SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RON-1e09ddbe/inputs/seq.fa: 1 curr_seq: _UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UUUUAGCACAGAGGUCAGAUGCAAACCACACCUGAGUGGUUAGCGUAUGUCAUUUACGGCUUUUCCGGCCAUAUAUA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 77 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 390 n_atoms_counter: 390 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.....................................................................(((())))_ nucl1: 72, chain1: 0, <---> nucl2: 73, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 72, chainIndex_2: 0, nuclIndex_2: 73 nucl1: 71, chain1: 0, <---> nucl2: 74, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 71, chainIndex_2: 0, nuclIndex_2: 74 nucl1: 70, chain1: 0, <---> nucl2: 75, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 70, chainIndex_2: 0, nuclIndex_2: 75 nucl1: 69, chain1: 0, <---> nucl2: 76, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 69, chainIndex_2: 0, nuclIndex_2: 76 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 77.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -264.100281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.100281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.117144 (E_RNA) where: Base-Base interactions energy: -12.141 where: short stacking energy: -12.141 Base-Backbone interact. energy: -0.000 local terms energy: -299.976073 where: bonds (distance) C4'-P energy: -74.812 bonds (distance) P-C4' energy: -69.783 flat angles C4'-P-C4' energy: -56.535 flat angles P-C4'-P energy: -64.670 tors. eta vs tors. theta energy: -34.176 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) out arg RESULTS//1/RON-1e09ddbe_01 DONE DONE ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -415.495297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.495297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.094176 (E_RNA) where: Base-Base interactions energy: -192.288 where: short stacking energy: -160.519 Base-Backbone interact. energy: -0.119 local terms energy: -226.687007 where: bonds (distance) C4'-P energy: -47.633 bonds (distance) P-C4' energy: -51.797 flat angles C4'-P-C4' energy: -54.922 flat angles P-C4'-P energy: -32.835 tors. eta vs tors. theta energy: -39.499 Dist. restrs. and SS energy: 3.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -421.334216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.334216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.313471 (E_RNA) where: Base-Base interactions energy: -214.796 where: short stacking energy: -145.440 Base-Backbone interact. energy: -0.534 local terms energy: -211.983382 where: bonds (distance) C4'-P energy: -48.411 bonds (distance) P-C4' energy: -49.910 flat angles C4'-P-C4' energy: -51.617 flat angles P-C4'-P energy: -31.102 tors. eta vs tors. theta energy: -30.944 Dist. restrs. and SS energy: 5.979 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -371.551060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.551060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.249990 (E_RNA) where: Base-Base interactions energy: -171.523 where: short stacking energy: -125.773 Base-Backbone interact. energy: 1.572 local terms energy: -208.299532 where: bonds (distance) C4'-P energy: -44.739 bonds (distance) P-C4' energy: -49.647 flat angles C4'-P-C4' energy: -52.329 flat angles P-C4'-P energy: -36.394 tors. eta vs tors. theta energy: -25.191 Dist. restrs. and SS energy: 6.699 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -366.628922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.628922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.685130 (E_RNA) where: Base-Base interactions energy: -167.560 where: short stacking energy: -123.651 Base-Backbone interact. energy: -0.765 local terms energy: -204.359737 where: bonds (distance) C4'-P energy: -50.188 bonds (distance) P-C4' energy: -50.224 flat angles C4'-P-C4' energy: -38.353 flat angles P-C4'-P energy: -41.831 tors. eta vs tors. theta energy: -23.764 Dist. restrs. and SS energy: 6.056 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -319.828398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.828398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.733277 (E_RNA) where: Base-Base interactions energy: -140.385 where: short stacking energy: -125.072 Base-Backbone interact. energy: -0.090 local terms energy: -184.257859 where: bonds (distance) C4'-P energy: -49.963 bonds (distance) P-C4' energy: -44.676 flat angles C4'-P-C4' energy: -47.477 flat angles P-C4'-P energy: -21.022 tors. eta vs tors. theta energy: -21.120 Dist. restrs. and SS energy: 4.905 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -300.600536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.600536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.569118 (E_RNA) where: Base-Base interactions energy: -133.005 where: short stacking energy: -98.718 Base-Backbone interact. energy: -0.493 local terms energy: -173.071472 where: bonds (distance) C4'-P energy: -42.762 bonds (distance) P-C4' energy: -44.530 flat angles C4'-P-C4' energy: -48.805 flat angles P-C4'-P energy: -17.177 tors. eta vs tors. theta energy: -19.798 Dist. restrs. and SS energy: 5.969 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -267.774340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.774340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.021930 (E_RNA) where: Base-Base interactions energy: -33.300 where: short stacking energy: -33.300 Base-Backbone interact. energy: -0.000 local terms energy: -281.722302 where: bonds (distance) C4'-P energy: -66.673 bonds (distance) P-C4' energy: -64.070 flat angles C4'-P-C4' energy: -55.422 flat angles P-C4'-P energy: -62.070 tors. eta vs tors. theta energy: -33.487 Dist. restrs. and SS energy: 47.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -264.652457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.652457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.669321 (E_RNA) where: Base-Base interactions energy: -20.424 where: short stacking energy: -20.424 Base-Backbone interact. energy: -0.000 local terms energy: -292.244809 where: bonds (distance) C4'-P energy: -70.565 bonds (distance) P-C4' energy: -67.701 flat angles C4'-P-C4' energy: -55.735 flat angles P-C4'-P energy: -64.291 tors. eta vs tors. theta energy: -33.953 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -263.934156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.934156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.951020 (E_RNA) where: Base-Base interactions energy: -13.923 where: short stacking energy: -13.923 Base-Backbone interact. energy: -0.000 local terms energy: -298.028331 where: bonds (distance) C4'-P energy: -74.402 bonds (distance) P-C4' energy: -68.472 flat angles C4'-P-C4' energy: -56.516 flat angles P-C4'-P energy: -64.415 tors. eta vs tors. theta energy: -34.222 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -263.934127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.934127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.950991 (E_RNA) where: Base-Base interactions energy: -13.923 where: short stacking energy: -13.923 Base-Backbone interact. energy: -0.000 local terms energy: -298.028331 where: bonds (distance) C4'-P energy: -74.402 bonds (distance) P-C4' energy: -68.472 flat angles C4'-P-C4' energy: -56.516 flat angles P-C4'-P energy: -64.415 tors. eta vs tors. theta energy: -34.222 Dist. restrs. and SS energy: 48.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 1 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 143176 moves confirmed later: 161540 all moves confirmed: 304716 percent of confirmed moves: 304.716000 current total energy: -331.960469 recalc. total energy: -331.960469 replica 2 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 144772 moves confirmed later: 164413 all moves confirmed: 309185 percent of confirmed moves: 309.185000 current total energy: -361.061836 recalc. total energy: -361.061836 replica 3 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 153180 moves confirmed later: 177879 all moves confirmed: 331059 percent of confirmed moves: 331.059000 current total energy: -321.666722 recalc. total energy: -321.666722 replica 4 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 159224 moves confirmed later: 186899 all moves confirmed: 346123 percent of confirmed moves: 346.123000 current total energy: -290.224562 recalc. total energy: -290.224562 replica 5 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 164835 moves confirmed later: 196578 all moves confirmed: 361413 percent of confirmed moves: 361.413000 current total energy: -203.423956 recalc. total energy: -203.423956 replica 6 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 167398 moves confirmed later: 199854 all moves confirmed: 367252 percent of confirmed moves: 367.252000 current total energy: -275.288268 recalc. total energy: -275.288268 replica 7 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 176773 moves confirmed later: 211420 all moves confirmed: 388193 percent of confirmed moves: 388.193000 current total energy: -206.010750 recalc. total energy: -206.010750 replica 9 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 184928 moves confirmed later: 224324 all moves confirmed: 409252 percent of confirmed moves: 409.252000 current total energy: -146.860458 recalc. total energy: -146.860458 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 181453 moves confirmed later: 217531 all moves confirmed: 398984 percent of confirmed moves: 398.984000 current total energy: -171.466523 recalc. total energy: -171.466523 replica 10 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 187881 moves confirmed later: 226452 all moves confirmed: 414333 percent of confirmed moves: 414.333000 current total energy: -79.985755 recalc. total energy: -79.985755 Time of doing 1000 iterations: 25.290 seconds