.046549 (E_RNA) where: Base-Base interactions energy: -953.621 where: short stacking energy: -383.935 Base-Backbone interact. energy: -0.430 local terms energy: -383.995047 where: bonds (distance) C4'-P energy: -66.407 bonds (distance) P-C4' energy: -71.003 flat angles C4'-P-C4' energy: -87.391 flat angles P-C4'-P energy: -50.302 tors. eta vs tors. theta energy: -108.891 Dist. restrs. and SS energy: 1.379 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1721.715978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.715978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.585135 (E_RNA) where: Base-Base interactions energy: -1260.017 where: short stacking energy: -514.882 Base-Backbone interact. energy: -1.649 local terms energy: -497.918709 where: bonds (distance) C4'-P energy: -88.965 bonds (distance) P-C4' energy: -87.919 flat angles C4'-P-C4' energy: -112.906 flat angles P-C4'-P energy: -63.245 tors. eta vs tors. theta energy: -144.884 Dist. restrs. and SS energy: 1.119 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1647.137714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.137714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.356911 (E_RNA) where: Base-Base interactions energy: -1184.398 where: short stacking energy: -511.167 Base-Backbone interact. energy: -1.799 local terms energy: -498.159683 where: bonds (distance) C4'-P energy: -81.294 bonds (distance) P-C4' energy: -84.379 flat angles C4'-P-C4' energy: -109.271 flat angles P-C4'-P energy: -78.500 tors. eta vs tors. theta energy: -144.716 Dist. restrs. and SS energy: 0.469 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1635.370868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.370868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1673.190450 (E_RNA) where: Base-Base interactions energy: -1199.100 where: short stacking energy: -487.343 Base-Backbone interact. energy: 0.422 local terms energy: -474.512403 where: bonds (distance) C4'-P energy: -95.354 bonds (distance) P-C4' energy: -74.919 flat angles C4'-P-C4' energy: -101.692 flat angles P-C4'-P energy: -74.964 tors. eta vs tors. theta energy: -127.583 Dist. restrs. and SS energy: 1.070 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1587.088863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.088863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.250397 (E_RNA) where: Base-Base interactions energy: -1142.077 where: short stacking energy: -483.511 Base-Backbone interact. energy: -1.889 local terms energy: -484.284979 where: bonds (distance) C4'-P energy: -86.945 bonds (distance) P-C4' energy: -87.100 flat angles C4'-P-C4' energy: -107.541 flat angles P-C4'-P energy: -64.497 tors. eta vs tors. theta energy: -138.202 Dist. restrs. and SS energy: 4.412 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1542.336877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1542.336877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.676319 (E_RNA) where: Base-Base interactions energy: -1144.864 where: short stacking energy: -480.880 Base-Backbone interact. energy: -0.312 local terms energy: -441.499714 where: bonds (distance) C4'-P energy: -76.752 bonds (distance) P-C4' energy: -80.427 flat angles C4'-P-C4' energy: -103.429 flat angles P-C4'-P energy: -57.644 tors. eta vs tors. theta energy: -123.248 Dist. restrs. and SS energy: 7.589 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1479.904797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.904797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.527944 (E_RNA) where: Base-Base interactions energy: -1065.374 where: short stacking energy: -429.012 Base-Backbone interact. energy: -2.019 local terms energy: -450.134979 where: bonds (distance) C4'-P energy: -80.058 bonds (distance) P-C4' energy: -84.729 flat angles C4'-P-C4' energy: -108.576 flat angles P-C4'-P energy: -53.838 tors. eta vs tors. theta energy: -122.934 Dist. restrs. and SS energy: 0.873 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1419.279714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.279714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.314457 (E_RNA) where: Base-Base interactions energy: -1023.521 where: short stacking energy: -400.942 Base-Backbone interact. energy: -3.176 local terms energy: -430.616959 where: bonds (distance) C4'-P energy: -80.749 bonds (distance) P-C4' energy: -83.698 flat angles C4'-P-C4' energy: -106.580 flat angles P-C4'-P energy: -43.869 tors. eta vs tors. theta energy: -115.722 Dist. restrs. and SS energy: 1.285 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1411.598898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.598898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.950396 (E_RNA) where: Base-Base interactions energy: -1019.693 where: short stacking energy: -428.865 Base-Backbone interact. energy: -0.835 local terms energy: -429.422300 where: bonds (distance) C4'-P energy: -82.775 bonds (distance) P-C4' energy: -73.131 flat angles C4'-P-C4' energy: -94.547 flat angles P-C4'-P energy: -58.606 tors. eta vs tors. theta energy: -120.362 Dist. restrs. and SS energy: 1.601 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1349.495329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.495329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.528134 (E_RNA) where: Base-Base interactions energy: -979.025 where: short stacking energy: -392.137 Base-Backbone interact. energy: -0.030 local terms energy: -408.472320 where: bonds (distance) C4'-P energy: -69.234 bonds (distance) P-C4' energy: -82.980 flat angles C4'-P-C4' energy: -85.053 flat angles P-C4'-P energy: -60.364 tors. eta vs tors. theta energy: -110.841 Dist. restrs. and SS energy: 1.283 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -1309.447425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.447425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.939814 (E_RNA) where: Base-Base interactions energy: -968.290 where: short stacking energy: -384.232 Base-Backbone interact. energy: 1.030 local terms energy: -380.679645 where: bonds (distance) C4'-P energy: -71.302 bonds (distance) P-C4' energy: -75.069 flat angles C4'-P-C4' energy: -83.241 flat angles P-C4'-P energy: -51.930 tors. eta vs tors. theta energy: -99.137 Dist. restrs. and SS energy: 1.742 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1750.320531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1750.320531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.593578 (E_RNA) where: Base-Base interactions energy: -1278.294 where: short stacking energy: -504.924 Base-Backbone interact. energy: -0.850 local terms energy: -508.449025 where: bonds (distance) C4'-P energy: -85.883 bonds (distance) P-C4' energy: -98.008 flat angles C4'-P-C4' energy: -107.197 flat angles P-C4'-P energy: -71.721 tors. eta vs tors. theta energy: -145.640 Dist. restrs. and SS energy: 0.523 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1659.975515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.975515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1698.043290 (E_RNA) where: Base-Base interactions energy: -1187.901 where: short stacking energy: -505.473 Base-Backbone interact. energy: -0.840 local terms energy: -509.302876 where: bonds (distance) C4'-P energy: -90.367 bonds (distance) P-C4' energy: -97.421 flat angles C4'-P-C4' energy: -102.760 flat angles P-C4'-P energy: -72.338 tors. eta vs tors. theta energy: -146.418 Dist. restrs. and SS energy: 1.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1640.071994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.071994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1677.826193 (E_RNA) where: Base-Base interactions energy: -1182.211 where: short stacking energy: -490.424 Base-Backbone interact. energy: -1.706 local terms energy: -493.909281 where: bonds (distance) C4'-P energy: -91.575 bonds (distance) P-C4' energy: -90.610 flat angles C4'-P-C4' energy: -102.844 flat angles P-C4'-P energy: -80.371 tors. eta vs tors. theta energy: -128.509 Dist. restrs. and SS energy: 1.004 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1589.317715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.317715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1627.130291 (E_RNA) where: Base-Base interactions energy: -1133.489 where: short stacking energy: -479.728 Base-Backbone interact. energy: 0.460 local terms energy: -494.100931 where: bonds (distance) C4'-P energy: -82.319 bonds (distance) P-C4' energy: -94.859 flat angles C4'-P-C4' energy: -96.543 flat angles P-C4'-P energy: -73.761 tors. eta vs tors. theta energy: -146.619 Dist. restrs. and SS energy: 1.063 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1524.999942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.999942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.567671 (E_RNA) where: Base-Base interactions energy: -1121.264 where: short stacking energy: -473.858 Base-Backbone interact. energy: -0.825 local terms energy: -447.478370 where: bonds (distance) C4'-P energy: -75.675 bonds (distance) P-C4' energy: -74.748 flat angles C4'-P-C4' energy: -101.318 flat angles P-C4'-P energy: -59.953 tors. eta vs tors. theta energy: -135.785 Dist. restrs. and SS energy: 7.818 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1464.846373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.846373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.035491 (E_RNA) where: Base-Base interactions energy: -1066.655 where: short stacking energy: -446.316 Base-Backbone interact. energy: -2.053 local terms energy: -435.327963 where: bonds (distance) C4'-P energy: -69.720 bonds (distance) P-C4' energy: -86.889 flat angles C4'-P-C4' energy: -93.562 flat angles P-C4'-P energy: -62.855 tors. eta vs tors. theta energy: -122.302 Dist. restrs. and SS energy: 2.439 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1414.531578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.531578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.215240 (E_RNA) where: Base-Base interactions energy: -1034.127 where: short stacking energy: -421.495 Base-Backbone interact. energy: -0.096 local terms energy: -418.992744 where: bonds (distance) C4'-P energy: -74.520 bonds (distance) P-C4' energy: -64.750 flat angles C4'-P-C4' energy: -93.444 flat angles P-C4'-P energy: -59.812 tors. eta vs tors. theta energy: -126.467 Dist. restrs. and SS energy: 1.934 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1419.279298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.279298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.764438 (E_RNA) where: Base-Base interactions energy: -1037.648 where: short stacking energy: -409.713 Base-Backbone interact. energy: 1.226 local terms energy: -421.343054 where: bonds (distance) C4'-P energy: -80.380 bonds (distance) P-C4' energy: -77.297 flat angles C4'-P-C4' energy: -87.730 flat angles P-C4'-P energy: -61.396 tors. eta vs tors. theta energy: -114.540 Dist. restrs. and SS energy: 1.735 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1343.729836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.729836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.215611 (E_RNA) where: Base-Base interactions energy: -1020.348 where: short stacking energy: -398.652 Base-Backbone interact. energy: 2.028 local terms energy: -363.894881 where: bonds (distance) C4'-P energy: -58.183 bonds (distance) P-C4' energy: -66.680 flat angles C4'-P-C4' energy: -75.678 flat angles P-C4'-P energy: -64.192 tors. eta vs tors. theta energy: -99.162 Dist. restrs. and SS energy: 1.736 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -1346.861956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.861956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.602307 (E_RNA) where: Base-Base interactions energy: -999.521 where: short stacking energy: -402.776 Base-Backbone interact. energy: -1.064 local terms energy: -387.016932 where: bonds (distance) C4'-P energy: -76.569 bonds (distance) P-C4' energy: -78.443 flat angles C4'-P-C4' energy: -83.472 flat angles P-C4'-P energy: -41.811 tors. eta vs tors. theta energy: -106.722 Dist. restrs. and SS energy: 3.990 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1725.666751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1725.666751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.322676 (E_RNA) where: Base-Base interactions energy: -1250.333 where: short stacking energy: -527.795 Base-Backbone interact. energy: -2.355 local terms energy: -510.633896 where: bonds (distance) C4'-P energy: -94.497 bonds (distance) P-C4' energy: -96.122 flat angles C4'-P-C4' energy: -97.689 flat angles P-C4'-P energy: -77.708 tors. eta vs tors. theta energy: -144.618 Dist. restrs. and SS energy: 0.906 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1679.713809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.713809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.604234 (E_RNA) where: Base-Base interactions energy: -1215.975 where: short stacking energy: -526.109 Base-Backbone interact. energy: -0.165 local terms energy: -501.464513 where: bonds (distance) C4'-P energy: -86.133 bonds (distance) P-C4' energy: -95.729 flat angles C4'-P-C4' energy: -108.480 flat angles P-C4'-P energy: -70.009 tors. eta vs tors. theta energy: -141.113 Dist. restrs. and SS energy: 1.140 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1655.827278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.827278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1693.580549 (E_RNA) where: Base-Base interactions energy: -1211.818 where: short stacking energy: -500.748 Base-Backbone interact. energy: -0.421 local terms energy: -481.341873 where: bonds (distance) C4'-P energy: -84.409 bonds (distance) P-C4' energy: -85.267 flat angles C4'-P-C4' energy: -96.336 flat angles P-C4'-P energy: -72.769 tors. eta vs tors. theta energy: -142.561 Dist. restrs. and SS energy: 1.003 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1618.450444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.450444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.219287 (E_RNA) where: Base-Base interactions energy: -1180.453 where: short stacking energy: -483.619 Base-Backbone interact. energy: -0.647 local terms energy: -475.118894 where: bonds (distance) C4'-P energy: -86.669 bonds (distance) P-C4' energy: -81.094 flat angles C4'-P-C4' energy: -97.471 flat angles P-C4'-P energy: -64.907 tors. eta vs tors. theta energy: -144.978 Dist. restrs. and SS energy: 1.019 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1570.005538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.005538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.747511 (E_RNA) where: Base-Base interactions energy: -1108.986 where: short stacking energy: -460.019 Base-Backbone interact. energy: -3.661 local terms energy: -501.100332 where: bonds (distance) C4'-P energy: -96.375 bonds (distance) P-C4' energy: -87.431 flat angles C4'-P-C4' energy: -110.776 flat angles P-C4'-P energy: -73.476 tors. eta vs tors. theta energy: -133.042 Dist. restrs. and SS energy: 6.992 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1460.453979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.453979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1498.328631 (E_RNA) where: Base-Base interactions energy: -1077.015 where: short stacking energy: -442.438 Base-Backbone interact. energy: -0.719 local terms energy: -420.594535 where: bonds (distance) C4'-P energy: -56.581 bonds (distance) P-C4' energy: -78.277 flat angles C4'-P-C4' energy: -97.005 flat angles P-C4'-P energy: -72.428 tors. eta vs tors. theta energy: -116.304 Dist. restrs. and SS energy: 1.125 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1442.911415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.911415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.916707 (E_RNA) where: Base-Base interactions energy: -1051.812 where: short stacking energy: -417.334 Base-Backbone interact. energy: -1.882 local terms energy: -428.222149 where: bonds (distance) C4'-P energy: -79.207 bonds (distance) P-C4' energy: -70.300 flat angles C4'-P-C4' energy: -96.939 flat angles P-C4'-P energy: -59.397 tors. eta vs tors. theta energy: -122.379 Dist. restrs. and SS energy: 2.255 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1401.120370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.120370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.929712 (E_RNA) where: Base-Base interactions energy: -1022.187 where: short stacking energy: -422.880 Base-Backbone interact. energy: 1.025 local terms energy: -418.768047 where: bonds (distance) C4'-P energy: -68.584 bonds (distance) P-C4' energy: -89.440 flat angles C4'-P-C4' energy: -86.340 flat angles P-C4'-P energy: -54.902 tors. eta vs tors. theta energy: -119.503 Dist. restrs. and SS energy: 2.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1351.857419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.857419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.153896 (E_RNA) where: Base-Base interactions energy: -980.326 where: short stacking energy: -407.308 Base-Backbone interact. energy: -0.500 local terms energy: -409.327912 where: bonds (distance) C4'-P energy: -75.468 bonds (distance) P-C4' energy: -71.397 flat angles C4'-P-C4' energy: -81.204 flat angles P-C4'-P energy: -67.244 tors. eta vs tors. theta energy: -114.015 Dist. restrs. and SS energy: 1.546 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -1306.756563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.756563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.543706 (E_RNA) where: Base-Base interactions energy: -967.456 where: short stacking energy: -400.295 Base-Backbone interact. energy: -1.356 local terms energy: -377.731318 where: bonds (distance) C4'-P energy: -64.379 bonds (distance) P-C4' energy: -69.345 flat angles C4'-P-C4' energy: -80.977 flat angles P-C4'-P energy: -60.081 tors. eta vs tors. theta energy: -102.949 Dist. restrs. and SS energy: 3.037 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1738.949839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1738.949839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.887627 (E_RNA) where: Base-Base interactions energy: -1263.521 where: short stacking energy: -526.214 Base-Backbone interact. energy: -1.991 local terms energy: -511.375696 where: bonds (distance) C4'-P energy: -95.315 bonds (distance) P-C4' energy: -87.138 flat angles C4'-P-C4' energy: -106.615 flat angles P-C4'-P energy: -75.089 tors. eta vs tors. theta energy: -147.219 Dist. restrs. and SS energy: 1.188 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1656.659818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.659818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.249672 (E_RNA) where: Base-Base interactions energy: -1184.828 where: short stacking energy: -500.739 Base-Backbone interact. energy: -2.598 local terms energy: -506.824048 where: bonds (distance) C4'-P energy: -100.494 bonds (distance) P-C4' energy: -90.786 flat angles C4'-P-C4' energy: -110.693 flat angles P-C4'-P energy: -69.349 tors. eta vs tors. theta energy: -135.503 Dist. restrs. and SS energy: 0.840 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1669.726187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.726187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.342980 (E_RNA) where: Base-Base interactions energy: -1203.622 where: short stacking energy: -497.019 Base-Backbone interact. energy: -0.742 local terms energy: -502.978688 where: bonds (distance) C4'-P energy: -91.904 bonds (distance) P-C4' energy: -88.450 flat angles C4'-P-C4' energy: -101.856 flat angles P-C4'-P energy: -82.321 tors. eta vs tors. theta energy: -138.448 Dist. restrs. and SS energy: 0.867 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1642.111105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.111105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.791507 (E_RNA) where: Base-Base interactions energy: -1183.609 where: short stacking energy: -498.006 Base-Backbone interact. energy: 1.171 local terms energy: -497.353545 where: bonds (distance) C4'-P energy: -87.745 bonds (distance) P-C4' energy: -87.057 flat angles C4'-P-C4' energy: -104.687 flat angles P-C4'-P energy: -69.337 tors. eta vs tors. theta energy: -148.527 Dist. restrs. and SS energy: 0.930 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1529.008501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1529.008501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1567.260114 (E_RNA) where: Base-Base interactions energy: -1092.842 where: short stacking energy: -464.058 Base-Backbone interact. energy: 1.100 local terms energy: -475.517888 where: bonds (distance) C4'-P energy: -76.844 bonds (distance) P-C4' energy: -88.871 flat angles C4'-P-C4' energy: -105.213 flat angles P-C4'-P energy: -73.508 tors. eta vs tors. theta energy: -131.081 Dist. restrs. and SS energy: 1.502 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1484.156066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.156066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.866626 (E_RNA) where: Base-Base interactions energy: -1080.180 where: short stacking energy: -455.706 Base-Backbone interact. energy: -0.082 local terms energy: -442.605027 where: bonds (distance) C4'-P energy: -78.876 bonds (distance) P-C4' energy: -74.711 flat angles C4'-P-C4' energy: -101.192 flat angles P-C4'-P energy: -62.974 tors. eta vs tors. theta energy: -124.852 Dist. restrs. and SS energy: 1.961 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1436.759341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.759341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.129606 (E_RNA) where: Base-Base interactions energy: -1026.888 where: short stacking energy: -419.040 Base-Backbone interact. energy: 0.897 local terms energy: -449.138490 where: bonds (distance) C4'-P energy: -75.931 bonds (distance) P-C4' energy: -80.512 flat angles C4'-P-C4' energy: -99.659 flat angles P-C4'-P energy: -69.659 tors. eta vs tors. theta energy: -123.378 Dist. restrs. and SS energy: 1.620 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1388.285532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.285532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.094848 (E_RNA) where: Base-Base interactions energy: -1019.870 where: short stacking energy: -425.806 Base-Backbone interact. energy: -0.890 local terms energy: -406.334138 where: bonds (distance) C4'-P energy: -69.593 bonds (distance) P-C4' energy: -72.075 flat angles C4'-P-C4' energy: -80.888 flat angles P-C4'-P energy: -65.482 tors. eta vs tors. theta energy: -118.296 Dist. restrs. and SS energy: 2.059 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1333.142917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.142917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.839476 (E_RNA) where: Base-Base interactions energy: -987.952 where: short stacking energy: -402.748 Base-Backbone interact. energy: 1.162 local terms energy: -385.049098 where: bonds (distance) C4'-P energy: -78.995 bonds (distance) P-C4' energy: -68.831 flat angles C4'-P-C4' energy: -101.007 flat angles P-C4'-P energy: -44.146 tors. eta vs tors. theta energy: -92.070 Dist. restrs. and SS energy: 1.947 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -1310.132244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.132244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.279560 (E_RNA) where: Base-Base interactions energy: -967.143 where: short stacking energy: -386.592 Base-Backbone interact. energy: -1.049 local terms energy: -382.087315 where: bonds (distance) C4'-P energy: -55.088 bonds (distance) P-C4' energy: -76.326 flat angles C4'-P-C4' energy: -88.029 flat angles P-C4'-P energy: -51.436 tors. eta vs tors. theta energy: -111.210 Dist. restrs. and SS energy: 3.397 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1749.863878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1749.863878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.830614 (E_RNA) where: Base-Base interactions energy: -1267.637 where: short stacking energy: -522.803 Base-Backbone interact. energy: -3.275 local terms energy: -516.919195 where: bonds (distance) C4'-P energy: -96.850 bonds (distance) P-C4' energy: -100.317 flat angles C4'-P-C4' energy: -109.673 flat angles P-C4'-P energy: -62.447 tors. eta vs tors. theta energy: -147.633 Dist. restrs. and SS energy: 1.217 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1679.732310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.732310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.649913 (E_RNA) where: Base-Base interactions energy: -1240.768 where: short stacking energy: -506.790 Base-Backbone interact. energy: -1.119 local terms energy: -476.762956 where: bonds (distance) C4'-P energy: -84.141 bonds (distance) P-C4' energy: -77.003 flat angles C4'-P-C4' energy: -103.497 flat angles P-C4'-P energy: -69.024 tors. eta vs tors. theta energy: -143.098 Dist. restrs. and SS energy: 2.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1621.007988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.007988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.152397 (E_RNA) where: Base-Base interactions energy: -1171.797 where: short stacking energy: -504.134 Base-Backbone interact. energy: -1.066 local terms energy: -486.288856 where: bonds (distance) C4'-P energy: -86.469 bonds (distance) P-C4' energy: -86.153 flat angles C4'-P-C4' energy: -105.726 flat angles P-C4'-P energy: -72.826 tors. eta vs tors. theta energy: -135.116 Dist. restrs. and SS energy: 1.394 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1616.059885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1616.059885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.559962 (E_RNA) where: Base-Base interactions energy: -1191.357 where: short stacking energy: -490.275 Base-Backbone interact. energy: -1.756 local terms energy: -460.447407 where: bonds (distance) C4'-P energy: -76.406 bonds (distance) P-C4' energy: -84.184 flat angles C4'-P-C4' energy: -98.914 flat angles P-C4'-P energy: -63.804 tors. eta vs tors. theta energy: -137.139 Dist. restrs. and SS energy: 0.750 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1554.074810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.074810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.992606 (E_RNA) where: Base-Base interactions energy: -1133.767 where: short stacking energy: -493.426 Base-Backbone interact. energy: 0.766 local terms energy: -460.991597 where: bonds (distance) C4'-P energy: -83.984 bonds (distance) P-C4' energy: -75.575 flat angles C4'-P-C4' energy: -95.992 flat angles P-C4'-P energy: -68.275 tors. eta vs tors. theta energy: -137.165 Dist. restrs. and SS energy: 3.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1509.721633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1509.721633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.195943 (E_RNA) where: Base-Base interactions energy: -1100.768 where: short stacking energy: -455.805 Base-Backbone interact. energy: 1.539 local terms energy: -448.967153 where: bonds (distance) C4'-P energy: -59.345 bonds (distance) P-C4' energy: -86.950 flat angles C4'-P-C4' energy: -103.648 flat angles P-C4'-P energy: -66.281 tors. eta vs tors. theta energy: -132.743 Dist. restrs. and SS energy: 1.724 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1440.514897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.514897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.285441 (E_RNA) where: Base-Base interactions energy: -1065.613 where: short stacking energy: -434.917 Base-Backbone interact. energy: -1.486 local terms energy: -411.186974 where: bonds (distance) C4'-P energy: -58.281 bonds (distance) P-C4' energy: -82.592 flat angles C4'-P-C4' energy: -86.294 flat angles P-C4'-P energy: -62.075 tors. eta vs tors. theta energy: -121.945 Dist. restrs. and SS energy: 1.021 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1401.333107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.333107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.786672 (E_RNA) where: Base-Base interactions energy: -1000.419 where: short stacking energy: -406.863 Base-Backbone interact. energy: -1.519 local terms energy: -437.848418 where: bonds (distance) C4'-P energy: -86.951 bonds (distance) P-C4' energy: -84.772 flat angles C4'-P-C4' energy: -91.622 flat angles P-C4'-P energy: -62.204 tors. eta vs tors. theta energy: -112.299 Dist. restrs. and SS energy: 1.704 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1365.855183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.855183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.900432 (E_RNA) where: Base-Base interactions energy: -992.134 where: short stacking energy: -394.095 Base-Backbone interact. energy: 0.489 local terms energy: -412.256143 where: bonds (distance) C4'-P energy: -69.162 bonds (distance) P-C4' energy: -66.444 flat angles C4'-P-C4' energy: -101.040 flat angles P-C4'-P energy: -54.439 tors. eta vs tors. theta energy: -121.171 Dist. restrs. and SS energy: 1.295 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -1342.388837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.388837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.904335 (E_RNA) where: Base-Base interactions energy: -989.050 where: short stacking energy: -396.417 Base-Backbone interact. energy: -0.917 local terms energy: -390.937204 where: bonds (distance) C4'-P energy: -56.318 bonds (distance) P-C4' energy: -81.108 flat angles C4'-P-C4' energy: -77.094 flat angles P-C4'-P energy: -64.158 tors. eta vs tors. theta energy: -112.260 Dist. restrs. and SS energy: 1.765 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1726.700779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.700779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1765.436927 (E_RNA) where: Base-Base interactions energy: -1239.162 where: short stacking energy: -525.837 Base-Backbone interact. energy: -3.279 local terms energy: -522.996513 where: bonds (distance) C4'-P energy: -104.769 bonds (distance) P-C4' energy: -93.131 flat angles C4'-P-C4' energy: -106.806 flat angles P-C4'-P energy: -68.807 tors. eta vs tors. theta energy: -149.483 Dist. restrs. and SS energy: 1.986 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1693.495963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1693.495963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.155887 (E_RNA) where: Base-Base interactions energy: -1236.319 where: short stacking energy: -510.082 Base-Backbone interact. energy: -2.230 local terms energy: -492.606463 where: bonds (distance) C4'-P energy: -89.201 bonds (distance) P-C4' energy: -94.166 flat angles C4'-P-C4' energy: -100.402 flat angles P-C4'-P energy: -67.145 tors. eta vs tors. theta energy: -141.693 Dist. restrs. and SS energy: 0.910 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1662.457164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.457164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.194108 (E_RNA) where: Base-Base interactions energy: -1213.523 where: short stacking energy: -501.322 Base-Backbone interact. energy: -4.369 local terms energy: -482.302548 where: bonds (distance) C4'-P energy: -90.390 bonds (distance) P-C4' energy: -91.351 flat angles C4'-P-C4' energy: -95.911 flat angles P-C4'-P energy: -66.175 tors. eta vs tors. theta energy: -138.476 Dist. restrs. and SS energy: 0.987 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1592.923646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.923646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.927677 (E_RNA) where: Base-Base interactions energy: -1180.311 where: short stacking energy: -489.928 Base-Backbone interact. energy: -0.307 local terms energy: -450.309541 where: bonds (distance) C4'-P energy: -71.959 bonds (distance) P-C4' energy: -80.660 flat angles C4'-P-C4' energy: -99.192 flat angles P-C4'-P energy: -65.066 tors. eta vs tors. theta energy: -133.432 Dist. restrs. and SS energy: 1.254 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1554.071196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.071196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.013411 (E_RNA) where: Base-Base interactions energy: -1118.083 where: short stacking energy: -479.389 Base-Backbone interact. energy: 0.292 local terms energy: -474.222639 where: bonds (distance) C4'-P energy: -83.267 bonds (distance) P-C4' energy: -86.508 flat angles C4'-P-C4' energy: -93.458 flat angles P-C4'-P energy: -67.626 tors. eta vs tors. theta energy: -143.365 Dist. restrs. and SS energy: 1.192 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1502.375093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.375093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.953495 (E_RNA) where: Base-Base interactions energy: -1089.209 where: short stacking energy: -457.928 Base-Backbone interact. energy: -2.778 local terms energy: -447.965891 where: bonds (distance) C4'-P energy: -78.946 bonds (distance) P-C4' energy: -88.697 flat angles C4'-P-C4' energy: -97.087 flat angles P-C4'-P energy: -57.149 tors. eta vs tors. theta energy: -126.088 Dist. restrs. and SS energy: 0.828 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1442.720994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.720994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.189906 (E_RNA) where: Base-Base interactions energy: -1028.598 where: short stacking energy: -442.938 Base-Backbone interact. energy: -0.445 local terms energy: -452.146912 where: bonds (distance) C4'-P energy: -91.529 bonds (distance) P-C4' energy: -87.971 flat angles C4'-P-C4' energy: -100.860 flat angles P-C4'-P energy: -49.162 tors. eta vs tors. theta energy: -122.624 Dist. restrs. and SS energy: 1.719 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1393.502256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.502256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.745064 (E_RNA) where: Base-Base interactions energy: -1022.651 where: short stacking energy: -412.188 Base-Backbone interact. energy: 3.787 local terms energy: -413.881599 where: bonds (distance) C4'-P energy: -69.184 bonds (distance) P-C4' energy: -93.463 flat angles C4'-P-C4' energy: -96.891 flat angles P-C4'-P energy: -47.653 tors. eta vs tors. theta energy: -106.692 Dist. restrs. and SS energy: 2.493 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1358.366538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.366538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.287393 (E_RNA) where: Base-Base interactions energy: -1000.255 where: short stacking energy: -395.152 Base-Backbone interact. energy: -2.318 local terms energy: -393.715281 where: bonds (distance) C4'-P energy: -68.794 bonds (distance) P-C4' energy: -64.351 flat angles C4'-P-C4' energy: -95.351 flat angles P-C4'-P energy: -57.232 tors. eta vs tors. theta energy: -107.987 Dist. restrs. and SS energy: 1.171 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -1328.531204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.531204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.466426 (E_RNA) where: Base-Base interactions energy: -1013.555 where: short stacking energy: -412.970 Base-Backbone interact. energy: -0.102 local terms energy: -352.809579 where: bonds (distance) C4'-P energy: -62.309 bonds (distance) P-C4' energy: -60.670 flat angles C4'-P-C4' energy: -77.007 flat angles P-C4'-P energy: -45.262 tors. eta vs tors. theta energy: -107.562 Dist. restrs. and SS energy: 1.185 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1690.631140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.631140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.243344 (E_RNA) where: Base-Base interactions energy: -1234.240 where: short stacking energy: -536.760 Base-Backbone interact. energy: 0.727 local terms energy: -494.730578 where: bonds (distance) C4'-P energy: -84.616 bonds (distance) P-C4' energy: -89.946 flat angles C4'-P-C4' energy: -100.861 flat angles P-C4'-P energy: -73.730 tors. eta vs tors. theta energy: -145.578 Dist. restrs. and SS energy: 0.862 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1699.209668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1699.209668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.159504 (E_RNA) where: Base-Base interactions energy: -1233.531 where: short stacking energy: -518.041 Base-Backbone interact. energy: -1.820 local terms energy: -501.808374 where: bonds (distance) C4'-P energy: -87.676 bonds (distance) P-C4' energy: -97.845 flat angles C4'-P-C4' energy: -100.673 flat angles P-C4'-P energy: -76.143 tors. eta vs tors. theta energy: -139.473 Dist. restrs. and SS energy: 1.200 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1647.866506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.866506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.386472 (E_RNA) where: Base-Base interactions energy: -1213.857 where: short stacking energy: -495.670 Base-Backbone interact. energy: -2.132 local terms energy: -469.398056 where: bonds (distance) C4'-P energy: -78.544 bonds (distance) P-C4' energy: -85.684 flat angles C4'-P-C4' energy: -96.070 flat angles P-C4'-P energy: -77.101 tors. eta vs tors. theta energy: -131.999 Dist. restrs. and SS energy: 0.770 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1600.221531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1600.221531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1637.621848 (E_RNA) where: Base-Base interactions energy: -1167.912 where: short stacking energy: -462.921 Base-Backbone interact. energy: 2.293 local terms energy: -472.003241 where: bonds (distance) C4'-P energy: -94.578 bonds (distance) P-C4' energy: -80.088 flat angles C4'-P-C4' energy: -98.979 flat angles P-C4'-P energy: -70.030 tors. eta vs tors. theta energy: -128.329 Dist. restrs. and SS energy: 0.650 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1524.824223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.824223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.401377 (E_RNA) where: Base-Base interactions energy: -1098.475 where: short stacking energy: -443.106 Base-Backbone interact. energy: -1.654 local terms energy: -462.273203 where: bonds (distance) C4'-P energy: -76.848 bonds (distance) P-C4' energy: -92.381 flat angles C4'-P-C4' energy: -99.308 flat angles P-C4'-P energy: -69.726 tors. eta vs tors. theta energy: -124.010 Dist. restrs. and SS energy: 0.827 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1457.310022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.310022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.917992 (E_RNA) where: Base-Base interactions energy: -1071.382 where: short stacking energy: -447.750 Base-Backbone interact. energy: 0.856 local terms energy: -427.391967 where: bonds (distance) C4'-P energy: -62.741 bonds (distance) P-C4' energy: -87.413 flat angles C4'-P-C4' energy: -96.253 flat angles P-C4'-P energy: -62.585 tors. eta vs tors. theta energy: -118.400 Dist. restrs. and SS energy: 3.858 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1466.826240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.826240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.176029 (E_RNA) where: Base-Base interactions energy: -1067.129 where: short stacking energy: -435.731 Base-Backbone interact. energy: 4.028 local terms energy: -445.075292 where: bonds (distance) C4'-P energy: -70.651 bonds (distance) P-C4' energy: -95.284 flat angles C4'-P-C4' energy: -97.651 flat angles P-C4'-P energy: -63.220 tors. eta vs tors. theta energy: -118.269 Dist. restrs. and SS energy: 4.600 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1408.255205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.255205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.306993 (E_RNA) where: Base-Base interactions energy: -1048.612 where: short stacking energy: -434.123 Base-Backbone interact. energy: 0.003 local terms energy: -398.698092 where: bonds (distance) C4'-P energy: -70.895 bonds (distance) P-C4' energy: -60.226 flat angles C4'-P-C4' energy: -97.639 flat angles P-C4'-P energy: -55.084 tors. eta vs tors. theta energy: -114.854 Dist. restrs. and SS energy: 2.302 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1327.665694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.665694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.352405 (E_RNA) where: Base-Base interactions energy: -973.417 where: short stacking energy: -410.859 Base-Backbone interact. energy: -1.907 local terms energy: -391.028306 where: bonds (distance) C4'-P energy: -58.218 bonds (distance) P-C4' energy: -76.285 flat angles C4'-P-C4' energy: -92.018 flat angles P-C4'-P energy: -52.799 tors. eta vs tors. theta energy: -111.708 Dist. restrs. and SS energy: 1.937 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -1323.251437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.251437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.654338 (E_RNA) where: Base-Base interactions energy: -1005.867 where: short stacking energy: -396.220 Base-Backbone interact. energy: -1.131 local terms energy: -353.657010 where: bonds (distance) C4'-P energy: -59.957 bonds (distance) P-C4' energy: -57.024 flat angles C4'-P-C4' energy: -97.548 flat angles P-C4'-P energy: -45.173 tors. eta vs tors. theta energy: -93.956 Dist. restrs. and SS energy: 0.653 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1731.376542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.376542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.335475 (E_RNA) where: Base-Base interactions energy: -1254.826 where: short stacking energy: -525.764 Base-Backbone interact. energy: -1.789 local terms energy: -511.719615 where: bonds (distance) C4'-P energy: -90.673 bonds (distance) P-C4' energy: -101.213 flat angles C4'-P-C4' energy: -106.929 flat angles P-C4'-P energy: -66.677 tors. eta vs tors. theta energy: -146.227 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1676.536873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.536873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.275816 (E_RNA) where: Base-Base interactions energy: -1220.056 where: short stacking energy: -513.611 Base-Backbone interact. energy: 0.371 local terms energy: -494.591294 where: bonds (distance) C4'-P energy: -83.484 bonds (distance) P-C4' energy: -93.434 flat angles C4'-P-C4' energy: -102.053 flat angles P-C4'-P energy: -63.614 tors. eta vs tors. theta energy: -152.007 Dist. restrs. and SS energy: 0.989 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1697.567080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.567080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.337342 (E_RNA) where: Base-Base interactions energy: -1244.944 where: short stacking energy: -524.387 Base-Backbone interact. energy: -0.753 local terms energy: -489.640186 where: bonds (distance) C4'-P energy: -99.107 bonds (distance) P-C4' energy: -85.792 flat angles C4'-P-C4' energy: -96.068 flat angles P-C4'-P energy: -68.113 tors. eta vs tors. theta energy: -140.560 Dist. restrs. and SS energy: 1.020 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1613.446120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1613.446120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.653563 (E_RNA) where: Base-Base interactions energy: -1166.953 where: short stacking energy: -477.272 Base-Backbone interact. energy: -0.887 local terms energy: -484.814110 where: bonds (distance) C4'-P energy: -88.829 bonds (distance) P-C4' energy: -84.916 flat angles C4'-P-C4' energy: -103.018 flat angles P-C4'-P energy: -74.339 tors. eta vs tors. theta energy: -133.713 Dist. restrs. and SS energy: 2.457 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1527.728540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.728540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.006293 (E_RNA) where: Base-Base interactions energy: -1102.908 where: short stacking energy: -452.254 Base-Backbone interact. energy: -1.766 local terms energy: -461.332943 where: bonds (distance) C4'-P energy: -79.930 bonds (distance) P-C4' energy: -82.173 flat angles C4'-P-C4' energy: -92.256 flat angles P-C4'-P energy: -72.710 tors. eta vs tors. theta energy: -134.265 Dist. restrs. and SS energy: 1.528 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1455.370810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.370810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.132252 (E_RNA) where: Base-Base interactions energy: -1063.267 where: short stacking energy: -442.898 Base-Backbone interact. energy: -0.003 local terms energy: -430.861836 where: bonds (distance) C4'-P energy: -67.743 bonds (distance) P-C4' energy: -84.596 flat angles C4'-P-C4' energy: -96.556 flat angles P-C4'-P energy: -67.950 tors. eta vs tors. theta energy: -114.017 Dist. restrs. and SS energy: 2.011 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1420.937381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.937381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.268734 (E_RNA) where: Base-Base interactions energy: -1034.741 where: short stacking energy: -441.748 Base-Backbone interact. energy: -1.536 local terms energy: -422.992322 where: bonds (distance) C4'-P energy: -81.736 bonds (distance) P-C4' energy: -76.656 flat angles C4'-P-C4' energy: -90.917 flat angles P-C4'-P energy: -58.560 tors. eta vs tors. theta energy: -115.123 Dist. restrs. and SS energy: 1.581 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1427.136528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.136528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.531344 (E_RNA) where: Base-Base interactions energy: -1062.008 where: short stacking energy: -417.513 Base-Backbone interact. energy: -1.747 local terms energy: -400.776689 where: bonds (distance) C4'-P energy: -72.514 bonds (distance) P-C4' energy: -68.372 flat angles C4'-P-C4' energy: -88.557 flat angles P-C4'-P energy: -55.868 tors. eta vs tors. theta energy: -115.466 Dist. restrs. and SS energy: 0.645 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1354.946248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.946248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.292612 (E_RNA) where: Base-Base interactions energy: -985.189 where: short stacking energy: -413.770 Base-Backbone interact. energy: -1.930 local terms energy: -406.172858 where: bonds (distance) C4'-P energy: -71.067 bonds (distance) P-C4' energy: -75.927 flat angles C4'-P-C4' energy: -90.757 flat angles P-C4'-P energy: -54.720 tors. eta vs tors. theta energy: -113.702 Dist. restrs. and SS energy: 1.596 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -1308.467611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.467611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.071770 (E_RNA) where: Base-Base interactions energy: -976.298 where: short stacking energy: -392.314 Base-Backbone interact. energy: -0.590 local terms energy: -369.184195 where: bonds (distance) C4'-P energy: -58.717 bonds (distance) P-C4' energy: -64.920 flat angles C4'-P-C4' energy: -85.873 flat angles P-C4'-P energy: -52.376 tors. eta vs tors. theta energy: -107.298 Dist. restrs. and SS energy: 0.854 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1737.373541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1737.373541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1774.543010 (E_RNA) where: Base-Base interactions energy: -1269.629 where: short stacking energy: -507.257 Base-Backbone interact. energy: -1.206 local terms energy: -503.707873 where: bonds (distance) C4'-P energy: -94.779 bonds (distance) P-C4' energy: -101.919 flat angles C4'-P-C4' energy: -106.900 flat angles P-C4'-P energy: -59.799 tors. eta vs tors. theta energy: -140.310 Dist. restrs. and SS energy: 0.419 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1695.570181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.570181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.340828 (E_RNA) where: Base-Base interactions energy: -1241.041 where: short stacking energy: -495.332 Base-Backbone interact. energy: 0.903 local terms energy: -493.202699 where: bonds (distance) C4'-P energy: -89.471 bonds (distance) P-C4' energy: -93.921 flat angles C4'-P-C4' energy: -105.246 flat angles P-C4'-P energy: -67.030 tors. eta vs tors. theta energy: -137.534 Dist. restrs. and SS energy: 1.021 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1663.405341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1663.405341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1701.123966 (E_RNA) where: Base-Base interactions energy: -1214.524 where: short stacking energy: -504.779 Base-Backbone interact. energy: -1.984 local terms energy: -484.616461 where: bonds (distance) C4'-P energy: -84.510 bonds (distance) P-C4' energy: -82.935 flat angles C4'-P-C4' energy: -104.431 flat angles P-C4'-P energy: -58.179 tors. eta vs tors. theta energy: -154.562 Dist. restrs. and SS energy: 0.969 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1537.899548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.899548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.541531 (E_RNA) where: Base-Base interactions energy: -1115.906 where: short stacking energy: -445.833 Base-Backbone interact. energy: -0.988 local terms energy: -458.647837 where: bonds (distance) C4'-P energy: -78.179 bonds (distance) P-C4' energy: -79.572 flat angles C4'-P-C4' energy: -99.628 flat angles P-C4'-P energy: -68.388 tors. eta vs tors. theta energy: -132.881 Dist. restrs. and SS energy: 0.892 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1567.227166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1567.227166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.441231 (E_RNA) where: Base-Base interactions energy: -1149.955 where: short stacking energy: -465.509 Base-Backbone interact. energy: -1.407 local terms energy: -454.078753 where: bonds (distance) C4'-P energy: -78.444 bonds (distance) P-C4' energy: -84.119 flat angles C4'-P-C4' energy: -99.741 flat angles P-C4'-P energy: -59.205 tors. eta vs tors. theta energy: -132.569 Dist. restrs. and SS energy: 1.464 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1465.161538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.161538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.658529 (E_RNA) where: Base-Base interactions energy: -1069.402 where: short stacking energy: -423.811 Base-Backbone interact. energy: 3.003 local terms energy: -436.258957 where: bonds (distance) C4'-P energy: -79.674 bonds (distance) P-C4' energy: -77.882 flat angles C4'-P-C4' energy: -95.796 flat angles P-C4'-P energy: -64.427 tors. eta vs tors. theta energy: -118.481 Dist. restrs. and SS energy: 0.747 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1400.811270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.811270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.652602 (E_RNA) where: Base-Base interactions energy: -1007.513 where: short stacking energy: -406.259 Base-Backbone interact. energy: 1.999 local terms energy: -433.138610 where: bonds (distance) C4'-P energy: -83.261 bonds (distance) P-C4' energy: -79.124 flat angles C4'-P-C4' energy: -90.255 flat angles P-C4'-P energy: -63.509 tors. eta vs tors. theta energy: -116.989 Dist. restrs. and SS energy: 1.091 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1429.684477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.684477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.816277 (E_RNA) where: Base-Base interactions energy: -1047.162 where: short stacking energy: -440.357 Base-Backbone interact. energy: -2.333 local terms energy: -418.320998 where: bonds (distance) C4'-P energy: -68.792 bonds (distance) P-C4' energy: -74.462 flat angles C4'-P-C4' energy: -94.107 flat angles P-C4'-P energy: -51.771 tors. eta vs tors. theta energy: -129.189 Dist. restrs. and SS energy: 1.382 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1375.590641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.590641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.347177 (E_RNA) where: Base-Base interactions energy: -1014.684 where: short stacking energy: -404.741 Base-Backbone interact. energy: -1.648 local terms energy: -397.015596 where: bonds (distance) C4'-P energy: -65.955 bonds (distance) P-C4' energy: -65.991 flat angles C4'-P-C4' energy: -86.067 flat angles P-C4'-P energy: -72.103 tors. eta vs tors. theta energy: -106.900 Dist. restrs. and SS energy: 1.007 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -1313.968945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.968945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.811590 (E_RNA) where: Base-Base interactions energy: -973.088 where: short stacking energy: -399.150 Base-Backbone interact. energy: -0.205 local terms energy: -379.518769 where: bonds (distance) C4'-P energy: -81.011 bonds (distance) P-C4' energy: -51.959 flat angles C4'-P-C4' energy: -74.253 flat angles P-C4'-P energy: -60.776 tors. eta vs tors. theta energy: -111.519 Dist. restrs. and SS energy: 2.093 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1733.411754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.411754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.016077 (E_RNA) where: Base-Base interactions energy: -1274.898 where: short stacking energy: -502.587 Base-Backbone interact. energy: 1.327 local terms energy: -498.444723 where: bonds (distance) C4'-P energy: -92.521 bonds (distance) P-C4' energy: -90.764 flat angles C4'-P-C4' energy: -111.679 flat angles P-C4'-P energy: -64.682 tors. eta vs tors. theta energy: -138.799 Dist. restrs. and SS energy: 1.854 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1691.651126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.651126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.930516 (E_RNA) where: Base-Base interactions energy: -1232.831 where: short stacking energy: -527.293 Base-Backbone interact. energy: -2.028 local terms energy: -495.071934 where: bonds (distance) C4'-P energy: -80.200 bonds (distance) P-C4' energy: -83.630 flat angles C4'-P-C4' energy: -112.196 flat angles P-C4'-P energy: -73.355 tors. eta vs tors. theta energy: -145.690 Dist. restrs. and SS energy: 1.529 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1630.838112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.838112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.278201 (E_RNA) where: Base-Base interactions energy: -1187.094 where: short stacking energy: -493.857 Base-Backbone interact. energy: -1.136 local terms energy: -480.048241 where: bonds (distance) C4'-P energy: -78.586 bonds (distance) P-C4' energy: -84.833 flat angles C4'-P-C4' energy: -105.241 flat angles P-C4'-P energy: -70.841 tors. eta vs tors. theta energy: -140.547 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1577.603507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1577.603507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.266125 (E_RNA) where: Base-Base interactions energy: -1131.106 where: short stacking energy: -471.397 Base-Backbone interact. energy: 0.498 local terms energy: -484.658390 where: bonds (distance) C4'-P energy: -91.835 bonds (distance) P-C4' energy: -86.683 flat angles C4'-P-C4' energy: -93.784 flat angles P-C4'-P energy: -76.171 tors. eta vs tors. theta energy: -136.186 Dist. restrs. and SS energy: 0.913 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1560.698311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.698311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.348913 (E_RNA) where: Base-Base interactions energy: -1130.185 where: short stacking energy: -454.372 Base-Backbone interact. energy: -1.765 local terms energy: -467.399291 where: bonds (distance) C4'-P energy: -86.847 bonds (distance) P-C4' energy: -86.967 flat angles C4'-P-C4' energy: -97.770 flat angles P-C4'-P energy: -71.338 tors. eta vs tors. theta energy: -124.477 Dist. restrs. and SS energy: 1.901 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1515.241087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.241087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.170012 (E_RNA) where: Base-Base interactions energy: -1098.051 where: short stacking energy: -447.380 Base-Backbone interact. energy: -1.641 local terms energy: -453.477993 where: bonds (distance) C4'-P energy: -77.517 bonds (distance) P-C4' energy: -91.331 flat angles C4'-P-C4' energy: -89.735 flat angles P-C4'-P energy: -66.685 tors. eta vs tors. theta energy: -128.210 Dist. restrs. and SS energy: 1.179 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1417.639613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.639613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.654171 (E_RNA) where: Base-Base interactions energy: -1039.916 where: short stacking energy: -433.469 Base-Backbone interact. energy: -1.735 local terms energy: -415.003453 where: bonds (distance) C4'-P energy: -82.728 bonds (distance) P-C4' energy: -80.271 flat angles C4'-P-C4' energy: -77.044 flat angles P-C4'-P energy: -57.946 tors. eta vs tors. theta energy: -117.014 Dist. restrs. and SS energy: 2.265 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1406.092157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.092157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.341924 (E_RNA) where: Base-Base interactions energy: -1063.142 where: short stacking energy: -425.136 Base-Backbone interact. energy: 2.537 local terms energy: -383.737558 where: bonds (distance) C4'-P energy: -58.684 bonds (distance) P-C4' energy: -68.822 flat angles C4'-P-C4' energy: -86.589 flat angles P-C4'-P energy: -48.542 tors. eta vs tors. theta energy: -121.100 Dist. restrs. and SS energy: 1.500 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1351.745141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.745141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.599946 (E_RNA) where: Base-Base interactions energy: -999.161 where: short stacking energy: -400.413 Base-Backbone interact. energy: 2.044 local terms energy: -393.483639 where: bonds (distance) C4'-P energy: -88.659 bonds (distance) P-C4' energy: -70.412 flat angles C4'-P-C4' energy: -79.537 flat angles P-C4'-P energy: -57.449 tors. eta vs tors. theta energy: -97.427 Dist. restrs. and SS energy: 2.105 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -1319.409112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.409112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.257835 (E_RNA) where: Base-Base interactions energy: -967.859 where: short stacking energy: -403.382 Base-Backbone interact. energy: 4.199 local terms energy: -394.597932 where: bonds (distance) C4'-P energy: -68.374 bonds (distance) P-C4' energy: -82.200 flat angles C4'-P-C4' energy: -82.982 flat angles P-C4'-P energy: -48.165 tors. eta vs tors. theta energy: -112.877 Dist. restrs. and SS energy: 2.099 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1753.993784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1753.993784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1791.133859 (E_RNA) where: Base-Base interactions energy: -1278.087 where: short stacking energy: -518.800 Base-Backbone interact. energy: -0.714 local terms energy: -512.332605 where: bonds (distance) C4'-P energy: -92.542 bonds (distance) P-C4' energy: -97.564 flat angles C4'-P-C4' energy: -107.927 flat angles P-C4'-P energy: -71.098 tors. eta vs tors. theta energy: -143.202 Dist. restrs. and SS energy: 0.390 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1649.333731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.333731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.763366 (E_RNA) where: Base-Base interactions energy: -1191.702 where: short stacking energy: -488.285 Base-Backbone interact. energy: -2.106 local terms energy: -492.954826 where: bonds (distance) C4'-P energy: -83.339 bonds (distance) P-C4' energy: -93.838 flat angles C4'-P-C4' energy: -98.466 flat angles P-C4'-P energy: -82.122 tors. eta vs tors. theta energy: -135.190 Dist. restrs. and SS energy: 0.680 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1658.611444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.611444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.975156 (E_RNA) where: Base-Base interactions energy: -1208.073 where: short stacking energy: -497.795 Base-Backbone interact. energy: -1.414 local terms energy: -486.487907 where: bonds (distance) C4'-P energy: -88.191 bonds (distance) P-C4' energy: -90.825 flat angles C4'-P-C4' energy: -90.562 flat angles P-C4'-P energy: -70.641 tors. eta vs tors. theta energy: -146.270 Dist. restrs. and SS energy: 0.614 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1620.831131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.831131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.725237 (E_RNA) where: Base-Base interactions energy: -1177.554 where: short stacking energy: -493.036 Base-Backbone interact. energy: -1.872 local terms energy: -481.299627 where: bonds (distance) C4'-P energy: -81.864 bonds (distance) P-C4' energy: -80.335 flat angles C4'-P-C4' energy: -102.194 flat angles P-C4'-P energy: -75.329 tors. eta vs tors. theta energy: -141.578 Dist. restrs. and SS energy: 3.144 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1572.709198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.709198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.376052 (E_RNA) where: Base-Base interactions energy: -1152.212 where: short stacking energy: -464.391 Base-Backbone interact. energy: -0.896 local terms energy: -457.268132 where: bonds (distance) C4'-P energy: -70.564 bonds (distance) P-C4' energy: -95.905 flat angles C4'-P-C4' energy: -104.126 flat angles P-C4'-P energy: -64.603 tors. eta vs tors. theta energy: -122.071 Dist. restrs. and SS energy: 0.917 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1503.380463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1503.380463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.684667 (E_RNA) where: Base-Base interactions energy: -1097.657 where: short stacking energy: -459.670 Base-Backbone interact. energy: -1.872 local terms energy: -441.155544 where: bonds (distance) C4'-P energy: -74.873 bonds (distance) P-C4' energy: -84.007 flat angles C4'-P-C4' energy: -91.840 flat angles P-C4'-P energy: -64.622 tors. eta vs tors. theta energy: -125.813 Dist. restrs. and SS energy: 0.554 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1400.246628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1400.246628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.867732 (E_RNA) where: Base-Base interactions energy: -1021.265 where: short stacking energy: -393.397 Base-Backbone interact. energy: 2.053 local terms energy: -418.655218 where: bonds (distance) C4'-P energy: -79.373 bonds (distance) P-C4' energy: -78.977 flat angles C4'-P-C4' energy: -92.535 flat angles P-C4'-P energy: -60.788 tors. eta vs tors. theta energy: -106.982 Dist. restrs. and SS energy: 0.871 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1393.766446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.766446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.643927 (E_RNA) where: Base-Base interactions energy: -1012.234 where: short stacking energy: -419.485 Base-Backbone interact. energy: -0.957 local terms energy: -419.453116 where: bonds (distance) C4'-P energy: -82.677 bonds (distance) P-C4' energy: -81.151 flat angles C4'-P-C4' energy: -86.217 flat angles P-C4'-P energy: -51.780 tors. eta vs tors. theta energy: -117.629 Dist. restrs. and SS energy: 2.127 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1383.871790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.871790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.742236 (E_RNA) where: Base-Base interactions energy: -1042.569 where: short stacking energy: -421.854 Base-Backbone interact. energy: -0.572 local terms energy: -379.601639 where: bonds (distance) C4'-P energy: -57.669 bonds (distance) P-C4' energy: -73.605 flat angles C4'-P-C4' energy: -87.631 flat angles P-C4'-P energy: -48.469 tors. eta vs tors. theta energy: -112.227 Dist. restrs. and SS energy: 2.120 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -1361.904965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.904965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1400.803525 (E_RNA) where: Base-Base interactions energy: -999.949 where: short stacking energy: -407.820 Base-Backbone interact. energy: 2.844 local terms energy: -403.698245 where: bonds (distance) C4'-P energy: -78.231 bonds (distance) P-C4' energy: -74.906 flat angles C4'-P-C4' energy: -74.845 flat angles P-C4'-P energy: -64.325 tors. eta vs tors. theta energy: -111.391 Dist. restrs. and SS energy: 2.149 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1780.907838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1780.907838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.084698 (E_RNA) where: Base-Base interactions energy: -1323.386 where: short stacking energy: -531.755 Base-Backbone interact. energy: -2.448 local terms energy: -492.250294 where: bonds (distance) C4'-P energy: -84.007 bonds (distance) P-C4' energy: -89.325 flat angles C4'-P-C4' energy: -105.119 flat angles P-C4'-P energy: -72.796 tors. eta vs tors. theta energy: -141.003 Dist. restrs. and SS energy: 0.427 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1687.338076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.338076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.713791 (E_RNA) where: Base-Base interactions energy: -1230.879 where: short stacking energy: -521.778 Base-Backbone interact. energy: -1.603 local terms energy: -492.231913 where: bonds (distance) C4'-P energy: -81.137 bonds (distance) P-C4' energy: -89.412 flat angles C4'-P-C4' energy: -105.879 flat angles P-C4'-P energy: -74.657 tors. eta vs tors. theta energy: -141.147 Dist. restrs. and SS energy: 0.626 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1644.304535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.304535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.938593 (E_RNA) where: Base-Base interactions energy: -1169.479 where: short stacking energy: -494.359 Base-Backbone interact. energy: -2.396 local terms energy: -510.063421 where: bonds (distance) C4'-P energy: -89.920 bonds (distance) P-C4' energy: -103.764 flat angles C4'-P-C4' energy: -100.285 flat angles P-C4'-P energy: -76.494 tors. eta vs tors. theta energy: -139.600 Dist. restrs. and SS energy: 0.884 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1628.636271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.636271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.434149 (E_RNA) where: Base-Base interactions energy: -1175.916 where: short stacking energy: -491.735 Base-Backbone interact. energy: -0.958 local terms energy: -489.560712 where: bonds (distance) C4'-P energy: -92.711 bonds (distance) P-C4' energy: -95.268 flat angles C4'-P-C4' energy: -100.374 flat angles P-C4'-P energy: -57.484 tors. eta vs tors. theta energy: -143.724 Dist. restrs. and SS energy: 1.048 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1566.781119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.781119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.971511 (E_RNA) where: Base-Base interactions energy: -1137.050 where: short stacking energy: -471.296 Base-Backbone interact. energy: -0.974 local terms energy: -466.947296 where: bonds (distance) C4'-P energy: -81.842 bonds (distance) P-C4' energy: -90.386 flat angles C4'-P-C4' energy: -98.124 flat angles P-C4'-P energy: -55.757 tors. eta vs tors. theta energy: -140.838 Dist. restrs. and SS energy: 1.440 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1493.424476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1493.424476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1531.164984 (E_RNA) where: Base-Base interactions energy: -1102.011 where: short stacking energy: -427.477 Base-Backbone interact. energy: -0.126 local terms energy: -429.028481 where: bonds (distance) C4'-P energy: -75.349 bonds (distance) P-C4' energy: -92.789 flat angles C4'-P-C4' energy: -94.528 flat angles P-C4'-P energy: -51.281 tors. eta vs tors. theta energy: -115.080 Dist. restrs. and SS energy: 0.991 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1425.474683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.474683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.544550 (E_RNA) where: Base-Base interactions energy: -1040.540 where: short stacking energy: -426.925 Base-Backbone interact. energy: -0.798 local terms energy: -422.207260 where: bonds (distance) C4'-P energy: -64.686 bonds (distance) P-C4' energy: -70.091 flat angles C4'-P-C4' energy: -104.279 flat angles P-C4'-P energy: -69.168 tors. eta vs tors. theta energy: -113.983 Dist. restrs. and SS energy: 1.320 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1384.297725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.297725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.635546 (E_RNA) where: Base-Base interactions energy: -1013.139 where: short stacking energy: -422.921 Base-Backbone interact. energy: -0.241 local terms energy: -409.255734 where: bonds (distance) C4'-P energy: -59.628 bonds (distance) P-C4' energy: -75.131 flat angles C4'-P-C4' energy: -86.181 flat angles P-C4'-P energy: -65.613 tors. eta vs tors. theta energy: -122.702 Dist. restrs. and SS energy: 1.588 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1404.968477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.968477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.562101 (E_RNA) where: Base-Base interactions energy: -1050.857 where: short stacking energy: -433.530 Base-Backbone interact. energy: -0.986 local terms energy: -391.718646 where: bonds (distance) C4'-P energy: -76.365 bonds (distance) P-C4' energy: -71.474 flat angles C4'-P-C4' energy: -71.015 flat angles P-C4'-P energy: -56.094 tors. eta vs tors. theta energy: -116.771 Dist. restrs. and SS energy: 1.844 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -1326.078557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.078557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.551935 (E_RNA) where: Base-Base interactions energy: -982.221 where: short stacking energy: -400.967 Base-Backbone interact. energy: -3.263 local terms energy: -378.067447 where: bonds (distance) C4'-P energy: -72.741 bonds (distance) P-C4' energy: -57.975 flat angles C4'-P-C4' energy: -74.834 flat angles P-C4'-P energy: -56.701 tors. eta vs tors. theta energy: -115.817 Dist. restrs. and SS energy: 0.723 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1779.309252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1779.309252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1816.909082 (E_RNA) where: Base-Base interactions energy: -1297.866 where: short stacking energy: -528.279 Base-Backbone interact. energy: 1.872 local terms energy: -520.915234 where: bonds (distance) C4'-P energy: -102.919 bonds (distance) P-C4' energy: -96.294 flat angles C4'-P-C4' energy: -109.657 flat angles P-C4'-P energy: -68.726 tors. eta vs tors. theta energy: -143.318 Dist. restrs. and SS energy: 0.850 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1665.724081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.724081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1703.496953 (E_RNA) where: Base-Base interactions energy: -1198.952 where: short stacking energy: -525.448 Base-Backbone interact. energy: -2.032 local terms energy: -502.513336 where: bonds (distance) C4'-P energy: -88.607 bonds (distance) P-C4' energy: -91.852 flat angles C4'-P-C4' energy: -98.137 flat angles P-C4'-P energy: -73.095 tors. eta vs tors. theta energy: -150.822 Dist. restrs. and SS energy: 1.023 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1679.822639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.822639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.976954 (E_RNA) where: Base-Base interactions energy: -1215.348 where: short stacking energy: -509.984 Base-Backbone interact. energy: 0.737 local terms energy: -503.365882 where: bonds (distance) C4'-P energy: -94.924 bonds (distance) P-C4' energy: -89.753 flat angles C4'-P-C4' energy: -111.443 flat angles P-C4'-P energy: -66.256 tors. eta vs tors. theta energy: -140.990 Dist. restrs. and SS energy: 1.404 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1581.981446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.981446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.815642 (E_RNA) where: Base-Base interactions energy: -1140.682 where: short stacking energy: -483.707 Base-Backbone interact. energy: -2.079 local terms energy: -477.055060 where: bonds (distance) C4'-P energy: -75.735 bonds (distance) P-C4' energy: -93.016 flat angles C4'-P-C4' energy: -101.925 flat angles P-C4'-P energy: -70.096 tors. eta vs tors. theta energy: -136.283 Dist. restrs. and SS energy: 1.084 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1559.682973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.682973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.786677 (E_RNA) where: Base-Base interactions energy: -1141.000 where: short stacking energy: -465.624 Base-Backbone interact. energy: 0.168 local terms energy: -457.954669 where: bonds (distance) C4'-P energy: -71.642 bonds (distance) P-C4' energy: -86.900 flat angles C4'-P-C4' energy: -100.269 flat angles P-C4'-P energy: -68.342 tors. eta vs tors. theta energy: -130.801 Dist. restrs. and SS energy: 2.354 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1501.688179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.688179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.650165 (E_RNA) where: Base-Base interactions energy: -1106.513 where: short stacking energy: -456.276 Base-Backbone interact. energy: -0.665 local terms energy: -432.472016 where: bonds (distance) C4'-P energy: -54.147 bonds (distance) P-C4' energy: -89.953 flat angles C4'-P-C4' energy: -94.743 flat angles P-C4'-P energy: -63.939 tors. eta vs tors. theta energy: -129.690 Dist. restrs. and SS energy: 1.212 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1422.859470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.859470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.352831 (E_RNA) where: Base-Base interactions energy: -1033.275 where: short stacking energy: -408.056 Base-Backbone interact. energy: -1.112 local terms energy: -425.965946 where: bonds (distance) C4'-P energy: -81.403 bonds (distance) P-C4' energy: -79.124 flat angles C4'-P-C4' energy: -90.736 flat angles P-C4'-P energy: -55.396 tors. eta vs tors. theta energy: -119.307 Dist. restrs. and SS energy: 0.743 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1392.785708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.785708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.001222 (E_RNA) where: Base-Base interactions energy: -1027.504 where: short stacking energy: -433.912 Base-Backbone interact. energy: -1.233 local terms energy: -406.264259 where: bonds (distance) C4'-P energy: -80.372 bonds (distance) P-C4' energy: -64.085 flat angles C4'-P-C4' energy: -92.285 flat angles P-C4'-P energy: -50.585 tors. eta vs tors. theta energy: -118.939 Dist. restrs. and SS energy: 5.466 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1352.814178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.814178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.106059 (E_RNA) where: Base-Base interactions energy: -978.924 where: short stacking energy: -402.612 Base-Backbone interact. energy: -1.651 local terms energy: -410.530911 where: bonds (distance) C4'-P energy: -70.665 bonds (distance) P-C4' energy: -73.075 flat angles C4'-P-C4' energy: -98.210 flat angles P-C4'-P energy: -58.289 tors. eta vs tors. theta energy: -110.292 Dist. restrs. and SS energy: 1.542 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -1287.167537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.167537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.789998 (E_RNA) where: Base-Base interactions energy: -979.581 where: short stacking energy: -392.266 Base-Backbone interact. energy: -1.392 local terms energy: -344.817207 where: bonds (distance) C4'-P energy: -55.124 bonds (distance) P-C4' energy: -65.128 flat angles C4'-P-C4' energy: -82.338 flat angles P-C4'-P energy: -50.522 tors. eta vs tors. theta energy: -91.705 Dist. restrs. and SS energy: 1.872 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1760.381626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1760.381626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.974608 (E_RNA) where: Base-Base interactions energy: -1297.389 where: short stacking energy: -517.714 Base-Backbone interact. energy: -0.299 local terms energy: -500.287044 where: bonds (distance) C4'-P energy: -81.283 bonds (distance) P-C4' energy: -93.257 flat angles C4'-P-C4' energy: -117.282 flat angles P-C4'-P energy: -71.543 tors. eta vs tors. theta energy: -136.922 Dist. restrs. and SS energy: 0.843 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1696.937129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.937129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.360904 (E_RNA) where: Base-Base interactions energy: -1243.506 where: short stacking energy: -511.450 Base-Backbone interact. energy: -1.159 local terms energy: -489.696587 where: bonds (distance) C4'-P energy: -73.834 bonds (distance) P-C4' energy: -99.135 flat angles C4'-P-C4' energy: -104.874 flat angles P-C4'-P energy: -65.949 tors. eta vs tors. theta energy: -145.904 Dist. restrs. and SS energy: 0.674 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1638.002859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.002859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.529895 (E_RNA) where: Base-Base interactions energy: -1195.722 where: short stacking energy: -492.650 Base-Backbone interact. energy: -0.572 local terms energy: -479.235601 where: bonds (distance) C4'-P energy: -88.064 bonds (distance) P-C4' energy: -77.219 flat angles C4'-P-C4' energy: -105.651 flat angles P-C4'-P energy: -71.180 tors. eta vs tors. theta energy: -137.121 Dist. restrs. and SS energy: 0.777 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1626.540727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.540727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1664.246757 (E_RNA) where: Base-Base interactions energy: -1180.365 where: short stacking energy: -486.353 Base-Backbone interact. energy: -0.165 local terms energy: -483.716551 where: bonds (distance) C4'-P energy: -81.282 bonds (distance) P-C4' energy: -91.593 flat angles C4'-P-C4' energy: -103.519 flat angles P-C4'-P energy: -69.801 tors. eta vs tors. theta energy: -137.522 Dist. restrs. and SS energy: 0.956 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1564.866807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.866807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.197811 (E_RNA) where: Base-Base interactions energy: -1137.286 where: short stacking energy: -455.396 Base-Backbone interact. energy: -1.879 local terms energy: -464.032249 where: bonds (distance) C4'-P energy: -83.937 bonds (distance) P-C4' energy: -77.119 flat angles C4'-P-C4' energy: -94.122 flat angles P-C4'-P energy: -72.439 tors. eta vs tors. theta energy: -136.415 Dist. restrs. and SS energy: 1.581 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1472.815569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.815569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.253776 (E_RNA) where: Base-Base interactions energy: -1082.644 where: short stacking energy: -431.369 Base-Backbone interact. energy: -0.051 local terms energy: -427.558449 where: bonds (distance) C4'-P energy: -66.463 bonds (distance) P-C4' energy: -73.832 flat angles C4'-P-C4' energy: -96.100 flat angles P-C4'-P energy: -70.520 tors. eta vs tors. theta energy: -120.644 Dist. restrs. and SS energy: 0.688 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1436.699816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.699816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.397594 (E_RNA) where: Base-Base interactions energy: -1061.908 where: short stacking energy: -435.025 Base-Backbone interact. energy: 2.053 local terms energy: -414.542239 where: bonds (distance) C4'-P energy: -69.637 bonds (distance) P-C4' energy: -79.682 flat angles C4'-P-C4' energy: -89.474 flat angles P-C4'-P energy: -56.220 tors. eta vs tors. theta energy: -119.529 Dist. restrs. and SS energy: 0.948 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1408.005283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.005283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.343167 (E_RNA) where: Base-Base interactions energy: -1024.418 where: short stacking energy: -421.796 Base-Backbone interact. energy: 0.253 local terms energy: -423.178777 where: bonds (distance) C4'-P energy: -69.561 bonds (distance) P-C4' energy: -80.963 flat angles C4'-P-C4' energy: -95.869 flat angles P-C4'-P energy: -56.312 tors. eta vs tors. theta energy: -120.474 Dist. restrs. and SS energy: 2.588 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1352.058770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.058770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.297512 (E_RNA) where: Base-Base interactions energy: -1007.514 where: short stacking energy: -415.414 Base-Backbone interact. energy: 0.613 local terms energy: -383.396276 where: bonds (distance) C4'-P energy: -69.821 bonds (distance) P-C4' energy: -52.730 flat angles C4'-P-C4' energy: -88.923 flat angles P-C4'-P energy: -61.627 tors. eta vs tors. theta energy: -110.296 Dist. restrs. and SS energy: 1.489 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -1333.311742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.311742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.597347 (E_RNA) where: Base-Base interactions energy: -969.332 where: short stacking energy: -383.645 Base-Backbone interact. energy: -1.608 local terms energy: -400.656688 where: bonds (distance) C4'-P energy: -75.227 bonds (distance) P-C4' energy: -70.105 flat angles C4'-P-C4' energy: -93.785 flat angles P-C4'-P energy: -58.664 tors. eta vs tors. theta energy: -102.875 Dist. restrs. and SS energy: 1.536 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1774.374200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1774.374200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1811.992828 (E_RNA) where: Base-Base interactions energy: -1300.208 where: short stacking energy: -504.999 Base-Backbone interact. energy: 2.340 local terms energy: -514.125211 where: bonds (distance) C4'-P energy: -95.557 bonds (distance) P-C4' energy: -97.202 flat angles C4'-P-C4' energy: -106.500 flat angles P-C4'-P energy: -74.165 tors. eta vs tors. theta energy: -140.701 Dist. restrs. and SS energy: 0.869 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1689.072254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.072254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.741591 (E_RNA) where: Base-Base interactions energy: -1217.554 where: short stacking energy: -513.011 Base-Backbone interact. energy: -3.112 local terms energy: -506.075485 where: bonds (distance) C4'-P energy: -89.489 bonds (distance) P-C4' energy: -85.333 flat angles C4'-P-C4' energy: -106.073 flat angles P-C4'-P energy: -67.320 tors. eta vs tors. theta energy: -157.860 Dist. restrs. and SS energy: 0.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1644.413384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.413384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.348883 (E_RNA) where: Base-Base interactions energy: -1194.050 where: short stacking energy: -487.036 Base-Backbone interact. energy: -2.538 local terms energy: -485.760976 where: bonds (distance) C4'-P energy: -79.531 bonds (distance) P-C4' energy: -97.708 flat angles C4'-P-C4' energy: -102.413 flat angles P-C4'-P energy: -70.621 tors. eta vs tors. theta energy: -135.488 Dist. restrs. and SS energy: 1.185 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1604.358243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.358243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1642.340071 (E_RNA) where: Base-Base interactions energy: -1163.489 where: short stacking energy: -490.683 Base-Backbone interact. energy: -2.608 local terms energy: -476.243640 where: bonds (distance) C4'-P energy: -89.781 bonds (distance) P-C4' energy: -93.350 flat angles C4'-P-C4' energy: -98.646 flat angles P-C4'-P energy: -63.041 tors. eta vs tors. theta energy: -131.425 Dist. restrs. and SS energy: 1.232 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1573.462551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.462551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.619711 (E_RNA) where: Base-Base interactions energy: -1156.238 where: short stacking energy: -459.513 Base-Backbone interact. energy: -2.880 local terms energy: -452.501763 where: bonds (distance) C4'-P energy: -79.932 bonds (distance) P-C4' energy: -92.979 flat angles C4'-P-C4' energy: -92.687 flat angles P-C4'-P energy: -60.297 tors. eta vs tors. theta energy: -126.607 Dist. restrs. and SS energy: 1.407 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1492.493058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1492.493058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1530.770325 (E_RNA) where: Base-Base interactions energy: -1099.109 where: short stacking energy: -456.441 Base-Backbone interact. energy: -0.659 local terms energy: -431.002142 where: bonds (distance) C4'-P energy: -68.973 bonds (distance) P-C4' energy: -75.311 flat angles C4'-P-C4' energy: -89.743 flat angles P-C4'-P energy: -69.498 tors. eta vs tors. theta energy: -127.477 Dist. restrs. and SS energy: 1.527 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1481.663769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.663769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.513872 (E_RNA) where: Base-Base interactions energy: -1085.111 where: short stacking energy: -459.895 Base-Backbone interact. energy: -1.247 local terms energy: -435.155235 where: bonds (distance) C4'-P energy: -76.806 bonds (distance) P-C4' energy: -68.882 flat angles C4'-P-C4' energy: -103.912 flat angles P-C4'-P energy: -55.618 tors. eta vs tors. theta energy: -129.938 Dist. restrs. and SS energy: 3.100 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1447.476514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.476514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.022496 (E_RNA) where: Base-Base interactions energy: -1064.416 where: short stacking energy: -435.638 Base-Backbone interact. energy: -1.033 local terms energy: -420.573397 where: bonds (distance) C4'-P energy: -59.483 bonds (distance) P-C4' energy: -79.675 flat angles C4'-P-C4' energy: -87.246 flat angles P-C4'-P energy: -72.970 tors. eta vs tors. theta energy: -121.199 Dist. restrs. and SS energy: 1.796 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1352.693961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.693961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.753804 (E_RNA) where: Base-Base interactions energy: -967.852 where: short stacking energy: -392.244 Base-Backbone interact. energy: -1.443 local terms energy: -422.459338 where: bonds (distance) C4'-P energy: -66.827 bonds (distance) P-C4' energy: -85.244 flat angles C4'-P-C4' energy: -85.155 flat angles P-C4'-P energy: -66.790 tors. eta vs tors. theta energy: -118.443 Dist. restrs. and SS energy: 2.310 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -1326.613024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.613024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.807970 (E_RNA) where: Base-Base interactions energy: -963.510 where: short stacking energy: -388.332 Base-Backbone interact. energy: -1.408 local terms energy: -399.889962 where: bonds (distance) C4'-P energy: -81.859 bonds (distance) P-C4' energy: -67.330 flat angles C4'-P-C4' energy: -91.144 flat angles P-C4'-P energy: -55.408 tors. eta vs tors. theta energy: -104.149 Dist. restrs. and SS energy: 1.445 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1761.587868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1761.587868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.172441 (E_RNA) where: Base-Base interactions energy: -1308.646 where: short stacking energy: -505.430 Base-Backbone interact. energy: -3.405 local terms energy: -487.121758 where: bonds (distance) C4'-P energy: -82.398 bonds (distance) P-C4' energy: -90.751 flat angles C4'-P-C4' energy: -96.757 flat angles P-C4'-P energy: -79.698 tors. eta vs tors. theta energy: -137.518 Dist. restrs. and SS energy: 0.835 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1692.233067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1692.233067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.418851 (E_RNA) where: Base-Base interactions energy: -1212.304 where: short stacking energy: -515.487 Base-Backbone interact. energy: -0.561 local terms energy: -516.553850 where: bonds (distance) C4'-P energy: -87.061 bonds (distance) P-C4' energy: -78.439 flat angles C4'-P-C4' energy: -118.282 flat angles P-C4'-P energy: -84.461 tors. eta vs tors. theta energy: -148.312 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1657.436479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.436479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.287291 (E_RNA) where: Base-Base interactions energy: -1218.643 where: short stacking energy: -505.951 Base-Backbone interact. energy: -2.685 local terms energy: -473.960135 where: bonds (distance) C4'-P energy: -77.010 bonds (distance) P-C4' energy: -94.985 flat angles C4'-P-C4' energy: -95.361 flat angles P-C4'-P energy: -65.043 tors. eta vs tors. theta energy: -141.561 Dist. restrs. and SS energy: 1.101 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1623.482651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1623.482651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.332371 (E_RNA) where: Base-Base interactions energy: -1187.389 where: short stacking energy: -496.389 Base-Backbone interact. energy: -1.425 local terms energy: -472.519008 where: bonds (distance) C4'-P energy: -80.579 bonds (distance) P-C4' energy: -88.611 flat angles C4'-P-C4' energy: -91.458 flat angles P-C4'-P energy: -67.235 tors. eta vs tors. theta energy: -144.636 Dist. restrs. and SS energy: 1.100 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1491.017887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.017887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1530.043375 (E_RNA) where: Base-Base interactions energy: -1082.131 where: short stacking energy: -436.245 Base-Backbone interact. energy: -1.603 local terms energy: -446.310134 where: bonds (distance) C4'-P energy: -79.911 bonds (distance) P-C4' energy: -89.843 flat angles C4'-P-C4' energy: -91.424 flat angles P-C4'-P energy: -54.401 tors. eta vs tors. theta energy: -130.731 Dist. restrs. and SS energy: 2.275 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1537.403172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.403172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.379806 (E_RNA) where: Base-Base interactions energy: -1118.589 where: short stacking energy: -447.826 Base-Backbone interact. energy: -0.966 local terms energy: -455.824988 where: bonds (distance) C4'-P energy: -72.998 bonds (distance) P-C4' energy: -86.068 flat angles C4'-P-C4' energy: -105.560 flat angles P-C4'-P energy: -56.538 tors. eta vs tors. theta energy: -134.661 Dist. restrs. and SS energy: 1.227 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1436.783951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.783951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.753063 (E_RNA) where: Base-Base interactions energy: -1027.507 where: short stacking energy: -410.815 Base-Backbone interact. energy: -1.818 local terms energy: -446.428315 where: bonds (distance) C4'-P energy: -85.806 bonds (distance) P-C4' energy: -90.012 flat angles C4'-P-C4' energy: -98.326 flat angles P-C4'-P energy: -54.426 tors. eta vs tors. theta energy: -117.858 Dist. restrs. and SS energy: 2.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1402.554709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.554709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.283756 (E_RNA) where: Base-Base interactions energy: -1029.322 where: short stacking energy: -416.294 Base-Backbone interact. energy: -0.687 local terms energy: -410.274725 where: bonds (distance) C4'-P energy: -76.127 bonds (distance) P-C4' energy: -74.508 flat angles C4'-P-C4' energy: -98.235 flat angles P-C4'-P energy: -46.446 tors. eta vs tors. theta energy: -114.959 Dist. restrs. and SS energy: 0.979 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1349.299073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.299073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.688115 (E_RNA) where: Base-Base interactions energy: -1007.523 where: short stacking energy: -421.543 Base-Backbone interact. energy: -1.866 local terms energy: -379.299585 where: bonds (distance) C4'-P energy: -61.249 bonds (distance) P-C4' energy: -68.256 flat angles C4'-P-C4' energy: -91.362 flat angles P-C4'-P energy: -50.410 tors. eta vs tors. theta energy: -108.021 Dist. restrs. and SS energy: 2.639 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -1318.766362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1318.766362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.449209 (E_RNA) where: Base-Base interactions energy: -992.154 where: short stacking energy: -404.860 Base-Backbone interact. energy: -1.308 local terms energy: -362.987786 where: bonds (distance) C4'-P energy: -78.157 bonds (distance) P-C4' energy: -57.555 flat angles C4'-P-C4' energy: -85.506 flat angles P-C4'-P energy: -32.522 tors. eta vs tors. theta energy: -109.248 Dist. restrs. and SS energy: 0.933 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1762.067042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1762.067042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.982699 (E_RNA) where: Base-Base interactions energy: -1294.411 where: short stacking energy: -517.970 Base-Backbone interact. energy: -1.295 local terms energy: -504.276347 where: bonds (distance) C4'-P energy: -93.056 bonds (distance) P-C4' energy: -95.125 flat angles C4'-P-C4' energy: -97.938 flat angles P-C4'-P energy: -75.656 tors. eta vs tors. theta energy: -142.502 Dist. restrs. and SS energy: 1.166 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1677.733399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1677.733399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1715.348198 (E_RNA) where: Base-Base interactions energy: -1235.599 where: short stacking energy: -497.822 Base-Backbone interact. energy: -2.026 local terms energy: -477.723037 where: bonds (distance) C4'-P energy: -82.694 bonds (distance) P-C4' energy: -89.003 flat angles C4'-P-C4' energy: -95.945 flat angles P-C4'-P energy: -74.355 tors. eta vs tors. theta energy: -135.726 Dist. restrs. and SS energy: 0.865 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1642.205896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1642.205896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.756935 (E_RNA) where: Base-Base interactions energy: -1184.694 where: short stacking energy: -507.865 Base-Backbone interact. energy: 0.763 local terms energy: -495.825777 where: bonds (distance) C4'-P energy: -86.792 bonds (distance) P-C4' energy: -99.510 flat angles C4'-P-C4' energy: -102.656 flat angles P-C4'-P energy: -61.914 tors. eta vs tors. theta energy: -144.953 Dist. restrs. and SS energy: 0.801 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1609.889133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.889133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.043951 (E_RNA) where: Base-Base interactions energy: -1153.544 where: short stacking energy: -492.290 Base-Backbone interact. energy: -0.817 local terms energy: -493.682583 where: bonds (distance) C4'-P energy: -74.967 bonds (distance) P-C4' energy: -95.930 flat angles C4'-P-C4' energy: -98.821 flat angles P-C4'-P energy: -75.698 tors. eta vs tors. theta energy: -148.266 Dist. restrs. and SS energy: 1.405 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1510.964941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.964941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1549.876008 (E_RNA) where: Base-Base interactions energy: -1107.923 where: short stacking energy: -464.051 Base-Backbone interact. energy: 1.109 local terms energy: -443.062148 where: bonds (distance) C4'-P energy: -86.908 bonds (distance) P-C4' energy: -75.812 flat angles C4'-P-C4' energy: -91.355 flat angles P-C4'-P energy: -57.913 tors. eta vs tors. theta energy: -131.075 Dist. restrs. and SS energy: 2.161 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1554.627624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.627624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.692092 (E_RNA) where: Base-Base interactions energy: -1147.785 where: short stacking energy: -470.026 Base-Backbone interact. energy: 1.710 local terms energy: -446.617641 where: bonds (distance) C4'-P energy: -81.836 bonds (distance) P-C4' energy: -82.257 flat angles C4'-P-C4' energy: -94.997 flat angles P-C4'-P energy: -55.134 tors. eta vs tors. theta energy: -132.393 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1424.422061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.422061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.656529 (E_RNA) where: Base-Base interactions energy: -1051.510 where: short stacking energy: -437.632 Base-Backbone interact. energy: -0.579 local terms energy: -410.566690 where: bonds (distance) C4'-P energy: -72.720 bonds (distance) P-C4' energy: -72.272 flat angles C4'-P-C4' energy: -99.767 flat angles P-C4'-P energy: -66.864 tors. eta vs tors. theta energy: -98.944 Dist. restrs. and SS energy: 1.484 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1375.546217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.546217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.969526 (E_RNA) where: Base-Base interactions energy: -1028.559 where: short stacking energy: -432.351 Base-Backbone interact. energy: -0.341 local terms energy: -385.069652 where: bonds (distance) C4'-P energy: -71.957 bonds (distance) P-C4' energy: -56.986 flat angles C4'-P-C4' energy: -100.597 flat angles P-C4'-P energy: -46.208 tors. eta vs tors. theta energy: -109.322 Dist. restrs. and SS energy: 1.673 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1327.428745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.428745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.797425 (E_RNA) where: Base-Base interactions energy: -993.793 where: short stacking energy: -418.486 Base-Backbone interact. energy: -0.476 local terms energy: -371.528493 where: bonds (distance) C4'-P energy: -61.677 bonds (distance) P-C4' energy: -51.636 flat angles C4'-P-C4' energy: -80.079 flat angles P-C4'-P energy: -58.375 tors. eta vs tors. theta energy: -119.761 Dist. restrs. and SS energy: 1.619 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -1328.270003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.270003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.593860 (E_RNA) where: Base-Base interactions energy: -966.325 where: short stacking energy: -411.316 Base-Backbone interact. energy: 1.791 local terms energy: -404.060045 where: bonds (distance) C4'-P energy: -75.366 bonds (distance) P-C4' energy: -67.929 flat angles C4'-P-C4' energy: -87.667 flat angles P-C4'-P energy: -59.779 tors. eta vs tors. theta energy: -113.319 Dist. restrs. and SS energy: 3.574 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1748.954677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1748.954677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.284784 (E_RNA) where: Base-Base interactions energy: -1286.893 where: short stacking energy: -510.246 Base-Backbone interact. energy: -0.818 local terms energy: -498.574481 where: bonds (distance) C4'-P energy: -93.120 bonds (distance) P-C4' energy: -94.190 flat angles C4'-P-C4' energy: -100.338 flat angles P-C4'-P energy: -68.255 tors. eta vs tors. theta energy: -142.671 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1698.453212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1698.453212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.005069 (E_RNA) where: Base-Base interactions energy: -1243.557 where: short stacking energy: -509.614 Base-Backbone interact. energy: -1.716 local terms energy: -490.732240 where: bonds (distance) C4'-P energy: -84.519 bonds (distance) P-C4' energy: -99.474 flat angles C4'-P-C4' energy: -105.272 flat angles P-C4'-P energy: -56.505 tors. eta vs tors. theta energy: -144.961 Dist. restrs. and SS energy: 0.802 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1637.239933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.239933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.081773 (E_RNA) where: Base-Base interactions energy: -1160.973 where: short stacking energy: -499.925 Base-Backbone interact. energy: -1.010 local terms energy: -513.098548 where: bonds (distance) C4'-P energy: -92.974 bonds (distance) P-C4' energy: -88.019 flat angles C4'-P-C4' energy: -107.775 flat angles P-C4'-P energy: -74.788 tors. eta vs tors. theta energy: -149.543 Dist. restrs. and SS energy: 1.092 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1599.246841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.246841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.545948 (E_RNA) where: Base-Base interactions energy: -1156.691 where: short stacking energy: -482.171 Base-Backbone interact. energy: -2.202 local terms energy: -479.652719 where: bonds (distance) C4'-P energy: -88.981 bonds (distance) P-C4' energy: -84.626 flat angles C4'-P-C4' energy: -96.239 flat angles P-C4'-P energy: -70.077 tors. eta vs tors. theta energy: -139.729 Dist. restrs. and SS energy: 2.549 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1552.242593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.242593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.872613 (E_RNA) where: Base-Base interactions energy: -1141.530 where: short stacking energy: -457.846 Base-Backbone interact. energy: -1.642 local terms energy: -447.701069 where: bonds (distance) C4'-P energy: -78.034 bonds (distance) P-C4' energy: -84.113 flat angles C4'-P-C4' energy: -96.320 flat angles P-C4'-P energy: -63.610 tors. eta vs tors. theta energy: -125.625 Dist. restrs. and SS energy: 1.880 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1464.693264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.693264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1503.179835 (E_RNA) where: Base-Base interactions energy: -1073.851 where: short stacking energy: -449.301 Base-Backbone interact. energy: -0.909 local terms energy: -428.420313 where: bonds (distance) C4'-P energy: -86.050 bonds (distance) P-C4' energy: -77.089 flat angles C4'-P-C4' energy: -95.187 flat angles P-C4'-P energy: -51.922 tors. eta vs tors. theta energy: -118.172 Dist. restrs. and SS energy: 1.737 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1429.868513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.868513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.446095 (E_RNA) where: Base-Base interactions energy: -1039.650 where: short stacking energy: -437.834 Base-Backbone interact. energy: -1.518 local terms energy: -428.278283 where: bonds (distance) C4'-P energy: -76.312 bonds (distance) P-C4' energy: -73.365 flat angles C4'-P-C4' energy: -98.734 flat angles P-C4'-P energy: -57.206 tors. eta vs tors. theta energy: -122.661 Dist. restrs. and SS energy: 2.828 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1378.372172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.372172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.214180 (E_RNA) where: Base-Base interactions energy: -1014.047 where: short stacking energy: -410.673 Base-Backbone interact. energy: 5.355 local terms energy: -407.522067 where: bonds (distance) C4'-P energy: -74.862 bonds (distance) P-C4' energy: -81.018 flat angles C4'-P-C4' energy: -89.918 flat angles P-C4'-P energy: -55.583 tors. eta vs tors. theta energy: -106.141 Dist. restrs. and SS energy: 1.092 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1370.252831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.252831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.909858 (E_RNA) where: Base-Base interactions energy: -1001.893 where: short stacking energy: -404.815 Base-Backbone interact. energy: -0.730 local terms energy: -405.286741 where: bonds (distance) C4'-P energy: -74.188 bonds (distance) P-C4' energy: -77.677 flat angles C4'-P-C4' energy: -92.863 flat angles P-C4'-P energy: -53.569 tors. eta vs tors. theta energy: -106.990 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -1297.808648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.808648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.553056 (E_RNA) where: Base-Base interactions energy: -953.245 where: short stacking energy: -400.744 Base-Backbone interact. energy: -2.537 local terms energy: -380.770896 where: bonds (distance) C4'-P energy: -69.787 bonds (distance) P-C4' energy: -68.043 flat angles C4'-P-C4' energy: -79.356 flat angles P-C4'-P energy: -56.411 tors. eta vs tors. theta energy: -107.174 Dist. restrs. and SS energy: 1.994 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1776.190523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.190523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1814.056483 (E_RNA) where: Base-Base interactions energy: -1326.056 where: short stacking energy: -521.671 Base-Backbone interact. energy: -1.879 local terms energy: -486.121106 where: bonds (distance) C4'-P energy: -93.652 bonds (distance) P-C4' energy: -83.482 flat angles C4'-P-C4' energy: -97.997 flat angles P-C4'-P energy: -64.083 tors. eta vs tors. theta energy: -146.907 Dist. restrs. and SS energy: 1.116 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1691.272397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1691.272397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.950712 (E_RNA) where: Base-Base interactions energy: -1221.835 where: short stacking energy: -518.376 Base-Backbone interact. energy: -0.261 local terms energy: -506.854803 where: bonds (distance) C4'-P energy: -99.134 bonds (distance) P-C4' energy: -89.865 flat angles C4'-P-C4' energy: -100.318 flat angles P-C4'-P energy: -70.473 tors. eta vs tors. theta energy: -147.064 Dist. restrs. and SS energy: 0.928 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1661.059595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1661.059595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1698.541358 (E_RNA) where: Base-Base interactions energy: -1205.068 where: short stacking energy: -494.657 Base-Backbone interact. energy: -2.972 local terms energy: -490.501432 where: bonds (distance) C4'-P energy: -92.849 bonds (distance) P-C4' energy: -94.941 flat angles C4'-P-C4' energy: -102.195 flat angles P-C4'-P energy: -70.120 tors. eta vs tors. theta energy: -130.396 Dist. restrs. and SS energy: 0.732 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1581.714984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.714984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.532683 (E_RNA) where: Base-Base interactions energy: -1168.370 where: short stacking energy: -473.733 Base-Backbone interact. energy: -3.049 local terms energy: -448.113396 where: bonds (distance) C4'-P energy: -84.404 bonds (distance) P-C4' energy: -90.104 flat angles C4'-P-C4' energy: -88.737 flat angles P-C4'-P energy: -63.161 tors. eta vs tors. theta energy: -121.708 Dist. restrs. and SS energy: 1.068 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1539.564613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.564613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1577.900492 (E_RNA) where: Base-Base interactions energy: -1111.424 where: short stacking energy: -468.622 Base-Backbone interact. energy: -1.326 local terms energy: -465.149748 where: bonds (distance) C4'-P energy: -89.635 bonds (distance) P-C4' energy: -80.429 flat angles C4'-P-C4' energy: -93.995 flat angles P-C4'-P energy: -68.721 tors. eta vs tors. theta energy: -132.370 Dist. restrs. and SS energy: 1.586 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1462.668215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.668215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.828255 (E_RNA) where: Base-Base interactions energy: -1069.405 where: short stacking energy: -444.326 Base-Backbone interact. energy: -0.626 local terms energy: -430.797106 where: bonds (distance) C4'-P energy: -78.279 bonds (distance) P-C4' energy: -84.171 flat angles C4'-P-C4' energy: -99.215 flat angles P-C4'-P energy: -60.494 tors. eta vs tors. theta energy: -108.638 Dist. restrs. and SS energy: 1.410 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1447.258819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.258819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.005515 (E_RNA) where: Base-Base interactions energy: -1050.926 where: short stacking energy: -431.487 Base-Backbone interact. energy: 0.671 local terms energy: -434.750458 where: bonds (distance) C4'-P energy: -74.183 bonds (distance) P-C4' energy: -83.095 flat angles C4'-P-C4' energy: -88.626 flat angles P-C4'-P energy: -64.211 tors. eta vs tors. theta energy: -124.636 Dist. restrs. and SS energy: 0.997 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1390.758465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.758465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.851906 (E_RNA) where: Base-Base interactions energy: -1031.556 where: short stacking energy: -437.140 Base-Backbone interact. energy: -0.934 local terms energy: -397.361742 where: bonds (distance) C4'-P energy: -67.985 bonds (distance) P-C4' energy: -81.522 flat angles C4'-P-C4' energy: -78.637 flat angles P-C4'-P energy: -52.386 tors. eta vs tors. theta energy: -116.831 Dist. restrs. and SS energy: 2.343 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1378.681726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.681726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.467848 (E_RNA) where: Base-Base interactions energy: -1003.588 where: short stacking energy: -415.731 Base-Backbone interact. energy: 3.508 local terms energy: -416.387961 where: bonds (distance) C4'-P energy: -75.911 bonds (distance) P-C4' energy: -73.754 flat angles C4'-P-C4' energy: -87.288 flat angles P-C4'-P energy: -66.396 tors. eta vs tors. theta energy: -113.039 Dist. restrs. and SS energy: 1.036 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -1282.541619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.541619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.132748 (E_RNA) where: Base-Base interactions energy: -943.229 where: short stacking energy: -391.092 Base-Backbone interact. energy: -0.472 local terms energy: -378.432391 where: bonds (distance) C4'-P energy: -70.281 bonds (distance) P-C4' energy: -73.947 flat angles C4'-P-C4' energy: -85.998 flat angles P-C4'-P energy: -47.492 tors. eta vs tors. theta energy: -100.714 Dist. restrs. and SS energy: 2.841 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1748.573981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1748.573981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.293923 (E_RNA) where: Base-Base interactions energy: -1285.169 where: short stacking energy: -505.794 Base-Backbone interact. energy: -0.853 local terms energy: -500.272357 where: bonds (distance) C4'-P energy: -86.629 bonds (distance) P-C4' energy: -99.489 flat angles C4'-P-C4' energy: -103.294 flat angles P-C4'-P energy: -74.437 tors. eta vs tors. theta energy: -136.423 Dist. restrs. and SS energy: 0.970 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1687.998715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.998715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.565475 (E_RNA) where: Base-Base interactions energy: -1232.834 where: short stacking energy: -509.165 Base-Backbone interact. energy: -1.847 local terms energy: -490.884845 where: bonds (distance) C4'-P energy: -96.417 bonds (distance) P-C4' energy: -82.442 flat angles C4'-P-C4' energy: -103.789 flat angles P-C4'-P energy: -56.894 tors. eta vs tors. theta energy: -151.342 Dist. restrs. and SS energy: 0.817 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1652.609438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.609438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.103744 (E_RNA) where: Base-Base interactions energy: -1207.530 where: short stacking energy: -498.148 Base-Backbone interact. energy: 1.887 local terms energy: -484.460728 where: bonds (distance) C4'-P energy: -84.459 bonds (distance) P-C4' energy: -92.875 flat angles C4'-P-C4' energy: -99.204 flat angles P-C4'-P energy: -68.795 tors. eta vs tors. theta energy: -139.128 Dist. restrs. and SS energy: 0.744 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1587.218139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1587.218139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.212367 (E_RNA) where: Base-Base interactions energy: -1149.560 where: short stacking energy: -475.936 Base-Backbone interact. energy: -1.002 local terms energy: -474.649749 where: bonds (distance) C4'-P energy: -84.195 bonds (distance) P-C4' energy: -94.472 flat angles C4'-P-C4' energy: -95.876 flat angles P-C4'-P energy: -62.691 tors. eta vs tors. theta energy: -137.415 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1514.012498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.012498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.742013 (E_RNA) where: Base-Base interactions energy: -1104.526 where: short stacking energy: -450.651 Base-Backbone interact. energy: -1.214 local terms energy: -446.002080 where: bonds (distance) C4'-P energy: -66.680 bonds (distance) P-C4' energy: -81.051 flat angles C4'-P-C4' energy: -106.491 flat angles P-C4'-P energy: -67.877 tors. eta vs tors. theta energy: -123.903 Dist. restrs. and SS energy: 0.980 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1475.979737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.979737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.636121 (E_RNA) where: Base-Base interactions energy: -1082.336 where: short stacking energy: -444.400 Base-Backbone interact. energy: -1.374 local terms energy: -430.926213 where: bonds (distance) C4'-P energy: -88.834 bonds (distance) P-C4' energy: -69.463 flat angles C4'-P-C4' energy: -94.196 flat angles P-C4'-P energy: -61.638 tors. eta vs tors. theta energy: -116.795 Dist. restrs. and SS energy: 1.906 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1442.917601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.917601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.706310 (E_RNA) where: Base-Base interactions energy: -1056.337 where: short stacking energy: -431.588 Base-Backbone interact. energy: -1.277 local terms energy: -423.092125 where: bonds (distance) C4'-P energy: -78.566 bonds (distance) P-C4' energy: -73.316 flat angles C4'-P-C4' energy: -101.690 flat angles P-C4'-P energy: -50.040 tors. eta vs tors. theta energy: -119.480 Dist. restrs. and SS energy: 1.039 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1401.192964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.192964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.697811 (E_RNA) where: Base-Base interactions energy: -1016.627 where: short stacking energy: -404.953 Base-Backbone interact. energy: -2.007 local terms energy: -421.063337 where: bonds (distance) C4'-P energy: -76.188 bonds (distance) P-C4' energy: -78.431 flat angles C4'-P-C4' energy: -97.368 flat angles P-C4'-P energy: -58.793 tors. eta vs tors. theta energy: -110.283 Dist. restrs. and SS energy: 1.755 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1357.704113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.704113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1396.930148 (E_RNA) where: Base-Base interactions energy: -998.609 where: short stacking energy: -387.244 Base-Backbone interact. energy: -1.512 local terms energy: -396.809043 where: bonds (distance) C4'-P energy: -71.370 bonds (distance) P-C4' energy: -79.809 flat angles C4'-P-C4' energy: -84.254 flat angles P-C4'-P energy: -61.086 tors. eta vs tors. theta energy: -100.290 Dist. restrs. and SS energy: 2.476 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -1289.242451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.242451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.820974 (E_RNA) where: Base-Base interactions energy: -934.454 where: short stacking energy: -387.664 Base-Backbone interact. energy: -0.975 local terms energy: -393.392210 where: bonds (distance) C4'-P energy: -71.573 bonds (distance) P-C4' energy: -70.907 flat angles C4'-P-C4' energy: -81.886 flat angles P-C4'-P energy: -53.099 tors. eta vs tors. theta energy: -115.928 Dist. restrs. and SS energy: 2.829 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1746.962704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1746.962704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.564738 (E_RNA) where: Base-Base interactions energy: -1307.526 where: short stacking energy: -519.746 Base-Backbone interact. energy: 3.016 local terms energy: -480.055434 where: bonds (distance) C4'-P energy: -88.853 bonds (distance) P-C4' energy: -86.151 flat angles C4'-P-C4' energy: -108.134 flat angles P-C4'-P energy: -55.956 tors. eta vs tors. theta energy: -140.961 Dist. restrs. and SS energy: 0.852 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1695.067279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1695.067279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.616885 (E_RNA) where: Base-Base interactions energy: -1233.423 where: short stacking energy: -521.676 Base-Backbone interact. energy: -1.940 local terms energy: -497.253221 where: bonds (distance) C4'-P energy: -89.135 bonds (distance) P-C4' energy: -86.862 flat angles C4'-P-C4' energy: -108.165 flat angles P-C4'-P energy: -66.264 tors. eta vs tors. theta energy: -146.827 Dist. restrs. and SS energy: 0.800 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1639.108718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.108718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1676.652882 (E_RNA) where: Base-Base interactions energy: -1199.209 where: short stacking energy: -487.705 Base-Backbone interact. energy: -0.196 local terms energy: -477.248382 where: bonds (distance) C4'-P energy: -84.450 bonds (distance) P-C4' energy: -95.161 flat angles C4'-P-C4' energy: -94.456 flat angles P-C4'-P energy: -63.483 tors. eta vs tors. theta energy: -139.698 Dist. restrs. and SS energy: 0.794 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1594.277095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.277095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.844314 (E_RNA) where: Base-Base interactions energy: -1170.466 where: short stacking energy: -478.242 Base-Backbone interact. energy: -0.336 local terms energy: -461.042077 where: bonds (distance) C4'-P energy: -81.950 bonds (distance) P-C4' energy: -81.917 flat angles C4'-P-C4' energy: -91.989 flat angles P-C4'-P energy: -68.167 tors. eta vs tors. theta energy: -137.019 Dist. restrs. and SS energy: 0.817 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1525.156096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.156096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1562.838673 (E_RNA) where: Base-Base interactions energy: -1100.756 where: short stacking energy: -462.746 Base-Backbone interact. energy: -1.604 local terms energy: -460.478639 where: bonds (distance) C4'-P energy: -90.420 bonds (distance) P-C4' energy: -80.149 flat angles C4'-P-C4' energy: -90.842 flat angles P-C4'-P energy: -65.773 tors. eta vs tors. theta energy: -133.296 Dist. restrs. and SS energy: 0.933 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1480.673396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.673396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.416853 (E_RNA) where: Base-Base interactions energy: -1070.938 where: short stacking energy: -458.734 Base-Backbone interact. energy: -0.380 local terms energy: -448.099514 where: bonds (distance) C4'-P energy: -80.361 bonds (distance) P-C4' energy: -82.820 flat angles C4'-P-C4' energy: -103.199 flat angles P-C4'-P energy: -58.064 tors. eta vs tors. theta energy: -123.656 Dist. restrs. and SS energy: 1.993 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1450.916340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.916340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.306745 (E_RNA) where: Base-Base interactions energy: -1047.812 where: short stacking energy: -428.119 Base-Backbone interact. energy: -1.828 local terms energy: -439.666304 where: bonds (distance) C4'-P energy: -64.686 bonds (distance) P-C4' energy: -89.969 flat angles C4'-P-C4' energy: -98.631 flat angles P-C4'-P energy: -63.079 tors. eta vs tors. theta energy: -123.301 Dist. restrs. and SS energy: 1.640 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1374.669111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.669111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.514104 (E_RNA) where: Base-Base interactions energy: -1022.494 where: short stacking energy: -419.704 Base-Backbone interact. energy: -1.026 local terms energy: -389.993676 where: bonds (distance) C4'-P energy: -70.634 bonds (distance) P-C4' energy: -69.739 flat angles C4'-P-C4' energy: -81.800 flat angles P-C4'-P energy: -54.972 tors. eta vs tors. theta energy: -112.849 Dist. restrs. and SS energy: 2.095 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1360.203449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.203449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.876742 (E_RNA) where: Base-Base interactions energy: -1011.079 where: short stacking energy: -410.960 Base-Backbone interact. energy: -1.324 local terms energy: -386.474710 where: bonds (distance) C4'-P energy: -64.916 bonds (distance) P-C4' energy: -78.083 flat angles C4'-P-C4' energy: -84.065 flat angles P-C4'-P energy: -43.452 tors. eta vs tors. theta energy: -115.959 Dist. restrs. and SS energy: 1.923 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -1332.788478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.788478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.055812 (E_RNA) where: Base-Base interactions energy: -972.729 where: short stacking energy: -388.531 Base-Backbone interact. energy: -2.357 local terms energy: -396.969687 where: bonds (distance) C4'-P energy: -75.995 bonds (distance) P-C4' energy: -79.906 flat angles C4'-P-C4' energy: -74.005 flat angles P-C4'-P energy: -64.828 tors. eta vs tors. theta energy: -102.235 Dist. restrs. and SS energy: 2.517 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1740.043106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1740.043106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.302284 (E_RNA) where: Base-Base interactions energy: -1289.405 where: short stacking energy: -500.850 Base-Backbone interact. energy: -0.975 local terms energy: -486.922039 where: bonds (distance) C4'-P energy: -89.307 bonds (distance) P-C4' energy: -91.941 flat angles C4'-P-C4' energy: -94.798 flat angles P-C4'-P energy: -73.933 tors. eta vs tors. theta energy: -136.943 Dist. restrs. and SS energy: 0.509 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1674.830842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.830842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.272687 (E_RNA) where: Base-Base interactions energy: -1192.090 where: short stacking energy: -492.158 Base-Backbone interact. energy: -2.384 local terms energy: -517.799022 where: bonds (distance) C4'-P energy: -104.042 bonds (distance) P-C4' energy: -92.852 flat angles C4'-P-C4' energy: -109.145 flat angles P-C4'-P energy: -68.372 tors. eta vs tors. theta energy: -143.388 Dist. restrs. and SS energy: 0.692 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1637.867299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1637.867299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.781837 (E_RNA) where: Base-Base interactions energy: -1211.923 where: short stacking energy: -502.989 Base-Backbone interact. energy: 0.387 local terms energy: -464.245041 where: bonds (distance) C4'-P energy: -69.506 bonds (distance) P-C4' energy: -86.314 flat angles C4'-P-C4' energy: -104.593 flat angles P-C4'-P energy: -65.554 tors. eta vs tors. theta energy: -138.277 Dist. restrs. and SS energy: 1.165 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1571.665532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.665532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.526760 (E_RNA) where: Base-Base interactions energy: -1143.614 where: short stacking energy: -468.433 Base-Backbone interact. energy: -1.766 local terms energy: -464.146668 where: bonds (distance) C4'-P energy: -89.763 bonds (distance) P-C4' energy: -74.212 flat angles C4'-P-C4' energy: -101.748 flat angles P-C4'-P energy: -67.288 tors. eta vs tors. theta energy: -131.135 Dist. restrs. and SS energy: 1.111 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1528.160407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1528.160407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.768374 (E_RNA) where: Base-Base interactions energy: -1123.986 where: short stacking energy: -478.217 Base-Backbone interact. energy: -0.703 local terms energy: -441.079792 where: bonds (distance) C4'-P energy: -72.183 bonds (distance) P-C4' energy: -70.706 flat angles C4'-P-C4' energy: -106.757 flat angles P-C4'-P energy: -64.035 tors. eta vs tors. theta energy: -127.399 Dist. restrs. and SS energy: 0.858 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1469.930739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.930739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.315032 (E_RNA) where: Base-Base interactions energy: -1067.363 where: short stacking energy: -450.508 Base-Backbone interact. energy: 4.301 local terms energy: -445.252838 where: bonds (distance) C4'-P energy: -81.678 bonds (distance) P-C4' energy: -74.614 flat angles C4'-P-C4' energy: -96.792 flat angles P-C4'-P energy: -58.628 tors. eta vs tors. theta energy: -133.541 Dist. restrs. and SS energy: 1.634 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -1443.724978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.724978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.673756 (E_RNA) where: Base-Base interactions energy: -1077.065 where: short stacking energy: -453.417 Base-Backbone interact. energy: -0.697 local terms energy: -405.911461 where: bonds (distance) C4'-P energy: -62.415 bonds (distance) P-C4' energy: -72.007 flat angles C4'-P-C4' energy: -90.344 flat angles P-C4'-P energy: -55.293 tors. eta vs tors. theta energy: -125.851 Dist. restrs. and SS energy: 3.199 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -1392.663098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.663098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.785104 (E_RNA) where: Base-Base interactions energy: -1000.633 where: short stacking energy: -427.815 Base-Backbone interact. energy: 0.534 local terms energy: -431.686070 where: bonds (distance) C4'-P energy: -91.310 bonds (distance) P-C4' energy: -72.372 flat angles C4'-P-C4' energy: -89.272 flat angles P-C4'-P energy: -62.349 tors. eta vs tors. theta energy: -116.383 Dist. restrs. and SS energy: 2.372 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1380.058387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.058387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.758187 (E_RNA) where: Base-Base interactions energy: -1010.709 where: short stacking energy: -404.246 Base-Backbone interact. energy: -1.159 local terms energy: -405.890816 where: bonds (distance) C4'-P energy: -75.246 bonds (distance) P-C4' energy: -60.044 flat angles C4'-P-C4' energy: -93.560 flat angles P-C4'-P energy: -55.341 tors. eta vs tors. theta energy: -121.699 Dist. restrs. and SS energy: 0.950 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -1382.853886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.853886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.771658 (E_RNA) where: Base-Base interactions energy: -1017.007 where: short stacking energy: -421.645 Base-Backbone interact. energy: 0.608 local terms energy: -404.372073 where: bonds (distance) C4'-P energy: -69.463 bonds (distance) P-C4' energy: -81.116 flat angles C4'-P-C4' energy: -92.921 flat angles P-C4'-P energy: -50.399 tors. eta vs tors. theta energy: -110.473 Dist. restrs. and SS energy: 1.168 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1744.452466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1744.452466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1782.020489 (E_RNA) where: Base-Base interactions energy: -1282.128 where: short stacking energy: -517.017 Base-Backbone interact. energy: 0.687 local terms energy: -500.579026 where: bonds (distance) C4'-P energy: -87.562 bonds (distance) P-C4' energy: -89.068 flat angles C4'-P-C4' energy: -105.727 flat angles P-C4'-P energy: -74.859 tors. eta vs tors. theta energy: -143.363 Dist. restrs. and SS energy: 0.818 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1686.638325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.638325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.529686 (E_RNA) where: Base-Base interactions energy: -1224.480 where: short stacking energy: -515.168 Base-Backbone interact. energy: -0.798 local terms energy: -499.252040 where: bonds (distance) C4'-P energy: -97.781 bonds (distance) P-C4' energy: -84.376 flat angles C4'-P-C4' energy: -106.338 flat angles P-C4'-P energy: -64.556 tors. eta vs tors. theta energy: -146.200 Dist. restrs. and SS energy: 1.141 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1664.452288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1664.452288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.421224 (E_RNA) where: Base-Base interactions energy: -1205.400 where: short stacking energy: -495.003 Base-Backbone interact. energy: -1.837 local terms energy: -495.184801 where: bonds (distance) C4'-P energy: -85.571 bonds (distance) P-C4' energy: -90.929 flat angles C4'-P-C4' energy: -109.338 flat angles P-C4'-P energy: -73.707 tors. eta vs tors. theta energy: -135.640 Dist. restrs. and SS energy: 1.219 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1591.086027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1591.086027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.360660 (E_RNA) where: Base-Base interactions energy: -1143.727 where: short stacking energy: -470.732 Base-Backbone interact. energy: -1.029 local terms energy: -484.604435 where: bonds (distance) C4'-P energy: -90.749 bonds (distance) P-C4' energy: -81.482 flat angles C4'-P-C4' energy: -103.715 flat angles P-C4'-P energy: -75.765 tors. eta vs tors. theta energy: -132.895 Dist. restrs. and SS energy: 1.525 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1562.727294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.727294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.729436 (E_RNA) where: Base-Base interactions energy: -1128.518 where: short stacking energy: -458.605 Base-Backbone interact. energy: -1.646 local terms energy: -470.565250 where: bonds (distance) C4'-P energy: -81.489 bonds (distance) P-C4' energy: -78.944 flat angles C4'-P-C4' energy: -106.914 flat angles P-C4'-P energy: -67.764 tors. eta vs tors. theta energy: -135.455 Dist. restrs. and SS energy: 1.252 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1461.706864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.706864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1499.978913 (E_RNA) where: Base-Base interactions energy: -1058.252 where: short stacking energy: -441.474 Base-Backbone interact. energy: 1.196 local terms energy: -442.923168 where: bonds (distance) C4'-P energy: -84.839 bonds (distance) P-C4' energy: -91.461 flat angles C4'-P-C4' energy: -87.619 flat angles P-C4'-P energy: -54.898 tors. eta vs tors. theta energy: -124.106 Dist. restrs. and SS energy: 1.522 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1469.962750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.962750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.052719 (E_RNA) where: Base-Base interactions energy: -1061.518 where: short stacking energy: -440.412 Base-Backbone interact. energy: -1.664 local terms energy: -444.870275 where: bonds (distance) C4'-P energy: -78.586 bonds (distance) P-C4' energy: -76.300 flat angles C4'-P-C4' energy: -98.076 flat angles P-C4'-P energy: -71.054 tors. eta vs tors. theta energy: -120.853 Dist. restrs. and SS energy: 1.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1392.869008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.869008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.085503 (E_RNA) where: Base-Base interactions energy: -1025.473 where: short stacking energy: -411.717 Base-Backbone interact. energy: 3.556 local terms energy: -409.168357 where: bonds (distance) C4'-P energy: -74.400 bonds (distance) P-C4' energy: -64.477 flat angles C4'-P-C4' energy: -103.637 flat angles P-C4'-P energy: -53.670 tors. eta vs tors. theta energy: -112.985 Dist. restrs. and SS energy: 1.466 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1380.664528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1380.664528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.254539 (E_RNA) where: Base-Base interactions energy: -1018.897 where: short stacking energy: -414.267 Base-Backbone interact. energy: -1.445 local terms energy: -398.913250 where: bonds (distance) C4'-P energy: -52.496 bonds (distance) P-C4' energy: -87.698 flat angles C4'-P-C4' energy: -95.809 flat angles P-C4'-P energy: -53.499 tors. eta vs tors. theta energy: -109.411 Dist. restrs. and SS energy: 1.840 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -1337.489977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1337.489977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.489419 (E_RNA) where: Base-Base interactions energy: -981.522 where: short stacking energy: -384.118 Base-Backbone interact. energy: -0.757 local terms energy: -396.210346 where: bonds (distance) C4'-P energy: -75.304 bonds (distance) P-C4' energy: -79.583 flat angles C4'-P-C4' energy: -81.585 flat angles P-C4'-P energy: -47.199 tors. eta vs tors. theta energy: -112.539 Dist. restrs. and SS energy: 4.249 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1740.691206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1740.691206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1778.360224 (E_RNA) where: Base-Base interactions energy: -1286.786 where: short stacking energy: -530.880 Base-Backbone interact. energy: -1.105 local terms energy: -490.468887 where: bonds (distance) C4'-P energy: -95.359 bonds (distance) P-C4' energy: -86.587 flat angles C4'-P-C4' energy: -95.291 flat angles P-C4'-P energy: -66.026 tors. eta vs tors. theta energy: -147.206 Dist. restrs. and SS energy: 0.919 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1687.776531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.776531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.267093 (E_RNA) where: Base-Base interactions energy: -1219.490 where: short stacking energy: -515.490 Base-Backbone interact. energy: -0.701 local terms energy: -505.075413 where: bonds (distance) C4'-P energy: -94.433 bonds (distance) P-C4' energy: -81.773 flat angles C4'-P-C4' energy: -103.753 flat angles P-C4'-P energy: -75.506 tors. eta vs tors. theta energy: -149.611 Dist. restrs. and SS energy: 0.741 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1664.453587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1664.453587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.432008 (E_RNA) where: Base-Base interactions energy: -1214.020 where: short stacking energy: -517.054 Base-Backbone interact. energy: -0.920 local terms energy: -487.491858 where: bonds (distance) C4'-P energy: -73.875 bonds (distance) P-C4' energy: -97.361 flat angles C4'-P-C4' energy: -101.738 flat angles P-C4'-P energy: -68.972 tors. eta vs tors. theta energy: -145.546 Dist. restrs. and SS energy: 1.228 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1564.234312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.234312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.329284 (E_RNA) where: Base-Base interactions energy: -1135.919 where: short stacking energy: -471.939 Base-Backbone interact. energy: 0.678 local terms energy: -468.088566 where: bonds (distance) C4'-P energy: -82.266 bonds (distance) P-C4' energy: -85.943 flat angles C4'-P-C4' energy: -100.459 flat angles P-C4'-P energy: -72.066 tors. eta vs tors. theta energy: -127.355 Dist. restrs. and SS energy: 2.345 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -1548.275902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.275902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.365625 (E_RNA) where: Base-Base interactions energy: -1113.365 where: short stacking energy: -469.139 Base-Backbone interact. energy: -2.902 local terms energy: -470.098731 where: bonds (distance) C4'-P energy: -84.625 bonds (distance) P-C4' energy: -73.965 flat angles C4'-P-C4' energy: -99.658 flat angles P-C4'-P energy: -64.791 tors. eta vs tors. theta energy: -147.060 Dist. restrs. and SS energy: 1.340 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1456.373687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.373687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1493.897419 (E_RNA) where: Base-Base interactions energy: -1053.650 where: short stacking energy: -429.813 Base-Backbone interact. energy: -1.044 local terms energy: -439.202924 where: bonds (distance) C4'-P energy: -82.180 bonds (distance) P-C4' energy: -73.353 flat angles C4'-P-C4' energy: -99.521 flat angles P-C4'-P energy: -54.962 tors. eta vs tors. theta energy: -129.186 Dist. restrs. and SS energy: 0.774 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -1436.766944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.766944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.140572 (E_RNA) where: Base-Base interactions energy: -1052.871 where: short stacking energy: -440.655 Base-Backbone interact. energy: -2.304 local terms energy: -419.965643 where: bonds (distance) C4'-P energy: -81.963 bonds (distance) P-C4' energy: -65.576 flat angles C4'-P-C4' energy: -85.255 flat angles P-C4'-P energy: -61.402 tors. eta vs tors. theta energy: -125.769 Dist. restrs. and SS energy: 1.624 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1401.966005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.966005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.905558 (E_RNA) where: Base-Base interactions energy: -1005.296 where: short stacking energy: -392.954 Base-Backbone interact. energy: 1.436 local terms energy: -436.045501 where: bonds (distance) C4'-P energy: -81.184 bonds (distance) P-C4' energy: -88.245 flat angles C4'-P-C4' energy: -88.765 flat angles P-C4'-P energy: -67.456 tors. eta vs tors. theta energy: -110.396 Dist. restrs. and SS energy: 1.190 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1393.395310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.395310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.124008 (E_RNA) where: Base-Base interactions energy: -1022.290 where: short stacking energy: -414.264 Base-Backbone interact. energy: 2.412 local terms energy: -411.245681 where: bonds (distance) C4'-P energy: -73.087 bonds (distance) P-C4' energy: -86.297 flat angles C4'-P-C4' energy: -79.779 flat angles P-C4'-P energy: -55.667 tors. eta vs tors. theta energy: -116.415 Dist. restrs. and SS energy: 0.979 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -1328.609575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.609575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.941338 (E_RNA) where: Base-Base interactions energy: -980.425 where: short stacking energy: -394.434 Base-Backbone interact. energy: -1.324 local terms energy: -386.192477 where: bonds (distance) C4'-P energy: -80.189 bonds (distance) P-C4' energy: -67.491 flat angles C4'-P-C4' energy: -70.532 flat angles P-C4'-P energy: -64.955 tors. eta vs tors. theta energy: -103.025 Dist. restrs. and SS energy: 2.582 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1726.427396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.427396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.338217 (E_RNA) where: Base-Base interactions energy: -1274.362 where: short stacking energy: -520.831 Base-Backbone interact. energy: -0.126 local terms energy: -489.849797 where: bonds (distance) C4'-P energy: -88.723 bonds (distance) P-C4' energy: -83.812 flat angles C4'-P-C4' energy: -105.033 flat angles P-C4'-P energy: -73.322 tors. eta vs tors. theta energy: -138.959 Dist. restrs. and SS energy: 1.161 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1652.031366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.031366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.913610 (E_RNA) where: Base-Base interactions energy: -1193.524 where: short stacking energy: -510.028 Base-Backbone interact. energy: -2.269 local terms energy: -494.120418 where: bonds (distance) C4'-P energy: -80.328 bonds (distance) P-C4' energy: -85.455 flat angles C4'-P-C4' energy: -111.831 flat angles P-C4'-P energy: -75.891 tors. eta vs tors. theta energy: -140.614 Dist. restrs. and SS energy: 1.132 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1645.299249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.299249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.956667 (E_RNA) where: Base-Base interactions energy: -1185.246 where: short stacking energy: -488.051 Base-Backbone interact. energy: -1.430 local terms energy: -496.281060 where: bonds (distance) C4'-P energy: -91.007 bonds (distance) P-C4' energy: -98.781 flat angles C4'-P-C4' energy: -96.535 flat angles P-C4'-P energy: -73.908 tors. eta vs tors. theta energy: -136.050 Dist. restrs. and SS energy: 0.907 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1598.619429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.619429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1636.456664 (E_RNA) where: Base-Base interactions energy: -1162.540 where: short stacking energy: -482.389 Base-Backbone interact. energy: 1.003 local terms energy: -474.919551 where: bonds (distance) C4'-P energy: -72.226 bonds (distance) P-C4' energy: -96.279 flat angles C4'-P-C4' energy: -98.447 flat angles P-C4'-P energy: -63.741 tors. eta vs tors. theta energy: -144.227 Dist. restrs. and SS energy: 1.087 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -1562.742132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1562.742132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1600.348176 (E_RNA) where: Base-Base interactions energy: -1128.063 where: short stacking energy: -472.126 Base-Backbone interact. energy: 0.627 local terms energy: -472.911341 where: bonds (distance) C4'-P energy: -88.894 bonds (distance) P-C4' energy: -84.003 flat angles C4'-P-C4' energy: -99.728 flat angles P-C4'-P energy: -60.907 tors. eta vs tors. theta energy: -139.379 Dist. restrs. and SS energy: 0.856 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1489.888261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.888261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1528.755109 (E_RNA) where: Base-Base interactions energy: -1076.704 where: short stacking energy: -449.154 Base-Backbone interact. energy: 1.546 local terms energy: -453.596185 where: bonds (distance) C4'-P energy: -80.426 bonds (distance) P-C4' energy: -83.982 flat angles C4'-P-C4' energy: -94.431 flat angles P-C4'-P energy: -67.159 tors. eta vs tors. theta energy: -127.599 Dist. restrs. and SS energy: 2.117 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1456.053177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.053177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.380749 (E_RNA) where: Base-Base interactions energy: -1058.396 where: short stacking energy: -449.846 Base-Backbone interact. energy: -1.774 local terms energy: -434.211385 where: bonds (distance) C4'-P energy: -82.938 bonds (distance) P-C4' energy: -76.087 flat angles C4'-P-C4' energy: -88.205 flat angles P-C4'-P energy: -52.909 tors. eta vs tors. theta energy: -134.072 Dist. restrs. and SS energy: 1.578 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1411.262947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.262947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.483768 (E_RNA) where: Base-Base interactions energy: -1036.164 where: short stacking energy: -417.043 Base-Backbone interact. energy: -0.807 local terms energy: -412.512510 where: bonds (distance) C4'-P energy: -76.247 bonds (distance) P-C4' energy: -79.313 flat angles C4'-P-C4' energy: -92.580 flat angles P-C4'-P energy: -42.107 tors. eta vs tors. theta energy: -122.265 Dist. restrs. and SS energy: 1.471 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1344.393932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.393932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.884836 (E_RNA) where: Base-Base interactions energy: -981.068 where: short stacking energy: -397.206 Base-Backbone interact. energy: -1.562 local terms energy: -401.255111 where: bonds (distance) C4'-P energy: -72.372 bonds (distance) P-C4' energy: -80.485 flat angles C4'-P-C4' energy: -96.118 flat angles P-C4'-P energy: -48.676 tors. eta vs tors. theta energy: -103.605 Dist. restrs. and SS energy: 2.741 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -1351.448215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.448215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.332673 (E_RNA) where: Base-Base interactions energy: -983.115 where: short stacking energy: -367.771 Base-Backbone interact. energy: -1.050 local terms energy: -405.168140 where: bonds (distance) C4'-P energy: -72.398 bonds (distance) P-C4' energy: -73.670 flat angles C4'-P-C4' energy: -76.548 flat angles P-C4'-P energy: -62.599 tors. eta vs tors. theta energy: -119.953 Dist. restrs. and SS energy: 1.134 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1752.844897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1752.844897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1790.361493 (E_RNA) where: Base-Base interactions energy: -1294.760 where: short stacking energy: -530.927 Base-Backbone interact. energy: 3.110 local terms energy: -498.711944 where: bonds (distance) C4'-P energy: -88.620 bonds (distance) P-C4' energy: -95.475 flat angles C4'-P-C4' energy: -106.269 flat angles P-C4'-P energy: -64.294 tors. eta vs tors. theta energy: -144.054 Dist. restrs. and SS energy: 0.767 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1669.584756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.584756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.809153 (E_RNA) where: Base-Base interactions energy: -1218.650 where: short stacking energy: -514.700 Base-Backbone interact. energy: -1.669 local terms energy: -487.490427 where: bonds (distance) C4'-P energy: -81.984 bonds (distance) P-C4' energy: -89.738 flat angles C4'-P-C4' energy: -99.086 flat angles P-C4'-P energy: -68.791 tors. eta vs tors. theta energy: -147.892 Dist. restrs. and SS energy: 1.474 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1634.500448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.500448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.568270 (E_RNA) where: Base-Base interactions energy: -1187.387 where: short stacking energy: -502.890 Base-Backbone interact. energy: -1.772 local terms energy: -483.409275 where: bonds (distance) C4'-P energy: -84.796 bonds (distance) P-C4' energy: -85.936 flat angles C4'-P-C4' energy: -98.202 flat angles P-C4'-P energy: -71.108 tors. eta vs tors. theta energy: -143.367 Dist. restrs. and SS energy: 1.318 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1573.880832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.880832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.846619 (E_RNA) where: Base-Base interactions energy: -1147.532 where: short stacking energy: -487.983 Base-Backbone interact. energy: -1.049 local terms energy: -463.264791 where: bonds (distance) C4'-P energy: -92.078 bonds (distance) P-C4' energy: -82.243 flat angles C4'-P-C4' energy: -102.146 flat angles P-C4'-P energy: -52.153 tors. eta vs tors. theta energy: -134.644 Dist. restrs. and SS energy: 1.216 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -1548.983405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.983405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1587.055995 (E_RNA) where: Base-Base interactions energy: -1135.327 where: short stacking energy: -459.372 Base-Backbone interact. energy: 0.050 local terms energy: -451.779052 where: bonds (distance) C4'-P energy: -72.873 bonds (distance) P-C4' energy: -97.519 flat angles C4'-P-C4' energy: -93.827 flat angles P-C4'-P energy: -53.455 tors. eta vs tors. theta energy: -134.106 Dist. restrs. and SS energy: 1.323 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -1494.346481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.346481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.291580 (E_RNA) where: Base-Base interactions energy: -1097.809 where: short stacking energy: -456.175 Base-Backbone interact. energy: -1.361 local terms energy: -433.121423 where: bonds (distance) C4'-P energy: -62.153 bonds (distance) P-C4' energy: -81.036 flat angles C4'-P-C4' energy: -94.047 flat angles P-C4'-P energy: -63.026 tors. eta vs tors. theta energy: -132.859 Dist. restrs. and SS energy: 1.195 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1447.704994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.704994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.286679 (E_RNA) where: Base-Base interactions energy: -1042.220 where: short stacking energy: -426.951 Base-Backbone interact. energy: -0.463 local terms energy: -443.603998 where: bonds (distance) C4'-P energy: -76.638 bonds (distance) P-C4' energy: -97.829 flat angles C4'-P-C4' energy: -86.663 flat angles P-C4'-P energy: -57.386 tors. eta vs tors. theta energy: -125.088 Dist. restrs. and SS energy: 1.832 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1426.922463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.922463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.500237 (E_RNA) where: Base-Base interactions energy: -1057.500 where: short stacking energy: -438.828 Base-Backbone interact. energy: 6.374 local terms energy: -414.373820 where: bonds (distance) C4'-P energy: -63.897 bonds (distance) P-C4' energy: -70.843 flat angles C4'-P-C4' energy: -96.774 flat angles P-C4'-P energy: -58.951 tors. eta vs tors. theta energy: -123.908 Dist. restrs. and SS energy: 1.828 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -1352.615171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.615171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.759899 (E_RNA) where: Base-Base interactions energy: -1004.569 where: short stacking energy: -397.686 Base-Backbone interact. energy: -2.151 local terms energy: -385.039810 where: bonds (distance) C4'-P energy: -60.310 bonds (distance) P-C4' energy: -82.574 flat angles C4'-P-C4' energy: -86.174 flat angles P-C4'-P energy: -43.438 tors. eta vs tors. theta energy: -112.543 Dist. restrs. and SS energy: 2.395 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -1385.704079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.704079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.429046 (E_RNA) where: Base-Base interactions energy: -1016.042 where: short stacking energy: -416.602 Base-Backbone interact. energy: 0.491 local terms energy: -409.877800 where: bonds (distance) C4'-P energy: -62.488 bonds (distance) P-C4' energy: -67.430 flat angles C4'-P-C4' energy: -97.159 flat angles P-C4'-P energy: -57.296 tors. eta vs tors. theta energy: -125.504 Dist. restrs. and SS energy: 2.975 (S_DIST_RNA) chem. prob. restrs. energy: 36.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)