SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-ff786a6e/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUAUUUUUAUAUAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 88 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 445 n_atoms_counter: 445 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _......................................................................(((((((....)))))))_ nucl1: 76, chain1: 0, <---> nucl2: 81, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 81 nucl1: 75, chain1: 0, <---> nucl2: 82, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 82 nucl1: 74, chain1: 0, <---> nucl2: 83, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 74, chainIndex_2: 0, nuclIndex_2: 83 nucl1: 73, chain1: 0, <---> nucl2: 84, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 73, chainIndex_2: 0, nuclIndex_2: 84 nucl1: 72, chain1: 0, <---> nucl2: 85, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 85 nucl1: 71, chain1: 0, <---> nucl2: 86, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 86 nucl1: 70, chain1: 0, <---> nucl2: 87, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 87 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 88.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 500 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -74.499480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -74.499480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.311535 (E_RNA) where: Base-Base interactions energy: -12.545 where: short stacking energy: -12.545 Base-Backbone interact. energy: -0.000 local terms energy: -342.766230 where: bonds (distance) C4'-P energy: -85.499 bonds (distance) P-C4' energy: -79.624 flat angles C4'-P-C4' energy: -64.612 flat angles P-C4'-P energy: -73.909 tors. eta vs tors. theta energy: -39.123 Dist. restrs. and SS energy: 280.812 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) out arg RESULTS//1/RON-ff786a6e_01 DONE DONE ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -525.907627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.907627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.251555 (E_RNA) where: Base-Base interactions energy: -273.788 where: short stacking energy: -193.910 Base-Backbone interact. energy: -0.281 local terms energy: -252.182340 where: bonds (distance) C4'-P energy: -54.017 bonds (distance) P-C4' energy: -57.129 flat angles C4'-P-C4' energy: -62.589 flat angles P-C4'-P energy: -38.164 tors. eta vs tors. theta energy: -40.284 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -511.074938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.074938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.479801 (E_RNA) where: Base-Base interactions energy: -257.591 where: short stacking energy: -183.605 Base-Backbone interact. energy: -0.306 local terms energy: -253.582799 where: bonds (distance) C4'-P energy: -48.430 bonds (distance) P-C4' energy: -60.244 flat angles C4'-P-C4' energy: -59.494 flat angles P-C4'-P energy: -41.202 tors. eta vs tors. theta energy: -44.213 Dist. restrs. and SS energy: 0.405 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -464.712511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.712511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.857917 (E_RNA) where: Base-Base interactions energy: -242.876 where: short stacking energy: -161.511 Base-Backbone interact. energy: -0.579 local terms energy: -228.402973 where: bonds (distance) C4'-P energy: -60.602 bonds (distance) P-C4' energy: -61.446 flat angles C4'-P-C4' energy: -49.538 flat angles P-C4'-P energy: -30.328 tors. eta vs tors. theta energy: -26.489 Dist. restrs. and SS energy: 7.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -472.150648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.150648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.596065 (E_RNA) where: Base-Base interactions energy: -273.130 where: short stacking energy: -188.954 Base-Backbone interact. energy: -0.465 local terms energy: -199.000978 where: bonds (distance) C4'-P energy: -39.236 bonds (distance) P-C4' energy: -44.116 flat angles C4'-P-C4' energy: -45.314 flat angles P-C4'-P energy: -28.314 tors. eta vs tors. theta energy: -42.021 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -413.183679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.183679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.528577 (E_RNA) where: Base-Base interactions energy: -190.662 where: short stacking energy: -138.567 Base-Backbone interact. energy: -1.067 local terms energy: -222.800425 where: bonds (distance) C4'-P energy: -47.158 bonds (distance) P-C4' energy: -51.046 flat angles C4'-P-C4' energy: -51.760 flat angles P-C4'-P energy: -39.616 tors. eta vs tors. theta energy: -33.219 Dist. restrs. and SS energy: 1.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -436.442643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.442643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.578537 (E_RNA) where: Base-Base interactions energy: -233.661 where: short stacking energy: -124.480 Base-Backbone interact. energy: -0.298 local terms energy: -202.619016 where: bonds (distance) C4'-P energy: -46.182 bonds (distance) P-C4' energy: -40.407 flat angles C4'-P-C4' energy: -53.033 flat angles P-C4'-P energy: -41.474 tors. eta vs tors. theta energy: -21.524 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -328.320319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.320319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.383291 (E_RNA) where: Base-Base interactions energy: -158.177 where: short stacking energy: -95.036 Base-Backbone interact. energy: -2.768 local terms energy: -176.438109 where: bonds (distance) C4'-P energy: -56.849 bonds (distance) P-C4' energy: -52.289 flat angles C4'-P-C4' energy: -50.167 flat angles P-C4'-P energy: -17.775 tors. eta vs tors. theta energy: 0.642 Dist. restrs. and SS energy: 9.063 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -328.475238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.475238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.907877 (E_RNA) where: Base-Base interactions energy: -138.884 where: short stacking energy: -78.215 Base-Backbone interact. energy: -1.233 local terms energy: -193.790674 where: bonds (distance) C4'-P energy: -58.197 bonds (distance) P-C4' energy: -45.028 flat angles C4'-P-C4' energy: -52.049 flat angles P-C4'-P energy: -25.619 tors. eta vs tors. theta energy: -12.898 Dist. restrs. and SS energy: 5.433 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -359.402524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.402524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.912388 (E_RNA) where: Base-Base interactions energy: -176.904 where: short stacking energy: -101.705 Base-Backbone interact. energy: -0.788 local terms energy: -182.220314 where: bonds (distance) C4'-P energy: -50.386 bonds (distance) P-C4' energy: -49.403 flat angles C4'-P-C4' energy: -42.191 flat angles P-C4'-P energy: -26.526 tors. eta vs tors. theta energy: -13.714 Dist. restrs. and SS energy: 0.510 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -305.584182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.584182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.804985 (E_RNA) where: Base-Base interactions energy: -135.266 where: short stacking energy: -80.311 Base-Backbone interact. energy: -0.517 local terms energy: -172.021501 where: bonds (distance) C4'-P energy: -43.661 bonds (distance) P-C4' energy: -46.986 flat angles C4'-P-C4' energy: -45.450 flat angles P-C4'-P energy: -27.910 tors. eta vs tors. theta energy: -8.014 Dist. restrs. and SS energy: 2.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 1 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 153912 moves confirmed later: 174831 all moves confirmed: 328743 percent of confirmed moves: 657.486000 current total energy: -462.243905 recalc. total energy: -462.243905 replica 2 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 158734 moves confirmed later: 184193 all moves confirmed: 342927 percent of confirmed moves: 685.854000 current total energy: -453.453678 recalc. total energy: -453.453678 replica 3 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 162700 moves confirmed later: 187979 all moves confirmed: 350679 percent of confirmed moves: 701.358000 current total energy: -407.826688 recalc. total energy: -407.826688 replica 5 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 179245 moves confirmed later: 212364 all moves confirmed: 391609 percent of confirmed moves: 783.218000 current total energy: -370.834975 recalc. total energy: -370.834975 replica 4 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 166193 moves confirmed later: 194542 all moves confirmed: 360735 percent of confirmed moves: 721.470000 current total energy: -367.484579 recalc. total energy: -367.484579 replica 6 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 183699 moves confirmed later: 219171 all moves confirmed: 402870 percent of confirmed moves: 805.740000 current total energy: -296.314532 recalc. total energy: -296.314532 replica 7 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 191612 moves confirmed later: 230817 all moves confirmed: 422429 percent of confirmed moves: 844.858000 current total energy: -209.959955 recalc. total energy: -209.959955 replica 9 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 196259 moves confirmed later: 238043 all moves confirmed: 434302 percent of confirmed moves: 868.604000 current total energy: -319.647733 recalc. total energy: -319.647733 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 195465 moves confirmed later: 234977 all moves confirmed: 430442 percent of confirmed moves: 860.884000 current total energy: -268.297092 recalc. total energy: -268.297092 replica 10 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 204326 moves confirmed later: 247983 all moves confirmed: 452309 percent of confirmed moves: 904.618000 current total energy: -239.479914 recalc. total energy: -239.479914 Time of doing 500 iterations: 31.115 seconds