SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/RNA_2_edited-a3f731bd/inputs/seq.fa: 1 curr_seq: _AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AUGCAUCCAUUUGACAGACCUGGAGCAGUUCCUGUCUAUUGCUAAGGUUUCCACUAGAGAUCCAAGAAAAAAGUGUCCUCGUGCUUUCUCUCUCAUUGUGGCAGUCAAGAUUAAAUGGGGGAGUAUAGGG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 130 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 655 n_atoms_counter: 655 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _.(((((((...((.((((((..(((((((.....)))))))....))))))))...).))))))...........((((((..(..((((((((.....)))))..))))..)....)))))........_ nucl1: 28, chain1: 0, <---> nucl2: 34, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 28, chainIndex_2: 0, nuclIndex_2: 34 nucl1: 27, chain1: 0, <---> nucl2: 35, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 27, chainIndex_2: 0, nuclIndex_2: 35 nucl1: 26, chain1: 0, <---> nucl2: 36, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 26, chainIndex_2: 0, nuclIndex_2: 36 nucl1: 25, chain1: 0, <---> nucl2: 37, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 25, chainIndex_2: 0, nuclIndex_2: 37 nucl1: 24, chain1: 0, <---> nucl2: 38, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 24, chainIndex_2: 0, nuclIndex_2: 38 nucl1: 23, chain1: 0, <---> nucl2: 39, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 23, chainIndex_2: 0, nuclIndex_2: 39 nucl1: 22, chain1: 0, <---> nucl2: 40, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 22, chainIndex_2: 0, nuclIndex_2: 40 nucl1: 19, chain1: 0, <---> nucl2: 45, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 45 nucl1: 18, chain1: 0, <---> nucl2: 46, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 0, nuclIndex_2: 46 nucl1: 17, chain1: 0, <---> nucl2: 47, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 0, nuclIndex_2: 47 nucl1: 16, chain1: 0, <---> nucl2: 48, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 48 nucl1: 15, chain1: 0, <---> nucl2: 49, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 49 nucl1: 14, chain1: 0, <---> nucl2: 50, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 0, nuclIndex_2: 50 nucl1: 12, chain1: 0, <---> nucl2: 51, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 0, nuclIndex_2: 51 nucl1: 11, chain1: 0, <---> nucl2: 52, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 0, nuclIndex_2: 52 nucl1: 7, chain1: 0, <---> nucl2: 56, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 56 nucl1: 6, chain1: 0, <---> nucl2: 58, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 58 nucl1: 5, chain1: 0, <---> nucl2: 59, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 59 nucl1: 4, chain1: 0, <---> nucl2: 60, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 60 nucl1: 3, chain1: 0, <---> nucl2: 61, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2: 61 nucl1: 2, chain1: 0, <---> nucl2: 62, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 0, nuclIndex_2: 62 nucl1: 1, chain1: 0, <---> nucl2: 63, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2: 63 nucl1: 93, chain1: 0, <---> nucl2: 99, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 93, chainIndex_2: 0, nuclIndex_2: 99 nucl1: 92, chain1: 0, <---> nucl2: 100, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 92, chainIndex_2: 0, nuclIndex_2: 100 nucl1: 91, chain1: 0, <---> nucl2: 101, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 91, chainIndex_2: 0, nuclIndex_2: 101 nucl1: 90, chain1: 0, <---> nucl2: 102, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 90, chainIndex_2: 0, nuclIndex_2: 102 nucl1: 89, chain1: 0, <---> nucl2: 103, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 89, chainIndex_2: 0, nuclIndex_2: 103 nucl1: 88, chain1: 0, <---> nucl2: 106, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 88, chainIndex_2: 0, nuclIndex_2: 106 nucl1: 87, chain1: 0, <---> nucl2: 107, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 87, chainIndex_2: 0, nuclIndex_2: 107 nucl1: 86, chain1: 0, <---> nucl2: 108, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 86, chainIndex_2: 0, nuclIndex_2: 108 nucl1: 83, chain1: 0, <---> nucl2: 109, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 83, chainIndex_2: 0, nuclIndex_2: 109 nucl1: 80, chain1: 0, <---> nucl2: 112, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 80, chainIndex_2: 0, nuclIndex_2: 112 nucl1: 79, chain1: 0, <---> nucl2: 117, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 79, chainIndex_2: 0, nuclIndex_2: 117 nucl1: 78, chain1: 0, <---> nucl2: 118, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 78, chainIndex_2: 0, nuclIndex_2: 118 nucl1: 77, chain1: 0, <---> nucl2: 119, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 77, chainIndex_2: 0, nuclIndex_2: 119 nucl1: 76, chain1: 0, <---> nucl2: 120, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 76, chainIndex_2: 0, nuclIndex_2: 120 nucl1: 75, chain1: 0, <---> nucl2: 121, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 75, chainIndex_2: 0, nuclIndex_2: 121 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 130.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 160000 trajectory write in every 1600 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -524.877855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.877855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.877855 (E_RNA) where: Base-Base interactions energy: -18.731 where: short stacking energy: -18.731 Base-Backbone interact. energy: -0.000 local terms energy: -506.146833 where: bonds (distance) C4'-P energy: -126.305 bonds (distance) P-C4' energy: -117.199 flat angles C4'-P-C4' energy: -95.449 flat angles P-C4'-P energy: -109.184 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -570.815130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.815130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.815130 (E_RNA) where: Base-Base interactions energy: -221.106 where: short stacking energy: -218.378 Base-Backbone interact. energy: -0.007 local terms energy: -349.701801 where: bonds (distance) C4'-P energy: -83.045 bonds (distance) P-C4' energy: -86.166 flat angles C4'-P-C4' energy: -93.398 flat angles P-C4'-P energy: -38.049 tors. eta vs tors. theta energy: -49.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -534.472225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.472225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.472225 (E_RNA) where: Base-Base interactions energy: -194.848 where: short stacking energy: -194.848 Base-Backbone interact. energy: -0.002 local terms energy: -339.622111 where: bonds (distance) C4'-P energy: -83.065 bonds (distance) P-C4' energy: -82.962 flat angles C4'-P-C4' energy: -75.411 flat angles P-C4'-P energy: -50.578 tors. eta vs tors. theta energy: -47.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -556.773930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.773930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.773930 (E_RNA) where: Base-Base interactions energy: -212.826 where: short stacking energy: -212.826 Base-Backbone interact. energy: 2.858 local terms energy: -346.805762 where: bonds (distance) C4'-P energy: -79.764 bonds (distance) P-C4' energy: -92.030 flat angles C4'-P-C4' energy: -74.498 flat angles P-C4'-P energy: -52.460 tors. eta vs tors. theta energy: -48.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -528.155492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.155492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.155492 (E_RNA) where: Base-Base interactions energy: -91.992 where: short stacking energy: -91.992 Base-Backbone interact. energy: -0.000 local terms energy: -436.163192 where: bonds (distance) C4'-P energy: -87.723 bonds (distance) P-C4' energy: -92.840 flat angles C4'-P-C4' energy: -96.907 flat angles P-C4'-P energy: -96.421 tors. eta vs tors. theta energy: -62.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -532.433768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.433768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.433768 (E_RNA) where: Base-Base interactions energy: -68.130 where: short stacking energy: -68.130 Base-Backbone interact. energy: -0.000 local terms energy: -464.303254 where: bonds (distance) C4'-P energy: -101.343 bonds (distance) P-C4' energy: -102.534 flat angles C4'-P-C4' energy: -97.086 flat angles P-C4'-P energy: -102.510 tors. eta vs tors. theta energy: -60.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -528.727387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.727387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.727387 (E_RNA) where: Base-Base interactions energy: -50.833 where: short stacking energy: -50.833 Base-Backbone interact. energy: -0.000 local terms energy: -477.894205 where: bonds (distance) C4'-P energy: -108.996 bonds (distance) P-C4' energy: -107.578 flat angles C4'-P-C4' energy: -96.098 flat angles P-C4'-P energy: -104.693 tors. eta vs tors. theta energy: -60.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -526.884058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.884058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.884058 (E_RNA) where: Base-Base interactions energy: -35.384 where: short stacking energy: -35.384 Base-Backbone interact. energy: -0.000 local terms energy: -491.499987 where: bonds (distance) C4'-P energy: -115.919 bonds (distance) P-C4' energy: -110.113 flat angles C4'-P-C4' energy: -98.481 flat angles P-C4'-P energy: -106.515 tors. eta vs tors. theta energy: -60.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -526.473546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.473546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.473546 (E_RNA) where: Base-Base interactions energy: -35.715 where: short stacking energy: -35.715 Base-Backbone interact. energy: -0.000 local terms energy: -490.758104 where: bonds (distance) C4'-P energy: -115.501 bonds (distance) P-C4' energy: -110.113 flat angles C4'-P-C4' energy: -98.481 flat angles P-C4'-P energy: -106.466 tors. eta vs tors. theta energy: -60.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -527.758932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.758932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.758932 (E_RNA) where: Base-Base interactions energy: -42.571 where: short stacking energy: -42.571 Base-Backbone interact. energy: -0.000 local terms energy: -485.187905 where: bonds (distance) C4'-P energy: -113.594 bonds (distance) P-C4' energy: -109.186 flat angles C4'-P-C4' energy: -97.494 flat angles P-C4'-P energy: -105.361 tors. eta vs tors. theta energy: -59.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -526.190582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.190582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.190582 (E_RNA) where: Base-Base interactions energy: -22.084 where: short stacking energy: -22.084 Base-Backbone interact. energy: -0.000 local terms energy: -504.106788 where: bonds (distance) C4'-P energy: -125.850 bonds (distance) P-C4' energy: -116.496 flat angles C4'-P-C4' energy: -94.710 flat angles P-C4'-P energy: -108.790 tors. eta vs tors. theta energy: -58.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -583.416228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.416228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.416228 (E_RNA) where: Base-Base interactions energy: -231.470 where: short stacking energy: -231.420 Base-Backbone interact. energy: -0.020 local terms energy: -351.926099 where: bonds (distance) C4'-P energy: -87.584 bonds (distance) P-C4' energy: -91.535 flat angles C4'-P-C4' energy: -81.983 flat angles P-C4'-P energy: -41.369 tors. eta vs tors. theta energy: -49.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -606.938341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.938341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.938341 (E_RNA) where: Base-Base interactions energy: -244.234 where: short stacking energy: -243.928 Base-Backbone interact. energy: -0.006 local terms energy: -362.699053 where: bonds (distance) C4'-P energy: -85.147 bonds (distance) P-C4' energy: -82.940 flat angles C4'-P-C4' energy: -87.185 flat angles P-C4'-P energy: -43.129 tors. eta vs tors. theta energy: -64.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -571.248269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.248269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.248269 (E_RNA) where: Base-Base interactions energy: -219.927 where: short stacking energy: -219.927 Base-Backbone interact. energy: -0.045 local terms energy: -351.275962 where: bonds (distance) C4'-P energy: -74.843 bonds (distance) P-C4' energy: -83.017 flat angles C4'-P-C4' energy: -85.856 flat angles P-C4'-P energy: -54.174 tors. eta vs tors. theta energy: -53.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -494.993727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.993727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.993727 (E_RNA) where: Base-Base interactions energy: -180.190 where: short stacking energy: -176.061 Base-Backbone interact. energy: -0.231 local terms energy: -314.572309 where: bonds (distance) C4'-P energy: -81.003 bonds (distance) P-C4' energy: -78.291 flat angles C4'-P-C4' energy: -72.569 flat angles P-C4'-P energy: -41.027 tors. eta vs tors. theta energy: -41.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -506.253993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.253993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.253993 (E_RNA) where: Base-Base interactions energy: -177.730 where: short stacking energy: -178.092 Base-Backbone interact. energy: -0.146 local terms energy: -328.377723 where: bonds (distance) C4'-P energy: -78.925 bonds (distance) P-C4' energy: -83.426 flat angles C4'-P-C4' energy: -68.649 flat angles P-C4'-P energy: -51.512 tors. eta vs tors. theta energy: -45.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -460.535324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.535324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.535324 (E_RNA) where: Base-Base interactions energy: -176.079 where: short stacking energy: -172.687 Base-Backbone interact. energy: -0.051 local terms energy: -284.405249 where: bonds (distance) C4'-P energy: -75.258 bonds (distance) P-C4' energy: -78.485 flat angles C4'-P-C4' energy: -56.063 flat angles P-C4'-P energy: -40.150 tors. eta vs tors. theta energy: -34.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -398.144100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.144100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.144100 (E_RNA) where: Base-Base interactions energy: -127.550 where: short stacking energy: -125.103 Base-Backbone interact. energy: 1.433 local terms energy: -272.026612 where: bonds (distance) C4'-P energy: -76.186 bonds (distance) P-C4' energy: -83.514 flat angles C4'-P-C4' energy: -66.052 flat angles P-C4'-P energy: -39.625 tors. eta vs tors. theta energy: -6.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -380.819356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.819356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.819356 (E_RNA) where: Base-Base interactions energy: -129.970 where: short stacking energy: -130.572 Base-Backbone interact. energy: -0.166 local terms energy: -250.682876 where: bonds (distance) C4'-P energy: -68.369 bonds (distance) P-C4' energy: -66.866 flat angles C4'-P-C4' energy: -65.284 flat angles P-C4'-P energy: -40.945 tors. eta vs tors. theta energy: -9.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -386.689467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.689467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.689467 (E_RNA) where: Base-Base interactions energy: -127.126 where: short stacking energy: -123.885 Base-Backbone interact. energy: -0.226 local terms energy: -259.336777 where: bonds (distance) C4'-P energy: -62.825 bonds (distance) P-C4' energy: -84.435 flat angles C4'-P-C4' energy: -65.070 flat angles P-C4'-P energy: -18.783 tors. eta vs tors. theta energy: -28.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -321.869053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.869053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.869053 (E_RNA) where: Base-Base interactions energy: -111.677 where: short stacking energy: -110.745 Base-Backbone interact. energy: -0.035 local terms energy: -210.157850 where: bonds (distance) C4'-P energy: -69.643 bonds (distance) P-C4' energy: -72.452 flat angles C4'-P-C4' energy: -52.871 flat angles P-C4'-P energy: -27.449 tors. eta vs tors. theta energy: 12.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -620.772513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.772513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.772513 (E_RNA) where: Base-Base interactions energy: -269.392 where: short stacking energy: -269.392 Base-Backbone interact. energy: -0.063 local terms energy: -351.316944 where: bonds (distance) C4'-P energy: -78.869 bonds (distance) P-C4' energy: -85.642 flat angles C4'-P-C4' energy: -84.155 flat angles P-C4'-P energy: -47.458 tors. eta vs tors. theta energy: -55.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -585.836273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.836273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.836273 (E_RNA) where: Base-Base interactions energy: -225.400 where: short stacking energy: -224.791 Base-Backbone interact. energy: -0.110 local terms energy: -360.326679 where: bonds (distance) C4'-P energy: -81.052 bonds (distance) P-C4' energy: -86.879 flat angles C4'-P-C4' energy: -76.112 flat angles P-C4'-P energy: -55.555 tors. eta vs tors. theta energy: -60.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -556.683791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.683791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.683791 (E_RNA) where: Base-Base interactions energy: -230.739 where: short stacking energy: -226.347 Base-Backbone interact. energy: -0.028 local terms energy: -325.917728 where: bonds (distance) C4'-P energy: -77.020 bonds (distance) P-C4' energy: -74.703 flat angles C4'-P-C4' energy: -84.242 flat angles P-C4'-P energy: -43.466 tors. eta vs tors. theta energy: -46.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -501.853464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.853464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.853464 (E_RNA) where: Base-Base interactions energy: -169.832 where: short stacking energy: -168.599 Base-Backbone interact. energy: -0.521 local terms energy: -331.501186 where: bonds (distance) C4'-P energy: -80.785 bonds (distance) P-C4' energy: -90.168 flat angles C4'-P-C4' energy: -64.673 flat angles P-C4'-P energy: -56.344 tors. eta vs tors. theta energy: -39.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -451.447294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.447294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.447294 (E_RNA) where: Base-Base interactions energy: -174.644 where: short stacking energy: -172.098 Base-Backbone interact. energy: -1.355 local terms energy: -275.448308 where: bonds (distance) C4'-P energy: -66.270 bonds (distance) P-C4' energy: -79.091 flat angles C4'-P-C4' energy: -72.554 flat angles P-C4'-P energy: -27.449 tors. eta vs tors. theta energy: -30.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -428.688988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.688988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.688988 (E_RNA) where: Base-Base interactions energy: -150.787 where: short stacking energy: -148.214 Base-Backbone interact. energy: -0.620 local terms energy: -277.282283 where: bonds (distance) C4'-P energy: -63.714 bonds (distance) P-C4' energy: -67.687 flat angles C4'-P-C4' energy: -66.507 flat angles P-C4'-P energy: -45.634 tors. eta vs tors. theta energy: -33.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -384.321473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.321473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.521473 (E_RNA) where: Base-Base interactions energy: -132.948 where: short stacking energy: -127.662 Base-Backbone interact. energy: -1.430 local terms energy: -248.142747 where: bonds (distance) C4'-P energy: -66.172 bonds (distance) P-C4' energy: -76.180 flat angles C4'-P-C4' energy: -77.773 flat angles P-C4'-P energy: -26.417 tors. eta vs tors. theta energy: -1.601 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -416.341021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.341021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.341021 (E_RNA) where: Base-Base interactions energy: -150.773 where: short stacking energy: -121.771 Base-Backbone interact. energy: -0.106 local terms energy: -265.461244 where: bonds (distance) C4'-P energy: -67.990 bonds (distance) P-C4' energy: -86.376 flat angles C4'-P-C4' energy: -63.405 flat angles P-C4'-P energy: -36.177 tors. eta vs tors. theta energy: -11.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -362.190625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.190625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.190625 (E_RNA) where: Base-Base interactions energy: -111.009 where: short stacking energy: -103.418 Base-Backbone interact. energy: -0.322 local terms energy: -250.859724 where: bonds (distance) C4'-P energy: -64.973 bonds (distance) P-C4' energy: -74.859 flat angles C4'-P-C4' energy: -61.325 flat angles P-C4'-P energy: -37.246 tors. eta vs tors. theta energy: -12.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -316.482988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.482988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.482988 (E_RNA) where: Base-Base interactions energy: -70.816 where: short stacking energy: -71.746 Base-Backbone interact. energy: -0.401 local terms energy: -245.266639 where: bonds (distance) C4'-P energy: -72.555 bonds (distance) P-C4' energy: -81.639 flat angles C4'-P-C4' energy: -70.135 flat angles P-C4'-P energy: -21.431 tors. eta vs tors. theta energy: 0.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -587.396124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.396124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.396124 (E_RNA) where: Base-Base interactions energy: -234.564 where: short stacking energy: -227.446 Base-Backbone interact. energy: -0.117 local terms energy: -352.714862 where: bonds (distance) C4'-P energy: -83.514 bonds (distance) P-C4' energy: -82.326 flat angles C4'-P-C4' energy: -85.492 flat angles P-C4'-P energy: -52.533 tors. eta vs tors. theta energy: -48.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -617.624643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.624643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.624643 (E_RNA) where: Base-Base interactions energy: -259.573 where: short stacking energy: -249.680 Base-Backbone interact. energy: -0.252 local terms energy: -357.799118 where: bonds (distance) C4'-P energy: -75.856 bonds (distance) P-C4' energy: -85.647 flat angles C4'-P-C4' energy: -94.327 flat angles P-C4'-P energy: -44.769 tors. eta vs tors. theta energy: -57.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -520.812540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.812540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.812540 (E_RNA) where: Base-Base interactions energy: -182.323 where: short stacking energy: -180.321 Base-Backbone interact. energy: -0.026 local terms energy: -338.462962 where: bonds (distance) C4'-P energy: -81.440 bonds (distance) P-C4' energy: -81.992 flat angles C4'-P-C4' energy: -83.287 flat angles P-C4'-P energy: -46.169 tors. eta vs tors. theta energy: -45.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -488.065002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.065002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.065002 (E_RNA) where: Base-Base interactions energy: -176.338 where: short stacking energy: -163.462 Base-Backbone interact. energy: -0.482 local terms energy: -311.244890 where: bonds (distance) C4'-P energy: -75.685 bonds (distance) P-C4' energy: -77.150 flat angles C4'-P-C4' energy: -80.843 flat angles P-C4'-P energy: -49.266 tors. eta vs tors. theta energy: -28.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -469.249133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.249133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.249133 (E_RNA) where: Base-Base interactions energy: -175.469 where: short stacking energy: -169.447 Base-Backbone interact. energy: 0.039 local terms energy: -293.819438 where: bonds (distance) C4'-P energy: -70.557 bonds (distance) P-C4' energy: -84.464 flat angles C4'-P-C4' energy: -64.953 flat angles P-C4'-P energy: -43.052 tors. eta vs tors. theta energy: -30.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -467.092837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.092837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.092837 (E_RNA) where: Base-Base interactions energy: -165.651 where: short stacking energy: -165.651 Base-Backbone interact. energy: 1.373 local terms energy: -302.814423 where: bonds (distance) C4'-P energy: -81.257 bonds (distance) P-C4' energy: -69.354 flat angles C4'-P-C4' energy: -75.988 flat angles P-C4'-P energy: -51.354 tors. eta vs tors. theta energy: -24.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -409.040058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.040058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.840058 (E_RNA) where: Base-Base interactions energy: -161.550 where: short stacking energy: -145.413 Base-Backbone interact. energy: 0.436 local terms energy: -240.726230 where: bonds (distance) C4'-P energy: -65.895 bonds (distance) P-C4' energy: -76.630 flat angles C4'-P-C4' energy: -60.854 flat angles P-C4'-P energy: -29.734 tors. eta vs tors. theta energy: -7.613 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -398.854630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.854630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.854630 (E_RNA) where: Base-Base interactions energy: -136.697 where: short stacking energy: -135.868 Base-Backbone interact. energy: -0.325 local terms energy: -261.833333 where: bonds (distance) C4'-P energy: -64.559 bonds (distance) P-C4' energy: -71.332 flat angles C4'-P-C4' energy: -75.713 flat angles P-C4'-P energy: -31.441 tors. eta vs tors. theta energy: -18.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -353.961117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.961117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.961117 (E_RNA) where: Base-Base interactions energy: -115.337 where: short stacking energy: -99.389 Base-Backbone interact. energy: -1.891 local terms energy: -236.733949 where: bonds (distance) C4'-P energy: -77.492 bonds (distance) P-C4' energy: -77.559 flat angles C4'-P-C4' energy: -54.552 flat angles P-C4'-P energy: -14.264 tors. eta vs tors. theta energy: -12.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -310.664940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.664940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.664940 (E_RNA) where: Base-Base interactions energy: -102.615 where: short stacking energy: -101.094 Base-Backbone interact. energy: -0.591 local terms energy: -207.458648 where: bonds (distance) C4'-P energy: -52.925 bonds (distance) P-C4' energy: -64.848 flat angles C4'-P-C4' energy: -62.955 flat angles P-C4'-P energy: -37.727 tors. eta vs tors. theta energy: 10.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -671.247759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.247759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.247759 (E_RNA) where: Base-Base interactions energy: -289.705 where: short stacking energy: -281.521 Base-Backbone interact. energy: -0.133 local terms energy: -381.409045 where: bonds (distance) C4'-P energy: -84.574 bonds (distance) P-C4' energy: -80.261 flat angles C4'-P-C4' energy: -85.737 flat angles P-C4'-P energy: -55.987 tors. eta vs tors. theta energy: -74.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -586.803333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.803333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.803333 (E_RNA) where: Base-Base interactions energy: -247.511 where: short stacking energy: -245.653 Base-Backbone interact. energy: 1.928 local terms energy: -341.220175 where: bonds (distance) C4'-P energy: -86.765 bonds (distance) P-C4' energy: -82.631 flat angles C4'-P-C4' energy: -77.273 flat angles P-C4'-P energy: -40.636 tors. eta vs tors. theta energy: -53.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -551.359580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.359580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.359580 (E_RNA) where: Base-Base interactions energy: -214.241 where: short stacking energy: -210.331 Base-Backbone interact. energy: -0.189 local terms energy: -336.929836 where: bonds (distance) C4'-P energy: -87.904 bonds (distance) P-C4' energy: -71.284 flat angles C4'-P-C4' energy: -89.624 flat angles P-C4'-P energy: -48.738 tors. eta vs tors. theta energy: -39.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -494.974463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.974463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.974463 (E_RNA) where: Base-Base interactions energy: -196.936 where: short stacking energy: -188.634 Base-Backbone interact. energy: -0.034 local terms energy: -298.004455 where: bonds (distance) C4'-P energy: -78.828 bonds (distance) P-C4' energy: -73.426 flat angles C4'-P-C4' energy: -77.627 flat angles P-C4'-P energy: -37.940 tors. eta vs tors. theta energy: -30.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -491.399688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.399688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.399688 (E_RNA) where: Base-Base interactions energy: -194.658 where: short stacking energy: -188.303 Base-Backbone interact. energy: -0.112 local terms energy: -296.629522 where: bonds (distance) C4'-P energy: -78.298 bonds (distance) P-C4' energy: -81.103 flat angles C4'-P-C4' energy: -64.873 flat angles P-C4'-P energy: -36.135 tors. eta vs tors. theta energy: -36.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -441.941732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.941732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.941732 (E_RNA) where: Base-Base interactions energy: -162.549 where: short stacking energy: -161.631 Base-Backbone interact. energy: -0.326 local terms energy: -279.067217 where: bonds (distance) C4'-P energy: -66.413 bonds (distance) P-C4' energy: -62.932 flat angles C4'-P-C4' energy: -69.153 flat angles P-C4'-P energy: -53.254 tors. eta vs tors. theta energy: -27.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -424.274494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.274494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.274494 (E_RNA) where: Base-Base interactions energy: -136.759 where: short stacking energy: -133.679 Base-Backbone interact. energy: 1.181 local terms energy: -288.695905 where: bonds (distance) C4'-P energy: -62.988 bonds (distance) P-C4' energy: -76.581 flat angles C4'-P-C4' energy: -82.756 flat angles P-C4'-P energy: -46.555 tors. eta vs tors. theta energy: -19.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -387.175406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.175406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.375406 (E_RNA) where: Base-Base interactions energy: -144.573 where: short stacking energy: -116.971 Base-Backbone interact. energy: -0.789 local terms energy: -231.013035 where: bonds (distance) C4'-P energy: -66.563 bonds (distance) P-C4' energy: -66.628 flat angles C4'-P-C4' energy: -57.330 flat angles P-C4'-P energy: -39.852 tors. eta vs tors. theta energy: -0.639 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -363.134379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.134379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.134379 (E_RNA) where: Base-Base interactions energy: -137.245 where: short stacking energy: -131.166 Base-Backbone interact. energy: 0.246 local terms energy: -226.135033 where: bonds (distance) C4'-P energy: -64.096 bonds (distance) P-C4' energy: -68.966 flat angles C4'-P-C4' energy: -60.815 flat angles P-C4'-P energy: -22.589 tors. eta vs tors. theta energy: -9.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -291.274963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.274963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.274963 (E_RNA) where: Base-Base interactions energy: -90.582 where: short stacking energy: -78.191 Base-Backbone interact. energy: -1.267 local terms energy: -199.426108 where: bonds (distance) C4'-P energy: -65.734 bonds (distance) P-C4' energy: -65.185 flat angles C4'-P-C4' energy: -65.004 flat angles P-C4'-P energy: -35.457 tors. eta vs tors. theta energy: 31.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -653.703744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.703744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.703744 (E_RNA) where: Base-Base interactions energy: -276.383 where: short stacking energy: -252.768 Base-Backbone interact. energy: -0.408 local terms energy: -376.913363 where: bonds (distance) C4'-P energy: -87.346 bonds (distance) P-C4' energy: -96.141 flat angles C4'-P-C4' energy: -84.096 flat angles P-C4'-P energy: -46.601 tors. eta vs tors. theta energy: -62.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -542.451891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.451891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.451891 (E_RNA) where: Base-Base interactions energy: -217.163 where: short stacking energy: -210.347 Base-Backbone interact. energy: 0.340 local terms energy: -325.629070 where: bonds (distance) C4'-P energy: -72.719 bonds (distance) P-C4' energy: -79.470 flat angles C4'-P-C4' energy: -76.287 flat angles P-C4'-P energy: -56.613 tors. eta vs tors. theta energy: -40.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -539.445325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.445325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.445325 (E_RNA) where: Base-Base interactions energy: -209.824 where: short stacking energy: -200.053 Base-Backbone interact. energy: -0.032 local terms energy: -329.590194 where: bonds (distance) C4'-P energy: -89.225 bonds (distance) P-C4' energy: -80.866 flat angles C4'-P-C4' energy: -76.512 flat angles P-C4'-P energy: -37.974 tors. eta vs tors. theta energy: -45.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -475.457438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.457438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.457438 (E_RNA) where: Base-Base interactions energy: -172.745 where: short stacking energy: -170.868 Base-Backbone interact. energy: -0.897 local terms energy: -301.814971 where: bonds (distance) C4'-P energy: -82.513 bonds (distance) P-C4' energy: -93.697 flat angles C4'-P-C4' energy: -65.544 flat angles P-C4'-P energy: -33.636 tors. eta vs tors. theta energy: -26.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -476.815786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.815786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.815786 (E_RNA) where: Base-Base interactions energy: -179.750 where: short stacking energy: -174.926 Base-Backbone interact. energy: -0.389 local terms energy: -296.676077 where: bonds (distance) C4'-P energy: -77.215 bonds (distance) P-C4' energy: -79.659 flat angles C4'-P-C4' energy: -76.447 flat angles P-C4'-P energy: -44.010 tors. eta vs tors. theta energy: -19.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -416.424578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.424578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.424578 (E_RNA) where: Base-Base interactions energy: -157.248 where: short stacking energy: -150.092 Base-Backbone interact. energy: 0.263 local terms energy: -259.438982 where: bonds (distance) C4'-P energy: -69.324 bonds (distance) P-C4' energy: -68.275 flat angles C4'-P-C4' energy: -57.021 flat angles P-C4'-P energy: -50.674 tors. eta vs tors. theta energy: -14.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -403.326769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.326769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.326769 (E_RNA) where: Base-Base interactions energy: -139.921 where: short stacking energy: -136.243 Base-Backbone interact. energy: -0.695 local terms energy: -262.711581 where: bonds (distance) C4'-P energy: -75.100 bonds (distance) P-C4' energy: -75.053 flat angles C4'-P-C4' energy: -68.858 flat angles P-C4'-P energy: -40.191 tors. eta vs tors. theta energy: -3.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -359.055281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.055281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.055281 (E_RNA) where: Base-Base interactions energy: -130.000 where: short stacking energy: -112.958 Base-Backbone interact. energy: -0.776 local terms energy: -219.279486 where: bonds (distance) C4'-P energy: -56.386 bonds (distance) P-C4' energy: -71.711 flat angles C4'-P-C4' energy: -64.257 flat angles P-C4'-P energy: -34.564 tors. eta vs tors. theta energy: 7.639 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -320.450195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.450195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.450195 (E_RNA) where: Base-Base interactions energy: -109.184 where: short stacking energy: -104.781 Base-Backbone interact. energy: -1.221 local terms energy: -210.045067 where: bonds (distance) C4'-P energy: -56.294 bonds (distance) P-C4' energy: -64.026 flat angles C4'-P-C4' energy: -49.779 flat angles P-C4'-P energy: -33.451 tors. eta vs tors. theta energy: -6.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -293.514706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.514706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.514706 (E_RNA) where: Base-Base interactions energy: -93.949 where: short stacking energy: -87.726 Base-Backbone interact. energy: 4.232 local terms energy: -203.797693 where: bonds (distance) C4'-P energy: -48.422 bonds (distance) P-C4' energy: -71.578 flat angles C4'-P-C4' energy: -53.735 flat angles P-C4'-P energy: -41.646 tors. eta vs tors. theta energy: 11.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -654.312275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.312275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.312275 (E_RNA) where: Base-Base interactions energy: -294.841 where: short stacking energy: -284.651 Base-Backbone interact. energy: -0.252 local terms energy: -359.219258 where: bonds (distance) C4'-P energy: -81.994 bonds (distance) P-C4' energy: -82.030 flat angles C4'-P-C4' energy: -79.110 flat angles P-C4'-P energy: -56.311 tors. eta vs tors. theta energy: -59.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -595.536121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.536121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.536121 (E_RNA) where: Base-Base interactions energy: -257.971 where: short stacking energy: -242.845 Base-Backbone interact. energy: -0.266 local terms energy: -337.298280 where: bonds (distance) C4'-P energy: -76.404 bonds (distance) P-C4' energy: -80.266 flat angles C4'-P-C4' energy: -80.700 flat angles P-C4'-P energy: -56.161 tors. eta vs tors. theta energy: -43.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -597.823375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.823375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.823375 (E_RNA) where: Base-Base interactions energy: -252.991 where: short stacking energy: -242.726 Base-Backbone interact. energy: 0.155 local terms energy: -344.987227 where: bonds (distance) C4'-P energy: -80.464 bonds (distance) P-C4' energy: -64.208 flat angles C4'-P-C4' energy: -81.878 flat angles P-C4'-P energy: -55.576 tors. eta vs tors. theta energy: -62.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -481.661125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.661125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.661125 (E_RNA) where: Base-Base interactions energy: -184.745 where: short stacking energy: -182.933 Base-Backbone interact. energy: -0.356 local terms energy: -296.559770 where: bonds (distance) C4'-P energy: -64.478 bonds (distance) P-C4' energy: -70.284 flat angles C4'-P-C4' energy: -76.141 flat angles P-C4'-P energy: -52.045 tors. eta vs tors. theta energy: -33.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -482.264050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.264050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.264050 (E_RNA) where: Base-Base interactions energy: -183.326 where: short stacking energy: -175.018 Base-Backbone interact. energy: 2.300 local terms energy: -301.238363 where: bonds (distance) C4'-P energy: -72.381 bonds (distance) P-C4' energy: -76.361 flat angles C4'-P-C4' energy: -81.643 flat angles P-C4'-P energy: -45.273 tors. eta vs tors. theta energy: -25.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -456.274351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.274351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.274351 (E_RNA) where: Base-Base interactions energy: -167.106 where: short stacking energy: -162.709 Base-Backbone interact. energy: -1.138 local terms energy: -288.030417 where: bonds (distance) C4'-P energy: -67.657 bonds (distance) P-C4' energy: -84.529 flat angles C4'-P-C4' energy: -73.767 flat angles P-C4'-P energy: -34.565 tors. eta vs tors. theta energy: -27.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -370.999807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.999807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.999807 (E_RNA) where: Base-Base interactions energy: -130.629 where: short stacking energy: -130.729 Base-Backbone interact. energy: 0.159 local terms energy: -240.529913 where: bonds (distance) C4'-P energy: -67.539 bonds (distance) P-C4' energy: -71.663 flat angles C4'-P-C4' energy: -62.415 flat angles P-C4'-P energy: -32.611 tors. eta vs tors. theta energy: -6.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -356.201436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.201436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.401436 (E_RNA) where: Base-Base interactions energy: -126.981 where: short stacking energy: -106.793 Base-Backbone interact. energy: 0.364 local terms energy: -218.784490 where: bonds (distance) C4'-P energy: -61.705 bonds (distance) P-C4' energy: -66.894 flat angles C4'-P-C4' energy: -62.708 flat angles P-C4'-P energy: -27.720 tors. eta vs tors. theta energy: 0.242 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -341.487497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.487497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.487497 (E_RNA) where: Base-Base interactions energy: -107.720 where: short stacking energy: -97.837 Base-Backbone interact. energy: -0.476 local terms energy: -233.291660 where: bonds (distance) C4'-P energy: -76.003 bonds (distance) P-C4' energy: -69.620 flat angles C4'-P-C4' energy: -53.721 flat angles P-C4'-P energy: -41.572 tors. eta vs tors. theta energy: 7.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -305.536280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.536280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.536280 (E_RNA) where: Base-Base interactions energy: -81.095 where: short stacking energy: -80.706 Base-Backbone interact. energy: -1.185 local terms energy: -223.256853 where: bonds (distance) C4'-P energy: -59.048 bonds (distance) P-C4' energy: -79.232 flat angles C4'-P-C4' energy: -57.349 flat angles P-C4'-P energy: -37.682 tors. eta vs tors. theta energy: 10.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -627.061309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.061309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.061309 (E_RNA) where: Base-Base interactions energy: -249.306 where: short stacking energy: -249.306 Base-Backbone interact. energy: 1.840 local terms energy: -379.596245 where: bonds (distance) C4'-P energy: -87.079 bonds (distance) P-C4' energy: -95.074 flat angles C4'-P-C4' energy: -74.121 flat angles P-C4'-P energy: -56.269 tors. eta vs tors. theta energy: -67.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -605.619400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.619400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.619400 (E_RNA) where: Base-Base interactions energy: -258.248 where: short stacking energy: -239.387 Base-Backbone interact. energy: 1.612 local terms energy: -348.983834 where: bonds (distance) C4'-P energy: -81.200 bonds (distance) P-C4' energy: -77.769 flat angles C4'-P-C4' energy: -84.466 flat angles P-C4'-P energy: -51.005 tors. eta vs tors. theta energy: -54.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -555.155175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.155175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.155175 (E_RNA) where: Base-Base interactions energy: -230.708 where: short stacking energy: -218.499 Base-Backbone interact. energy: -0.154 local terms energy: -324.292710 where: bonds (distance) C4'-P energy: -83.745 bonds (distance) P-C4' energy: -89.015 flat angles C4'-P-C4' energy: -70.028 flat angles P-C4'-P energy: -47.630 tors. eta vs tors. theta energy: -33.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -498.560484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.560484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.560484 (E_RNA) where: Base-Base interactions energy: -200.918 where: short stacking energy: -182.438 Base-Backbone interact. energy: 0.031 local terms energy: -297.673659 where: bonds (distance) C4'-P energy: -78.367 bonds (distance) P-C4' energy: -75.842 flat angles C4'-P-C4' energy: -71.768 flat angles P-C4'-P energy: -48.377 tors. eta vs tors. theta energy: -23.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -453.532166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.532166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.532166 (E_RNA) where: Base-Base interactions energy: -176.530 where: short stacking energy: -173.239 Base-Backbone interact. energy: 3.023 local terms energy: -280.024889 where: bonds (distance) C4'-P energy: -62.436 bonds (distance) P-C4' energy: -81.840 flat angles C4'-P-C4' energy: -69.064 flat angles P-C4'-P energy: -36.660 tors. eta vs tors. theta energy: -30.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -405.043904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.043904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.043904 (E_RNA) where: Base-Base interactions energy: -147.842 where: short stacking energy: -134.564 Base-Backbone interact. energy: -0.999 local terms energy: -256.203663 where: bonds (distance) C4'-P energy: -77.513 bonds (distance) P-C4' energy: -68.935 flat angles C4'-P-C4' energy: -70.241 flat angles P-C4'-P energy: -31.895 tors. eta vs tors. theta energy: -7.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -393.126022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.126022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.126022 (E_RNA) where: Base-Base interactions energy: -128.590 where: short stacking energy: -128.546 Base-Backbone interact. energy: 0.563 local terms energy: -265.098937 where: bonds (distance) C4'-P energy: -71.955 bonds (distance) P-C4' energy: -75.833 flat angles C4'-P-C4' energy: -65.985 flat angles P-C4'-P energy: -42.417 tors. eta vs tors. theta energy: -8.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -341.701311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.701311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.701311 (E_RNA) where: Base-Base interactions energy: -113.633 where: short stacking energy: -114.381 Base-Backbone interact. energy: 3.831 local terms energy: -231.900125 where: bonds (distance) C4'-P energy: -56.982 bonds (distance) P-C4' energy: -82.002 flat angles C4'-P-C4' energy: -64.821 flat angles P-C4'-P energy: -34.751 tors. eta vs tors. theta energy: 6.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -379.269542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.269542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.669542 (E_RNA) where: Base-Base interactions energy: -132.020 where: short stacking energy: -107.408 Base-Backbone interact. energy: -0.617 local terms energy: -234.032088 where: bonds (distance) C4'-P energy: -73.021 bonds (distance) P-C4' energy: -67.568 flat angles C4'-P-C4' energy: -60.566 flat angles P-C4'-P energy: -33.596 tors. eta vs tors. theta energy: 0.719 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -305.726901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.726901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.726901 (E_RNA) where: Base-Base interactions energy: -87.219 where: short stacking energy: -74.479 Base-Backbone interact. energy: -1.219 local terms energy: -217.289455 where: bonds (distance) C4'-P energy: -75.611 bonds (distance) P-C4' energy: -63.028 flat angles C4'-P-C4' energy: -64.848 flat angles P-C4'-P energy: -33.458 tors. eta vs tors. theta energy: 19.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -680.027933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.027933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.027933 (E_RNA) where: Base-Base interactions energy: -282.728 where: short stacking energy: -281.063 Base-Backbone interact. energy: 0.510 local terms energy: -397.809465 where: bonds (distance) C4'-P energy: -66.011 bonds (distance) P-C4' energy: -92.514 flat angles C4'-P-C4' energy: -91.100 flat angles P-C4'-P energy: -58.246 tors. eta vs tors. theta energy: -89.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -622.732061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.732061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.732061 (E_RNA) where: Base-Base interactions energy: -278.985 where: short stacking energy: -243.352 Base-Backbone interact. energy: 0.571 local terms energy: -344.318141 where: bonds (distance) C4'-P energy: -86.712 bonds (distance) P-C4' energy: -76.151 flat angles C4'-P-C4' energy: -84.032 flat angles P-C4'-P energy: -49.543 tors. eta vs tors. theta energy: -47.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -540.240185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.240185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.240185 (E_RNA) where: Base-Base interactions energy: -236.003 where: short stacking energy: -212.783 Base-Backbone interact. energy: -1.619 local terms energy: -302.617872 where: bonds (distance) C4'-P energy: -77.106 bonds (distance) P-C4' energy: -78.790 flat angles C4'-P-C4' energy: -82.209 flat angles P-C4'-P energy: -35.088 tors. eta vs tors. theta energy: -29.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -550.389052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.389052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.389052 (E_RNA) where: Base-Base interactions energy: -248.462 where: short stacking energy: -238.253 Base-Backbone interact. energy: -0.181 local terms energy: -301.746140 where: bonds (distance) C4'-P energy: -73.956 bonds (distance) P-C4' energy: -85.220 flat angles C4'-P-C4' energy: -68.144 flat angles P-C4'-P energy: -21.488 tors. eta vs tors. theta energy: -52.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -446.941073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.941073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.941073 (E_RNA) where: Base-Base interactions energy: -154.808 where: short stacking energy: -129.726 Base-Backbone interact. energy: 0.252 local terms energy: -292.385377 where: bonds (distance) C4'-P energy: -74.937 bonds (distance) P-C4' energy: -82.738 flat angles C4'-P-C4' energy: -73.031 flat angles P-C4'-P energy: -43.724 tors. eta vs tors. theta energy: -17.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -460.277029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.277029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.277029 (E_RNA) where: Base-Base interactions energy: -171.528 where: short stacking energy: -150.519 Base-Backbone interact. energy: 6.687 local terms energy: -295.436269 where: bonds (distance) C4'-P energy: -75.334 bonds (distance) P-C4' energy: -76.593 flat angles C4'-P-C4' energy: -66.765 flat angles P-C4'-P energy: -56.781 tors. eta vs tors. theta energy: -19.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -414.206580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.206580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.406580 (E_RNA) where: Base-Base interactions energy: -156.564 where: short stacking energy: -132.935 Base-Backbone interact. energy: 0.524 local terms energy: -256.366130 where: bonds (distance) C4'-P energy: -72.859 bonds (distance) P-C4' energy: -80.793 flat angles C4'-P-C4' energy: -66.690 flat angles P-C4'-P energy: -24.708 tors. eta vs tors. theta energy: -11.317 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -373.074445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.074445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.074445 (E_RNA) where: Base-Base interactions energy: -143.074 where: short stacking energy: -127.922 Base-Backbone interact. energy: -0.721 local terms energy: -229.279399 where: bonds (distance) C4'-P energy: -57.266 bonds (distance) P-C4' energy: -59.180 flat angles C4'-P-C4' energy: -69.307 flat angles P-C4'-P energy: -29.650 tors. eta vs tors. theta energy: -13.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -354.846472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.846472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.046472 (E_RNA) where: Base-Base interactions energy: -88.278 where: short stacking energy: -74.934 Base-Backbone interact. energy: 2.094 local terms energy: -257.862897 where: bonds (distance) C4'-P energy: -79.855 bonds (distance) P-C4' energy: -75.716 flat angles C4'-P-C4' energy: -74.141 flat angles P-C4'-P energy: -43.450 tors. eta vs tors. theta energy: 15.300 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -256.801054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.801054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.801054 (E_RNA) where: Base-Base interactions energy: -70.787 where: short stacking energy: -49.998 Base-Backbone interact. energy: -1.327 local terms energy: -184.687366 where: bonds (distance) C4'-P energy: -75.975 bonds (distance) P-C4' energy: -66.616 flat angles C4'-P-C4' energy: -58.550 flat angles P-C4'-P energy: -19.216 tors. eta vs tors. theta energy: 35.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -676.658024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -676.658024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.658024 (E_RNA) where: Base-Base interactions energy: -284.735 where: short stacking energy: -280.147 Base-Backbone interact. energy: 0.954 local terms energy: -392.876130 where: bonds (distance) C4'-P energy: -75.960 bonds (distance) P-C4' energy: -90.827 flat angles C4'-P-C4' energy: -84.740 flat angles P-C4'-P energy: -69.563 tors. eta vs tors. theta energy: -71.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -612.357911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.357911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.357911 (E_RNA) where: Base-Base interactions energy: -270.756 where: short stacking energy: -227.347 Base-Backbone interact. energy: -0.296 local terms energy: -341.306382 where: bonds (distance) C4'-P energy: -74.639 bonds (distance) P-C4' energy: -80.219 flat angles C4'-P-C4' energy: -76.970 flat angles P-C4'-P energy: -63.059 tors. eta vs tors. theta energy: -46.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -590.363825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.363825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.363825 (E_RNA) where: Base-Base interactions energy: -250.322 where: short stacking energy: -225.044 Base-Backbone interact. energy: -0.468 local terms energy: -339.574439 where: bonds (distance) C4'-P energy: -82.608 bonds (distance) P-C4' energy: -81.505 flat angles C4'-P-C4' energy: -75.871 flat angles P-C4'-P energy: -52.584 tors. eta vs tors. theta energy: -47.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -524.493935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.493935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.493935 (E_RNA) where: Base-Base interactions energy: -236.317 where: short stacking energy: -220.556 Base-Backbone interact. energy: 1.540 local terms energy: -289.716066 where: bonds (distance) C4'-P energy: -73.992 bonds (distance) P-C4' energy: -78.832 flat angles C4'-P-C4' energy: -65.782 flat angles P-C4'-P energy: -38.364 tors. eta vs tors. theta energy: -32.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -455.662928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.662928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.662928 (E_RNA) where: Base-Base interactions energy: -176.638 where: short stacking energy: -161.626 Base-Backbone interact. energy: -1.498 local terms energy: -277.526307 where: bonds (distance) C4'-P energy: -73.182 bonds (distance) P-C4' energy: -88.058 flat angles C4'-P-C4' energy: -57.174 flat angles P-C4'-P energy: -45.667 tors. eta vs tors. theta energy: -13.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -431.599386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.599386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.599386 (E_RNA) where: Base-Base interactions energy: -151.566 where: short stacking energy: -149.495 Base-Backbone interact. energy: -0.890 local terms energy: -279.143078 where: bonds (distance) C4'-P energy: -76.417 bonds (distance) P-C4' energy: -70.032 flat angles C4'-P-C4' energy: -72.141 flat angles P-C4'-P energy: -42.855 tors. eta vs tors. theta energy: -17.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -416.785260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.785260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.785260 (E_RNA) where: Base-Base interactions energy: -157.229 where: short stacking energy: -117.817 Base-Backbone interact. energy: -1.071 local terms energy: -249.485213 where: bonds (distance) C4'-P energy: -72.298 bonds (distance) P-C4' energy: -64.171 flat angles C4'-P-C4' energy: -70.799 flat angles P-C4'-P energy: -41.032 tors. eta vs tors. theta energy: -1.185 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -358.874356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.874356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.874356 (E_RNA) where: Base-Base interactions energy: -112.936 where: short stacking energy: -100.882 Base-Backbone interact. energy: -2.346 local terms energy: -234.592168 where: bonds (distance) C4'-P energy: -49.462 bonds (distance) P-C4' energy: -75.907 flat angles C4'-P-C4' energy: -58.954 flat angles P-C4'-P energy: -47.370 tors. eta vs tors. theta energy: -2.899 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -362.309559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.309559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.309559 (E_RNA) where: Base-Base interactions energy: -122.238 where: short stacking energy: -118.229 Base-Backbone interact. energy: 2.294 local terms energy: -242.365738 where: bonds (distance) C4'-P energy: -59.979 bonds (distance) P-C4' energy: -81.964 flat angles C4'-P-C4' energy: -65.469 flat angles P-C4'-P energy: -37.776 tors. eta vs tors. theta energy: 2.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -296.587695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.587695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.587695 (E_RNA) where: Base-Base interactions energy: -115.788 where: short stacking energy: -81.954 Base-Backbone interact. energy: -1.865 local terms energy: -178.934762 where: bonds (distance) C4'-P energy: -50.633 bonds (distance) P-C4' energy: -67.775 flat angles C4'-P-C4' energy: -53.807 flat angles P-C4'-P energy: -12.573 tors. eta vs tors. theta energy: 5.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -640.496616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.496616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.496616 (E_RNA) where: Base-Base interactions energy: -284.690 where: short stacking energy: -284.690 Base-Backbone interact. energy: -0.257 local terms energy: -355.549018 where: bonds (distance) C4'-P energy: -82.091 bonds (distance) P-C4' energy: -76.476 flat angles C4'-P-C4' energy: -72.911 flat angles P-C4'-P energy: -57.812 tors. eta vs tors. theta energy: -66.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -623.860501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.860501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.860501 (E_RNA) where: Base-Base interactions energy: -269.018 where: short stacking energy: -241.755 Base-Backbone interact. energy: -0.448 local terms energy: -354.394593 where: bonds (distance) C4'-P energy: -75.478 bonds (distance) P-C4' energy: -91.520 flat angles C4'-P-C4' energy: -81.147 flat angles P-C4'-P energy: -46.658 tors. eta vs tors. theta energy: -59.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -600.010709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.010709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.010709 (E_RNA) where: Base-Base interactions energy: -262.214 where: short stacking energy: -226.707 Base-Backbone interact. energy: 0.224 local terms energy: -338.020033 where: bonds (distance) C4'-P energy: -76.693 bonds (distance) P-C4' energy: -82.261 flat angles C4'-P-C4' energy: -81.897 flat angles P-C4'-P energy: -57.213 tors. eta vs tors. theta energy: -39.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -509.774140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.774140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.774140 (E_RNA) where: Base-Base interactions energy: -193.350 where: short stacking energy: -169.076 Base-Backbone interact. energy: -0.435 local terms energy: -315.989772 where: bonds (distance) C4'-P energy: -81.823 bonds (distance) P-C4' energy: -78.128 flat angles C4'-P-C4' energy: -74.737 flat angles P-C4'-P energy: -40.725 tors. eta vs tors. theta energy: -40.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -432.447955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.447955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.447955 (E_RNA) where: Base-Base interactions energy: -163.157 where: short stacking energy: -161.803 Base-Backbone interact. energy: 4.117 local terms energy: -273.407432 where: bonds (distance) C4'-P energy: -62.602 bonds (distance) P-C4' energy: -85.777 flat angles C4'-P-C4' energy: -80.448 flat angles P-C4'-P energy: -33.702 tors. eta vs tors. theta energy: -10.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -390.976842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.976842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.176842 (E_RNA) where: Base-Base interactions energy: -133.748 where: short stacking energy: -129.290 Base-Backbone interact. energy: -0.317 local terms energy: -255.111757 where: bonds (distance) C4'-P energy: -61.821 bonds (distance) P-C4' energy: -70.557 flat angles C4'-P-C4' energy: -67.708 flat angles P-C4'-P energy: -42.686 tors. eta vs tors. theta energy: -12.340 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -404.157466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.157466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.757466 (E_RNA) where: Base-Base interactions energy: -142.577 where: short stacking energy: -125.955 Base-Backbone interact. energy: -0.050 local terms energy: -247.130314 where: bonds (distance) C4'-P energy: -73.105 bonds (distance) P-C4' energy: -81.567 flat angles C4'-P-C4' energy: -54.302 flat angles P-C4'-P energy: -39.264 tors. eta vs tors. theta energy: 1.108 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -368.344202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.344202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.544202 (E_RNA) where: Base-Base interactions energy: -109.630 where: short stacking energy: -94.387 Base-Backbone interact. energy: -0.665 local terms energy: -247.250038 where: bonds (distance) C4'-P energy: -50.420 bonds (distance) P-C4' energy: -76.748 flat angles C4'-P-C4' energy: -65.607 flat angles P-C4'-P energy: -56.585 tors. eta vs tors. theta energy: 2.110 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -376.726760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.726760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.526760 (E_RNA) where: Base-Base interactions energy: -146.995 where: short stacking energy: -106.971 Base-Backbone interact. energy: 0.509 local terms energy: -223.040878 where: bonds (distance) C4'-P energy: -64.970 bonds (distance) P-C4' energy: -73.258 flat angles C4'-P-C4' energy: -60.543 flat angles P-C4'-P energy: -32.526 tors. eta vs tors. theta energy: 8.256 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -319.580465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.580465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.580465 (E_RNA) where: Base-Base interactions energy: -102.104 where: short stacking energy: -91.820 Base-Backbone interact. energy: 1.252 local terms energy: -218.727935 where: bonds (distance) C4'-P energy: -65.463 bonds (distance) P-C4' energy: -59.225 flat angles C4'-P-C4' energy: -66.552 flat angles P-C4'-P energy: -36.174 tors. eta vs tors. theta energy: 8.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -658.534218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.534218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -658.534218 (E_RNA) where: Base-Base interactions energy: -294.641 where: short stacking energy: -293.859 Base-Backbone interact. energy: -0.087 local terms energy: -363.806232 where: bonds (distance) C4'-P energy: -80.351 bonds (distance) P-C4' energy: -78.098 flat angles C4'-P-C4' energy: -76.953 flat angles P-C4'-P energy: -56.238 tors. eta vs tors. theta energy: -72.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -641.640224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.640224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.640224 (E_RNA) where: Base-Base interactions energy: -283.140 where: short stacking energy: -246.930 Base-Backbone interact. energy: -0.111 local terms energy: -358.388859 where: bonds (distance) C4'-P energy: -76.508 bonds (distance) P-C4' energy: -79.567 flat angles C4'-P-C4' energy: -78.767 flat angles P-C4'-P energy: -52.970 tors. eta vs tors. theta energy: -70.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -552.270962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.270962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.270962 (E_RNA) where: Base-Base interactions energy: -237.212 where: short stacking energy: -199.721 Base-Backbone interact. energy: -0.596 local terms energy: -314.462251 where: bonds (distance) C4'-P energy: -81.845 bonds (distance) P-C4' energy: -68.152 flat angles C4'-P-C4' energy: -69.969 flat angles P-C4'-P energy: -56.154 tors. eta vs tors. theta energy: -38.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -536.646531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.646531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.646531 (E_RNA) where: Base-Base interactions energy: -226.113 where: short stacking energy: -219.480 Base-Backbone interact. energy: -0.486 local terms energy: -310.047482 where: bonds (distance) C4'-P energy: -70.438 bonds (distance) P-C4' energy: -76.222 flat angles C4'-P-C4' energy: -75.630 flat angles P-C4'-P energy: -49.856 tors. eta vs tors. theta energy: -37.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -437.660185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.660185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.660185 (E_RNA) where: Base-Base interactions energy: -151.824 where: short stacking energy: -145.916 Base-Backbone interact. energy: -0.673 local terms energy: -285.163071 where: bonds (distance) C4'-P energy: -74.910 bonds (distance) P-C4' energy: -78.257 flat angles C4'-P-C4' energy: -71.771 flat angles P-C4'-P energy: -41.071 tors. eta vs tors. theta energy: -19.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -430.125819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.125819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.325819 (E_RNA) where: Base-Base interactions energy: -153.632 where: short stacking energy: -149.027 Base-Backbone interact. energy: -0.565 local terms energy: -274.129163 where: bonds (distance) C4'-P energy: -81.707 bonds (distance) P-C4' energy: -79.866 flat angles C4'-P-C4' energy: -58.852 flat angles P-C4'-P energy: -37.739 tors. eta vs tors. theta energy: -15.965 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -403.652228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.652228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.652228 (E_RNA) where: Base-Base interactions energy: -148.677 where: short stacking energy: -107.606 Base-Backbone interact. energy: 0.011 local terms energy: -245.986508 where: bonds (distance) C4'-P energy: -58.626 bonds (distance) P-C4' energy: -82.039 flat angles C4'-P-C4' energy: -69.054 flat angles P-C4'-P energy: -39.609 tors. eta vs tors. theta energy: 3.343 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -382.404353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.404353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.604353 (E_RNA) where: Base-Base interactions energy: -138.663 where: short stacking energy: -106.509 Base-Backbone interact. energy: -0.656 local terms energy: -232.285737 where: bonds (distance) C4'-P energy: -60.724 bonds (distance) P-C4' energy: -72.406 flat angles C4'-P-C4' energy: -70.468 flat angles P-C4'-P energy: -36.990 tors. eta vs tors. theta energy: 8.302 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -340.706084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.706084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.506084 (E_RNA) where: Base-Base interactions energy: -141.817 where: short stacking energy: -88.377 Base-Backbone interact. energy: 3.637 local terms energy: -195.325941 where: bonds (distance) C4'-P energy: -71.455 bonds (distance) P-C4' energy: -70.438 flat angles C4'-P-C4' energy: -48.975 flat angles P-C4'-P energy: -24.461 tors. eta vs tors. theta energy: 20.003 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -294.857241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.857241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.857241 (E_RNA) where: Base-Base interactions energy: -89.750 where: short stacking energy: -76.089 Base-Backbone interact. energy: 1.783 local terms energy: -206.890014 where: bonds (distance) C4'-P energy: -71.268 bonds (distance) P-C4' energy: -59.359 flat angles C4'-P-C4' energy: -52.670 flat angles P-C4'-P energy: -40.488 tors. eta vs tors. theta energy: 16.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -675.254573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.254573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.254573 (E_RNA) where: Base-Base interactions energy: -276.113 where: short stacking energy: -273.338 Base-Backbone interact. energy: -0.087 local terms energy: -399.055107 where: bonds (distance) C4'-P energy: -86.046 bonds (distance) P-C4' energy: -88.109 flat angles C4'-P-C4' energy: -90.774 flat angles P-C4'-P energy: -53.738 tors. eta vs tors. theta energy: -80.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -647.184069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.184069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.184069 (E_RNA) where: Base-Base interactions energy: -307.783 where: short stacking energy: -253.107 Base-Backbone interact. energy: -0.844 local terms energy: -338.556975 where: bonds (distance) C4'-P energy: -73.191 bonds (distance) P-C4' energy: -83.977 flat angles C4'-P-C4' energy: -75.216 flat angles P-C4'-P energy: -62.282 tors. eta vs tors. theta energy: -43.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -551.430483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.430483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.430483 (E_RNA) where: Base-Base interactions energy: -219.524 where: short stacking energy: -218.386 Base-Backbone interact. energy: -0.953 local terms energy: -330.952812 where: bonds (distance) C4'-P energy: -78.646 bonds (distance) P-C4' energy: -81.243 flat angles C4'-P-C4' energy: -74.783 flat angles P-C4'-P energy: -54.292 tors. eta vs tors. theta energy: -41.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -562.738880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.738880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.738880 (E_RNA) where: Base-Base interactions energy: -234.705 where: short stacking energy: -209.448 Base-Backbone interact. energy: 1.811 local terms energy: -329.844742 where: bonds (distance) C4'-P energy: -86.147 bonds (distance) P-C4' energy: -75.361 flat angles C4'-P-C4' energy: -63.966 flat angles P-C4'-P energy: -57.291 tors. eta vs tors. theta energy: -47.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -480.272150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.272150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.472150 (E_RNA) where: Base-Base interactions energy: -184.192 where: short stacking energy: -157.632 Base-Backbone interact. energy: 0.075 local terms energy: -294.354861 where: bonds (distance) C4'-P energy: -75.805 bonds (distance) P-C4' energy: -78.520 flat angles C4'-P-C4' energy: -76.402 flat angles P-C4'-P energy: -43.794 tors. eta vs tors. theta energy: -19.834 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -404.215823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.215823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.215823 (E_RNA) where: Base-Base interactions energy: -136.954 where: short stacking energy: -116.500 Base-Backbone interact. energy: -0.912 local terms energy: -266.349430 where: bonds (distance) C4'-P energy: -77.582 bonds (distance) P-C4' energy: -71.987 flat angles C4'-P-C4' energy: -65.339 flat angles P-C4'-P energy: -50.301 tors. eta vs tors. theta energy: -1.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -423.300246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.300246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.500246 (E_RNA) where: Base-Base interactions energy: -169.327 where: short stacking energy: -137.540 Base-Backbone interact. energy: -1.786 local terms energy: -241.387819 where: bonds (distance) C4'-P energy: -58.996 bonds (distance) P-C4' energy: -77.348 flat angles C4'-P-C4' energy: -65.631 flat angles P-C4'-P energy: -37.418 tors. eta vs tors. theta energy: -1.994 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -375.661966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.661966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.061966 (E_RNA) where: Base-Base interactions energy: -140.006 where: short stacking energy: -98.673 Base-Backbone interact. energy: -1.123 local terms energy: -221.932143 where: bonds (distance) C4'-P energy: -54.160 bonds (distance) P-C4' energy: -84.755 flat angles C4'-P-C4' energy: -51.873 flat angles P-C4'-P energy: -35.036 tors. eta vs tors. theta energy: 3.892 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -359.360389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.360389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.160389 (E_RNA) where: Base-Base interactions energy: -132.057 where: short stacking energy: -98.387 Base-Backbone interact. energy: 2.312 local terms energy: -222.415644 where: bonds (distance) C4'-P energy: -54.326 bonds (distance) P-C4' energy: -80.388 flat angles C4'-P-C4' energy: -68.643 flat angles P-C4'-P energy: -23.240 tors. eta vs tors. theta energy: 4.182 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -300.610767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.610767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.610767 (E_RNA) where: Base-Base interactions energy: -105.760 where: short stacking energy: -101.551 Base-Backbone interact. energy: -2.015 local terms energy: -192.835491 where: bonds (distance) C4'-P energy: -57.337 bonds (distance) P-C4' energy: -71.781 flat angles C4'-P-C4' energy: -61.801 flat angles P-C4'-P energy: -19.265 tors. eta vs tors. theta energy: 17.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -655.216887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.216887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.216887 (E_RNA) where: Base-Base interactions energy: -283.486 where: short stacking energy: -281.340 Base-Backbone interact. energy: -1.286 local terms energy: -370.445169 where: bonds (distance) C4'-P energy: -80.026 bonds (distance) P-C4' energy: -74.067 flat angles C4'-P-C4' energy: -84.152 flat angles P-C4'-P energy: -55.575 tors. eta vs tors. theta energy: -76.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -640.257205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.257205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.257205 (E_RNA) where: Base-Base interactions energy: -299.371 where: short stacking energy: -238.863 Base-Backbone interact. energy: -0.764 local terms energy: -340.122247 where: bonds (distance) C4'-P energy: -76.184 bonds (distance) P-C4' energy: -80.783 flat angles C4'-P-C4' energy: -71.398 flat angles P-C4'-P energy: -52.355 tors. eta vs tors. theta energy: -59.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -592.882596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.882596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.882596 (E_RNA) where: Base-Base interactions energy: -244.197 where: short stacking energy: -232.810 Base-Backbone interact. energy: -0.778 local terms energy: -347.907093 where: bonds (distance) C4'-P energy: -84.102 bonds (distance) P-C4' energy: -83.146 flat angles C4'-P-C4' energy: -72.025 flat angles P-C4'-P energy: -53.806 tors. eta vs tors. theta energy: -54.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -520.888297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.888297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.888297 (E_RNA) where: Base-Base interactions energy: -202.598 where: short stacking energy: -196.254 Base-Backbone interact. energy: -0.914 local terms energy: -317.375494 where: bonds (distance) C4'-P energy: -71.315 bonds (distance) P-C4' energy: -90.352 flat angles C4'-P-C4' energy: -65.228 flat angles P-C4'-P energy: -42.057 tors. eta vs tors. theta energy: -48.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -485.814766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.814766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.814766 (E_RNA) where: Base-Base interactions energy: -183.310 where: short stacking energy: -168.403 Base-Backbone interact. energy: -0.788 local terms energy: -301.716810 where: bonds (distance) C4'-P energy: -65.608 bonds (distance) P-C4' energy: -85.738 flat angles C4'-P-C4' energy: -81.345 flat angles P-C4'-P energy: -43.810 tors. eta vs tors. theta energy: -25.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -456.912858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.912858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.312858 (E_RNA) where: Base-Base interactions energy: -194.503 where: short stacking energy: -138.359 Base-Backbone interact. energy: -0.767 local terms energy: -249.043056 where: bonds (distance) C4'-P energy: -68.475 bonds (distance) P-C4' energy: -76.478 flat angles C4'-P-C4' energy: -60.130 flat angles P-C4'-P energy: -34.506 tors. eta vs tors. theta energy: -9.455 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -376.937243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.937243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.937243 (E_RNA) where: Base-Base interactions energy: -136.586 where: short stacking energy: -125.822 Base-Backbone interact. energy: -0.326 local terms energy: -240.025922 where: bonds (distance) C4'-P energy: -75.083 bonds (distance) P-C4' energy: -65.852 flat angles C4'-P-C4' energy: -66.060 flat angles P-C4'-P energy: -35.786 tors. eta vs tors. theta energy: 2.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -381.773593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.773593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.373593 (E_RNA) where: Base-Base interactions energy: -153.680 where: short stacking energy: -96.270 Base-Backbone interact. energy: 0.389 local terms energy: -214.081958 where: bonds (distance) C4'-P energy: -67.047 bonds (distance) P-C4' energy: -81.401 flat angles C4'-P-C4' energy: -47.645 flat angles P-C4'-P energy: -31.085 tors. eta vs tors. theta energy: 13.096 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -363.509726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.509726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.509726 (E_RNA) where: Base-Base interactions energy: -147.737 where: short stacking energy: -112.345 Base-Backbone interact. energy: -1.432 local terms energy: -214.341240 where: bonds (distance) C4'-P energy: -52.908 bonds (distance) P-C4' energy: -70.161 flat angles C4'-P-C4' energy: -56.867 flat angles P-C4'-P energy: -42.411 tors. eta vs tors. theta energy: 8.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -302.975343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.975343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.975343 (E_RNA) where: Base-Base interactions energy: -91.640 where: short stacking energy: -79.313 Base-Backbone interact. energy: 0.265 local terms energy: -211.600694 where: bonds (distance) C4'-P energy: -68.948 bonds (distance) P-C4' energy: -67.697 flat angles C4'-P-C4' energy: -48.228 flat angles P-C4'-P energy: -41.196 tors. eta vs tors. theta energy: 14.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -677.014806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.014806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.014806 (E_RNA) where: Base-Base interactions energy: -301.918 where: short stacking energy: -294.679 Base-Backbone interact. energy: -0.535 local terms energy: -374.561944 where: bonds (distance) C4'-P energy: -81.978 bonds (distance) P-C4' energy: -80.681 flat angles C4'-P-C4' energy: -83.532 flat angles P-C4'-P energy: -49.032 tors. eta vs tors. theta energy: -79.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -675.291150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.291150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.291150 (E_RNA) where: Base-Base interactions energy: -319.720 where: short stacking energy: -258.020 Base-Backbone interact. energy: -1.203 local terms energy: -354.368225 where: bonds (distance) C4'-P energy: -75.083 bonds (distance) P-C4' energy: -90.930 flat angles C4'-P-C4' energy: -74.773 flat angles P-C4'-P energy: -45.274 tors. eta vs tors. theta energy: -68.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -591.624112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.624112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.624112 (E_RNA) where: Base-Base interactions energy: -235.984 where: short stacking energy: -225.503 Base-Backbone interact. energy: -0.324 local terms energy: -355.316204 where: bonds (distance) C4'-P energy: -82.134 bonds (distance) P-C4' energy: -79.620 flat angles C4'-P-C4' energy: -80.107 flat angles P-C4'-P energy: -59.211 tors. eta vs tors. theta energy: -54.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -498.772432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.772432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.772432 (E_RNA) where: Base-Base interactions energy: -211.518 where: short stacking energy: -175.459 Base-Backbone interact. energy: 2.217 local terms energy: -289.471891 where: bonds (distance) C4'-P energy: -59.160 bonds (distance) P-C4' energy: -72.506 flat angles C4'-P-C4' energy: -84.784 flat angles P-C4'-P energy: -35.718 tors. eta vs tors. theta energy: -37.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -489.966564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.966564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.966564 (E_RNA) where: Base-Base interactions energy: -206.965 where: short stacking energy: -167.679 Base-Backbone interact. energy: 0.088 local terms energy: -265.089290 where: bonds (distance) C4'-P energy: -75.445 bonds (distance) P-C4' energy: -65.015 flat angles C4'-P-C4' energy: -63.521 flat angles P-C4'-P energy: -49.783 tors. eta vs tors. theta energy: -11.325 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -480.646042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.646042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.646042 (E_RNA) where: Base-Base interactions energy: -211.348 where: short stacking energy: -169.626 Base-Backbone interact. energy: -0.369 local terms energy: -268.929542 where: bonds (distance) C4'-P energy: -61.809 bonds (distance) P-C4' energy: -79.114 flat angles C4'-P-C4' energy: -74.046 flat angles P-C4'-P energy: -25.820 tors. eta vs tors. theta energy: -28.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -400.318961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.318961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.118961 (E_RNA) where: Base-Base interactions energy: -144.525 where: short stacking energy: -109.057 Base-Backbone interact. energy: -0.255 local terms energy: -248.338757 where: bonds (distance) C4'-P energy: -71.714 bonds (distance) P-C4' energy: -77.633 flat angles C4'-P-C4' energy: -60.462 flat angles P-C4'-P energy: -42.242 tors. eta vs tors. theta energy: 3.713 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -357.151934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.151934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.151934 (E_RNA) where: Base-Base interactions energy: -109.338 where: short stacking energy: -104.473 Base-Backbone interact. energy: 4.119 local terms energy: -251.932884 where: bonds (distance) C4'-P energy: -69.305 bonds (distance) P-C4' energy: -79.379 flat angles C4'-P-C4' energy: -62.403 flat angles P-C4'-P energy: -35.987 tors. eta vs tors. theta energy: -4.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -390.652416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.652416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.652416 (E_RNA) where: Base-Base interactions energy: -155.120 where: short stacking energy: -120.202 Base-Backbone interact. energy: -0.750 local terms energy: -234.782176 where: bonds (distance) C4'-P energy: -62.418 bonds (distance) P-C4' energy: -77.875 flat angles C4'-P-C4' energy: -52.435 flat angles P-C4'-P energy: -30.859 tors. eta vs tors. theta energy: -11.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -301.264321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.264321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.264321 (E_RNA) where: Base-Base interactions energy: -113.158 where: short stacking energy: -85.215 Base-Backbone interact. energy: -0.831 local terms energy: -187.275202 where: bonds (distance) C4'-P energy: -70.133 bonds (distance) P-C4' energy: -63.283 flat angles C4'-P-C4' energy: -47.645 flat angles P-C4'-P energy: -23.604 tors. eta vs tors. theta energy: 17.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -647.854482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.854482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.854482 (E_RNA) where: Base-Base interactions energy: -277.865 where: short stacking energy: -275.587 Base-Backbone interact. energy: -0.280 local terms energy: -369.709445 where: bonds (distance) C4'-P energy: -75.295 bonds (distance) P-C4' energy: -87.704 flat angles C4'-P-C4' energy: -81.882 flat angles P-C4'-P energy: -56.069 tors. eta vs tors. theta energy: -68.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -653.750843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.750843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.750843 (E_RNA) where: Base-Base interactions energy: -311.106 where: short stacking energy: -216.131 Base-Backbone interact. energy: 3.048 local terms energy: -345.692750 where: bonds (distance) C4'-P energy: -83.808 bonds (distance) P-C4' energy: -89.296 flat angles C4'-P-C4' energy: -84.017 flat angles P-C4'-P energy: -44.421 tors. eta vs tors. theta energy: -44.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -557.834198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.834198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.834198 (E_RNA) where: Base-Base interactions energy: -217.362 where: short stacking energy: -195.261 Base-Backbone interact. energy: -0.942 local terms energy: -339.530827 where: bonds (distance) C4'-P energy: -78.796 bonds (distance) P-C4' energy: -83.305 flat angles C4'-P-C4' energy: -89.903 flat angles P-C4'-P energy: -47.868 tors. eta vs tors. theta energy: -39.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -514.174403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.174403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.174403 (E_RNA) where: Base-Base interactions energy: -211.862 where: short stacking energy: -181.686 Base-Backbone interact. energy: 4.263 local terms energy: -288.575313 where: bonds (distance) C4'-P energy: -63.736 bonds (distance) P-C4' energy: -79.674 flat angles C4'-P-C4' energy: -71.223 flat angles P-C4'-P energy: -54.419 tors. eta vs tors. theta energy: -19.524 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -516.004168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.004168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.004168 (E_RNA) where: Base-Base interactions energy: -223.328 where: short stacking energy: -172.045 Base-Backbone interact. energy: -1.562 local terms energy: -291.114271 where: bonds (distance) C4'-P energy: -76.801 bonds (distance) P-C4' energy: -62.331 flat angles C4'-P-C4' energy: -71.357 flat angles P-C4'-P energy: -40.604 tors. eta vs tors. theta energy: -40.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -403.545660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.545660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.545660 (E_RNA) where: Base-Base interactions energy: -141.761 where: short stacking energy: -110.698 Base-Backbone interact. energy: -1.268 local terms energy: -260.517376 where: bonds (distance) C4'-P energy: -69.946 bonds (distance) P-C4' energy: -74.351 flat angles C4'-P-C4' energy: -73.683 flat angles P-C4'-P energy: -35.556 tors. eta vs tors. theta energy: -6.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -455.586015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.586015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.186015 (E_RNA) where: Base-Base interactions energy: -196.003 where: short stacking energy: -145.832 Base-Backbone interact. energy: 0.128 local terms energy: -245.310874 where: bonds (distance) C4'-P energy: -77.964 bonds (distance) P-C4' energy: -78.107 flat angles C4'-P-C4' energy: -70.121 flat angles P-C4'-P energy: -18.697 tors. eta vs tors. theta energy: -0.421 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -369.335250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.335250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.335250 (E_RNA) where: Base-Base interactions energy: -135.033 where: short stacking energy: -102.759 Base-Backbone interact. energy: -2.281 local terms energy: -232.021845 where: bonds (distance) C4'-P energy: -63.887 bonds (distance) P-C4' energy: -74.855 flat angles C4'-P-C4' energy: -67.500 flat angles P-C4'-P energy: -28.669 tors. eta vs tors. theta energy: 2.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -359.514927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.514927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.514927 (E_RNA) where: Base-Base interactions energy: -126.379 where: short stacking energy: -112.939 Base-Backbone interact. energy: -0.259 local terms energy: -232.876891 where: bonds (distance) C4'-P energy: -68.921 bonds (distance) P-C4' energy: -58.568 flat angles C4'-P-C4' energy: -68.211 flat angles P-C4'-P energy: -34.223 tors. eta vs tors. theta energy: -2.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -282.582667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.582667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.582667 (E_RNA) where: Base-Base interactions energy: -78.510 where: short stacking energy: -61.580 Base-Backbone interact. energy: -0.370 local terms energy: -203.703344 where: bonds (distance) C4'-P energy: -49.495 bonds (distance) P-C4' energy: -77.211 flat angles C4'-P-C4' energy: -52.577 flat angles P-C4'-P energy: -40.794 tors. eta vs tors. theta energy: 16.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -734.869040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.869040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.869040 (E_RNA) where: Base-Base interactions energy: -367.581 where: short stacking energy: -280.112 Base-Backbone interact. energy: -0.515 local terms energy: -366.772428 where: bonds (distance) C4'-P energy: -82.617 bonds (distance) P-C4' energy: -87.770 flat angles C4'-P-C4' energy: -85.387 flat angles P-C4'-P energy: -50.318 tors. eta vs tors. theta energy: -60.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -651.547928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.547928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.547928 (E_RNA) where: Base-Base interactions energy: -269.176 where: short stacking energy: -263.124 Base-Backbone interact. energy: 0.370 local terms energy: -382.741637 where: bonds (distance) C4'-P energy: -84.654 bonds (distance) P-C4' energy: -83.942 flat angles C4'-P-C4' energy: -83.630 flat angles P-C4'-P energy: -60.336 tors. eta vs tors. theta energy: -70.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -549.938624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.938624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.938624 (E_RNA) where: Base-Base interactions energy: -230.640 where: short stacking energy: -210.102 Base-Backbone interact. energy: 0.855 local terms energy: -320.153673 where: bonds (distance) C4'-P energy: -84.503 bonds (distance) P-C4' energy: -82.540 flat angles C4'-P-C4' energy: -77.199 flat angles P-C4'-P energy: -43.756 tors. eta vs tors. theta energy: -32.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -523.406967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.406967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.206967 (E_RNA) where: Base-Base interactions energy: -215.664 where: short stacking energy: -183.742 Base-Backbone interact. energy: 2.623 local terms energy: -294.166208 where: bonds (distance) C4'-P energy: -80.326 bonds (distance) P-C4' energy: -80.702 flat angles C4'-P-C4' energy: -67.974 flat angles P-C4'-P energy: -47.174 tors. eta vs tors. theta energy: -17.991 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -498.487670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.487670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.487670 (E_RNA) where: Base-Base interactions energy: -221.692 where: short stacking energy: -153.258 Base-Backbone interact. energy: -0.528 local terms energy: -276.267750 where: bonds (distance) C4'-P energy: -72.926 bonds (distance) P-C4' energy: -75.359 flat angles C4'-P-C4' energy: -74.888 flat angles P-C4'-P energy: -44.874 tors. eta vs tors. theta energy: -8.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -388.648576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.648576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.848576 (E_RNA) where: Base-Base interactions energy: -139.642 where: short stacking energy: -121.251 Base-Backbone interact. energy: 4.130 local terms energy: -251.336586 where: bonds (distance) C4'-P energy: -65.062 bonds (distance) P-C4' energy: -81.947 flat angles C4'-P-C4' energy: -67.006 flat angles P-C4'-P energy: -35.926 tors. eta vs tors. theta energy: -1.395 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -447.616104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.616104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.416104 (E_RNA) where: Base-Base interactions energy: -183.605 where: short stacking energy: -124.863 Base-Backbone interact. energy: -0.088 local terms energy: -247.722623 where: bonds (distance) C4'-P energy: -71.232 bonds (distance) P-C4' energy: -57.830 flat angles C4'-P-C4' energy: -68.026 flat angles P-C4'-P energy: -41.083 tors. eta vs tors. theta energy: -9.551 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -337.484890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.484890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.484890 (E_RNA) where: Base-Base interactions energy: -125.171 where: short stacking energy: -94.203 Base-Backbone interact. energy: 3.622 local terms energy: -215.935844 where: bonds (distance) C4'-P energy: -62.382 bonds (distance) P-C4' energy: -83.623 flat angles C4'-P-C4' energy: -47.632 flat angles P-C4'-P energy: -32.036 tors. eta vs tors. theta energy: 9.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -310.475041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.475041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.475041 (E_RNA) where: Base-Base interactions energy: -93.223 where: short stacking energy: -76.674 Base-Backbone interact. energy: 2.833 local terms energy: -220.085043 where: bonds (distance) C4'-P energy: -67.865 bonds (distance) P-C4' energy: -78.536 flat angles C4'-P-C4' energy: -50.564 flat angles P-C4'-P energy: -34.062 tors. eta vs tors. theta energy: 10.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -304.450726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.450726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.650726 (E_RNA) where: Base-Base interactions energy: -104.039 where: short stacking energy: -77.506 Base-Backbone interact. energy: -1.081 local terms energy: -197.530627 where: bonds (distance) C4'-P energy: -72.833 bonds (distance) P-C4' energy: -67.229 flat angles C4'-P-C4' energy: -57.630 flat angles P-C4'-P energy: -12.643 tors. eta vs tors. theta energy: 12.805 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -755.343858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.343858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.343858 (E_RNA) where: Base-Base interactions energy: -374.150 where: short stacking energy: -273.964 Base-Backbone interact. energy: -0.811 local terms energy: -380.382704 where: bonds (distance) C4'-P energy: -81.379 bonds (distance) P-C4' energy: -86.575 flat angles C4'-P-C4' energy: -92.543 flat angles P-C4'-P energy: -49.408 tors. eta vs tors. theta energy: -70.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -631.832408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.832408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -631.832408 (E_RNA) where: Base-Base interactions energy: -273.655 where: short stacking energy: -251.843 Base-Backbone interact. energy: -0.039 local terms energy: -358.138493 where: bonds (distance) C4'-P energy: -89.576 bonds (distance) P-C4' energy: -83.053 flat angles C4'-P-C4' energy: -80.743 flat angles P-C4'-P energy: -47.693 tors. eta vs tors. theta energy: -57.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -562.120499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.120499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.320499 (E_RNA) where: Base-Base interactions energy: -240.055 where: short stacking energy: -226.616 Base-Backbone interact. energy: 0.808 local terms energy: -321.073975 where: bonds (distance) C4'-P energy: -76.775 bonds (distance) P-C4' energy: -79.786 flat angles C4'-P-C4' energy: -79.737 flat angles P-C4'-P energy: -42.705 tors. eta vs tors. theta energy: -42.071 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -493.501071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.501071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.501071 (E_RNA) where: Base-Base interactions energy: -190.411 where: short stacking energy: -184.985 Base-Backbone interact. energy: 0.416 local terms energy: -303.505505 where: bonds (distance) C4'-P energy: -62.029 bonds (distance) P-C4' energy: -70.621 flat angles C4'-P-C4' energy: -83.423 flat angles P-C4'-P energy: -51.092 tors. eta vs tors. theta energy: -36.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -542.430856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.430856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.830856 (E_RNA) where: Base-Base interactions energy: -204.613 where: short stacking energy: -158.668 Base-Backbone interact. energy: -0.644 local terms energy: -315.574146 where: bonds (distance) C4'-P energy: -85.629 bonds (distance) P-C4' energy: -78.299 flat angles C4'-P-C4' energy: -85.517 flat angles P-C4'-P energy: -49.044 tors. eta vs tors. theta energy: -17.084 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -465.922205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.922205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.922205 (E_RNA) where: Base-Base interactions energy: -198.312 where: short stacking energy: -137.274 Base-Backbone interact. energy: -0.944 local terms energy: -248.667075 where: bonds (distance) C4'-P energy: -66.245 bonds (distance) P-C4' energy: -69.209 flat angles C4'-P-C4' energy: -69.861 flat angles P-C4'-P energy: -45.498 tors. eta vs tors. theta energy: 2.146 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -329.863458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.863458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.263458 (E_RNA) where: Base-Base interactions energy: -95.216 where: short stacking energy: -89.488 Base-Backbone interact. energy: -1.699 local terms energy: -229.348015 where: bonds (distance) C4'-P energy: -69.615 bonds (distance) P-C4' energy: -77.409 flat angles C4'-P-C4' energy: -53.504 flat angles P-C4'-P energy: -45.047 tors. eta vs tors. theta energy: 16.226 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -377.605890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.605890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.605890 (E_RNA) where: Base-Base interactions energy: -169.584 where: short stacking energy: -105.158 Base-Backbone interact. energy: -2.190 local terms energy: -205.831685 where: bonds (distance) C4'-P energy: -65.648 bonds (distance) P-C4' energy: -69.096 flat angles C4'-P-C4' energy: -66.025 flat angles P-C4'-P energy: -22.462 tors. eta vs tors. theta energy: 17.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -302.708227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.708227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.708227 (E_RNA) where: Base-Base interactions energy: -109.707 where: short stacking energy: -94.814 Base-Backbone interact. energy: -0.199 local terms energy: -192.802158 where: bonds (distance) C4'-P energy: -54.271 bonds (distance) P-C4' energy: -66.418 flat angles C4'-P-C4' energy: -52.981 flat angles P-C4'-P energy: -25.519 tors. eta vs tors. theta energy: 6.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -299.895362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.895362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.895362 (E_RNA) where: Base-Base interactions energy: -89.200 where: short stacking energy: -85.303 Base-Backbone interact. energy: -0.404 local terms energy: -210.291538 where: bonds (distance) C4'-P energy: -63.003 bonds (distance) P-C4' energy: -65.992 flat angles C4'-P-C4' energy: -69.354 flat angles P-C4'-P energy: -22.089 tors. eta vs tors. theta energy: 10.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -731.388245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.388245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.388245 (E_RNA) where: Base-Base interactions energy: -358.878 where: short stacking energy: -256.631 Base-Backbone interact. energy: 0.102 local terms energy: -372.612374 where: bonds (distance) C4'-P energy: -77.219 bonds (distance) P-C4' energy: -86.487 flat angles C4'-P-C4' energy: -84.449 flat angles P-C4'-P energy: -60.191 tors. eta vs tors. theta energy: -64.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -622.893123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.893123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.893123 (E_RNA) where: Base-Base interactions energy: -269.313 where: short stacking energy: -231.214 Base-Backbone interact. energy: -0.079 local terms energy: -353.501727 where: bonds (distance) C4'-P energy: -80.310 bonds (distance) P-C4' energy: -83.020 flat angles C4'-P-C4' energy: -89.476 flat angles P-C4'-P energy: -51.324 tors. eta vs tors. theta energy: -49.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -568.854209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.854209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.854209 (E_RNA) where: Base-Base interactions energy: -239.056 where: short stacking energy: -215.281 Base-Backbone interact. energy: -0.235 local terms energy: -329.563267 where: bonds (distance) C4'-P energy: -80.058 bonds (distance) P-C4' energy: -77.896 flat angles C4'-P-C4' energy: -84.423 flat angles P-C4'-P energy: -46.177 tors. eta vs tors. theta energy: -41.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -486.035016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.035016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.035016 (E_RNA) where: Base-Base interactions energy: -192.969 where: short stacking energy: -188.501 Base-Backbone interact. energy: -0.762 local terms energy: -292.303200 where: bonds (distance) C4'-P energy: -70.515 bonds (distance) P-C4' energy: -74.575 flat angles C4'-P-C4' energy: -76.196 flat angles P-C4'-P energy: -42.676 tors. eta vs tors. theta energy: -28.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -572.585009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.585009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.585009 (E_RNA) where: Base-Base interactions energy: -249.410 where: short stacking energy: -160.570 Base-Backbone interact. energy: 1.375 local terms energy: -297.549392 where: bonds (distance) C4'-P energy: -73.348 bonds (distance) P-C4' energy: -77.643 flat angles C4'-P-C4' energy: -68.115 flat angles P-C4'-P energy: -51.934 tors. eta vs tors. theta energy: -26.509 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -516.648788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.648788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.648788 (E_RNA) where: Base-Base interactions energy: -223.694 where: short stacking energy: -145.487 Base-Backbone interact. energy: 2.662 local terms energy: -268.616708 where: bonds (distance) C4'-P energy: -64.912 bonds (distance) P-C4' energy: -86.876 flat angles C4'-P-C4' energy: -54.167 flat angles P-C4'-P energy: -48.796 tors. eta vs tors. theta energy: -13.866 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -438.128650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.128650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.128650 (E_RNA) where: Base-Base interactions energy: -193.392 where: short stacking energy: -138.523 Base-Backbone interact. energy: 4.091 local terms energy: -248.827019 where: bonds (distance) C4'-P energy: -54.513 bonds (distance) P-C4' energy: -74.294 flat angles C4'-P-C4' energy: -63.760 flat angles P-C4'-P energy: -52.367 tors. eta vs tors. theta energy: -3.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -397.802780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.802780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.202780 (E_RNA) where: Base-Base interactions energy: -148.627 where: short stacking energy: -113.528 Base-Backbone interact. energy: -0.717 local terms energy: -235.858610 where: bonds (distance) C4'-P energy: -71.050 bonds (distance) P-C4' energy: -80.097 flat angles C4'-P-C4' energy: -66.410 flat angles P-C4'-P energy: -25.368 tors. eta vs tors. theta energy: 7.068 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -331.617760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.617760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.617760 (E_RNA) where: Base-Base interactions energy: -127.667 where: short stacking energy: -104.824 Base-Backbone interact. energy: -2.673 local terms energy: -201.278030 where: bonds (distance) C4'-P energy: -71.716 bonds (distance) P-C4' energy: -68.551 flat angles C4'-P-C4' energy: -58.950 flat angles P-C4'-P energy: -10.674 tors. eta vs tors. theta energy: 8.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -290.155776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.155776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.155776 (E_RNA) where: Base-Base interactions energy: -86.110 where: short stacking energy: -83.015 Base-Backbone interact. energy: 4.299 local terms energy: -208.344834 where: bonds (distance) C4'-P energy: -52.915 bonds (distance) P-C4' energy: -79.087 flat angles C4'-P-C4' energy: -58.786 flat angles P-C4'-P energy: -28.621 tors. eta vs tors. theta energy: 11.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -756.801241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.801241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.801241 (E_RNA) where: Base-Base interactions energy: -391.175 where: short stacking energy: -264.444 Base-Backbone interact. energy: -2.889 local terms energy: -362.737447 where: bonds (distance) C4'-P energy: -78.749 bonds (distance) P-C4' energy: -84.888 flat angles C4'-P-C4' energy: -92.103 flat angles P-C4'-P energy: -51.537 tors. eta vs tors. theta energy: -55.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -659.514529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.514529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.514529 (E_RNA) where: Base-Base interactions energy: -316.103 where: short stacking energy: -253.152 Base-Backbone interact. energy: 1.794 local terms energy: -345.204770 where: bonds (distance) C4'-P energy: -76.074 bonds (distance) P-C4' energy: -81.536 flat angles C4'-P-C4' energy: -81.473 flat angles P-C4'-P energy: -50.479 tors. eta vs tors. theta energy: -55.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -600.566745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.566745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.566745 (E_RNA) where: Base-Base interactions energy: -261.977 where: short stacking energy: -228.814 Base-Backbone interact. energy: 0.248 local terms energy: -338.838224 where: bonds (distance) C4'-P energy: -80.090 bonds (distance) P-C4' energy: -86.256 flat angles C4'-P-C4' energy: -77.366 flat angles P-C4'-P energy: -42.401 tors. eta vs tors. theta energy: -52.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -608.508487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.508487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.508487 (E_RNA) where: Base-Base interactions energy: -279.583 where: short stacking energy: -192.225 Base-Backbone interact. energy: 1.009 local terms energy: -302.934930 where: bonds (distance) C4'-P energy: -75.429 bonds (distance) P-C4' energy: -71.929 flat angles C4'-P-C4' energy: -80.212 flat angles P-C4'-P energy: -41.453 tors. eta vs tors. theta energy: -33.911 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -498.032092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.032092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.032092 (E_RNA) where: Base-Base interactions energy: -190.137 where: short stacking energy: -183.877 Base-Backbone interact. energy: -0.893 local terms energy: -307.001582 where: bonds (distance) C4'-P energy: -65.882 bonds (distance) P-C4' energy: -70.776 flat angles C4'-P-C4' energy: -82.049 flat angles P-C4'-P energy: -45.581 tors. eta vs tors. theta energy: -42.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -481.861081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.861081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.661081 (E_RNA) where: Base-Base interactions energy: -205.482 where: short stacking energy: -140.360 Base-Backbone interact. energy: 2.894 local terms energy: -254.073489 where: bonds (distance) C4'-P energy: -61.708 bonds (distance) P-C4' energy: -75.480 flat angles C4'-P-C4' energy: -69.658 flat angles P-C4'-P energy: -42.416 tors. eta vs tors. theta energy: -4.812 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -438.322882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.322882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.322882 (E_RNA) where: Base-Base interactions energy: -187.017 where: short stacking energy: -133.368 Base-Backbone interact. energy: -1.324 local terms energy: -240.981625 where: bonds (distance) C4'-P energy: -59.840 bonds (distance) P-C4' energy: -70.934 flat angles C4'-P-C4' energy: -72.635 flat angles P-C4'-P energy: -39.049 tors. eta vs tors. theta energy: 1.476 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -382.018417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.018417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.618417 (E_RNA) where: Base-Base interactions energy: -149.363 where: short stacking energy: -129.868 Base-Backbone interact. energy: 0.990 local terms energy: -219.244707 where: bonds (distance) C4'-P energy: -62.132 bonds (distance) P-C4' energy: -68.324 flat angles C4'-P-C4' energy: -72.233 flat angles P-C4'-P energy: -22.925 tors. eta vs tors. theta energy: 6.369 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -319.288739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.288739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.288739 (E_RNA) where: Base-Base interactions energy: -108.732 where: short stacking energy: -92.233 Base-Backbone interact. energy: 1.949 local terms energy: -212.505860 where: bonds (distance) C4'-P energy: -69.046 bonds (distance) P-C4' energy: -79.138 flat angles C4'-P-C4' energy: -59.199 flat angles P-C4'-P energy: -28.523 tors. eta vs tors. theta energy: 23.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -284.920190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.920190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.920190 (E_RNA) where: Base-Base interactions energy: -112.064 where: short stacking energy: -87.685 Base-Backbone interact. energy: 0.711 local terms energy: -173.567439 where: bonds (distance) C4'-P energy: -55.025 bonds (distance) P-C4' energy: -74.343 flat angles C4'-P-C4' energy: -43.036 flat angles P-C4'-P energy: -18.532 tors. eta vs tors. theta energy: 17.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -756.649033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.649033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.649033 (E_RNA) where: Base-Base interactions energy: -375.143 where: short stacking energy: -257.637 Base-Backbone interact. energy: -1.548 local terms energy: -379.957710 where: bonds (distance) C4'-P energy: -82.883 bonds (distance) P-C4' energy: -86.478 flat angles C4'-P-C4' energy: -95.171 flat angles P-C4'-P energy: -56.531 tors. eta vs tors. theta energy: -58.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -647.160077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.160077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.160077 (E_RNA) where: Base-Base interactions energy: -292.023 where: short stacking energy: -252.109 Base-Backbone interact. energy: 0.828 local terms energy: -355.964861 where: bonds (distance) C4'-P energy: -78.050 bonds (distance) P-C4' energy: -89.814 flat angles C4'-P-C4' energy: -75.072 flat angles P-C4'-P energy: -52.517 tors. eta vs tors. theta energy: -60.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -640.737681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.737681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.537681 (E_RNA) where: Base-Base interactions energy: -296.487 where: short stacking energy: -210.356 Base-Backbone interact. energy: -1.257 local terms energy: -317.792819 where: bonds (distance) C4'-P energy: -67.108 bonds (distance) P-C4' energy: -85.311 flat angles C4'-P-C4' energy: -76.098 flat angles P-C4'-P energy: -47.290 tors. eta vs tors. theta energy: -41.985 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -602.510886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.510886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.510886 (E_RNA) where: Base-Base interactions energy: -269.372 where: short stacking energy: -217.982 Base-Backbone interact. energy: -1.566 local terms energy: -331.572984 where: bonds (distance) C4'-P energy: -78.080 bonds (distance) P-C4' energy: -80.426 flat angles C4'-P-C4' energy: -81.052 flat angles P-C4'-P energy: -41.175 tors. eta vs tors. theta energy: -50.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -479.185143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.185143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.185143 (E_RNA) where: Base-Base interactions energy: -192.870 where: short stacking energy: -180.599 Base-Backbone interact. energy: -1.283 local terms energy: -285.031614 where: bonds (distance) C4'-P energy: -70.642 bonds (distance) P-C4' energy: -72.845 flat angles C4'-P-C4' energy: -82.616 flat angles P-C4'-P energy: -37.027 tors. eta vs tors. theta energy: -21.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -470.450784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.450784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.250784 (E_RNA) where: Base-Base interactions energy: -195.941 where: short stacking energy: -136.089 Base-Backbone interact. energy: 1.635 local terms energy: -250.944733 where: bonds (distance) C4'-P energy: -77.221 bonds (distance) P-C4' energy: -75.824 flat angles C4'-P-C4' energy: -62.401 flat angles P-C4'-P energy: -39.045 tors. eta vs tors. theta energy: 3.546 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -434.520480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.520480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.920480 (E_RNA) where: Base-Base interactions energy: -180.554 where: short stacking energy: -127.309 Base-Backbone interact. energy: -1.228 local terms energy: -249.137943 where: bonds (distance) C4'-P energy: -65.978 bonds (distance) P-C4' energy: -67.852 flat angles C4'-P-C4' energy: -63.317 flat angles P-C4'-P energy: -47.759 tors. eta vs tors. theta energy: -4.232 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -385.337092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.337092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.937092 (E_RNA) where: Base-Base interactions energy: -137.829 where: short stacking energy: -112.407 Base-Backbone interact. energy: -0.984 local terms energy: -232.124844 where: bonds (distance) C4'-P energy: -65.393 bonds (distance) P-C4' energy: -73.360 flat angles C4'-P-C4' energy: -58.459 flat angles P-C4'-P energy: -35.136 tors. eta vs tors. theta energy: 0.222 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -289.580147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.580147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.580147 (E_RNA) where: Base-Base interactions energy: -83.066 where: short stacking energy: -61.374 Base-Backbone interact. energy: -1.540 local terms energy: -204.973999 where: bonds (distance) C4'-P energy: -60.093 bonds (distance) P-C4' energy: -75.638 flat angles C4'-P-C4' energy: -68.344 flat angles P-C4'-P energy: -18.370 tors. eta vs tors. theta energy: 17.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -318.631691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.631691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.631691 (E_RNA) where: Base-Base interactions energy: -114.565 where: short stacking energy: -109.374 Base-Backbone interact. energy: 0.425 local terms energy: -204.491635 where: bonds (distance) C4'-P energy: -67.105 bonds (distance) P-C4' energy: -62.575 flat angles C4'-P-C4' energy: -41.617 flat angles P-C4'-P energy: -36.136 tors. eta vs tors. theta energy: 2.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -770.561899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.561899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.561899 (E_RNA) where: Base-Base interactions energy: -395.548 where: short stacking energy: -279.897 Base-Backbone interact. energy: 1.164 local terms energy: -376.177258 where: bonds (distance) C4'-P energy: -81.417 bonds (distance) P-C4' energy: -81.156 flat angles C4'-P-C4' energy: -89.614 flat angles P-C4'-P energy: -51.079 tors. eta vs tors. theta energy: -72.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -683.106109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.106109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.106109 (E_RNA) where: Base-Base interactions energy: -323.789 where: short stacking energy: -283.936 Base-Backbone interact. energy: -0.748 local terms energy: -358.569191 where: bonds (distance) C4'-P energy: -78.376 bonds (distance) P-C4' energy: -79.478 flat angles C4'-P-C4' energy: -79.355 flat angles P-C4'-P energy: -52.321 tors. eta vs tors. theta energy: -69.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -631.684778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.684778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.284778 (E_RNA) where: Base-Base interactions energy: -272.267 where: short stacking energy: -202.822 Base-Backbone interact. energy: -1.006 local terms energy: -335.012107 where: bonds (distance) C4'-P energy: -73.479 bonds (distance) P-C4' energy: -90.502 flat angles C4'-P-C4' energy: -84.137 flat angles P-C4'-P energy: -43.609 tors. eta vs tors. theta energy: -43.285 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -534.910198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.910198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.910198 (E_RNA) where: Base-Base interactions energy: -221.674 where: short stacking energy: -202.580 Base-Backbone interact. energy: -0.412 local terms energy: -312.824457 where: bonds (distance) C4'-P energy: -69.322 bonds (distance) P-C4' energy: -78.444 flat angles C4'-P-C4' energy: -74.330 flat angles P-C4'-P energy: -47.481 tors. eta vs tors. theta energy: -43.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -447.797377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.797377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.797377 (E_RNA) where: Base-Base interactions energy: -195.839 where: short stacking energy: -179.524 Base-Backbone interact. energy: -1.675 local terms energy: -250.283642 where: bonds (distance) C4'-P energy: -67.138 bonds (distance) P-C4' energy: -70.495 flat angles C4'-P-C4' energy: -62.624 flat angles P-C4'-P energy: -32.730 tors. eta vs tors. theta energy: -17.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -494.643023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.643023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.243023 (E_RNA) where: Base-Base interactions energy: -215.853 where: short stacking energy: -153.881 Base-Backbone interact. energy: -1.307 local terms energy: -245.083154 where: bonds (distance) C4'-P energy: -61.280 bonds (distance) P-C4' energy: -66.878 flat angles C4'-P-C4' energy: -63.789 flat angles P-C4'-P energy: -37.708 tors. eta vs tors. theta energy: -15.429 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -431.319668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.319668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.319668 (E_RNA) where: Base-Base interactions energy: -196.550 where: short stacking energy: -121.799 Base-Backbone interact. energy: -1.379 local terms energy: -224.390312 where: bonds (distance) C4'-P energy: -66.487 bonds (distance) P-C4' energy: -62.162 flat angles C4'-P-C4' energy: -51.239 flat angles P-C4'-P energy: -51.364 tors. eta vs tors. theta energy: 6.862 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -377.045365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.045365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.045365 (E_RNA) where: Base-Base interactions energy: -152.091 where: short stacking energy: -117.562 Base-Backbone interact. energy: 0.782 local terms energy: -216.736585 where: bonds (distance) C4'-P energy: -63.660 bonds (distance) P-C4' energy: -55.341 flat angles C4'-P-C4' energy: -58.369 flat angles P-C4'-P energy: -38.307 tors. eta vs tors. theta energy: -1.060 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -307.278501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.278501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.278501 (E_RNA) where: Base-Base interactions energy: -89.820 where: short stacking energy: -71.190 Base-Backbone interact. energy: 0.082 local terms energy: -217.539790 where: bonds (distance) C4'-P energy: -64.254 bonds (distance) P-C4' energy: -77.079 flat angles C4'-P-C4' energy: -57.765 flat angles P-C4'-P energy: -34.899 tors. eta vs tors. theta energy: 16.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -338.219582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.219582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.219582 (E_RNA) where: Base-Base interactions energy: -123.369 where: short stacking energy: -113.136 Base-Backbone interact. energy: 1.408 local terms energy: -216.258480 where: bonds (distance) C4'-P energy: -64.799 bonds (distance) P-C4' energy: -70.418 flat angles C4'-P-C4' energy: -52.463 flat angles P-C4'-P energy: -30.798 tors. eta vs tors. theta energy: 2.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -753.882309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.882309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.882309 (E_RNA) where: Base-Base interactions energy: -380.115 where: short stacking energy: -265.924 Base-Backbone interact. energy: -3.360 local terms energy: -370.407372 where: bonds (distance) C4'-P energy: -83.938 bonds (distance) P-C4' energy: -82.564 flat angles C4'-P-C4' energy: -86.217 flat angles P-C4'-P energy: -51.504 tors. eta vs tors. theta energy: -66.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -668.506479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.506479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.506479 (E_RNA) where: Base-Base interactions energy: -307.945 where: short stacking energy: -244.151 Base-Backbone interact. energy: 2.015 local terms energy: -362.575848 where: bonds (distance) C4'-P energy: -81.028 bonds (distance) P-C4' energy: -87.138 flat angles C4'-P-C4' energy: -81.141 flat angles P-C4'-P energy: -58.529 tors. eta vs tors. theta energy: -54.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -628.390249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.390249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.190249 (E_RNA) where: Base-Base interactions energy: -276.644 where: short stacking energy: -223.433 Base-Backbone interact. energy: -1.714 local terms energy: -324.832188 where: bonds (distance) C4'-P energy: -81.888 bonds (distance) P-C4' energy: -76.077 flat angles C4'-P-C4' energy: -76.829 flat angles P-C4'-P energy: -44.493 tors. eta vs tors. theta energy: -45.546 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -548.651879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.651879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.651879 (E_RNA) where: Base-Base interactions energy: -240.901 where: short stacking energy: -189.101 Base-Backbone interact. energy: 1.994 local terms energy: -309.745240 where: bonds (distance) C4'-P energy: -70.788 bonds (distance) P-C4' energy: -83.749 flat angles C4'-P-C4' energy: -70.827 flat angles P-C4'-P energy: -55.406 tors. eta vs tors. theta energy: -28.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -539.318842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.318842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.518842 (E_RNA) where: Base-Base interactions energy: -238.536 where: short stacking energy: -152.057 Base-Backbone interact. energy: -0.120 local terms energy: -271.863716 where: bonds (distance) C4'-P energy: -73.348 bonds (distance) P-C4' energy: -77.237 flat angles C4'-P-C4' energy: -70.140 flat angles P-C4'-P energy: -41.418 tors. eta vs tors. theta energy: -9.721 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -428.377125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.377125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.577125 (E_RNA) where: Base-Base interactions energy: -175.410 where: short stacking energy: -162.525 Base-Backbone interact. energy: 0.903 local terms energy: -252.070145 where: bonds (distance) C4'-P energy: -55.628 bonds (distance) P-C4' energy: -70.916 flat angles C4'-P-C4' energy: -65.557 flat angles P-C4'-P energy: -46.896 tors. eta vs tors. theta energy: -13.074 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -462.168722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.168722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.368722 (E_RNA) where: Base-Base interactions energy: -208.667 where: short stacking energy: -125.054 Base-Backbone interact. energy: -1.090 local terms energy: -241.611560 where: bonds (distance) C4'-P energy: -80.131 bonds (distance) P-C4' energy: -79.451 flat angles C4'-P-C4' energy: -48.289 flat angles P-C4'-P energy: -28.477 tors. eta vs tors. theta energy: -5.264 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -376.485818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.485818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.085818 (E_RNA) where: Base-Base interactions energy: -130.043 where: short stacking energy: -88.972 Base-Backbone interact. energy: -1.890 local terms energy: -230.153417 where: bonds (distance) C4'-P energy: -67.060 bonds (distance) P-C4' energy: -75.607 flat angles C4'-P-C4' energy: -71.927 flat angles P-C4'-P energy: -32.931 tors. eta vs tors. theta energy: 17.371 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -331.859996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.859996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.859996 (E_RNA) where: Base-Base interactions energy: -110.936 where: short stacking energy: -102.130 Base-Backbone interact. energy: 5.808 local terms energy: -226.732071 where: bonds (distance) C4'-P energy: -72.945 bonds (distance) P-C4' energy: -60.593 flat angles C4'-P-C4' energy: -59.261 flat angles P-C4'-P energy: -39.081 tors. eta vs tors. theta energy: 5.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -289.304081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.304081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.304081 (E_RNA) where: Base-Base interactions energy: -95.383 where: short stacking energy: -67.155 Base-Backbone interact. energy: -0.880 local terms energy: -193.040418 where: bonds (distance) C4'-P energy: -56.860 bonds (distance) P-C4' energy: -54.960 flat angles C4'-P-C4' energy: -53.175 flat angles P-C4'-P energy: -42.874 tors. eta vs tors. theta energy: 14.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -744.782131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.782131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.782131 (E_RNA) where: Base-Base interactions energy: -354.143 where: short stacking energy: -247.066 Base-Backbone interact. energy: -1.676 local terms energy: -388.963299 where: bonds (distance) C4'-P energy: -97.956 bonds (distance) P-C4' energy: -81.360 flat angles C4'-P-C4' energy: -78.557 flat angles P-C4'-P energy: -68.054 tors. eta vs tors. theta energy: -63.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -701.680811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.680811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.680811 (E_RNA) where: Base-Base interactions energy: -338.456 where: short stacking energy: -280.846 Base-Backbone interact. energy: -1.118 local terms energy: -362.107209 where: bonds (distance) C4'-P energy: -73.203 bonds (distance) P-C4' energy: -86.063 flat angles C4'-P-C4' energy: -76.349 flat angles P-C4'-P energy: -63.262 tors. eta vs tors. theta energy: -63.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -588.425377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.425377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.425377 (E_RNA) where: Base-Base interactions energy: -268.009 where: short stacking energy: -194.651 Base-Backbone interact. energy: -1.724 local terms energy: -300.691543 where: bonds (distance) C4'-P energy: -69.544 bonds (distance) P-C4' energy: -86.021 flat angles C4'-P-C4' energy: -68.239 flat angles P-C4'-P energy: -55.683 tors. eta vs tors. theta energy: -21.204 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -573.535520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.535520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.535520 (E_RNA) where: Base-Base interactions energy: -261.843 where: short stacking energy: -215.576 Base-Backbone interact. energy: -1.012 local terms energy: -310.680537 where: bonds (distance) C4'-P energy: -87.656 bonds (distance) P-C4' energy: -65.214 flat angles C4'-P-C4' energy: -80.845 flat angles P-C4'-P energy: -32.925 tors. eta vs tors. theta energy: -44.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -586.400229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.400229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.200229 (E_RNA) where: Base-Base interactions energy: -256.541 where: short stacking energy: -147.133 Base-Backbone interact. energy: -3.891 local terms energy: -291.767983 where: bonds (distance) C4'-P energy: -68.375 bonds (distance) P-C4' energy: -74.806 flat angles C4'-P-C4' energy: -79.063 flat angles P-C4'-P energy: -52.799 tors. eta vs tors. theta energy: -16.725 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -488.015424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.015424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.015424 (E_RNA) where: Base-Base interactions energy: -200.966 where: short stacking energy: -135.117 Base-Backbone interact. energy: -1.102 local terms energy: -276.947010 where: bonds (distance) C4'-P energy: -83.432 bonds (distance) P-C4' energy: -78.066 flat angles C4'-P-C4' energy: -57.366 flat angles P-C4'-P energy: -50.129 tors. eta vs tors. theta energy: -7.954 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -421.894052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.894052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.094052 (E_RNA) where: Base-Base interactions energy: -157.033 where: short stacking energy: -153.725 Base-Backbone interact. energy: -0.251 local terms energy: -262.810724 where: bonds (distance) C4'-P energy: -72.106 bonds (distance) P-C4' energy: -70.785 flat angles C4'-P-C4' energy: -60.521 flat angles P-C4'-P energy: -43.642 tors. eta vs tors. theta energy: -15.757 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -379.607016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.607016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.407016 (E_RNA) where: Base-Base interactions energy: -141.901 where: short stacking energy: -111.453 Base-Backbone interact. energy: -0.449 local terms energy: -230.057190 where: bonds (distance) C4'-P energy: -68.928 bonds (distance) P-C4' energy: -70.651 flat angles C4'-P-C4' energy: -57.540 flat angles P-C4'-P energy: -43.814 tors. eta vs tors. theta energy: 10.876 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -358.037773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.037773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.637773 (E_RNA) where: Base-Base interactions energy: -125.114 where: short stacking energy: -81.145 Base-Backbone interact. energy: -0.517 local terms energy: -218.006991 where: bonds (distance) C4'-P energy: -61.131 bonds (distance) P-C4' energy: -64.079 flat angles C4'-P-C4' energy: -65.682 flat angles P-C4'-P energy: -42.079 tors. eta vs tors. theta energy: 14.963 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -307.909736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.909736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.909736 (E_RNA) where: Base-Base interactions energy: -100.727 where: short stacking energy: -95.200 Base-Backbone interact. energy: 1.182 local terms energy: -208.365592 where: bonds (distance) C4'-P energy: -69.601 bonds (distance) P-C4' energy: -65.086 flat angles C4'-P-C4' energy: -50.861 flat angles P-C4'-P energy: -34.624 tors. eta vs tors. theta energy: 11.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -768.942956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.942956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.942956 (E_RNA) where: Base-Base interactions energy: -407.400 where: short stacking energy: -262.953 Base-Backbone interact. energy: -1.371 local terms energy: -360.172029 where: bonds (distance) C4'-P energy: -78.803 bonds (distance) P-C4' energy: -93.230 flat angles C4'-P-C4' energy: -78.594 flat angles P-C4'-P energy: -52.913 tors. eta vs tors. theta energy: -56.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -684.962770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.962770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.962770 (E_RNA) where: Base-Base interactions energy: -334.401 where: short stacking energy: -243.428 Base-Backbone interact. energy: -1.221 local terms energy: -349.341613 where: bonds (distance) C4'-P energy: -70.209 bonds (distance) P-C4' energy: -87.755 flat angles C4'-P-C4' energy: -75.353 flat angles P-C4'-P energy: -62.435 tors. eta vs tors. theta energy: -53.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -578.227426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.227426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.627426 (E_RNA) where: Base-Base interactions energy: -260.272 where: short stacking energy: -197.877 Base-Backbone interact. energy: -0.028 local terms energy: -296.327385 where: bonds (distance) C4'-P energy: -73.524 bonds (distance) P-C4' energy: -81.814 flat angles C4'-P-C4' energy: -80.585 flat angles P-C4'-P energy: -35.962 tors. eta vs tors. theta energy: -24.442 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -591.124115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.124115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.124115 (E_RNA) where: Base-Base interactions energy: -288.056 where: short stacking energy: -226.631 Base-Backbone interact. energy: -0.032 local terms energy: -303.035579 where: bonds (distance) C4'-P energy: -79.257 bonds (distance) P-C4' energy: -74.148 flat angles C4'-P-C4' energy: -73.498 flat angles P-C4'-P energy: -25.878 tors. eta vs tors. theta energy: -50.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -537.085803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.085803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.485803 (E_RNA) where: Base-Base interactions energy: -247.107 where: short stacking energy: -147.661 Base-Backbone interact. energy: 2.316 local terms energy: -279.694492 where: bonds (distance) C4'-P energy: -81.915 bonds (distance) P-C4' energy: -79.645 flat angles C4'-P-C4' energy: -76.064 flat angles P-C4'-P energy: -33.126 tors. eta vs tors. theta energy: -8.945 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -600.505338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.505338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.305338 (E_RNA) where: Base-Base interactions energy: -273.356 where: short stacking energy: -171.854 Base-Backbone interact. energy: 0.898 local terms energy: -275.846720 where: bonds (distance) C4'-P energy: -78.202 bonds (distance) P-C4' energy: -73.303 flat angles C4'-P-C4' energy: -68.109 flat angles P-C4'-P energy: -36.488 tors. eta vs tors. theta energy: -19.745 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -369.605621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.605621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.405621 (E_RNA) where: Base-Base interactions energy: -131.590 where: short stacking energy: -112.988 Base-Backbone interact. energy: -0.148 local terms energy: -230.667331 where: bonds (distance) C4'-P energy: -66.330 bonds (distance) P-C4' energy: -69.804 flat angles C4'-P-C4' energy: -63.755 flat angles P-C4'-P energy: -27.877 tors. eta vs tors. theta energy: -2.901 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -333.296740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.296740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.096740 (E_RNA) where: Base-Base interactions energy: -116.794 where: short stacking energy: -87.279 Base-Backbone interact. energy: 1.895 local terms energy: -211.197567 where: bonds (distance) C4'-P energy: -72.844 bonds (distance) P-C4' energy: -53.417 flat angles C4'-P-C4' energy: -55.997 flat angles P-C4'-P energy: -29.600 tors. eta vs tors. theta energy: 0.660 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -361.860906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.860906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.460906 (E_RNA) where: Base-Base interactions energy: -118.673 where: short stacking energy: -98.019 Base-Backbone interact. energy: 0.051 local terms energy: -219.839309 where: bonds (distance) C4'-P energy: -69.538 bonds (distance) P-C4' energy: -45.737 flat angles C4'-P-C4' energy: -62.409 flat angles P-C4'-P energy: -40.647 tors. eta vs tors. theta energy: -1.509 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -314.983780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.983780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.383780 (E_RNA) where: Base-Base interactions energy: -117.108 where: short stacking energy: -77.371 Base-Backbone interact. energy: 0.051 local terms energy: -185.326470 where: bonds (distance) C4'-P energy: -77.864 bonds (distance) P-C4' energy: -71.002 flat angles C4'-P-C4' energy: -36.288 flat angles P-C4'-P energy: -34.504 tors. eta vs tors. theta energy: 34.331 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -793.735546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.735546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.735546 (E_RNA) where: Base-Base interactions energy: -415.727 where: short stacking energy: -286.616 Base-Backbone interact. energy: -1.567 local terms energy: -376.441449 where: bonds (distance) C4'-P energy: -82.727 bonds (distance) P-C4' energy: -84.621 flat angles C4'-P-C4' energy: -81.463 flat angles P-C4'-P energy: -54.715 tors. eta vs tors. theta energy: -72.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -699.677706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.677706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.677706 (E_RNA) where: Base-Base interactions energy: -352.832 where: short stacking energy: -251.211 Base-Backbone interact. energy: 1.716 local terms energy: -348.561938 where: bonds (distance) C4'-P energy: -70.211 bonds (distance) P-C4' energy: -88.327 flat angles C4'-P-C4' energy: -80.804 flat angles P-C4'-P energy: -59.006 tors. eta vs tors. theta energy: -50.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -614.395968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.395968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.195968 (E_RNA) where: Base-Base interactions energy: -253.765 where: short stacking energy: -182.536 Base-Backbone interact. energy: -1.434 local terms energy: -333.996252 where: bonds (distance) C4'-P energy: -81.265 bonds (distance) P-C4' energy: -82.007 flat angles C4'-P-C4' energy: -78.505 flat angles P-C4'-P energy: -56.831 tors. eta vs tors. theta energy: -35.388 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -598.362082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.362082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.362082 (E_RNA) where: Base-Base interactions energy: -267.570 where: short stacking energy: -212.538 Base-Backbone interact. energy: -1.199 local terms energy: -329.592873 where: bonds (distance) C4'-P energy: -83.866 bonds (distance) P-C4' energy: -81.413 flat angles C4'-P-C4' energy: -75.582 flat angles P-C4'-P energy: -40.324 tors. eta vs tors. theta energy: -48.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -613.557721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.557721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.557721 (E_RNA) where: Base-Base interactions energy: -309.907 where: short stacking energy: -182.299 Base-Backbone interact. energy: 0.147 local terms energy: -285.797640 where: bonds (distance) C4'-P energy: -64.071 bonds (distance) P-C4' energy: -76.846 flat angles C4'-P-C4' energy: -70.000 flat angles P-C4'-P energy: -38.045 tors. eta vs tors. theta energy: -36.837 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -590.795744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.795744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.995744 (E_RNA) where: Base-Base interactions energy: -254.943 where: short stacking energy: -157.372 Base-Backbone interact. energy: 0.097 local terms energy: -289.150057 where: bonds (distance) C4'-P energy: -73.840 bonds (distance) P-C4' energy: -69.494 flat angles C4'-P-C4' energy: -69.181 flat angles P-C4'-P energy: -52.711 tors. eta vs tors. theta energy: -23.923 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -388.491799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.491799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.291799 (E_RNA) where: Base-Base interactions energy: -125.438 where: short stacking energy: -101.274 Base-Backbone interact. energy: 0.588 local terms energy: -256.442190 where: bonds (distance) C4'-P energy: -71.231 bonds (distance) P-C4' energy: -74.906 flat angles C4'-P-C4' energy: -61.329 flat angles P-C4'-P energy: -43.379 tors. eta vs tors. theta energy: -5.597 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -419.993662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.993662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.793662 (E_RNA) where: Base-Base interactions energy: -170.092 where: short stacking energy: -120.790 Base-Backbone interact. energy: -2.189 local terms energy: -222.512586 where: bonds (distance) C4'-P energy: -62.524 bonds (distance) P-C4' energy: -77.635 flat angles C4'-P-C4' energy: -64.620 flat angles P-C4'-P energy: -20.489 tors. eta vs tors. theta energy: 2.755 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -335.553182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -335.553182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.553182 (E_RNA) where: Base-Base interactions energy: -119.090 where: short stacking energy: -90.710 Base-Backbone interact. energy: 0.638 local terms energy: -217.101239 where: bonds (distance) C4'-P energy: -62.460 bonds (distance) P-C4' energy: -70.250 flat angles C4'-P-C4' energy: -69.390 flat angles P-C4'-P energy: -44.483 tors. eta vs tors. theta energy: 29.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -311.910106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.910106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.310106 (E_RNA) where: Base-Base interactions energy: -127.352 where: short stacking energy: -89.408 Base-Backbone interact. energy: 0.964 local terms energy: -172.922475 where: bonds (distance) C4'-P energy: -68.598 bonds (distance) P-C4' energy: -64.803 flat angles C4'-P-C4' energy: -36.488 flat angles P-C4'-P energy: -20.571 tors. eta vs tors. theta energy: 17.537 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -813.209140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.209140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.209140 (E_RNA) where: Base-Base interactions energy: -451.267 where: short stacking energy: -273.410 Base-Backbone interact. energy: -2.678 local terms energy: -359.264284 where: bonds (distance) C4'-P energy: -77.812 bonds (distance) P-C4' energy: -84.519 flat angles C4'-P-C4' energy: -83.684 flat angles P-C4'-P energy: -54.724 tors. eta vs tors. theta energy: -58.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -680.880673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.880673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.880673 (E_RNA) where: Base-Base interactions energy: -315.796 where: short stacking energy: -245.603 Base-Backbone interact. energy: -0.954 local terms energy: -364.130861 where: bonds (distance) C4'-P energy: -78.720 bonds (distance) P-C4' energy: -82.124 flat angles C4'-P-C4' energy: -89.105 flat angles P-C4'-P energy: -56.061 tors. eta vs tors. theta energy: -58.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -641.557693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.557693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.557693 (E_RNA) where: Base-Base interactions energy: -275.349 where: short stacking energy: -202.963 Base-Backbone interact. energy: -1.425 local terms energy: -337.783615 where: bonds (distance) C4'-P energy: -81.295 bonds (distance) P-C4' energy: -77.133 flat angles C4'-P-C4' energy: -75.904 flat angles P-C4'-P energy: -54.680 tors. eta vs tors. theta energy: -48.772 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -564.787349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.787349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.787349 (E_RNA) where: Base-Base interactions energy: -241.384 where: short stacking energy: -168.191 Base-Backbone interact. energy: -0.417 local terms energy: -322.986508 where: bonds (distance) C4'-P energy: -81.136 bonds (distance) P-C4' energy: -87.041 flat angles C4'-P-C4' energy: -72.344 flat angles P-C4'-P energy: -53.238 tors. eta vs tors. theta energy: -29.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -613.544781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.544781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.544781 (E_RNA) where: Base-Base interactions energy: -305.806 where: short stacking energy: -180.497 Base-Backbone interact. energy: -1.763 local terms energy: -287.975465 where: bonds (distance) C4'-P energy: -75.249 bonds (distance) P-C4' energy: -71.132 flat angles C4'-P-C4' energy: -62.722 flat angles P-C4'-P energy: -42.150 tors. eta vs tors. theta energy: -36.722 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -626.987188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.987188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.587188 (E_RNA) where: Base-Base interactions energy: -274.164 where: short stacking energy: -181.204 Base-Backbone interact. energy: 0.506 local terms energy: -302.929757 where: bonds (distance) C4'-P energy: -67.419 bonds (distance) P-C4' energy: -84.644 flat angles C4'-P-C4' energy: -81.197 flat angles P-C4'-P energy: -36.195 tors. eta vs tors. theta energy: -33.475 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -464.843908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.843908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.243908 (E_RNA) where: Base-Base interactions energy: -188.728 where: short stacking energy: -124.185 Base-Backbone interact. energy: -1.679 local terms energy: -243.836936 where: bonds (distance) C4'-P energy: -69.399 bonds (distance) P-C4' energy: -82.288 flat angles C4'-P-C4' energy: -59.891 flat angles P-C4'-P energy: -35.380 tors. eta vs tors. theta energy: 3.121 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -354.593071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.593071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.593071 (E_RNA) where: Base-Base interactions energy: -116.062 where: short stacking energy: -98.776 Base-Backbone interact. energy: 0.127 local terms energy: -238.657871 where: bonds (distance) C4'-P energy: -77.901 bonds (distance) P-C4' energy: -71.941 flat angles C4'-P-C4' energy: -49.767 flat angles P-C4'-P energy: -46.509 tors. eta vs tors. theta energy: 7.461 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -324.899243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.899243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.699243 (E_RNA) where: Base-Base interactions energy: -99.129 where: short stacking energy: -83.446 Base-Backbone interact. energy: -1.767 local terms energy: -216.803018 where: bonds (distance) C4'-P energy: -71.567 bonds (distance) P-C4' energy: -74.046 flat angles C4'-P-C4' energy: -67.515 flat angles P-C4'-P energy: -23.270 tors. eta vs tors. theta energy: 19.595 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -281.909559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.909559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.909559 (E_RNA) where: Base-Base interactions energy: -123.187 where: short stacking energy: -113.466 Base-Backbone interact. energy: 3.235 local terms energy: -161.956860 where: bonds (distance) C4'-P energy: -58.492 bonds (distance) P-C4' energy: -51.970 flat angles C4'-P-C4' energy: -54.923 flat angles P-C4'-P energy: -15.761 tors. eta vs tors. theta energy: 19.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -836.956490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.956490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.956490 (E_RNA) where: Base-Base interactions energy: -483.481 where: short stacking energy: -300.207 Base-Backbone interact. energy: -0.672 local terms energy: -352.802736 where: bonds (distance) C4'-P energy: -77.859 bonds (distance) P-C4' energy: -74.045 flat angles C4'-P-C4' energy: -84.030 flat angles P-C4'-P energy: -46.128 tors. eta vs tors. theta energy: -70.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -679.611872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.611872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.611872 (E_RNA) where: Base-Base interactions energy: -301.317 where: short stacking energy: -229.053 Base-Backbone interact. energy: -1.099 local terms energy: -350.195314 where: bonds (distance) C4'-P energy: -81.789 bonds (distance) P-C4' energy: -90.257 flat angles C4'-P-C4' energy: -79.052 flat angles P-C4'-P energy: -56.662 tors. eta vs tors. theta energy: -42.435 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -623.579526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.579526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.579526 (E_RNA) where: Base-Base interactions energy: -273.550 where: short stacking energy: -219.638 Base-Backbone interact. energy: -0.672 local terms energy: -349.358268 where: bonds (distance) C4'-P energy: -82.152 bonds (distance) P-C4' energy: -79.745 flat angles C4'-P-C4' energy: -83.338 flat angles P-C4'-P energy: -48.636 tors. eta vs tors. theta energy: -55.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -597.138609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.138609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.138609 (E_RNA) where: Base-Base interactions energy: -293.035 where: short stacking energy: -183.574 Base-Backbone interact. energy: -1.562 local terms energy: -284.541322 where: bonds (distance) C4'-P energy: -80.719 bonds (distance) P-C4' energy: -84.068 flat angles C4'-P-C4' energy: -58.610 flat angles P-C4'-P energy: -47.907 tors. eta vs tors. theta energy: -13.238 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -505.319364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.319364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.319364 (E_RNA) where: Base-Base interactions energy: -233.703 where: short stacking energy: -175.466 Base-Backbone interact. energy: 1.106 local terms energy: -272.722487 where: bonds (distance) C4'-P energy: -86.009 bonds (distance) P-C4' energy: -79.883 flat angles C4'-P-C4' energy: -46.923 flat angles P-C4'-P energy: -33.158 tors. eta vs tors. theta energy: -26.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -614.004249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.004249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.604249 (E_RNA) where: Base-Base interactions energy: -265.388 where: short stacking energy: -189.860 Base-Backbone interact. energy: -1.547 local terms energy: -296.669227 where: bonds (distance) C4'-P energy: -68.150 bonds (distance) P-C4' energy: -74.483 flat angles C4'-P-C4' energy: -69.221 flat angles P-C4'-P energy: -48.752 tors. eta vs tors. theta energy: -36.063 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -484.682769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.682769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.282769 (E_RNA) where: Base-Base interactions energy: -201.981 where: short stacking energy: -135.825 Base-Backbone interact. energy: -0.698 local terms energy: -249.604001 where: bonds (distance) C4'-P energy: -75.721 bonds (distance) P-C4' energy: -69.031 flat angles C4'-P-C4' energy: -65.356 flat angles P-C4'-P energy: -46.006 tors. eta vs tors. theta energy: 6.510 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -401.872106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.872106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.072106 (E_RNA) where: Base-Base interactions energy: -145.218 where: short stacking energy: -139.764 Base-Backbone interact. energy: 2.608 local terms energy: -257.462464 where: bonds (distance) C4'-P energy: -57.043 bonds (distance) P-C4' energy: -79.644 flat angles C4'-P-C4' energy: -61.747 flat angles P-C4'-P energy: -40.728 tors. eta vs tors. theta energy: -18.300 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -325.657852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.657852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.657852 (E_RNA) where: Base-Base interactions energy: -141.953 where: short stacking energy: -94.522 Base-Backbone interact. energy: -0.517 local terms energy: -183.187352 where: bonds (distance) C4'-P energy: -46.678 bonds (distance) P-C4' energy: -66.745 flat angles C4'-P-C4' energy: -44.904 flat angles P-C4'-P energy: -34.394 tors. eta vs tors. theta energy: 9.534 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -309.233587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.233587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.233587 (E_RNA) where: Base-Base interactions energy: -90.548 where: short stacking energy: -67.024 Base-Backbone interact. energy: 1.279 local terms energy: -219.964218 where: bonds (distance) C4'-P energy: -69.128 bonds (distance) P-C4' energy: -63.133 flat angles C4'-P-C4' energy: -58.374 flat angles P-C4'-P energy: -42.390 tors. eta vs tors. theta energy: 13.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -814.502514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.502514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.502514 (E_RNA) where: Base-Base interactions energy: -463.590 where: short stacking energy: -275.046 Base-Backbone interact. energy: 1.182 local terms energy: -352.094401 where: bonds (distance) C4'-P energy: -77.205 bonds (distance) P-C4' energy: -87.422 flat angles C4'-P-C4' energy: -78.190 flat angles P-C4'-P energy: -53.279 tors. eta vs tors. theta energy: -55.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -679.875494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.875494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.075494 (E_RNA) where: Base-Base interactions energy: -317.575 where: short stacking energy: -243.175 Base-Backbone interact. energy: -1.735 local terms energy: -331.765060 where: bonds (distance) C4'-P energy: -74.318 bonds (distance) P-C4' energy: -81.663 flat angles C4'-P-C4' energy: -80.420 flat angles P-C4'-P energy: -53.349 tors. eta vs tors. theta energy: -42.015 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -688.322503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.322503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.522503 (E_RNA) where: Base-Base interactions energy: -338.471 where: short stacking energy: -191.797 Base-Backbone interact. energy: 4.165 local terms energy: -334.216058 where: bonds (distance) C4'-P energy: -77.285 bonds (distance) P-C4' energy: -88.992 flat angles C4'-P-C4' energy: -79.176 flat angles P-C4'-P energy: -52.510 tors. eta vs tors. theta energy: -36.254 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -592.760576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.760576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.760576 (E_RNA) where: Base-Base interactions energy: -269.357 where: short stacking energy: -203.529 Base-Backbone interact. energy: -1.668 local terms energy: -321.735496 where: bonds (distance) C4'-P energy: -76.262 bonds (distance) P-C4' energy: -88.864 flat angles C4'-P-C4' energy: -70.281 flat angles P-C4'-P energy: -48.614 tors. eta vs tors. theta energy: -37.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -663.891757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.891757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.891757 (E_RNA) where: Base-Base interactions energy: -315.515 where: short stacking energy: -197.184 Base-Backbone interact. energy: 0.627 local terms energy: -295.003813 where: bonds (distance) C4'-P energy: -66.924 bonds (distance) P-C4' energy: -91.481 flat angles C4'-P-C4' energy: -63.962 flat angles P-C4'-P energy: -41.125 tors. eta vs tors. theta energy: -31.512 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -486.924836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.924836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.924836 (E_RNA) where: Base-Base interactions energy: -191.832 where: short stacking energy: -139.380 Base-Backbone interact. energy: -0.153 local terms energy: -294.940110 where: bonds (distance) C4'-P energy: -61.465 bonds (distance) P-C4' energy: -79.033 flat angles C4'-P-C4' energy: -91.531 flat angles P-C4'-P energy: -44.790 tors. eta vs tors. theta energy: -18.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -481.412686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.412686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.212686 (E_RNA) where: Base-Base interactions energy: -193.350 where: short stacking energy: -109.654 Base-Backbone interact. energy: -3.009 local terms energy: -250.853168 where: bonds (distance) C4'-P energy: -60.502 bonds (distance) P-C4' energy: -80.412 flat angles C4'-P-C4' energy: -66.621 flat angles P-C4'-P energy: -40.833 tors. eta vs tors. theta energy: -2.485 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -392.173944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.173944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.173944 (E_RNA) where: Base-Base interactions energy: -175.237 where: short stacking energy: -102.464 Base-Backbone interact. energy: -1.558 local terms energy: -197.379087 where: bonds (distance) C4'-P energy: -59.410 bonds (distance) P-C4' energy: -70.891 flat angles C4'-P-C4' energy: -55.784 flat angles P-C4'-P energy: -22.455 tors. eta vs tors. theta energy: 11.160 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -319.733337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.733337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.733337 (E_RNA) where: Base-Base interactions energy: -122.718 where: short stacking energy: -95.241 Base-Backbone interact. energy: 6.046 local terms energy: -203.061970 where: bonds (distance) C4'-P energy: -53.095 bonds (distance) P-C4' energy: -78.598 flat angles C4'-P-C4' energy: -49.817 flat angles P-C4'-P energy: -27.346 tors. eta vs tors. theta energy: 5.793 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -284.983870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.983870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.983870 (E_RNA) where: Base-Base interactions energy: -111.577 where: short stacking energy: -91.447 Base-Backbone interact. energy: 2.299 local terms energy: -175.705689 where: bonds (distance) C4'-P energy: -57.821 bonds (distance) P-C4' energy: -68.234 flat angles C4'-P-C4' energy: -55.702 flat angles P-C4'-P energy: -21.031 tors. eta vs tors. theta energy: 27.083 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -841.801433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.801433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.801433 (E_RNA) where: Base-Base interactions energy: -465.856 where: short stacking energy: -266.251 Base-Backbone interact. energy: -1.817 local terms energy: -374.128819 where: bonds (distance) C4'-P energy: -81.102 bonds (distance) P-C4' energy: -88.476 flat angles C4'-P-C4' energy: -84.554 flat angles P-C4'-P energy: -61.159 tors. eta vs tors. theta energy: -58.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -758.286986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.286986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.686986 (E_RNA) where: Base-Base interactions energy: -415.119 where: short stacking energy: -214.537 Base-Backbone interact. energy: -0.321 local terms energy: -321.247059 where: bonds (distance) C4'-P energy: -72.786 bonds (distance) P-C4' energy: -87.376 flat angles C4'-P-C4' energy: -80.235 flat angles P-C4'-P energy: -45.807 tors. eta vs tors. theta energy: -35.043 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -647.655455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.655455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.055455 (E_RNA) where: Base-Base interactions energy: -294.120 where: short stacking energy: -211.598 Base-Backbone interact. energy: 0.708 local terms energy: -323.643204 where: bonds (distance) C4'-P energy: -68.807 bonds (distance) P-C4' energy: -79.648 flat angles C4'-P-C4' energy: -79.766 flat angles P-C4'-P energy: -54.646 tors. eta vs tors. theta energy: -40.776 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -700.466384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.466384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.866384 (E_RNA) where: Base-Base interactions energy: -329.976 where: short stacking energy: -208.341 Base-Backbone interact. energy: 1.926 local terms energy: -314.816487 where: bonds (distance) C4'-P energy: -78.194 bonds (distance) P-C4' energy: -82.080 flat angles C4'-P-C4' energy: -66.352 flat angles P-C4'-P energy: -49.194 tors. eta vs tors. theta energy: -38.996 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -536.980305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.980305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.980305 (E_RNA) where: Base-Base interactions energy: -229.272 where: short stacking energy: -160.788 Base-Backbone interact. energy: -0.872 local terms energy: -306.836327 where: bonds (distance) C4'-P energy: -83.993 bonds (distance) P-C4' energy: -88.918 flat angles C4'-P-C4' energy: -75.869 flat angles P-C4'-P energy: -42.435 tors. eta vs tors. theta energy: -15.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -492.849622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.849622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.049622 (E_RNA) where: Base-Base interactions energy: -213.402 where: short stacking energy: -153.126 Base-Backbone interact. energy: -0.887 local terms energy: -276.760812 where: bonds (distance) C4'-P energy: -70.231 bonds (distance) P-C4' energy: -78.466 flat angles C4'-P-C4' energy: -72.382 flat angles P-C4'-P energy: -41.242 tors. eta vs tors. theta energy: -14.440 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -524.793155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.793155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.393155 (E_RNA) where: Base-Base interactions energy: -240.885 where: short stacking energy: -141.270 Base-Backbone interact. energy: 0.471 local terms energy: -233.979039 where: bonds (distance) C4'-P energy: -56.929 bonds (distance) P-C4' energy: -71.418 flat angles C4'-P-C4' energy: -76.922 flat angles P-C4'-P energy: -29.931 tors. eta vs tors. theta energy: 1.221 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -397.832093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.832093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.632093 (E_RNA) where: Base-Base interactions energy: -142.637 where: short stacking energy: -94.079 Base-Backbone interact. energy: -1.221 local terms energy: -237.774443 where: bonds (distance) C4'-P energy: -67.272 bonds (distance) P-C4' energy: -77.647 flat angles C4'-P-C4' energy: -66.381 flat angles P-C4'-P energy: -39.716 tors. eta vs tors. theta energy: 13.242 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -318.007837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.007837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.207837 (E_RNA) where: Base-Base interactions energy: -115.673 where: short stacking energy: -93.523 Base-Backbone interact. energy: -1.131 local terms energy: -199.403761 where: bonds (distance) C4'-P energy: -64.000 bonds (distance) P-C4' energy: -76.942 flat angles C4'-P-C4' energy: -40.364 flat angles P-C4'-P energy: -29.679 tors. eta vs tors. theta energy: 11.581 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -336.008609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.008609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.808609 (E_RNA) where: Base-Base interactions energy: -116.491 where: short stacking energy: -74.112 Base-Backbone interact. energy: 1.042 local terms energy: -195.360096 where: bonds (distance) C4'-P energy: -75.240 bonds (distance) P-C4' energy: -52.286 flat angles C4'-P-C4' energy: -64.338 flat angles P-C4'-P energy: -18.951 tors. eta vs tors. theta energy: 15.455 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -809.585891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.585891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.585891 (E_RNA) where: Base-Base interactions energy: -471.319 where: short stacking energy: -248.426 Base-Backbone interact. energy: -1.867 local terms energy: -336.400142 where: bonds (distance) C4'-P energy: -74.059 bonds (distance) P-C4' energy: -88.464 flat angles C4'-P-C4' energy: -70.749 flat angles P-C4'-P energy: -53.667 tors. eta vs tors. theta energy: -49.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -767.139259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.139259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.539259 (E_RNA) where: Base-Base interactions energy: -437.828 where: short stacking energy: -224.988 Base-Backbone interact. energy: -1.160 local terms energy: -315.551971 where: bonds (distance) C4'-P energy: -77.464 bonds (distance) P-C4' energy: -83.107 flat angles C4'-P-C4' energy: -72.253 flat angles P-C4'-P energy: -49.036 tors. eta vs tors. theta energy: -33.692 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -744.480315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.480315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.480315 (E_RNA) where: Base-Base interactions energy: -357.820 where: short stacking energy: -219.694 Base-Backbone interact. energy: -0.685 local terms energy: -322.975072 where: bonds (distance) C4'-P energy: -77.738 bonds (distance) P-C4' energy: -81.217 flat angles C4'-P-C4' energy: -87.686 flat angles P-C4'-P energy: -42.799 tors. eta vs tors. theta energy: -33.536 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -601.543333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.543333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.543333 (E_RNA) where: Base-Base interactions energy: -253.986 where: short stacking energy: -172.063 Base-Backbone interact. energy: -2.365 local terms energy: -318.191969 where: bonds (distance) C4'-P energy: -81.420 bonds (distance) P-C4' energy: -82.770 flat angles C4'-P-C4' energy: -75.232 flat angles P-C4'-P energy: -50.286 tors. eta vs tors. theta energy: -28.484 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -530.690814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.690814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.690814 (E_RNA) where: Base-Base interactions energy: -255.402 where: short stacking energy: -171.878 Base-Backbone interact. energy: -2.000 local terms energy: -273.288999 where: bonds (distance) C4'-P energy: -61.969 bonds (distance) P-C4' energy: -80.420 flat angles C4'-P-C4' energy: -68.487 flat angles P-C4'-P energy: -39.816 tors. eta vs tors. theta energy: -22.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -518.227564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.227564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.227564 (E_RNA) where: Base-Base interactions energy: -225.838 where: short stacking energy: -175.324 Base-Backbone interact. energy: 4.528 local terms energy: -296.917388 where: bonds (distance) C4'-P energy: -76.611 bonds (distance) P-C4' energy: -78.078 flat angles C4'-P-C4' energy: -74.821 flat angles P-C4'-P energy: -39.454 tors. eta vs tors. theta energy: -27.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -564.730552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.730552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.730552 (E_RNA) where: Base-Base interactions energy: -258.201 where: short stacking energy: -133.239 Base-Backbone interact. energy: 0.640 local terms energy: -244.169282 where: bonds (distance) C4'-P energy: -66.088 bonds (distance) P-C4' energy: -74.927 flat angles C4'-P-C4' energy: -56.661 flat angles P-C4'-P energy: -42.182 tors. eta vs tors. theta energy: -4.311 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -361.895551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.895551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.295551 (E_RNA) where: Base-Base interactions energy: -135.767 where: short stacking energy: -80.739 Base-Backbone interact. energy: -2.477 local terms energy: -202.051279 where: bonds (distance) C4'-P energy: -65.855 bonds (distance) P-C4' energy: -76.668 flat angles C4'-P-C4' energy: -38.448 flat angles P-C4'-P energy: -35.268 tors. eta vs tors. theta energy: 14.188 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -352.901614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.901614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.101614 (E_RNA) where: Base-Base interactions energy: -134.974 where: short stacking energy: -87.238 Base-Backbone interact. energy: -2.061 local terms energy: -205.066579 where: bonds (distance) C4'-P energy: -59.378 bonds (distance) P-C4' energy: -66.463 flat angles C4'-P-C4' energy: -53.423 flat angles P-C4'-P energy: -32.530 tors. eta vs tors. theta energy: 6.727 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -295.825970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.825970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.825970 (E_RNA) where: Base-Base interactions energy: -75.929 where: short stacking energy: -60.881 Base-Backbone interact. energy: 0.616 local terms energy: -220.513639 where: bonds (distance) C4'-P energy: -67.086 bonds (distance) P-C4' energy: -68.322 flat angles C4'-P-C4' energy: -52.830 flat angles P-C4'-P energy: -57.118 tors. eta vs tors. theta energy: 24.842 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -837.688492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.688492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.688492 (E_RNA) where: Base-Base interactions energy: -494.423 where: short stacking energy: -256.866 Base-Backbone interact. energy: -1.804 local terms energy: -341.461592 where: bonds (distance) C4'-P energy: -75.657 bonds (distance) P-C4' energy: -79.861 flat angles C4'-P-C4' energy: -83.313 flat angles P-C4'-P energy: -50.096 tors. eta vs tors. theta energy: -52.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -758.142123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.142123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.542123 (E_RNA) where: Base-Base interactions energy: -437.916 where: short stacking energy: -224.315 Base-Backbone interact. energy: 1.392 local terms energy: -300.017715 where: bonds (distance) C4'-P energy: -82.785 bonds (distance) P-C4' energy: -64.901 flat angles C4'-P-C4' energy: -79.101 flat angles P-C4'-P energy: -43.417 tors. eta vs tors. theta energy: -29.813 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -777.510907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.510907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.910907 (E_RNA) where: Base-Base interactions energy: -376.235 where: short stacking energy: -243.243 Base-Backbone interact. energy: 3.699 local terms energy: -347.374902 where: bonds (distance) C4'-P energy: -82.990 bonds (distance) P-C4' energy: -80.037 flat angles C4'-P-C4' energy: -86.563 flat angles P-C4'-P energy: -51.867 tors. eta vs tors. theta energy: -45.918 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -608.368908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.368908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.168908 (E_RNA) where: Base-Base interactions energy: -274.059 where: short stacking energy: -204.054 Base-Backbone interact. energy: -1.645 local terms energy: -307.464076 where: bonds (distance) C4'-P energy: -84.080 bonds (distance) P-C4' energy: -72.260 flat angles C4'-P-C4' energy: -69.695 flat angles P-C4'-P energy: -41.975 tors. eta vs tors. theta energy: -39.455 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -539.316284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.316284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.316284 (E_RNA) where: Base-Base interactions energy: -256.564 where: short stacking energy: -171.234 Base-Backbone interact. energy: -0.484 local terms energy: -282.268003 where: bonds (distance) C4'-P energy: -79.640 bonds (distance) P-C4' energy: -68.837 flat angles C4'-P-C4' energy: -72.119 flat angles P-C4'-P energy: -43.458 tors. eta vs tors. theta energy: -18.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -582.958857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.958857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.758857 (E_RNA) where: Base-Base interactions energy: -253.787 where: short stacking energy: -148.240 Base-Backbone interact. energy: 1.299 local terms energy: -260.270193 where: bonds (distance) C4'-P energy: -66.452 bonds (distance) P-C4' energy: -79.664 flat angles C4'-P-C4' energy: -71.357 flat angles P-C4'-P energy: -38.242 tors. eta vs tors. theta energy: -4.555 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -443.919319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.919319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.919319 (E_RNA) where: Base-Base interactions energy: -185.575 where: short stacking energy: -125.212 Base-Backbone interact. energy: -0.846 local terms energy: -257.498953 where: bonds (distance) C4'-P energy: -66.312 bonds (distance) P-C4' energy: -77.841 flat angles C4'-P-C4' energy: -62.968 flat angles P-C4'-P energy: -39.639 tors. eta vs tors. theta energy: -10.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -422.802991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.802991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.602991 (E_RNA) where: Base-Base interactions energy: -175.119 where: short stacking energy: -105.013 Base-Backbone interact. energy: 3.995 local terms energy: -235.478958 where: bonds (distance) C4'-P energy: -78.565 bonds (distance) P-C4' energy: -67.098 flat angles C4'-P-C4' energy: -58.888 flat angles P-C4'-P energy: -40.000 tors. eta vs tors. theta energy: 9.071 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -373.378423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.378423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.978423 (E_RNA) where: Base-Base interactions energy: -146.338 where: short stacking energy: -106.194 Base-Backbone interact. energy: 1.161 local terms energy: -204.801772 where: bonds (distance) C4'-P energy: -49.975 bonds (distance) P-C4' energy: -76.938 flat angles C4'-P-C4' energy: -51.624 flat angles P-C4'-P energy: -29.645 tors. eta vs tors. theta energy: 3.381 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -302.189836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.189836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.189836 (E_RNA) where: Base-Base interactions energy: -90.902 where: short stacking energy: -63.869 Base-Backbone interact. energy: -2.188 local terms energy: -200.099592 where: bonds (distance) C4'-P energy: -60.659 bonds (distance) P-C4' energy: -67.581 flat angles C4'-P-C4' energy: -57.199 flat angles P-C4'-P energy: -36.713 tors. eta vs tors. theta energy: 22.053 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -838.122676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.122676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.122676 (E_RNA) where: Base-Base interactions energy: -495.240 where: short stacking energy: -261.299 Base-Backbone interact. energy: -2.468 local terms energy: -340.414447 where: bonds (distance) C4'-P energy: -75.496 bonds (distance) P-C4' energy: -87.343 flat angles C4'-P-C4' energy: -85.814 flat angles P-C4'-P energy: -42.522 tors. eta vs tors. theta energy: -49.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -744.913394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.913394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.513394 (E_RNA) where: Base-Base interactions energy: -420.309 where: short stacking energy: -218.097 Base-Backbone interact. energy: -1.066 local terms energy: -300.138160 where: bonds (distance) C4'-P energy: -70.931 bonds (distance) P-C4' energy: -74.273 flat angles C4'-P-C4' energy: -69.988 flat angles P-C4'-P energy: -55.108 tors. eta vs tors. theta energy: -29.838 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -846.482197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -846.482197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.482197 (E_RNA) where: Base-Base interactions energy: -452.457 where: short stacking energy: -281.048 Base-Backbone interact. energy: -1.223 local terms energy: -329.802086 where: bonds (distance) C4'-P energy: -71.784 bonds (distance) P-C4' energy: -74.717 flat angles C4'-P-C4' energy: -73.179 flat angles P-C4'-P energy: -53.662 tors. eta vs tors. theta energy: -56.461 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -608.179658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.179658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.379658 (E_RNA) where: Base-Base interactions energy: -278.700 where: short stacking energy: -187.158 Base-Backbone interact. energy: -1.033 local terms energy: -299.646550 where: bonds (distance) C4'-P energy: -70.086 bonds (distance) P-C4' energy: -78.132 flat angles C4'-P-C4' energy: -77.934 flat angles P-C4'-P energy: -39.684 tors. eta vs tors. theta energy: -33.811 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -645.174899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.174899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.974899 (E_RNA) where: Base-Base interactions energy: -289.482 where: short stacking energy: -158.480 Base-Backbone interact. energy: -0.769 local terms energy: -284.723372 where: bonds (distance) C4'-P energy: -74.562 bonds (distance) P-C4' energy: -75.042 flat angles C4'-P-C4' energy: -68.943 flat angles P-C4'-P energy: -43.091 tors. eta vs tors. theta energy: -23.086 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -531.935291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.935291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.535291 (E_RNA) where: Base-Base interactions energy: -238.030 where: short stacking energy: -153.397 Base-Backbone interact. energy: 0.694 local terms energy: -280.199079 where: bonds (distance) C4'-P energy: -78.115 bonds (distance) P-C4' energy: -73.745 flat angles C4'-P-C4' energy: -80.155 flat angles P-C4'-P energy: -32.996 tors. eta vs tors. theta energy: -15.188 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -458.236476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.236476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.236476 (E_RNA) where: Base-Base interactions energy: -198.555 where: short stacking energy: -150.284 Base-Backbone interact. energy: -2.558 local terms energy: -257.123415 where: bonds (distance) C4'-P energy: -73.388 bonds (distance) P-C4' energy: -69.148 flat angles C4'-P-C4' energy: -72.138 flat angles P-C4'-P energy: -33.247 tors. eta vs tors. theta energy: -9.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -420.079723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.079723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.479723 (E_RNA) where: Base-Base interactions energy: -188.655 where: short stacking energy: -117.642 Base-Backbone interact. energy: 2.574 local terms energy: -212.399597 where: bonds (distance) C4'-P energy: -64.071 bonds (distance) P-C4' energy: -68.120 flat angles C4'-P-C4' energy: -54.112 flat angles P-C4'-P energy: -29.042 tors. eta vs tors. theta energy: 2.945 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -342.480154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.480154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.280154 (E_RNA) where: Base-Base interactions energy: -122.985 where: short stacking energy: -87.811 Base-Backbone interact. energy: -1.101 local terms energy: -202.193442 where: bonds (distance) C4'-P energy: -65.824 bonds (distance) P-C4' energy: -63.280 flat angles C4'-P-C4' energy: -50.967 flat angles P-C4'-P energy: -32.558 tors. eta vs tors. theta energy: 10.435 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -291.843483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.843483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.843483 (E_RNA) where: Base-Base interactions energy: -86.395 where: short stacking energy: -78.863 Base-Backbone interact. energy: -0.177 local terms energy: -205.271914 where: bonds (distance) C4'-P energy: -78.324 bonds (distance) P-C4' energy: -70.403 flat angles C4'-P-C4' energy: -54.035 flat angles P-C4'-P energy: -26.290 tors. eta vs tors. theta energy: 23.780 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -868.036061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.036061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.036061 (E_RNA) where: Base-Base interactions energy: -506.228 where: short stacking energy: -262.690 Base-Backbone interact. energy: 0.467 local terms energy: -362.275533 where: bonds (distance) C4'-P energy: -79.062 bonds (distance) P-C4' energy: -81.643 flat angles C4'-P-C4' energy: -82.957 flat angles P-C4'-P energy: -63.199 tors. eta vs tors. theta energy: -55.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -847.543946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.543946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.943946 (E_RNA) where: Base-Base interactions energy: -420.950 where: short stacking energy: -262.687 Base-Backbone interact. energy: -2.373 local terms energy: -357.621005 where: bonds (distance) C4'-P energy: -75.588 bonds (distance) P-C4' energy: -80.225 flat angles C4'-P-C4' energy: -90.042 flat angles P-C4'-P energy: -57.385 tors. eta vs tors. theta energy: -54.381 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -750.448284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.448284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.048284 (E_RNA) where: Base-Base interactions energy: -416.230 where: short stacking energy: -223.580 Base-Backbone interact. energy: -1.291 local terms energy: -309.528055 where: bonds (distance) C4'-P energy: -73.198 bonds (distance) P-C4' energy: -76.566 flat angles C4'-P-C4' energy: -71.149 flat angles P-C4'-P energy: -53.719 tors. eta vs tors. theta energy: -34.896 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -671.411558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.411558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.611558 (E_RNA) where: Base-Base interactions energy: -285.522 where: short stacking energy: -175.593 Base-Backbone interact. energy: -1.805 local terms energy: -301.284234 where: bonds (distance) C4'-P energy: -72.852 bonds (distance) P-C4' energy: -78.871 flat angles C4'-P-C4' energy: -73.587 flat angles P-C4'-P energy: -35.533 tors. eta vs tors. theta energy: -40.442 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -558.257151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.257151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.057151 (E_RNA) where: Base-Base interactions energy: -236.877 where: short stacking energy: -171.040 Base-Backbone interact. energy: 1.953 local terms energy: -298.133222 where: bonds (distance) C4'-P energy: -66.433 bonds (distance) P-C4' energy: -81.634 flat angles C4'-P-C4' energy: -80.042 flat angles P-C4'-P energy: -37.497 tors. eta vs tors. theta energy: -32.528 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -543.479031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.479031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.279031 (E_RNA) where: Base-Base interactions energy: -262.562 where: short stacking energy: -163.432 Base-Backbone interact. energy: -2.440 local terms energy: -271.277464 where: bonds (distance) C4'-P energy: -71.044 bonds (distance) P-C4' energy: -77.979 flat angles C4'-P-C4' energy: -68.266 flat angles P-C4'-P energy: -30.241 tors. eta vs tors. theta energy: -23.748 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -405.091009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.091009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.091009 (E_RNA) where: Base-Base interactions energy: -165.000 where: short stacking energy: -119.141 Base-Backbone interact. energy: -1.114 local terms energy: -238.976519 where: bonds (distance) C4'-P energy: -70.993 bonds (distance) P-C4' energy: -82.716 flat angles C4'-P-C4' energy: -61.413 flat angles P-C4'-P energy: -40.621 tors. eta vs tors. theta energy: 16.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -403.078454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.078454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.678454 (E_RNA) where: Base-Base interactions energy: -147.881 where: short stacking energy: -86.433 Base-Backbone interact. energy: -1.936 local terms energy: -238.861249 where: bonds (distance) C4'-P energy: -66.199 bonds (distance) P-C4' energy: -77.977 flat angles C4'-P-C4' energy: -67.003 flat angles P-C4'-P energy: -28.920 tors. eta vs tors. theta energy: 1.238 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -366.019183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.019183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.219183 (E_RNA) where: Base-Base interactions energy: -147.692 where: short stacking energy: -88.239 Base-Backbone interact. energy: -1.678 local terms energy: -205.849238 where: bonds (distance) C4'-P energy: -65.151 bonds (distance) P-C4' energy: -68.087 flat angles C4'-P-C4' energy: -66.008 flat angles P-C4'-P energy: -26.169 tors. eta vs tors. theta energy: 19.566 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -303.411730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.411730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.411730 (E_RNA) where: Base-Base interactions energy: -92.617 where: short stacking energy: -75.818 Base-Backbone interact. energy: 5.159 local terms energy: -215.953884 where: bonds (distance) C4'-P energy: -77.386 bonds (distance) P-C4' energy: -60.099 flat angles C4'-P-C4' energy: -52.641 flat angles P-C4'-P energy: -39.182 tors. eta vs tors. theta energy: 13.353 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -933.194387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.194387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.394387 (E_RNA) where: Base-Base interactions energy: -505.885 where: short stacking energy: -299.063 Base-Backbone interact. energy: -0.800 local terms energy: -352.709575 where: bonds (distance) C4'-P energy: -75.766 bonds (distance) P-C4' energy: -69.929 flat angles C4'-P-C4' energy: -82.990 flat angles P-C4'-P energy: -57.994 tors. eta vs tors. theta energy: -66.030 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -853.520466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.520466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.520466 (E_RNA) where: Base-Base interactions energy: -522.479 where: short stacking energy: -261.574 Base-Backbone interact. energy: 1.453 local terms energy: -332.493770 where: bonds (distance) C4'-P energy: -69.246 bonds (distance) P-C4' energy: -80.245 flat angles C4'-P-C4' energy: -70.811 flat angles P-C4'-P energy: -63.932 tors. eta vs tors. theta energy: -48.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -758.654846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.654846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.854846 (E_RNA) where: Base-Base interactions energy: -362.349 where: short stacking energy: -233.205 Base-Backbone interact. energy: -0.435 local terms energy: -322.070422 where: bonds (distance) C4'-P energy: -77.406 bonds (distance) P-C4' energy: -73.684 flat angles C4'-P-C4' energy: -73.264 flat angles P-C4'-P energy: -51.738 tors. eta vs tors. theta energy: -45.980 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -693.844403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.844403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.244403 (E_RNA) where: Base-Base interactions energy: -395.358 where: short stacking energy: -198.170 Base-Backbone interact. energy: 2.289 local terms energy: -279.174701 where: bonds (distance) C4'-P energy: -62.550 bonds (distance) P-C4' energy: -71.009 flat angles C4'-P-C4' energy: -72.631 flat angles P-C4'-P energy: -36.468 tors. eta vs tors. theta energy: -36.517 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -579.693325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.693325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.693325 (E_RNA) where: Base-Base interactions energy: -267.301 where: short stacking energy: -169.981 Base-Backbone interact. energy: -3.223 local terms energy: -291.169448 where: bonds (distance) C4'-P energy: -80.272 bonds (distance) P-C4' energy: -84.103 flat angles C4'-P-C4' energy: -74.969 flat angles P-C4'-P energy: -35.186 tors. eta vs tors. theta energy: -16.640 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -512.466619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.466619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.266619 (E_RNA) where: Base-Base interactions energy: -229.992 where: short stacking energy: -146.589 Base-Backbone interact. energy: 1.315 local terms energy: -258.589189 where: bonds (distance) C4'-P energy: -66.484 bonds (distance) P-C4' energy: -68.299 flat angles C4'-P-C4' energy: -79.736 flat angles P-C4'-P energy: -42.912 tors. eta vs tors. theta energy: -1.158 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -447.807658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.807658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.407658 (E_RNA) where: Base-Base interactions energy: -204.977 where: short stacking energy: -120.118 Base-Backbone interact. energy: 2.142 local terms energy: -221.572664 where: bonds (distance) C4'-P energy: -61.491 bonds (distance) P-C4' energy: -70.408 flat angles C4'-P-C4' energy: -57.147 flat angles P-C4'-P energy: -36.051 tors. eta vs tors. theta energy: 3.525 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -406.017819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.017819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.017819 (E_RNA) where: Base-Base interactions energy: -164.130 where: short stacking energy: -111.752 Base-Backbone interact. energy: -1.822 local terms energy: -240.066386 where: bonds (distance) C4'-P energy: -80.845 bonds (distance) P-C4' energy: -73.816 flat angles C4'-P-C4' energy: -51.921 flat angles P-C4'-P energy: -47.298 tors. eta vs tors. theta energy: 13.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -325.769722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.769722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.969722 (E_RNA) where: Base-Base interactions energy: -106.145 where: short stacking energy: -85.165 Base-Backbone interact. energy: 4.691 local terms energy: -222.515957 where: bonds (distance) C4'-P energy: -78.191 bonds (distance) P-C4' energy: -70.789 flat angles C4'-P-C4' energy: -60.595 flat angles P-C4'-P energy: -35.877 tors. eta vs tors. theta energy: 22.935 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -378.706808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.706808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.306808 (E_RNA) where: Base-Base interactions energy: -164.349 where: short stacking energy: -106.456 Base-Backbone interact. energy: -1.918 local terms energy: -207.039547 where: bonds (distance) C4'-P energy: -62.578 bonds (distance) P-C4' energy: -64.767 flat angles C4'-P-C4' energy: -68.225 flat angles P-C4'-P energy: -29.359 tors. eta vs tors. theta energy: 17.889 Dist. restrs. and SS energy: -5.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -953.136409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.136409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.336409 (E_RNA) where: Base-Base interactions energy: -510.667 where: short stacking energy: -289.127 Base-Backbone interact. energy: -0.644 local terms energy: -368.025870 where: bonds (distance) C4'-P energy: -68.852 bonds (distance) P-C4' energy: -89.082 flat angles C4'-P-C4' energy: -84.107 flat angles P-C4'-P energy: -58.214 tors. eta vs tors. theta energy: -67.771 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -874.890496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.890496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.890496 (E_RNA) where: Base-Base interactions energy: -527.703 where: short stacking energy: -265.062 Base-Backbone interact. energy: -1.475 local terms energy: -345.712032 where: bonds (distance) C4'-P energy: -78.152 bonds (distance) P-C4' energy: -75.834 flat angles C4'-P-C4' energy: -79.905 flat angles P-C4'-P energy: -59.862 tors. eta vs tors. theta energy: -51.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -762.320009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.320009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.120009 (E_RNA) where: Base-Base interactions energy: -355.526 where: short stacking energy: -208.945 Base-Backbone interact. energy: -1.679 local terms energy: -334.915064 where: bonds (distance) C4'-P energy: -85.320 bonds (distance) P-C4' energy: -82.435 flat angles C4'-P-C4' energy: -64.338 flat angles P-C4'-P energy: -61.469 tors. eta vs tors. theta energy: -41.354 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -702.003580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.003580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.203580 (E_RNA) where: Base-Base interactions energy: -375.100 where: short stacking energy: -215.139 Base-Backbone interact. energy: -1.255 local terms energy: -305.848201 where: bonds (distance) C4'-P energy: -68.507 bonds (distance) P-C4' energy: -83.021 flat angles C4'-P-C4' energy: -75.920 flat angles P-C4'-P energy: -52.471 tors. eta vs tors. theta energy: -25.929 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -546.004431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -546.004431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.804431 (E_RNA) where: Base-Base interactions energy: -249.889 where: short stacking energy: -151.297 Base-Backbone interact. energy: 2.113 local terms energy: -273.028649 where: bonds (distance) C4'-P energy: -67.433 bonds (distance) P-C4' energy: -84.988 flat angles C4'-P-C4' energy: -59.679 flat angles P-C4'-P energy: -43.409 tors. eta vs tors. theta energy: -17.519 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -462.881288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.881288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.481288 (E_RNA) where: Base-Base interactions energy: -165.810 where: short stacking energy: -100.235 Base-Backbone interact. energy: -2.894 local terms energy: -261.777648 where: bonds (distance) C4'-P energy: -82.527 bonds (distance) P-C4' energy: -79.161 flat angles C4'-P-C4' energy: -60.093 flat angles P-C4'-P energy: -40.567 tors. eta vs tors. theta energy: 0.570 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -411.467280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.467280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.467280 (E_RNA) where: Base-Base interactions energy: -165.095 where: short stacking energy: -91.963 Base-Backbone interact. energy: 0.846 local terms energy: -229.218441 where: bonds (distance) C4'-P energy: -69.806 bonds (distance) P-C4' energy: -60.158 flat angles C4'-P-C4' energy: -65.622 flat angles P-C4'-P energy: -41.865 tors. eta vs tors. theta energy: 8.233 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -347.072687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.072687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.072687 (E_RNA) where: Base-Base interactions energy: -143.407 where: short stacking energy: -97.539 Base-Backbone interact. energy: 5.924 local terms energy: -209.589786 where: bonds (distance) C4'-P energy: -73.682 bonds (distance) P-C4' energy: -73.601 flat angles C4'-P-C4' energy: -55.495 flat angles P-C4'-P energy: -23.889 tors. eta vs tors. theta energy: 17.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -322.282132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.282132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.482132 (E_RNA) where: Base-Base interactions energy: -88.365 where: short stacking energy: -78.946 Base-Backbone interact. energy: 0.237 local terms energy: -232.354515 where: bonds (distance) C4'-P energy: -72.342 bonds (distance) P-C4' energy: -57.079 flat angles C4'-P-C4' energy: -75.194 flat angles P-C4'-P energy: -38.979 tors. eta vs tors. theta energy: 11.239 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -369.120551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.120551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.320551 (E_RNA) where: Base-Base interactions energy: -139.055 where: short stacking energy: -89.693 Base-Backbone interact. energy: 7.392 local terms energy: -217.657941 where: bonds (distance) C4'-P energy: -61.987 bonds (distance) P-C4' energy: -67.924 flat angles C4'-P-C4' energy: -61.336 flat angles P-C4'-P energy: -29.562 tors. eta vs tors. theta energy: 3.151 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -965.432438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.432438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.432438 (E_RNA) where: Base-Base interactions energy: -532.901 where: short stacking energy: -286.686 Base-Backbone interact. energy: -1.302 local terms energy: -359.229017 where: bonds (distance) C4'-P energy: -80.275 bonds (distance) P-C4' energy: -84.960 flat angles C4'-P-C4' energy: -81.824 flat angles P-C4'-P energy: -43.087 tors. eta vs tors. theta energy: -69.083 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -894.707821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.707821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.707821 (E_RNA) where: Base-Base interactions energy: -533.992 where: short stacking energy: -267.838 Base-Backbone interact. energy: 1.944 local terms energy: -362.658970 where: bonds (distance) C4'-P energy: -84.352 bonds (distance) P-C4' energy: -84.044 flat angles C4'-P-C4' energy: -82.974 flat angles P-C4'-P energy: -50.028 tors. eta vs tors. theta energy: -61.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -773.177396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.177396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.177396 (E_RNA) where: Base-Base interactions energy: -370.296 where: short stacking energy: -214.612 Base-Backbone interact. energy: -1.288 local terms energy: -320.593557 where: bonds (distance) C4'-P energy: -75.699 bonds (distance) P-C4' energy: -84.801 flat angles C4'-P-C4' energy: -78.523 flat angles P-C4'-P energy: -42.832 tors. eta vs tors. theta energy: -38.738 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -654.221829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.221829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.421829 (E_RNA) where: Base-Base interactions energy: -352.217 where: short stacking energy: -200.969 Base-Backbone interact. energy: -1.700 local terms energy: -280.505043 where: bonds (distance) C4'-P energy: -65.664 bonds (distance) P-C4' energy: -75.521 flat angles C4'-P-C4' energy: -64.866 flat angles P-C4'-P energy: -46.007 tors. eta vs tors. theta energy: -28.447 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -542.728297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.728297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.928297 (E_RNA) where: Base-Base interactions energy: -269.668 where: short stacking energy: -141.382 Base-Backbone interact. energy: -1.892 local terms energy: -242.369001 where: bonds (distance) C4'-P energy: -72.399 bonds (distance) P-C4' energy: -63.988 flat angles C4'-P-C4' energy: -62.747 flat angles P-C4'-P energy: -40.457 tors. eta vs tors. theta energy: -2.779 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -570.796179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.796179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.996179 (E_RNA) where: Base-Base interactions energy: -252.231 where: short stacking energy: -151.327 Base-Backbone interact. energy: -0.505 local terms energy: -271.260527 where: bonds (distance) C4'-P energy: -76.901 bonds (distance) P-C4' energy: -67.190 flat angles C4'-P-C4' energy: -71.520 flat angles P-C4'-P energy: -41.050 tors. eta vs tors. theta energy: -14.599 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -402.803559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.803559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.803559 (E_RNA) where: Base-Base interactions energy: -142.208 where: short stacking energy: -94.751 Base-Backbone interact. energy: -1.031 local terms energy: -250.564261 where: bonds (distance) C4'-P energy: -73.688 bonds (distance) P-C4' energy: -75.768 flat angles C4'-P-C4' energy: -57.526 flat angles P-C4'-P energy: -44.138 tors. eta vs tors. theta energy: 0.555 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -442.065937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.065937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.865937 (E_RNA) where: Base-Base interactions energy: -182.645 where: short stacking energy: -122.735 Base-Backbone interact. energy: -1.570 local terms energy: -241.651194 where: bonds (distance) C4'-P energy: -69.057 bonds (distance) P-C4' energy: -58.841 flat angles C4'-P-C4' energy: -76.328 flat angles P-C4'-P energy: -35.142 tors. eta vs tors. theta energy: -2.282 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -397.821036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.821036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.621036 (E_RNA) where: Base-Base interactions energy: -174.470 where: short stacking energy: -95.814 Base-Backbone interact. energy: -1.812 local terms energy: -196.339146 where: bonds (distance) C4'-P energy: -50.931 bonds (distance) P-C4' energy: -74.960 flat angles C4'-P-C4' energy: -55.609 flat angles P-C4'-P energy: -24.650 tors. eta vs tors. theta energy: 9.811 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -301.122668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.122668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.322668 (E_RNA) where: Base-Base interactions energy: -84.115 where: short stacking energy: -81.760 Base-Backbone interact. energy: 5.491 local terms energy: -220.697903 where: bonds (distance) C4'-P energy: -60.436 bonds (distance) P-C4' energy: -62.487 flat angles C4'-P-C4' energy: -63.816 flat angles P-C4'-P energy: -40.688 tors. eta vs tors. theta energy: 6.729 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -976.965157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -976.965157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.965157 (E_RNA) where: Base-Base interactions energy: -529.310 where: short stacking energy: -282.736 Base-Backbone interact. energy: 0.112 local terms energy: -375.766873 where: bonds (distance) C4'-P energy: -86.971 bonds (distance) P-C4' energy: -90.916 flat angles C4'-P-C4' energy: -75.642 flat angles P-C4'-P energy: -60.071 tors. eta vs tors. theta energy: -62.166 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -912.545025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.545025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.545025 (E_RNA) where: Base-Base interactions energy: -562.826 where: short stacking energy: -273.513 Base-Backbone interact. energy: -4.693 local terms energy: -345.026280 where: bonds (distance) C4'-P energy: -60.122 bonds (distance) P-C4' energy: -85.450 flat angles C4'-P-C4' energy: -79.520 flat angles P-C4'-P energy: -54.456 tors. eta vs tors. theta energy: -65.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -784.471384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.471384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.071384 (E_RNA) where: Base-Base interactions energy: -387.456 where: short stacking energy: -213.311 Base-Backbone interact. energy: -2.941 local terms energy: -316.673774 where: bonds (distance) C4'-P energy: -73.836 bonds (distance) P-C4' energy: -87.596 flat angles C4'-P-C4' energy: -73.563 flat angles P-C4'-P energy: -41.337 tors. eta vs tors. theta energy: -40.342 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -677.555792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.555792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.755792 (E_RNA) where: Base-Base interactions energy: -359.417 where: short stacking energy: -230.913 Base-Backbone interact. energy: -1.160 local terms energy: -297.178563 where: bonds (distance) C4'-P energy: -75.956 bonds (distance) P-C4' energy: -68.219 flat angles C4'-P-C4' energy: -70.160 flat angles P-C4'-P energy: -43.602 tors. eta vs tors. theta energy: -39.241 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -607.434517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.434517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.634517 (E_RNA) where: Base-Base interactions energy: -299.622 where: short stacking energy: -196.253 Base-Backbone interact. energy: -3.530 local terms energy: -266.482684 where: bonds (distance) C4'-P energy: -65.694 bonds (distance) P-C4' energy: -69.983 flat angles C4'-P-C4' energy: -69.160 flat angles P-C4'-P energy: -37.530 tors. eta vs tors. theta energy: -24.115 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -582.968486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.968486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.568486 (E_RNA) where: Base-Base interactions energy: -262.831 where: short stacking energy: -153.717 Base-Backbone interact. energy: 0.826 local terms energy: -270.563613 where: bonds (distance) C4'-P energy: -68.227 bonds (distance) P-C4' energy: -71.032 flat angles C4'-P-C4' energy: -67.312 flat angles P-C4'-P energy: -37.458 tors. eta vs tors. theta energy: -26.534 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -454.377227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.377227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.977227 (E_RNA) where: Base-Base interactions energy: -175.168 where: short stacking energy: -118.726 Base-Backbone interact. energy: 0.411 local terms energy: -274.220662 where: bonds (distance) C4'-P energy: -70.453 bonds (distance) P-C4' energy: -80.115 flat angles C4'-P-C4' energy: -69.312 flat angles P-C4'-P energy: -44.324 tors. eta vs tors. theta energy: -10.017 Dist. restrs. and SS energy: -5.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -439.953491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.953491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.353491 (E_RNA) where: Base-Base interactions energy: -177.466 where: short stacking energy: -102.261 Base-Backbone interact. energy: 2.517 local terms energy: -234.404073 where: bonds (distance) C4'-P energy: -63.379 bonds (distance) P-C4' energy: -69.080 flat angles C4'-P-C4' energy: -74.534 flat angles P-C4'-P energy: -30.515 tors. eta vs tors. theta energy: 3.103 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -350.477755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.477755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.077755 (E_RNA) where: Base-Base interactions energy: -133.101 where: short stacking energy: -84.133 Base-Backbone interact. energy: 2.465 local terms energy: -205.441348 where: bonds (distance) C4'-P energy: -65.461 bonds (distance) P-C4' energy: -69.677 flat angles C4'-P-C4' energy: -61.959 flat angles P-C4'-P energy: -31.565 tors. eta vs tors. theta energy: 23.219 Dist. restrs. and SS energy: -14.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -320.187533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.187533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.187533 (E_RNA) where: Base-Base interactions energy: -100.222 where: short stacking energy: -94.249 Base-Backbone interact. energy: -1.849 local terms energy: -218.116530 where: bonds (distance) C4'-P energy: -68.839 bonds (distance) P-C4' energy: -77.896 flat angles C4'-P-C4' energy: -47.764 flat angles P-C4'-P energy: -38.514 tors. eta vs tors. theta energy: 14.897 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -969.102320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.102320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.102320 (E_RNA) where: Base-Base interactions energy: -540.035 where: short stacking energy: -302.106 Base-Backbone interact. energy: 1.680 local terms energy: -358.746752 where: bonds (distance) C4'-P energy: -83.372 bonds (distance) P-C4' energy: -76.767 flat angles C4'-P-C4' energy: -88.014 flat angles P-C4'-P energy: -54.380 tors. eta vs tors. theta energy: -56.213 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -942.273372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.273372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.273372 (E_RNA) where: Base-Base interactions energy: -569.567 where: short stacking energy: -276.659 Base-Backbone interact. energy: -0.690 local terms energy: -372.016200 where: bonds (distance) C4'-P energy: -88.999 bonds (distance) P-C4' energy: -83.284 flat angles C4'-P-C4' energy: -76.885 flat angles P-C4'-P energy: -55.749 tors. eta vs tors. theta energy: -67.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -816.073196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.073196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.473196 (E_RNA) where: Base-Base interactions energy: -400.801 where: short stacking energy: -219.298 Base-Backbone interact. energy: 0.850 local terms energy: -322.522365 where: bonds (distance) C4'-P energy: -82.938 bonds (distance) P-C4' energy: -66.033 flat angles C4'-P-C4' energy: -83.220 flat angles P-C4'-P energy: -40.525 tors. eta vs tors. theta energy: -49.806 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -672.445698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.445698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.645698 (E_RNA) where: Base-Base interactions energy: -361.041 where: short stacking energy: -218.631 Base-Backbone interact. energy: -2.453 local terms energy: -289.152231 where: bonds (distance) C4'-P energy: -78.769 bonds (distance) P-C4' energy: -67.944 flat angles C4'-P-C4' energy: -56.969 flat angles P-C4'-P energy: -46.252 tors. eta vs tors. theta energy: -39.219 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -642.827946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.827946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.027946 (E_RNA) where: Base-Base interactions energy: -290.221 where: short stacking energy: -182.240 Base-Backbone interact. energy: -0.975 local terms energy: -295.832004 where: bonds (distance) C4'-P energy: -75.344 bonds (distance) P-C4' energy: -72.482 flat angles C4'-P-C4' energy: -69.578 flat angles P-C4'-P energy: -42.990 tors. eta vs tors. theta energy: -35.438 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -589.951001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.951001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.751001 (E_RNA) where: Base-Base interactions energy: -278.688 where: short stacking energy: -165.538 Base-Backbone interact. energy: -2.562 local terms energy: -274.501757 where: bonds (distance) C4'-P energy: -76.255 bonds (distance) P-C4' energy: -66.626 flat angles C4'-P-C4' energy: -55.246 flat angles P-C4'-P energy: -49.574 tors. eta vs tors. theta energy: -26.801 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -459.598367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.598367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.198367 (E_RNA) where: Base-Base interactions energy: -197.953 where: short stacking energy: -125.022 Base-Backbone interact. energy: -2.037 local terms energy: -236.208976 where: bonds (distance) C4'-P energy: -73.030 bonds (distance) P-C4' energy: -78.521 flat angles C4'-P-C4' energy: -56.196 flat angles P-C4'-P energy: -24.104 tors. eta vs tors. theta energy: -4.358 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -411.896292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.896292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.496292 (E_RNA) where: Base-Base interactions energy: -167.686 where: short stacking energy: -124.863 Base-Backbone interact. energy: -1.164 local terms energy: -237.646200 where: bonds (distance) C4'-P energy: -48.375 bonds (distance) P-C4' energy: -81.591 flat angles C4'-P-C4' energy: -71.634 flat angles P-C4'-P energy: -34.382 tors. eta vs tors. theta energy: -1.664 Dist. restrs. and SS energy: -5.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -332.494217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.494217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.494217 (E_RNA) where: Base-Base interactions energy: -119.046 where: short stacking energy: -106.105 Base-Backbone interact. energy: -0.086 local terms energy: -213.362577 where: bonds (distance) C4'-P energy: -72.711 bonds (distance) P-C4' energy: -67.377 flat angles C4'-P-C4' energy: -51.172 flat angles P-C4'-P energy: -35.372 tors. eta vs tors. theta energy: 13.270 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -344.664257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.664257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.664257 (E_RNA) where: Base-Base interactions energy: -116.766 where: short stacking energy: -70.676 Base-Backbone interact. energy: -2.235 local terms energy: -207.663285 where: bonds (distance) C4'-P energy: -66.822 bonds (distance) P-C4' energy: -79.134 flat angles C4'-P-C4' energy: -53.426 flat angles P-C4'-P energy: -31.813 tors. eta vs tors. theta energy: 23.533 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -933.267170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.267170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.467170 (E_RNA) where: Base-Base interactions energy: -494.836 where: short stacking energy: -271.423 Base-Backbone interact. energy: 3.855 local terms energy: -368.486345 where: bonds (distance) C4'-P energy: -83.060 bonds (distance) P-C4' energy: -84.378 flat angles C4'-P-C4' energy: -93.690 flat angles P-C4'-P energy: -51.292 tors. eta vs tors. theta energy: -56.067 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -945.118815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.118815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.118815 (E_RNA) where: Base-Base interactions energy: -566.509 where: short stacking energy: -277.687 Base-Backbone interact. energy: -0.995 local terms energy: -377.615118 where: bonds (distance) C4'-P energy: -83.089 bonds (distance) P-C4' energy: -79.998 flat angles C4'-P-C4' energy: -91.656 flat angles P-C4'-P energy: -47.407 tors. eta vs tors. theta energy: -75.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -854.158860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.158860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.958860 (E_RNA) where: Base-Base interactions energy: -439.647 where: short stacking energy: -235.787 Base-Backbone interact. energy: -1.833 local terms energy: -324.478820 where: bonds (distance) C4'-P energy: -75.947 bonds (distance) P-C4' energy: -83.694 flat angles C4'-P-C4' energy: -73.703 flat angles P-C4'-P energy: -42.439 tors. eta vs tors. theta energy: -48.696 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -662.351286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.351286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.151286 (E_RNA) where: Base-Base interactions energy: -273.208 where: short stacking energy: -192.081 Base-Backbone interact. energy: -1.775 local terms energy: -326.168316 where: bonds (distance) C4'-P energy: -81.381 bonds (distance) P-C4' energy: -82.498 flat angles C4'-P-C4' energy: -84.317 flat angles P-C4'-P energy: -39.783 tors. eta vs tors. theta energy: -38.189 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -669.612959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.612959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.212959 (E_RNA) where: Base-Base interactions energy: -365.755 where: short stacking energy: -193.274 Base-Backbone interact. energy: -2.157 local terms energy: -278.301021 where: bonds (distance) C4'-P energy: -63.536 bonds (distance) P-C4' energy: -74.455 flat angles C4'-P-C4' energy: -64.794 flat angles P-C4'-P energy: -42.947 tors. eta vs tors. theta energy: -32.570 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -531.472845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.472845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.072845 (E_RNA) where: Base-Base interactions energy: -226.740 where: short stacking energy: -140.913 Base-Backbone interact. energy: -2.976 local terms energy: -278.357539 where: bonds (distance) C4'-P energy: -72.987 bonds (distance) P-C4' energy: -92.617 flat angles C4'-P-C4' energy: -63.911 flat angles P-C4'-P energy: -43.900 tors. eta vs tors. theta energy: -4.943 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -483.645063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.645063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.845063 (E_RNA) where: Base-Base interactions energy: -201.315 where: short stacking energy: -114.050 Base-Backbone interact. energy: -2.657 local terms energy: -241.873449 where: bonds (distance) C4'-P energy: -75.203 bonds (distance) P-C4' energy: -65.642 flat angles C4'-P-C4' energy: -58.597 flat angles P-C4'-P energy: -38.443 tors. eta vs tors. theta energy: -3.988 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -417.257991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.257991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.657991 (E_RNA) where: Base-Base interactions energy: -166.420 where: short stacking energy: -119.775 Base-Backbone interact. energy: 0.671 local terms energy: -247.908825 where: bonds (distance) C4'-P energy: -72.860 bonds (distance) P-C4' energy: -78.833 flat angles C4'-P-C4' energy: -65.804 flat angles P-C4'-P energy: -33.234 tors. eta vs tors. theta energy: 2.823 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -329.204349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.204349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.204349 (E_RNA) where: Base-Base interactions energy: -127.316 where: short stacking energy: -110.899 Base-Backbone interact. energy: 2.858 local terms energy: -204.746820 where: bonds (distance) C4'-P energy: -68.336 bonds (distance) P-C4' energy: -66.428 flat angles C4'-P-C4' energy: -50.477 flat angles P-C4'-P energy: -38.304 tors. eta vs tors. theta energy: 18.799 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -358.676644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.676644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.476644 (E_RNA) where: Base-Base interactions energy: -127.151 where: short stacking energy: -66.051 Base-Backbone interact. energy: -0.802 local terms energy: -214.523950 where: bonds (distance) C4'-P energy: -64.387 bonds (distance) P-C4' energy: -64.485 flat angles C4'-P-C4' energy: -58.074 flat angles P-C4'-P energy: -35.824 tors. eta vs tors. theta energy: 8.247 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -983.502975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.502975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.502975 (E_RNA) where: Base-Base interactions energy: -517.970 where: short stacking energy: -284.250 Base-Backbone interact. energy: 0.090 local terms energy: -393.623029 where: bonds (distance) C4'-P energy: -81.411 bonds (distance) P-C4' energy: -95.559 flat angles C4'-P-C4' energy: -94.161 flat angles P-C4'-P energy: -55.331 tors. eta vs tors. theta energy: -67.160 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -902.869787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.869787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.869787 (E_RNA) where: Base-Base interactions energy: -535.093 where: short stacking energy: -248.439 Base-Backbone interact. energy: -3.438 local terms energy: -364.339251 where: bonds (distance) C4'-P energy: -84.898 bonds (distance) P-C4' energy: -78.402 flat angles C4'-P-C4' energy: -91.912 flat angles P-C4'-P energy: -58.946 tors. eta vs tors. theta energy: -50.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -814.190296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.190296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.390296 (E_RNA) where: Base-Base interactions energy: -396.467 where: short stacking energy: -204.896 Base-Backbone interact. energy: -1.016 local terms energy: -333.906852 where: bonds (distance) C4'-P energy: -87.220 bonds (distance) P-C4' energy: -80.965 flat angles C4'-P-C4' energy: -71.485 flat angles P-C4'-P energy: -49.235 tors. eta vs tors. theta energy: -45.002 Dist. restrs. and SS energy: -82.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -697.165255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.165255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.565255 (E_RNA) where: Base-Base interactions energy: -325.285 where: short stacking energy: -223.452 Base-Backbone interact. energy: 2.369 local terms energy: -316.649032 where: bonds (distance) C4'-P energy: -73.790 bonds (distance) P-C4' energy: -83.153 flat angles C4'-P-C4' energy: -74.884 flat angles P-C4'-P energy: -47.323 tors. eta vs tors. theta energy: -37.500 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -647.189794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.189794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.989794 (E_RNA) where: Base-Base interactions energy: -346.502 where: short stacking energy: -192.402 Base-Backbone interact. energy: -1.770 local terms energy: -282.718133 where: bonds (distance) C4'-P energy: -66.877 bonds (distance) P-C4' energy: -84.094 flat angles C4'-P-C4' energy: -66.619 flat angles P-C4'-P energy: -46.497 tors. eta vs tors. theta energy: -18.631 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -551.626637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.626637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.026637 (E_RNA) where: Base-Base interactions energy: -269.658 where: short stacking energy: -144.380 Base-Backbone interact. energy: 2.959 local terms energy: -254.327643 where: bonds (distance) C4'-P energy: -56.732 bonds (distance) P-C4' energy: -75.486 flat angles C4'-P-C4' energy: -70.049 flat angles P-C4'-P energy: -32.165 tors. eta vs tors. theta energy: -19.896 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -574.814236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.814236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.214236 (E_RNA) where: Base-Base interactions energy: -292.969 where: short stacking energy: -180.191 Base-Backbone interact. energy: 0.611 local terms energy: -233.856223 where: bonds (distance) C4'-P energy: -53.966 bonds (distance) P-C4' energy: -79.921 flat angles C4'-P-C4' energy: -49.262 flat angles P-C4'-P energy: -28.391 tors. eta vs tors. theta energy: -22.315 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -376.715360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.715360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.715360 (E_RNA) where: Base-Base interactions energy: -148.257 where: short stacking energy: -115.241 Base-Backbone interact. energy: 0.373 local terms energy: -219.831887 where: bonds (distance) C4'-P energy: -58.459 bonds (distance) P-C4' energy: -63.316 flat angles C4'-P-C4' energy: -77.523 flat angles P-C4'-P energy: -17.833 tors. eta vs tors. theta energy: -2.701 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -393.244943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.244943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.844943 (E_RNA) where: Base-Base interactions energy: -161.020 where: short stacking energy: -96.296 Base-Backbone interact. energy: 0.003 local terms energy: -208.828256 where: bonds (distance) C4'-P energy: -57.250 bonds (distance) P-C4' energy: -73.020 flat angles C4'-P-C4' energy: -65.150 flat angles P-C4'-P energy: -30.772 tors. eta vs tors. theta energy: 17.363 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -294.946331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.946331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.946331 (E_RNA) where: Base-Base interactions energy: -96.804 where: short stacking energy: -96.378 Base-Backbone interact. energy: 0.491 local terms energy: -198.633387 where: bonds (distance) C4'-P energy: -63.356 bonds (distance) P-C4' energy: -64.062 flat angles C4'-P-C4' energy: -61.828 flat angles P-C4'-P energy: -25.214 tors. eta vs tors. theta energy: 15.827 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -962.719841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.719841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.719841 (E_RNA) where: Base-Base interactions energy: -527.034 where: short stacking energy: -293.662 Base-Backbone interact. energy: -0.877 local terms energy: -362.809255 where: bonds (distance) C4'-P energy: -77.325 bonds (distance) P-C4' energy: -80.087 flat angles C4'-P-C4' energy: -83.383 flat angles P-C4'-P energy: -54.075 tors. eta vs tors. theta energy: -67.940 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -922.567156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.567156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.567156 (E_RNA) where: Base-Base interactions energy: -569.832 where: short stacking energy: -253.905 Base-Backbone interact. energy: -1.294 local terms energy: -351.441395 where: bonds (distance) C4'-P energy: -90.236 bonds (distance) P-C4' energy: -69.002 flat angles C4'-P-C4' energy: -72.336 flat angles P-C4'-P energy: -56.970 tors. eta vs tors. theta energy: -62.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -880.247425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.247425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.647425 (E_RNA) where: Base-Base interactions energy: -448.700 where: short stacking energy: -221.537 Base-Backbone interact. energy: -3.311 local terms energy: -334.636728 where: bonds (distance) C4'-P energy: -75.761 bonds (distance) P-C4' energy: -86.851 flat angles C4'-P-C4' energy: -72.399 flat angles P-C4'-P energy: -55.373 tors. eta vs tors. theta energy: -44.252 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -743.073954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.073954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.073954 (E_RNA) where: Base-Base interactions energy: -383.809 where: short stacking energy: -208.740 Base-Backbone interact. energy: -1.678 local terms energy: -303.586965 where: bonds (distance) C4'-P energy: -68.289 bonds (distance) P-C4' energy: -80.107 flat angles C4'-P-C4' energy: -81.792 flat angles P-C4'-P energy: -36.365 tors. eta vs tors. theta energy: -37.034 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -646.761524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.761524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.761524 (E_RNA) where: Base-Base interactions energy: -329.751 where: short stacking energy: -163.369 Base-Backbone interact. energy: -1.489 local terms energy: -279.521742 where: bonds (distance) C4'-P energy: -70.460 bonds (distance) P-C4' energy: -77.362 flat angles C4'-P-C4' energy: -58.251 flat angles P-C4'-P energy: -50.321 tors. eta vs tors. theta energy: -23.128 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -616.138135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.138135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.138135 (E_RNA) where: Base-Base interactions energy: -286.793 where: short stacking energy: -173.367 Base-Backbone interact. energy: -1.491 local terms energy: -282.854255 where: bonds (distance) C4'-P energy: -62.438 bonds (distance) P-C4' energy: -76.605 flat angles C4'-P-C4' energy: -69.166 flat angles P-C4'-P energy: -45.393 tors. eta vs tors. theta energy: -29.252 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -539.752037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.752037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.352037 (E_RNA) where: Base-Base interactions energy: -241.697 where: short stacking energy: -149.489 Base-Backbone interact. energy: 0.132 local terms energy: -265.787811 where: bonds (distance) C4'-P energy: -60.142 bonds (distance) P-C4' energy: -71.067 flat angles C4'-P-C4' energy: -71.516 flat angles P-C4'-P energy: -44.883 tors. eta vs tors. theta energy: -18.179 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -440.457528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.457528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.857528 (E_RNA) where: Base-Base interactions energy: -150.597 where: short stacking energy: -90.068 Base-Backbone interact. energy: -2.837 local terms energy: -256.424060 where: bonds (distance) C4'-P energy: -67.199 bonds (distance) P-C4' energy: -85.936 flat angles C4'-P-C4' energy: -56.888 flat angles P-C4'-P energy: -52.703 tors. eta vs tors. theta energy: 6.303 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -354.223442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.223442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.023442 (E_RNA) where: Base-Base interactions energy: -113.045 where: short stacking energy: -81.964 Base-Backbone interact. energy: -1.239 local terms energy: -223.739788 where: bonds (distance) C4'-P energy: -77.559 bonds (distance) P-C4' energy: -68.291 flat angles C4'-P-C4' energy: -64.504 flat angles P-C4'-P energy: -23.955 tors. eta vs tors. theta energy: 10.568 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -303.069205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.069205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.069205 (E_RNA) where: Base-Base interactions energy: -96.786 where: short stacking energy: -74.804 Base-Backbone interact. energy: 1.509 local terms energy: -207.791565 where: bonds (distance) C4'-P energy: -63.729 bonds (distance) P-C4' energy: -81.495 flat angles C4'-P-C4' energy: -61.658 flat angles P-C4'-P energy: -31.000 tors. eta vs tors. theta energy: 30.090 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1007.713866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.713866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.513866 (E_RNA) where: Base-Base interactions energy: -567.377 where: short stacking energy: -317.275 Base-Backbone interact. energy: -2.142 local terms energy: -367.994189 where: bonds (distance) C4'-P energy: -71.014 bonds (distance) P-C4' energy: -85.860 flat angles C4'-P-C4' energy: -85.478 flat angles P-C4'-P energy: -49.639 tors. eta vs tors. theta energy: -76.004 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -946.587790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.587790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.587790 (E_RNA) where: Base-Base interactions energy: -559.379 where: short stacking energy: -275.272 Base-Backbone interact. energy: -2.453 local terms energy: -384.755263 where: bonds (distance) C4'-P energy: -90.921 bonds (distance) P-C4' energy: -77.455 flat angles C4'-P-C4' energy: -90.412 flat angles P-C4'-P energy: -57.995 tors. eta vs tors. theta energy: -67.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -897.281851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.281851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.081851 (E_RNA) where: Base-Base interactions energy: -459.312 where: short stacking energy: -252.427 Base-Backbone interact. energy: -0.593 local terms energy: -340.176248 where: bonds (distance) C4'-P energy: -77.986 bonds (distance) P-C4' energy: -73.191 flat angles C4'-P-C4' energy: -77.903 flat angles P-C4'-P energy: -53.177 tors. eta vs tors. theta energy: -57.920 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -762.129676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.129676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.529676 (E_RNA) where: Base-Base interactions energy: -393.719 where: short stacking energy: -246.044 Base-Backbone interact. energy: 0.542 local terms energy: -311.352746 where: bonds (distance) C4'-P energy: -64.424 bonds (distance) P-C4' energy: -70.920 flat angles C4'-P-C4' energy: -81.282 flat angles P-C4'-P energy: -48.215 tors. eta vs tors. theta energy: -46.513 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -634.598154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -634.598154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -614.798154 (E_RNA) where: Base-Base interactions energy: -336.595 where: short stacking energy: -180.672 Base-Backbone interact. energy: -1.304 local terms energy: -276.900018 where: bonds (distance) C4'-P energy: -77.026 bonds (distance) P-C4' energy: -72.247 flat angles C4'-P-C4' energy: -76.005 flat angles P-C4'-P energy: -28.975 tors. eta vs tors. theta energy: -22.646 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -597.687234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.687234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.887234 (E_RNA) where: Base-Base interactions energy: -270.880 where: short stacking energy: -159.834 Base-Backbone interact. energy: -1.213 local terms energy: -278.793875 where: bonds (distance) C4'-P energy: -65.514 bonds (distance) P-C4' energy: -80.881 flat angles C4'-P-C4' energy: -64.733 flat angles P-C4'-P energy: -38.860 tors. eta vs tors. theta energy: -28.806 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -550.294706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.294706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.294706 (E_RNA) where: Base-Base interactions energy: -251.170 where: short stacking energy: -136.526 Base-Backbone interact. energy: -2.224 local terms energy: -269.900769 where: bonds (distance) C4'-P energy: -71.807 bonds (distance) P-C4' energy: -70.689 flat angles C4'-P-C4' energy: -66.616 flat angles P-C4'-P energy: -39.125 tors. eta vs tors. theta energy: -21.663 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -439.738766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.738766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.738766 (E_RNA) where: Base-Base interactions energy: -185.364 where: short stacking energy: -120.819 Base-Backbone interact. energy: 1.998 local terms energy: -238.372808 where: bonds (distance) C4'-P energy: -72.021 bonds (distance) P-C4' energy: -61.615 flat angles C4'-P-C4' energy: -61.413 flat angles P-C4'-P energy: -32.114 tors. eta vs tors. theta energy: -11.210 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -375.617969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.617969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.417969 (E_RNA) where: Base-Base interactions energy: -131.759 where: short stacking energy: -104.218 Base-Backbone interact. energy: -1.161 local terms energy: -226.497620 where: bonds (distance) C4'-P energy: -55.103 bonds (distance) P-C4' energy: -77.994 flat angles C4'-P-C4' energy: -67.902 flat angles P-C4'-P energy: -26.180 tors. eta vs tors. theta energy: 0.681 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -307.031583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.031583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.231583 (E_RNA) where: Base-Base interactions energy: -92.602 where: short stacking energy: -75.399 Base-Backbone interact. energy: 0.128 local terms energy: -212.757792 where: bonds (distance) C4'-P energy: -67.740 bonds (distance) P-C4' energy: -72.221 flat angles C4'-P-C4' energy: -67.637 flat angles P-C4'-P energy: -27.612 tors. eta vs tors. theta energy: 22.452 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -993.830153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.830153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.830153 (E_RNA) where: Base-Base interactions energy: -546.476 where: short stacking energy: -278.394 Base-Backbone interact. energy: -1.390 local terms energy: -373.964252 where: bonds (distance) C4'-P energy: -75.942 bonds (distance) P-C4' energy: -77.946 flat angles C4'-P-C4' energy: -90.826 flat angles P-C4'-P energy: -54.213 tors. eta vs tors. theta energy: -75.037 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -952.216406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.216406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.216406 (E_RNA) where: Base-Base interactions energy: -584.987 where: short stacking energy: -293.640 Base-Backbone interact. energy: -2.138 local terms energy: -365.091946 where: bonds (distance) C4'-P energy: -77.549 bonds (distance) P-C4' energy: -80.999 flat angles C4'-P-C4' energy: -82.919 flat angles P-C4'-P energy: -53.284 tors. eta vs tors. theta energy: -70.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -930.972370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.972370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.972370 (E_RNA) where: Base-Base interactions energy: -509.814 where: short stacking energy: -267.378 Base-Backbone interact. energy: -1.171 local terms energy: -320.987107 where: bonds (distance) C4'-P energy: -67.560 bonds (distance) P-C4' energy: -78.913 flat angles C4'-P-C4' energy: -66.003 flat angles P-C4'-P energy: -45.543 tors. eta vs tors. theta energy: -62.969 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -733.672158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.672158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.272158 (E_RNA) where: Base-Base interactions energy: -345.024 where: short stacking energy: -214.004 Base-Backbone interact. energy: -0.334 local terms energy: -328.914826 where: bonds (distance) C4'-P energy: -84.056 bonds (distance) P-C4' energy: -79.230 flat angles C4'-P-C4' energy: -73.222 flat angles P-C4'-P energy: -42.827 tors. eta vs tors. theta energy: -49.580 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -662.676812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.676812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -628.476812 (E_RNA) where: Base-Base interactions energy: -343.250 where: short stacking energy: -202.928 Base-Backbone interact. energy: 0.711 local terms energy: -285.938054 where: bonds (distance) C4'-P energy: -67.679 bonds (distance) P-C4' energy: -69.123 flat angles C4'-P-C4' energy: -69.084 flat angles P-C4'-P energy: -41.759 tors. eta vs tors. theta energy: -38.294 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -651.405376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.405376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.205376 (E_RNA) where: Base-Base interactions energy: -303.658 where: short stacking energy: -179.935 Base-Backbone interact. energy: 1.133 local terms energy: -296.679819 where: bonds (distance) C4'-P energy: -70.547 bonds (distance) P-C4' energy: -76.493 flat angles C4'-P-C4' energy: -77.792 flat angles P-C4'-P energy: -43.126 tors. eta vs tors. theta energy: -28.722 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -530.613513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.613513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.213513 (E_RNA) where: Base-Base interactions energy: -261.887 where: short stacking energy: -141.890 Base-Backbone interact. energy: -2.629 local terms energy: -233.697652 where: bonds (distance) C4'-P energy: -57.910 bonds (distance) P-C4' energy: -64.054 flat angles C4'-P-C4' energy: -61.281 flat angles P-C4'-P energy: -48.379 tors. eta vs tors. theta energy: -2.073 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -455.896442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.896442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.696442 (E_RNA) where: Base-Base interactions energy: -211.766 where: short stacking energy: -107.986 Base-Backbone interact. energy: -0.060 local terms energy: -227.870910 where: bonds (distance) C4'-P energy: -77.074 bonds (distance) P-C4' energy: -66.433 flat angles C4'-P-C4' energy: -63.529 flat angles P-C4'-P energy: -36.601 tors. eta vs tors. theta energy: 15.767 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -357.631378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.631378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.831378 (E_RNA) where: Base-Base interactions energy: -142.106 where: short stacking energy: -105.988 Base-Backbone interact. energy: -2.100 local terms energy: -193.624551 where: bonds (distance) C4'-P energy: -46.637 bonds (distance) P-C4' energy: -77.178 flat angles C4'-P-C4' energy: -45.087 flat angles P-C4'-P energy: -28.811 tors. eta vs tors. theta energy: 4.089 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -322.903646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.903646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -322.903646 (E_RNA) where: Base-Base interactions energy: -104.365 where: short stacking energy: -97.902 Base-Backbone interact. energy: -1.374 local terms energy: -217.164845 where: bonds (distance) C4'-P energy: -78.269 bonds (distance) P-C4' energy: -68.442 flat angles C4'-P-C4' energy: -53.746 flat angles P-C4'-P energy: -31.248 tors. eta vs tors. theta energy: 14.539 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -996.292488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.292488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.292488 (E_RNA) where: Base-Base interactions energy: -547.036 where: short stacking energy: -285.150 Base-Backbone interact. energy: -1.916 local terms energy: -375.340649 where: bonds (distance) C4'-P energy: -77.365 bonds (distance) P-C4' energy: -89.414 flat angles C4'-P-C4' energy: -87.949 flat angles P-C4'-P energy: -52.360 tors. eta vs tors. theta energy: -68.253 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -952.237523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.237523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.237523 (E_RNA) where: Base-Base interactions energy: -578.983 where: short stacking energy: -250.498 Base-Backbone interact. energy: -3.186 local terms energy: -370.068251 where: bonds (distance) C4'-P energy: -86.261 bonds (distance) P-C4' energy: -74.671 flat angles C4'-P-C4' energy: -84.008 flat angles P-C4'-P energy: -54.525 tors. eta vs tors. theta energy: -70.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -911.332703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.332703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.132703 (E_RNA) where: Base-Base interactions energy: -457.460 where: short stacking energy: -237.132 Base-Backbone interact. energy: -2.372 local terms energy: -354.301210 where: bonds (distance) C4'-P energy: -84.082 bonds (distance) P-C4' energy: -81.620 flat angles C4'-P-C4' energy: -79.333 flat angles P-C4'-P energy: -57.405 tors. eta vs tors. theta energy: -51.861 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -728.509653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.509653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.909653 (E_RNA) where: Base-Base interactions energy: -366.409 where: short stacking energy: -179.762 Base-Backbone interact. energy: -0.732 local terms energy: -303.769450 where: bonds (distance) C4'-P energy: -71.889 bonds (distance) P-C4' energy: -74.125 flat angles C4'-P-C4' energy: -70.457 flat angles P-C4'-P energy: -44.026 tors. eta vs tors. theta energy: -43.272 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -731.271616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.271616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.671616 (E_RNA) where: Base-Base interactions energy: -380.519 where: short stacking energy: -219.253 Base-Backbone interact. energy: 1.696 local terms energy: -303.848237 where: bonds (distance) C4'-P energy: -59.001 bonds (distance) P-C4' energy: -85.023 flat angles C4'-P-C4' energy: -74.059 flat angles P-C4'-P energy: -45.913 tors. eta vs tors. theta energy: -39.851 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -662.799081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.799081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.799081 (E_RNA) where: Base-Base interactions energy: -311.341 where: short stacking energy: -194.759 Base-Backbone interact. energy: -0.602 local terms energy: -296.856089 where: bonds (distance) C4'-P energy: -74.562 bonds (distance) P-C4' energy: -79.602 flat angles C4'-P-C4' energy: -72.767 flat angles P-C4'-P energy: -36.728 tors. eta vs tors. theta energy: -33.197 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -567.557115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.557115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.157115 (E_RNA) where: Base-Base interactions energy: -263.019 where: short stacking energy: -160.747 Base-Backbone interact. energy: 1.477 local terms energy: -273.614652 where: bonds (distance) C4'-P energy: -60.763 bonds (distance) P-C4' energy: -74.943 flat angles C4'-P-C4' energy: -68.806 flat angles P-C4'-P energy: -47.148 tors. eta vs tors. theta energy: -21.955 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -447.211091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.211091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.011091 (E_RNA) where: Base-Base interactions energy: -216.632 where: short stacking energy: -129.456 Base-Backbone interact. energy: -1.420 local terms energy: -212.959369 where: bonds (distance) C4'-P energy: -56.077 bonds (distance) P-C4' energy: -59.348 flat angles C4'-P-C4' energy: -70.853 flat angles P-C4'-P energy: -33.892 tors. eta vs tors. theta energy: 7.210 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -352.071872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.071872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.071872 (E_RNA) where: Base-Base interactions energy: -124.450 where: short stacking energy: -102.424 Base-Backbone interact. energy: -1.358 local terms energy: -226.263835 where: bonds (distance) C4'-P energy: -67.354 bonds (distance) P-C4' energy: -73.884 flat angles C4'-P-C4' energy: -62.385 flat angles P-C4'-P energy: -35.594 tors. eta vs tors. theta energy: 12.954 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -308.576943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.576943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.776943 (E_RNA) where: Base-Base interactions energy: -100.238 where: short stacking energy: -69.217 Base-Backbone interact. energy: -1.754 local terms energy: -186.785159 where: bonds (distance) C4'-P energy: -57.889 bonds (distance) P-C4' energy: -64.665 flat angles C4'-P-C4' energy: -58.762 flat angles P-C4'-P energy: -36.782 tors. eta vs tors. theta energy: 31.312 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1000.380626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.380626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.180626 (E_RNA) where: Base-Base interactions energy: -549.461 where: short stacking energy: -312.976 Base-Backbone interact. energy: 0.679 local terms energy: -381.398588 where: bonds (distance) C4'-P energy: -78.768 bonds (distance) P-C4' energy: -77.153 flat angles C4'-P-C4' energy: -92.542 flat angles P-C4'-P energy: -54.116 tors. eta vs tors. theta energy: -78.819 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -962.030999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.030999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.030999 (E_RNA) where: Base-Base interactions energy: -600.692 where: short stacking energy: -288.997 Base-Backbone interact. energy: -2.401 local terms energy: -358.937588 where: bonds (distance) C4'-P energy: -75.593 bonds (distance) P-C4' energy: -84.804 flat angles C4'-P-C4' energy: -77.504 flat angles P-C4'-P energy: -50.399 tors. eta vs tors. theta energy: -70.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -897.001257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.001257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.001257 (E_RNA) where: Base-Base interactions energy: -480.345 where: short stacking energy: -264.456 Base-Backbone interact. energy: 0.324 local terms energy: -326.980835 where: bonds (distance) C4'-P energy: -78.052 bonds (distance) P-C4' energy: -72.586 flat angles C4'-P-C4' energy: -79.071 flat angles P-C4'-P energy: -44.872 tors. eta vs tors. theta energy: -52.400 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -753.822453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.822453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.222453 (E_RNA) where: Base-Base interactions energy: -390.130 where: short stacking energy: -207.573 Base-Backbone interact. energy: -1.699 local terms energy: -313.393356 where: bonds (distance) C4'-P energy: -72.816 bonds (distance) P-C4' energy: -78.626 flat angles C4'-P-C4' energy: -72.937 flat angles P-C4'-P energy: -49.170 tors. eta vs tors. theta energy: -39.844 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -744.891894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.891894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.491894 (E_RNA) where: Base-Base interactions energy: -390.208 where: short stacking energy: -203.242 Base-Backbone interact. energy: -1.457 local terms energy: -293.826530 where: bonds (distance) C4'-P energy: -63.843 bonds (distance) P-C4' energy: -73.379 flat angles C4'-P-C4' energy: -73.655 flat angles P-C4'-P energy: -41.628 tors. eta vs tors. theta energy: -41.322 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -638.654360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.654360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.854360 (E_RNA) where: Base-Base interactions energy: -320.956 where: short stacking energy: -187.576 Base-Backbone interact. energy: -1.650 local terms energy: -260.249221 where: bonds (distance) C4'-P energy: -57.631 bonds (distance) P-C4' energy: -73.387 flat angles C4'-P-C4' energy: -70.498 flat angles P-C4'-P energy: -35.753 tors. eta vs tors. theta energy: -22.981 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -537.850511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.850511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.250511 (E_RNA) where: Base-Base interactions energy: -284.724 where: short stacking energy: -158.408 Base-Backbone interact. energy: 2.693 local terms energy: -225.219690 where: bonds (distance) C4'-P energy: -65.188 bonds (distance) P-C4' energy: -74.541 flat angles C4'-P-C4' energy: -63.927 flat angles P-C4'-P energy: -12.116 tors. eta vs tors. theta energy: -9.447 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -458.294132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.294132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.094132 (E_RNA) where: Base-Base interactions energy: -182.445 where: short stacking energy: -118.397 Base-Backbone interact. energy: 0.086 local terms energy: -250.735121 where: bonds (distance) C4'-P energy: -70.867 bonds (distance) P-C4' energy: -82.638 flat angles C4'-P-C4' energy: -60.892 flat angles P-C4'-P energy: -38.833 tors. eta vs tors. theta energy: 2.495 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -309.357074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.357074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.357074 (E_RNA) where: Base-Base interactions energy: -84.901 where: short stacking energy: -77.497 Base-Backbone interact. energy: -1.430 local terms energy: -223.025847 where: bonds (distance) C4'-P energy: -67.933 bonds (distance) P-C4' energy: -76.229 flat angles C4'-P-C4' energy: -63.724 flat angles P-C4'-P energy: -34.394 tors. eta vs tors. theta energy: 19.254 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -291.411482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.411482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.211482 (E_RNA) where: Base-Base interactions energy: -78.822 where: short stacking energy: -63.355 Base-Backbone interact. energy: -1.269 local terms energy: -204.120575 where: bonds (distance) C4'-P energy: -67.203 bonds (distance) P-C4' energy: -78.991 flat angles C4'-P-C4' energy: -59.223 flat angles P-C4'-P energy: -27.739 tors. eta vs tors. theta energy: 29.035 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -991.010776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.010776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.010776 (E_RNA) where: Base-Base interactions energy: -614.593 where: short stacking energy: -301.895 Base-Backbone interact. energy: -2.018 local terms energy: -374.399650 where: bonds (distance) C4'-P energy: -83.344 bonds (distance) P-C4' energy: -87.751 flat angles C4'-P-C4' energy: -75.156 flat angles P-C4'-P energy: -52.583 tors. eta vs tors. theta energy: -75.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -968.792903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.792903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.992903 (E_RNA) where: Base-Base interactions energy: -516.868 where: short stacking energy: -294.657 Base-Backbone interact. energy: -2.024 local terms energy: -376.100993 where: bonds (distance) C4'-P energy: -78.588 bonds (distance) P-C4' energy: -77.696 flat angles C4'-P-C4' energy: -91.363 flat angles P-C4'-P energy: -54.212 tors. eta vs tors. theta energy: -74.242 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -903.153301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.153301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.353301 (E_RNA) where: Base-Base interactions energy: -465.693 where: short stacking energy: -235.767 Base-Backbone interact. energy: -1.778 local terms energy: -343.882406 where: bonds (distance) C4'-P energy: -78.158 bonds (distance) P-C4' energy: -90.724 flat angles C4'-P-C4' energy: -78.337 flat angles P-C4'-P energy: -37.003 tors. eta vs tors. theta energy: -59.661 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -746.594152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.594152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.994152 (E_RNA) where: Base-Base interactions energy: -387.317 where: short stacking energy: -236.157 Base-Backbone interact. energy: -1.015 local terms energy: -309.662650 where: bonds (distance) C4'-P energy: -68.078 bonds (distance) P-C4' energy: -81.773 flat angles C4'-P-C4' energy: -66.203 flat angles P-C4'-P energy: -51.224 tors. eta vs tors. theta energy: -42.385 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -736.356063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.356063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.356063 (E_RNA) where: Base-Base interactions energy: -387.611 where: short stacking energy: -203.709 Base-Backbone interact. energy: -1.225 local terms energy: -293.520124 where: bonds (distance) C4'-P energy: -69.784 bonds (distance) P-C4' energy: -73.806 flat angles C4'-P-C4' energy: -62.994 flat angles P-C4'-P energy: -48.146 tors. eta vs tors. theta energy: -38.790 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -655.145076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.145076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.145076 (E_RNA) where: Base-Base interactions energy: -297.480 where: short stacking energy: -174.272 Base-Backbone interact. energy: -1.808 local terms energy: -301.857096 where: bonds (distance) C4'-P energy: -76.729 bonds (distance) P-C4' energy: -82.626 flat angles C4'-P-C4' energy: -79.465 flat angles P-C4'-P energy: -43.896 tors. eta vs tors. theta energy: -19.141 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -556.486126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.486126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.486126 (E_RNA) where: Base-Base interactions energy: -259.773 where: short stacking energy: -136.181 Base-Backbone interact. energy: -2.881 local terms energy: -257.832334 where: bonds (distance) C4'-P energy: -65.784 bonds (distance) P-C4' energy: -62.766 flat angles C4'-P-C4' energy: -65.700 flat angles P-C4'-P energy: -49.531 tors. eta vs tors. theta energy: -14.051 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -441.387302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.387302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.387302 (E_RNA) where: Base-Base interactions energy: -177.433 where: short stacking energy: -113.018 Base-Backbone interact. energy: 0.548 local terms energy: -237.502415 where: bonds (distance) C4'-P energy: -72.090 bonds (distance) P-C4' energy: -69.023 flat angles C4'-P-C4' energy: -69.661 flat angles P-C4'-P energy: -32.223 tors. eta vs tors. theta energy: 5.495 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -304.095410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.095410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.695410 (E_RNA) where: Base-Base interactions energy: -95.996 where: short stacking energy: -82.648 Base-Backbone interact. energy: -1.559 local terms energy: -201.140722 where: bonds (distance) C4'-P energy: -62.185 bonds (distance) P-C4' energy: -83.412 flat angles C4'-P-C4' energy: -58.443 flat angles P-C4'-P energy: -17.369 tors. eta vs tors. theta energy: 20.269 Dist. restrs. and SS energy: -5.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -298.120879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.120879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.120879 (E_RNA) where: Base-Base interactions energy: -83.692 where: short stacking energy: -78.654 Base-Backbone interact. energy: 3.553 local terms energy: -217.982043 where: bonds (distance) C4'-P energy: -62.920 bonds (distance) P-C4' energy: -77.942 flat angles C4'-P-C4' energy: -65.641 flat angles P-C4'-P energy: -26.195 tors. eta vs tors. theta energy: 14.717 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1022.276104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.276104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.276104 (E_RNA) where: Base-Base interactions energy: -653.774 where: short stacking energy: -323.670 Base-Backbone interact. energy: -3.949 local terms energy: -364.553606 where: bonds (distance) C4'-P energy: -74.722 bonds (distance) P-C4' energy: -79.784 flat angles C4'-P-C4' energy: -80.024 flat angles P-C4'-P energy: -48.795 tors. eta vs tors. theta energy: -81.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -994.582084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.582084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.582084 (E_RNA) where: Base-Base interactions energy: -551.373 where: short stacking energy: -308.918 Base-Backbone interact. energy: -2.684 local terms energy: -368.524658 where: bonds (distance) C4'-P energy: -71.892 bonds (distance) P-C4' energy: -78.883 flat angles C4'-P-C4' energy: -85.637 flat angles P-C4'-P energy: -46.004 tors. eta vs tors. theta energy: -86.108 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -876.936714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.936714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.536714 (E_RNA) where: Base-Base interactions energy: -453.521 where: short stacking energy: -255.438 Base-Backbone interact. energy: -0.877 local terms energy: -327.138612 where: bonds (distance) C4'-P energy: -81.737 bonds (distance) P-C4' energy: -77.233 flat angles C4'-P-C4' energy: -63.394 flat angles P-C4'-P energy: -48.785 tors. eta vs tors. theta energy: -55.991 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -783.006822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.006822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.806822 (E_RNA) where: Base-Base interactions energy: -391.941 where: short stacking energy: -207.851 Base-Backbone interact. energy: -0.845 local terms energy: -329.021037 where: bonds (distance) C4'-P energy: -72.948 bonds (distance) P-C4' energy: -79.062 flat angles C4'-P-C4' energy: -79.624 flat angles P-C4'-P energy: -53.946 tors. eta vs tors. theta energy: -43.442 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -681.938713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.938713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.938713 (E_RNA) where: Base-Base interactions energy: -339.276 where: short stacking energy: -200.854 Base-Backbone interact. energy: -0.391 local terms energy: -297.271690 where: bonds (distance) C4'-P energy: -64.622 bonds (distance) P-C4' energy: -81.206 flat angles C4'-P-C4' energy: -68.757 flat angles P-C4'-P energy: -39.333 tors. eta vs tors. theta energy: -43.354 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -591.484339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.484339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.084339 (E_RNA) where: Base-Base interactions energy: -283.776 where: short stacking energy: -166.005 Base-Backbone interact. energy: -1.231 local terms energy: -274.076573 where: bonds (distance) C4'-P energy: -79.410 bonds (distance) P-C4' energy: -70.877 flat angles C4'-P-C4' energy: -59.748 flat angles P-C4'-P energy: -40.392 tors. eta vs tors. theta energy: -23.651 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -626.387391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.387391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.187391 (E_RNA) where: Base-Base interactions energy: -306.990 where: short stacking energy: -180.304 Base-Backbone interact. energy: 0.812 local terms energy: -268.008858 where: bonds (distance) C4'-P energy: -65.678 bonds (distance) P-C4' energy: -78.838 flat angles C4'-P-C4' energy: -71.269 flat angles P-C4'-P energy: -27.384 tors. eta vs tors. theta energy: -24.841 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -454.502681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.502681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.502681 (E_RNA) where: Base-Base interactions energy: -202.130 where: short stacking energy: -133.469 Base-Backbone interact. energy: 0.694 local terms energy: -235.065881 where: bonds (distance) C4'-P energy: -64.341 bonds (distance) P-C4' energy: -59.439 flat angles C4'-P-C4' energy: -58.615 flat angles P-C4'-P energy: -38.965 tors. eta vs tors. theta energy: -13.705 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -349.848935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.848935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.648935 (E_RNA) where: Base-Base interactions energy: -110.104 where: short stacking energy: -91.050 Base-Backbone interact. energy: 3.299 local terms energy: -226.844215 where: bonds (distance) C4'-P energy: -78.374 bonds (distance) P-C4' energy: -66.680 flat angles C4'-P-C4' energy: -55.016 flat angles P-C4'-P energy: -42.251 tors. eta vs tors. theta energy: 15.477 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -317.797972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.797972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.797972 (E_RNA) where: Base-Base interactions energy: -107.044 where: short stacking energy: -89.062 Base-Backbone interact. energy: 0.445 local terms energy: -211.199026 where: bonds (distance) C4'-P energy: -69.871 bonds (distance) P-C4' energy: -64.564 flat angles C4'-P-C4' energy: -60.585 flat angles P-C4'-P energy: -23.206 tors. eta vs tors. theta energy: 7.027 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1013.047583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.047583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.047583 (E_RNA) where: Base-Base interactions energy: -631.209 where: short stacking energy: -303.643 Base-Backbone interact. energy: -3.119 local terms energy: -378.719221 where: bonds (distance) C4'-P energy: -75.408 bonds (distance) P-C4' energy: -88.801 flat angles C4'-P-C4' energy: -84.286 flat angles P-C4'-P energy: -52.253 tors. eta vs tors. theta energy: -77.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -948.134245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.134245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.334245 (E_RNA) where: Base-Base interactions energy: -507.743 where: short stacking energy: -291.822 Base-Backbone interact. energy: -1.639 local terms energy: -364.952279 where: bonds (distance) C4'-P energy: -83.023 bonds (distance) P-C4' energy: -78.332 flat angles C4'-P-C4' energy: -84.103 flat angles P-C4'-P energy: -52.168 tors. eta vs tors. theta energy: -67.327 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -854.326212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.326212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.726212 (E_RNA) where: Base-Base interactions energy: -442.861 where: short stacking energy: -246.231 Base-Backbone interact. energy: -0.017 local terms energy: -317.849093 where: bonds (distance) C4'-P energy: -70.724 bonds (distance) P-C4' energy: -73.494 flat angles C4'-P-C4' energy: -69.794 flat angles P-C4'-P energy: -37.689 tors. eta vs tors. theta energy: -66.146 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -747.208056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.208056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.208056 (E_RNA) where: Base-Base interactions energy: -392.450 where: short stacking energy: -205.635 Base-Backbone interact. energy: -0.674 local terms energy: -291.084308 where: bonds (distance) C4'-P energy: -69.766 bonds (distance) P-C4' energy: -69.159 flat angles C4'-P-C4' energy: -69.568 flat angles P-C4'-P energy: -45.285 tors. eta vs tors. theta energy: -37.307 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -684.379009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.379009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.379009 (E_RNA) where: Base-Base interactions energy: -346.049 where: short stacking energy: -192.599 Base-Backbone interact. energy: 1.569 local terms energy: -294.898249 where: bonds (distance) C4'-P energy: -73.451 bonds (distance) P-C4' energy: -61.337 flat angles C4'-P-C4' energy: -67.069 flat angles P-C4'-P energy: -53.362 tors. eta vs tors. theta energy: -39.679 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -602.129323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.129323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.329323 (E_RNA) where: Base-Base interactions energy: -305.077 where: short stacking energy: -167.673 Base-Backbone interact. energy: -1.675 local terms energy: -266.576411 where: bonds (distance) C4'-P energy: -64.446 bonds (distance) P-C4' energy: -71.354 flat angles C4'-P-C4' energy: -66.972 flat angles P-C4'-P energy: -43.444 tors. eta vs tors. theta energy: -20.361 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -606.524130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.524130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.324130 (E_RNA) where: Base-Base interactions energy: -297.575 where: short stacking energy: -162.734 Base-Backbone interact. energy: -1.231 local terms energy: -255.518266 where: bonds (distance) C4'-P energy: -68.435 bonds (distance) P-C4' energy: -70.496 flat angles C4'-P-C4' energy: -59.966 flat angles P-C4'-P energy: -37.859 tors. eta vs tors. theta energy: -18.762 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -453.015097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.015097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.615097 (E_RNA) where: Base-Base interactions energy: -184.125 where: short stacking energy: -122.979 Base-Backbone interact. energy: -1.233 local terms energy: -244.257659 where: bonds (distance) C4'-P energy: -77.273 bonds (distance) P-C4' energy: -71.886 flat angles C4'-P-C4' energy: -65.490 flat angles P-C4'-P energy: -37.520 tors. eta vs tors. theta energy: 7.911 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -360.794561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.794561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.794561 (E_RNA) where: Base-Base interactions energy: -111.219 where: short stacking energy: -93.830 Base-Backbone interact. energy: 1.966 local terms energy: -233.541236 where: bonds (distance) C4'-P energy: -58.251 bonds (distance) P-C4' energy: -80.744 flat angles C4'-P-C4' energy: -67.188 flat angles P-C4'-P energy: -33.798 tors. eta vs tors. theta energy: 6.439 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -346.532199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.532199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.532199 (E_RNA) where: Base-Base interactions energy: -139.454 where: short stacking energy: -97.600 Base-Backbone interact. energy: -0.875 local terms energy: -206.203274 where: bonds (distance) C4'-P energy: -71.157 bonds (distance) P-C4' energy: -63.522 flat angles C4'-P-C4' energy: -53.668 flat angles P-C4'-P energy: -36.306 tors. eta vs tors. theta energy: 18.449 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1021.091146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.091146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.091146 (E_RNA) where: Base-Base interactions energy: -618.417 where: short stacking energy: -311.901 Base-Backbone interact. energy: -3.278 local terms energy: -399.396302 where: bonds (distance) C4'-P energy: -81.733 bonds (distance) P-C4' energy: -86.817 flat angles C4'-P-C4' energy: -88.812 flat angles P-C4'-P energy: -66.816 tors. eta vs tors. theta energy: -75.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -990.255261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.255261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.455261 (E_RNA) where: Base-Base interactions energy: -544.441 where: short stacking energy: -292.535 Base-Backbone interact. energy: -0.640 local terms energy: -371.373859 where: bonds (distance) C4'-P energy: -68.437 bonds (distance) P-C4' energy: -81.278 flat angles C4'-P-C4' energy: -94.810 flat angles P-C4'-P energy: -60.078 tors. eta vs tors. theta energy: -66.771 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -856.298433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.298433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.698433 (E_RNA) where: Base-Base interactions energy: -421.169 where: short stacking energy: -225.475 Base-Backbone interact. energy: -0.582 local terms energy: -340.947071 where: bonds (distance) C4'-P energy: -63.033 bonds (distance) P-C4' energy: -83.743 flat angles C4'-P-C4' energy: -86.054 flat angles P-C4'-P energy: -48.600 tors. eta vs tors. theta energy: -59.517 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -776.133875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.133875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.733875 (E_RNA) where: Base-Base interactions energy: -399.032 where: short stacking energy: -226.995 Base-Backbone interact. energy: 0.821 local terms energy: -327.522502 where: bonds (distance) C4'-P energy: -80.696 bonds (distance) P-C4' energy: -85.152 flat angles C4'-P-C4' energy: -74.236 flat angles P-C4'-P energy: -45.191 tors. eta vs tors. theta energy: -42.248 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -741.512093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.512093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.112093 (E_RNA) where: Base-Base interactions energy: -362.524 where: short stacking energy: -199.155 Base-Backbone interact. energy: -0.462 local terms energy: -310.125763 where: bonds (distance) C4'-P energy: -67.129 bonds (distance) P-C4' energy: -76.667 flat angles C4'-P-C4' energy: -70.296 flat angles P-C4'-P energy: -52.340 tors. eta vs tors. theta energy: -43.694 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -641.267208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -641.267208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.667208 (E_RNA) where: Base-Base interactions energy: -307.992 where: short stacking energy: -179.673 Base-Backbone interact. energy: 0.382 local terms energy: -276.057298 where: bonds (distance) C4'-P energy: -65.319 bonds (distance) P-C4' energy: -79.337 flat angles C4'-P-C4' energy: -75.795 flat angles P-C4'-P energy: -36.602 tors. eta vs tors. theta energy: -19.004 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -644.286647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.286647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.886647 (E_RNA) where: Base-Base interactions energy: -311.258 where: short stacking energy: -175.149 Base-Backbone interact. energy: -2.175 local terms energy: -298.452862 where: bonds (distance) C4'-P energy: -64.070 bonds (distance) P-C4' energy: -80.816 flat angles C4'-P-C4' energy: -68.737 flat angles P-C4'-P energy: -52.841 tors. eta vs tors. theta energy: -31.988 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -468.725184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.725184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.725184 (E_RNA) where: Base-Base interactions energy: -206.053 where: short stacking energy: -124.840 Base-Backbone interact. energy: -0.565 local terms energy: -244.107377 where: bonds (distance) C4'-P energy: -72.089 bonds (distance) P-C4' energy: -74.661 flat angles C4'-P-C4' energy: -57.033 flat angles P-C4'-P energy: -31.072 tors. eta vs tors. theta energy: -9.252 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -379.340418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.340418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.340418 (E_RNA) where: Base-Base interactions energy: -140.993 where: short stacking energy: -87.326 Base-Backbone interact. energy: -1.375 local terms energy: -209.973190 where: bonds (distance) C4'-P energy: -60.385 bonds (distance) P-C4' energy: -66.063 flat angles C4'-P-C4' energy: -51.417 flat angles P-C4'-P energy: -39.070 tors. eta vs tors. theta energy: 6.961 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -286.537842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.537842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.537842 (E_RNA) where: Base-Base interactions energy: -92.148 where: short stacking energy: -78.563 Base-Backbone interact. energy: 2.138 local terms energy: -196.527397 where: bonds (distance) C4'-P energy: -63.836 bonds (distance) P-C4' energy: -64.347 flat angles C4'-P-C4' energy: -53.675 flat angles P-C4'-P energy: -26.828 tors. eta vs tors. theta energy: 12.159 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1023.697714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.697714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.697714 (E_RNA) where: Base-Base interactions energy: -634.836 where: short stacking energy: -308.947 Base-Backbone interact. energy: -2.242 local terms energy: -386.619083 where: bonds (distance) C4'-P energy: -81.680 bonds (distance) P-C4' energy: -85.312 flat angles C4'-P-C4' energy: -92.648 flat angles P-C4'-P energy: -51.415 tors. eta vs tors. theta energy: -75.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1001.008637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.008637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.408637 (E_RNA) where: Base-Base interactions energy: -556.301 where: short stacking energy: -288.353 Base-Backbone interact. energy: -0.100 local terms energy: -369.007404 where: bonds (distance) C4'-P energy: -72.723 bonds (distance) P-C4' energy: -92.009 flat angles C4'-P-C4' energy: -85.874 flat angles P-C4'-P energy: -51.856 tors. eta vs tors. theta energy: -66.545 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -907.095359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.095359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.895359 (E_RNA) where: Base-Base interactions energy: -436.945 where: short stacking energy: -243.573 Base-Backbone interact. energy: -0.744 local terms energy: -363.206532 where: bonds (distance) C4'-P energy: -77.980 bonds (distance) P-C4' energy: -84.477 flat angles C4'-P-C4' energy: -71.571 flat angles P-C4'-P energy: -58.255 tors. eta vs tors. theta energy: -70.923 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -777.149577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.149577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.949577 (E_RNA) where: Base-Base interactions energy: -395.507 where: short stacking energy: -228.822 Base-Backbone interact. energy: 1.567 local terms energy: -331.008968 where: bonds (distance) C4'-P energy: -80.252 bonds (distance) P-C4' energy: -84.500 flat angles C4'-P-C4' energy: -82.981 flat angles P-C4'-P energy: -52.206 tors. eta vs tors. theta energy: -31.070 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -744.534116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.534116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.334116 (E_RNA) where: Base-Base interactions energy: -378.871 where: short stacking energy: -176.016 Base-Backbone interact. energy: -0.111 local terms energy: -295.352292 where: bonds (distance) C4'-P energy: -71.441 bonds (distance) P-C4' energy: -79.556 flat angles C4'-P-C4' energy: -61.239 flat angles P-C4'-P energy: -46.120 tors. eta vs tors. theta energy: -36.996 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -696.418081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.418081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.418081 (E_RNA) where: Base-Base interactions energy: -353.526 where: short stacking energy: -190.462 Base-Backbone interact. energy: 3.564 local terms energy: -292.455735 where: bonds (distance) C4'-P energy: -75.389 bonds (distance) P-C4' energy: -74.161 flat angles C4'-P-C4' energy: -75.735 flat angles P-C4'-P energy: -26.675 tors. eta vs tors. theta energy: -40.496 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -611.346832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.346832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.346832 (E_RNA) where: Base-Base interactions energy: -316.739 where: short stacking energy: -161.174 Base-Backbone interact. energy: -2.352 local terms energy: -265.255744 where: bonds (distance) C4'-P energy: -66.252 bonds (distance) P-C4' energy: -67.825 flat angles C4'-P-C4' energy: -73.725 flat angles P-C4'-P energy: -36.248 tors. eta vs tors. theta energy: -21.205 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -475.615368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.615368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.415368 (E_RNA) where: Base-Base interactions energy: -220.879 where: short stacking energy: -128.729 Base-Backbone interact. energy: 2.996 local terms energy: -241.532520 where: bonds (distance) C4'-P energy: -63.019 bonds (distance) P-C4' energy: -71.427 flat angles C4'-P-C4' energy: -51.681 flat angles P-C4'-P energy: -47.420 tors. eta vs tors. theta energy: -7.985 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -390.311798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.311798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.511798 (E_RNA) where: Base-Base interactions energy: -136.415 where: short stacking energy: -89.297 Base-Backbone interact. energy: -1.192 local terms energy: -223.904930 where: bonds (distance) C4'-P energy: -79.455 bonds (distance) P-C4' energy: -68.690 flat angles C4'-P-C4' energy: -52.354 flat angles P-C4'-P energy: -23.978 tors. eta vs tors. theta energy: 0.573 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -289.038150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.038150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.038150 (E_RNA) where: Base-Base interactions energy: -83.316 where: short stacking energy: -69.066 Base-Backbone interact. energy: -0.473 local terms energy: -205.249438 where: bonds (distance) C4'-P energy: -55.807 bonds (distance) P-C4' energy: -64.390 flat angles C4'-P-C4' energy: -68.429 flat angles P-C4'-P energy: -39.835 tors. eta vs tors. theta energy: 23.211 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1011.318425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.318425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.318425 (E_RNA) where: Base-Base interactions energy: -601.129 where: short stacking energy: -304.980 Base-Backbone interact. energy: -1.219 local terms energy: -408.970289 where: bonds (distance) C4'-P energy: -89.493 bonds (distance) P-C4' energy: -84.934 flat angles C4'-P-C4' energy: -102.676 flat angles P-C4'-P energy: -59.801 tors. eta vs tors. theta energy: -72.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -984.774015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.774015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.174015 (E_RNA) where: Base-Base interactions energy: -545.895 where: short stacking energy: -294.820 Base-Backbone interact. energy: -0.483 local terms energy: -362.796379 where: bonds (distance) C4'-P energy: -76.805 bonds (distance) P-C4' energy: -71.451 flat angles C4'-P-C4' energy: -82.035 flat angles P-C4'-P energy: -61.888 tors. eta vs tors. theta energy: -70.618 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -898.701605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.701605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.101605 (E_RNA) where: Base-Base interactions energy: -461.268 where: short stacking energy: -255.592 Base-Backbone interact. energy: -2.863 local terms energy: -331.970996 where: bonds (distance) C4'-P energy: -80.224 bonds (distance) P-C4' energy: -68.843 flat angles C4'-P-C4' energy: -77.552 flat angles P-C4'-P energy: -49.849 tors. eta vs tors. theta energy: -55.503 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -764.673397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.673397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.273397 (E_RNA) where: Base-Base interactions energy: -395.957 where: short stacking energy: -221.252 Base-Backbone interact. energy: -0.664 local terms energy: -317.652139 where: bonds (distance) C4'-P energy: -74.519 bonds (distance) P-C4' energy: -82.351 flat angles C4'-P-C4' energy: -76.739 flat angles P-C4'-P energy: -49.090 tors. eta vs tors. theta energy: -34.953 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -757.840181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.840181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.240181 (E_RNA) where: Base-Base interactions energy: -385.859 where: short stacking energy: -189.491 Base-Backbone interact. energy: -0.503 local terms energy: -304.878446 where: bonds (distance) C4'-P energy: -70.721 bonds (distance) P-C4' energy: -79.436 flat angles C4'-P-C4' energy: -82.850 flat angles P-C4'-P energy: -45.835 tors. eta vs tors. theta energy: -26.037 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -707.657435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.657435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.857435 (E_RNA) where: Base-Base interactions energy: -377.142 where: short stacking energy: -187.530 Base-Backbone interact. energy: 0.574 local terms energy: -275.289837 where: bonds (distance) C4'-P energy: -63.723 bonds (distance) P-C4' energy: -73.764 flat angles C4'-P-C4' energy: -66.304 flat angles P-C4'-P energy: -43.758 tors. eta vs tors. theta energy: -27.741 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -599.365754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.365754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.565754 (E_RNA) where: Base-Base interactions energy: -310.511 where: short stacking energy: -159.815 Base-Backbone interact. energy: 1.789 local terms energy: -261.843012 where: bonds (distance) C4'-P energy: -60.168 bonds (distance) P-C4' energy: -64.356 flat angles C4'-P-C4' energy: -67.902 flat angles P-C4'-P energy: -43.762 tors. eta vs tors. theta energy: -25.656 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -449.148008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.148008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.148008 (E_RNA) where: Base-Base interactions energy: -180.975 where: short stacking energy: -140.002 Base-Backbone interact. energy: -2.378 local terms energy: -247.795344 where: bonds (distance) C4'-P energy: -66.306 bonds (distance) P-C4' energy: -74.539 flat angles C4'-P-C4' energy: -59.624 flat angles P-C4'-P energy: -37.996 tors. eta vs tors. theta energy: -9.330 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -452.391197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.391197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.191197 (E_RNA) where: Base-Base interactions energy: -201.238 where: short stacking energy: -104.251 Base-Backbone interact. energy: -1.881 local terms energy: -233.072114 where: bonds (distance) C4'-P energy: -63.075 bonds (distance) P-C4' energy: -73.728 flat angles C4'-P-C4' energy: -67.377 flat angles P-C4'-P energy: -38.766 tors. eta vs tors. theta energy: 9.874 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -296.160345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.160345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.160345 (E_RNA) where: Base-Base interactions energy: -94.314 where: short stacking energy: -70.842 Base-Backbone interact. energy: 0.593 local terms energy: -202.439914 where: bonds (distance) C4'-P energy: -65.224 bonds (distance) P-C4' energy: -63.678 flat angles C4'-P-C4' energy: -53.737 flat angles P-C4'-P energy: -43.517 tors. eta vs tors. theta energy: 23.716 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1027.882801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.882801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.882801 (E_RNA) where: Base-Base interactions energy: -646.866 where: short stacking energy: -303.889 Base-Backbone interact. energy: -2.862 local terms energy: -378.154872 where: bonds (distance) C4'-P energy: -76.511 bonds (distance) P-C4' energy: -80.202 flat angles C4'-P-C4' energy: -89.163 flat angles P-C4'-P energy: -57.393 tors. eta vs tors. theta energy: -74.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -984.522240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.522240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.722240 (E_RNA) where: Base-Base interactions energy: -541.406 where: short stacking energy: -285.469 Base-Backbone interact. energy: -1.297 local terms energy: -368.019218 where: bonds (distance) C4'-P energy: -83.263 bonds (distance) P-C4' energy: -88.629 flat angles C4'-P-C4' energy: -82.189 flat angles P-C4'-P energy: -42.155 tors. eta vs tors. theta energy: -71.784 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -910.954340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.954340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.554340 (E_RNA) where: Base-Base interactions energy: -482.508 where: short stacking energy: -265.500 Base-Backbone interact. energy: 0.804 local terms energy: -324.850205 where: bonds (distance) C4'-P energy: -60.193 bonds (distance) P-C4' energy: -66.670 flat angles C4'-P-C4' energy: -76.907 flat angles P-C4'-P energy: -50.134 tors. eta vs tors. theta energy: -70.946 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -751.999755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.999755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.799755 (E_RNA) where: Base-Base interactions energy: -372.565 where: short stacking energy: -194.332 Base-Backbone interact. energy: 0.252 local terms energy: -327.486618 where: bonds (distance) C4'-P energy: -79.073 bonds (distance) P-C4' energy: -83.893 flat angles C4'-P-C4' energy: -73.872 flat angles P-C4'-P energy: -51.874 tors. eta vs tors. theta energy: -38.775 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -713.267795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.267795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.867795 (E_RNA) where: Base-Base interactions energy: -350.785 where: short stacking energy: -187.367 Base-Backbone interact. energy: 1.179 local terms energy: -295.261760 where: bonds (distance) C4'-P energy: -74.062 bonds (distance) P-C4' energy: -70.994 flat angles C4'-P-C4' energy: -73.341 flat angles P-C4'-P energy: -50.619 tors. eta vs tors. theta energy: -26.246 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -697.986362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.986362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.786362 (E_RNA) where: Base-Base interactions energy: -374.398 where: short stacking energy: -182.779 Base-Backbone interact. energy: -1.277 local terms energy: -270.110826 where: bonds (distance) C4'-P energy: -72.814 bonds (distance) P-C4' energy: -70.064 flat angles C4'-P-C4' energy: -70.215 flat angles P-C4'-P energy: -35.329 tors. eta vs tors. theta energy: -21.690 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -612.578303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.578303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.378303 (E_RNA) where: Base-Base interactions energy: -289.221 where: short stacking energy: -156.813 Base-Backbone interact. energy: 2.884 local terms energy: -292.041263 where: bonds (distance) C4'-P energy: -71.781 bonds (distance) P-C4' energy: -82.890 flat angles C4'-P-C4' energy: -68.321 flat angles P-C4'-P energy: -40.328 tors. eta vs tors. theta energy: -28.722 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -449.733995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.733995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.133995 (E_RNA) where: Base-Base interactions energy: -199.286 where: short stacking energy: -129.320 Base-Backbone interact. energy: -0.956 local terms energy: -227.891993 where: bonds (distance) C4'-P energy: -54.195 bonds (distance) P-C4' energy: -75.929 flat angles C4'-P-C4' energy: -60.168 flat angles P-C4'-P energy: -37.037 tors. eta vs tors. theta energy: -0.564 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -498.769214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.769214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.569214 (E_RNA) where: Base-Base interactions energy: -228.922 where: short stacking energy: -119.564 Base-Backbone interact. energy: -1.931 local terms energy: -251.716034 where: bonds (distance) C4'-P energy: -70.963 bonds (distance) P-C4' energy: -53.164 flat angles C4'-P-C4' energy: -74.513 flat angles P-C4'-P energy: -44.345 tors. eta vs tors. theta energy: -8.731 Dist. restrs. and SS energy: -16.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -276.991095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.991095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.991095 (E_RNA) where: Base-Base interactions energy: -112.286 where: short stacking energy: -88.795 Base-Backbone interact. energy: 1.838 local terms energy: -166.543008 where: bonds (distance) C4'-P energy: -56.394 bonds (distance) P-C4' energy: -63.541 flat angles C4'-P-C4' energy: -51.154 flat angles P-C4'-P energy: -20.623 tors. eta vs tors. theta energy: 25.169 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1023.487231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.487231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.487231 (E_RNA) where: Base-Base interactions energy: -649.422 where: short stacking energy: -313.061 Base-Backbone interact. energy: -1.094 local terms energy: -372.971305 where: bonds (distance) C4'-P energy: -76.258 bonds (distance) P-C4' energy: -79.994 flat angles C4'-P-C4' energy: -86.627 flat angles P-C4'-P energy: -61.253 tors. eta vs tors. theta energy: -68.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1012.207999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.207999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.207999 (E_RNA) where: Base-Base interactions energy: -555.271 where: short stacking energy: -305.303 Base-Backbone interact. energy: 2.707 local terms energy: -387.643646 where: bonds (distance) C4'-P energy: -75.733 bonds (distance) P-C4' energy: -84.747 flat angles C4'-P-C4' energy: -90.072 flat angles P-C4'-P energy: -53.440 tors. eta vs tors. theta energy: -83.652 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -913.951672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.951672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.551672 (E_RNA) where: Base-Base interactions energy: -463.860 where: short stacking energy: -246.787 Base-Backbone interact. energy: -0.785 local terms energy: -344.906573 where: bonds (distance) C4'-P energy: -71.437 bonds (distance) P-C4' energy: -77.211 flat angles C4'-P-C4' energy: -90.978 flat angles P-C4'-P energy: -48.838 tors. eta vs tors. theta energy: -56.443 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -769.302619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.302619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.902619 (E_RNA) where: Base-Base interactions energy: -402.421 where: short stacking energy: -210.061 Base-Backbone interact. energy: -1.379 local terms energy: -315.102233 where: bonds (distance) C4'-P energy: -74.026 bonds (distance) P-C4' energy: -77.564 flat angles C4'-P-C4' energy: -80.758 flat angles P-C4'-P energy: -44.125 tors. eta vs tors. theta energy: -38.629 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -724.707148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.707148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.707148 (E_RNA) where: Base-Base interactions energy: -346.751 where: short stacking energy: -193.921 Base-Backbone interact. energy: -3.680 local terms energy: -302.276477 where: bonds (distance) C4'-P energy: -73.397 bonds (distance) P-C4' energy: -74.001 flat angles C4'-P-C4' energy: -80.606 flat angles P-C4'-P energy: -44.430 tors. eta vs tors. theta energy: -29.843 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -687.848644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.848644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -633.848644 (E_RNA) where: Base-Base interactions energy: -355.808 where: short stacking energy: -194.404 Base-Backbone interact. energy: -0.533 local terms energy: -277.507351 where: bonds (distance) C4'-P energy: -76.986 bonds (distance) P-C4' energy: -65.753 flat angles C4'-P-C4' energy: -59.449 flat angles P-C4'-P energy: -44.369 tors. eta vs tors. theta energy: -30.950 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -556.878143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.878143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.078143 (E_RNA) where: Base-Base interactions energy: -282.606 where: short stacking energy: -163.713 Base-Backbone interact. energy: -2.143 local terms energy: -243.329793 where: bonds (distance) C4'-P energy: -66.515 bonds (distance) P-C4' energy: -65.915 flat angles C4'-P-C4' energy: -58.098 flat angles P-C4'-P energy: -30.976 tors. eta vs tors. theta energy: -21.825 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -541.764430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -541.764430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.364430 (E_RNA) where: Base-Base interactions energy: -292.662 where: short stacking energy: -155.167 Base-Backbone interact. energy: -1.653 local terms energy: -215.048973 where: bonds (distance) C4'-P energy: -62.224 bonds (distance) P-C4' energy: -49.737 flat angles C4'-P-C4' energy: -60.101 flat angles P-C4'-P energy: -31.670 tors. eta vs tors. theta energy: -11.317 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -375.619321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.619321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.419321 (E_RNA) where: Base-Base interactions energy: -147.204 where: short stacking energy: -98.135 Base-Backbone interact. energy: 0.072 local terms energy: -203.287380 where: bonds (distance) C4'-P energy: -65.388 bonds (distance) P-C4' energy: -67.623 flat angles C4'-P-C4' energy: -57.539 flat angles P-C4'-P energy: -28.345 tors. eta vs tors. theta energy: 15.608 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -299.153627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.153627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.153627 (E_RNA) where: Base-Base interactions energy: -114.991 where: short stacking energy: -111.943 Base-Backbone interact. energy: 1.788 local terms energy: -185.950324 where: bonds (distance) C4'-P energy: -52.572 bonds (distance) P-C4' energy: -73.931 flat angles C4'-P-C4' energy: -45.394 flat angles P-C4'-P energy: -18.388 tors. eta vs tors. theta energy: 4.335 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1055.762698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.762698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.762698 (E_RNA) where: Base-Base interactions energy: -673.001 where: short stacking energy: -336.176 Base-Backbone interact. energy: -2.832 local terms energy: -379.928907 where: bonds (distance) C4'-P energy: -85.070 bonds (distance) P-C4' energy: -79.810 flat angles C4'-P-C4' energy: -86.887 flat angles P-C4'-P energy: -59.251 tors. eta vs tors. theta energy: -68.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1005.723551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.723551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.123551 (E_RNA) where: Base-Base interactions energy: -554.995 where: short stacking energy: -302.036 Base-Backbone interact. energy: -1.666 local terms energy: -373.463208 where: bonds (distance) C4'-P energy: -77.369 bonds (distance) P-C4' energy: -85.912 flat angles C4'-P-C4' energy: -89.432 flat angles P-C4'-P energy: -43.443 tors. eta vs tors. theta energy: -77.307 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -891.913733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.913733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.513733 (E_RNA) where: Base-Base interactions energy: -462.501 where: short stacking energy: -243.072 Base-Backbone interact. energy: 0.682 local terms energy: -325.695436 where: bonds (distance) C4'-P energy: -72.370 bonds (distance) P-C4' energy: -75.593 flat angles C4'-P-C4' energy: -76.141 flat angles P-C4'-P energy: -43.353 tors. eta vs tors. theta energy: -58.239 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -808.652627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.652627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.852627 (E_RNA) where: Base-Base interactions energy: -427.446 where: short stacking energy: -222.910 Base-Backbone interact. energy: -1.201 local terms energy: -324.205173 where: bonds (distance) C4'-P energy: -65.528 bonds (distance) P-C4' energy: -79.307 flat angles C4'-P-C4' energy: -82.130 flat angles P-C4'-P energy: -54.634 tors. eta vs tors. theta energy: -42.606 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -744.504082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.504082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.704082 (E_RNA) where: Base-Base interactions energy: -389.045 where: short stacking energy: -193.049 Base-Backbone interact. energy: -1.639 local terms energy: -298.020345 where: bonds (distance) C4'-P energy: -75.052 bonds (distance) P-C4' energy: -74.745 flat angles C4'-P-C4' energy: -72.407 flat angles P-C4'-P energy: -39.960 tors. eta vs tors. theta energy: -35.857 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -679.737486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.737486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.737486 (E_RNA) where: Base-Base interactions energy: -323.555 where: short stacking energy: -176.032 Base-Backbone interact. energy: -1.185 local terms energy: -282.997986 where: bonds (distance) C4'-P energy: -67.916 bonds (distance) P-C4' energy: -82.779 flat angles C4'-P-C4' energy: -53.788 flat angles P-C4'-P energy: -54.864 tors. eta vs tors. theta energy: -23.652 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -587.195885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.195885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.595885 (E_RNA) where: Base-Base interactions energy: -288.826 where: short stacking energy: -156.209 Base-Backbone interact. energy: -1.246 local terms energy: -266.523763 where: bonds (distance) C4'-P energy: -67.415 bonds (distance) P-C4' energy: -76.793 flat angles C4'-P-C4' energy: -51.987 flat angles P-C4'-P energy: -53.536 tors. eta vs tors. theta energy: -16.794 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -571.645805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.645805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.045805 (E_RNA) where: Base-Base interactions energy: -274.539 where: short stacking energy: -151.645 Base-Backbone interact. energy: 1.927 local terms energy: -268.434513 where: bonds (distance) C4'-P energy: -68.988 bonds (distance) P-C4' energy: -82.658 flat angles C4'-P-C4' energy: -63.263 flat angles P-C4'-P energy: -33.467 tors. eta vs tors. theta energy: -20.059 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -375.962413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.962413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.162413 (E_RNA) where: Base-Base interactions energy: -131.173 where: short stacking energy: -83.784 Base-Backbone interact. energy: -0.243 local terms energy: -224.746460 where: bonds (distance) C4'-P energy: -65.289 bonds (distance) P-C4' energy: -73.361 flat angles C4'-P-C4' energy: -57.910 flat angles P-C4'-P energy: -30.697 tors. eta vs tors. theta energy: 2.511 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -315.541750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.541750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.541750 (E_RNA) where: Base-Base interactions energy: -126.463 where: short stacking energy: -122.996 Base-Backbone interact. energy: 1.626 local terms energy: -190.705405 where: bonds (distance) C4'-P energy: -52.488 bonds (distance) P-C4' energy: -55.115 flat angles C4'-P-C4' energy: -50.712 flat angles P-C4'-P energy: -36.423 tors. eta vs tors. theta energy: 4.032 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -997.338273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.338273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.338273 (E_RNA) where: Base-Base interactions energy: -631.071 where: short stacking energy: -264.244 Base-Backbone interact. energy: -2.022 local terms energy: -364.244699 where: bonds (distance) C4'-P energy: -79.163 bonds (distance) P-C4' energy: -83.867 flat angles C4'-P-C4' energy: -87.326 flat angles P-C4'-P energy: -53.724 tors. eta vs tors. theta energy: -60.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -999.078841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.078841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.478841 (E_RNA) where: Base-Base interactions energy: -569.214 where: short stacking energy: -297.693 Base-Backbone interact. energy: 1.885 local terms energy: -356.149881 where: bonds (distance) C4'-P energy: -66.477 bonds (distance) P-C4' energy: -82.658 flat angles C4'-P-C4' energy: -83.481 flat angles P-C4'-P energy: -44.986 tors. eta vs tors. theta energy: -78.548 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -908.505770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.505770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.905770 (E_RNA) where: Base-Base interactions energy: -456.823 where: short stacking energy: -232.525 Base-Backbone interact. energy: 2.567 local terms energy: -351.650516 where: bonds (distance) C4'-P energy: -80.838 bonds (distance) P-C4' energy: -82.400 flat angles C4'-P-C4' energy: -79.582 flat angles P-C4'-P energy: -54.898 tors. eta vs tors. theta energy: -53.933 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -805.798610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -805.798610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.198610 (E_RNA) where: Base-Base interactions energy: -404.923 where: short stacking energy: -234.004 Base-Backbone interact. energy: 1.887 local terms energy: -345.162390 where: bonds (distance) C4'-P energy: -86.432 bonds (distance) P-C4' energy: -80.434 flat angles C4'-P-C4' energy: -86.287 flat angles P-C4'-P energy: -43.268 tors. eta vs tors. theta energy: -48.741 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -726.705699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.705699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.905699 (E_RNA) where: Base-Base interactions energy: -370.654 where: short stacking energy: -201.308 Base-Backbone interact. energy: -2.272 local terms energy: -297.979307 where: bonds (distance) C4'-P energy: -66.081 bonds (distance) P-C4' energy: -81.448 flat angles C4'-P-C4' energy: -75.380 flat angles P-C4'-P energy: -46.876 tors. eta vs tors. theta energy: -28.193 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -686.954189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.954189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.754189 (E_RNA) where: Base-Base interactions energy: -333.913 where: short stacking energy: -151.730 Base-Backbone interact. energy: -1.332 local terms energy: -281.509030 where: bonds (distance) C4'-P energy: -68.997 bonds (distance) P-C4' energy: -74.697 flat angles C4'-P-C4' energy: -67.774 flat angles P-C4'-P energy: -46.039 tors. eta vs tors. theta energy: -24.003 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -536.480560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.480560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.080560 (E_RNA) where: Base-Base interactions energy: -242.364 where: short stacking energy: -129.890 Base-Backbone interact. energy: -3.642 local terms energy: -258.074557 where: bonds (distance) C4'-P energy: -68.462 bonds (distance) P-C4' energy: -79.411 flat angles C4'-P-C4' energy: -64.803 flat angles P-C4'-P energy: -36.499 tors. eta vs tors. theta energy: -8.900 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -515.518945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.518945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.318945 (E_RNA) where: Base-Base interactions energy: -233.552 where: short stacking energy: -137.864 Base-Backbone interact. energy: -0.660 local terms energy: -247.106589 where: bonds (distance) C4'-P energy: -66.959 bonds (distance) P-C4' energy: -69.893 flat angles C4'-P-C4' energy: -65.792 flat angles P-C4'-P energy: -26.668 tors. eta vs tors. theta energy: -17.794 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -409.970815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.970815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.770815 (E_RNA) where: Base-Base interactions energy: -165.758 where: short stacking energy: -119.824 Base-Backbone interact. energy: -2.059 local terms energy: -216.954015 where: bonds (distance) C4'-P energy: -62.257 bonds (distance) P-C4' energy: -71.240 flat angles C4'-P-C4' energy: -73.052 flat angles P-C4'-P energy: -18.745 tors. eta vs tors. theta energy: 8.340 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -319.585127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.585127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.585127 (E_RNA) where: Base-Base interactions energy: -109.214 where: short stacking energy: -86.905 Base-Backbone interact. energy: 0.980 local terms energy: -211.351688 where: bonds (distance) C4'-P energy: -66.333 bonds (distance) P-C4' energy: -76.479 flat angles C4'-P-C4' energy: -55.261 flat angles P-C4'-P energy: -33.547 tors. eta vs tors. theta energy: 20.268 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1045.950940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.950940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.950940 (E_RNA) where: Base-Base interactions energy: -666.974 where: short stacking energy: -302.295 Base-Backbone interact. energy: -1.673 local terms energy: -377.303419 where: bonds (distance) C4'-P energy: -84.171 bonds (distance) P-C4' energy: -78.424 flat angles C4'-P-C4' energy: -83.984 flat angles P-C4'-P energy: -56.315 tors. eta vs tors. theta energy: -74.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -979.980760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.980760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.980760 (E_RNA) where: Base-Base interactions energy: -534.870 where: short stacking energy: -296.787 Base-Backbone interact. energy: 0.543 local terms energy: -373.653716 where: bonds (distance) C4'-P energy: -79.128 bonds (distance) P-C4' energy: -79.272 flat angles C4'-P-C4' energy: -85.318 flat angles P-C4'-P energy: -54.007 tors. eta vs tors. theta energy: -75.929 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -940.871319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.871319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.671319 (E_RNA) where: Base-Base interactions energy: -494.813 where: short stacking energy: -273.378 Base-Backbone interact. energy: -0.830 local terms energy: -339.027915 where: bonds (distance) C4'-P energy: -86.283 bonds (distance) P-C4' energy: -75.594 flat angles C4'-P-C4' energy: -79.425 flat angles P-C4'-P energy: -47.225 tors. eta vs tors. theta energy: -50.501 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -773.213353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.213353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.413353 (E_RNA) where: Base-Base interactions energy: -406.087 where: short stacking energy: -207.197 Base-Backbone interact. energy: -1.414 local terms energy: -309.911880 where: bonds (distance) C4'-P energy: -79.897 bonds (distance) P-C4' energy: -68.695 flat angles C4'-P-C4' energy: -68.867 flat angles P-C4'-P energy: -55.317 tors. eta vs tors. theta energy: -37.136 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -755.582879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.582879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.982879 (E_RNA) where: Base-Base interactions energy: -417.871 where: short stacking energy: -197.141 Base-Backbone interact. energy: -1.317 local terms energy: -278.794322 where: bonds (distance) C4'-P energy: -71.162 bonds (distance) P-C4' energy: -80.845 flat angles C4'-P-C4' energy: -69.616 flat angles P-C4'-P energy: -39.498 tors. eta vs tors. theta energy: -17.673 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -726.497611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.497611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.497611 (E_RNA) where: Base-Base interactions energy: -358.379 where: short stacking energy: -187.749 Base-Backbone interact. energy: -1.373 local terms energy: -294.746399 where: bonds (distance) C4'-P energy: -70.800 bonds (distance) P-C4' energy: -77.036 flat angles C4'-P-C4' energy: -72.945 flat angles P-C4'-P energy: -44.183 tors. eta vs tors. theta energy: -29.782 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -545.879663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.879663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.279663 (E_RNA) where: Base-Base interactions energy: -230.860 where: short stacking energy: -142.111 Base-Backbone interact. energy: -2.433 local terms energy: -272.987203 where: bonds (distance) C4'-P energy: -66.692 bonds (distance) P-C4' energy: -81.701 flat angles C4'-P-C4' energy: -65.149 flat angles P-C4'-P energy: -51.241 tors. eta vs tors. theta energy: -8.205 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -517.862548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.862548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.462548 (E_RNA) where: Base-Base interactions energy: -252.890 where: short stacking energy: -135.607 Base-Backbone interact. energy: 1.882 local terms energy: -243.455135 where: bonds (distance) C4'-P energy: -79.961 bonds (distance) P-C4' energy: -72.120 flat angles C4'-P-C4' energy: -59.955 flat angles P-C4'-P energy: -35.133 tors. eta vs tors. theta energy: 3.713 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -396.407051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.407051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.007051 (E_RNA) where: Base-Base interactions energy: -147.250 where: short stacking energy: -108.772 Base-Backbone interact. energy: -0.366 local terms energy: -225.390903 where: bonds (distance) C4'-P energy: -78.951 bonds (distance) P-C4' energy: -65.379 flat angles C4'-P-C4' energy: -54.573 flat angles P-C4'-P energy: -31.483 tors. eta vs tors. theta energy: 4.994 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -309.142984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.142984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -309.142984 (E_RNA) where: Base-Base interactions energy: -113.785 where: short stacking energy: -87.933 Base-Backbone interact. energy: 1.385 local terms energy: -196.743016 where: bonds (distance) C4'-P energy: -61.195 bonds (distance) P-C4' energy: -62.309 flat angles C4'-P-C4' energy: -47.871 flat angles P-C4'-P energy: -33.952 tors. eta vs tors. theta energy: 8.584 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1024.146499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.146499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.146499 (E_RNA) where: Base-Base interactions energy: -643.203 where: short stacking energy: -296.890 Base-Backbone interact. energy: -1.850 local terms energy: -379.093820 where: bonds (distance) C4'-P energy: -88.176 bonds (distance) P-C4' energy: -75.411 flat angles C4'-P-C4' energy: -83.887 flat angles P-C4'-P energy: -59.115 tors. eta vs tors. theta energy: -72.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1008.378993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.378993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.578993 (E_RNA) where: Base-Base interactions energy: -553.692 where: short stacking energy: -295.379 Base-Backbone interact. energy: -1.375 local terms energy: -379.511976 where: bonds (distance) C4'-P energy: -86.369 bonds (distance) P-C4' energy: -83.487 flat angles C4'-P-C4' energy: -85.405 flat angles P-C4'-P energy: -46.596 tors. eta vs tors. theta energy: -77.655 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -967.208453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.208453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.008453 (E_RNA) where: Base-Base interactions energy: -511.977 where: short stacking energy: -293.698 Base-Backbone interact. energy: -1.794 local terms energy: -347.237156 where: bonds (distance) C4'-P energy: -75.962 bonds (distance) P-C4' energy: -88.660 flat angles C4'-P-C4' energy: -69.357 flat angles P-C4'-P energy: -40.636 tors. eta vs tors. theta energy: -72.622 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -755.690425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.690425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.690425 (E_RNA) where: Base-Base interactions energy: -405.389 where: short stacking energy: -236.922 Base-Backbone interact. energy: -2.826 local terms energy: -293.475478 where: bonds (distance) C4'-P energy: -66.552 bonds (distance) P-C4' energy: -80.968 flat angles C4'-P-C4' energy: -64.466 flat angles P-C4'-P energy: -44.194 tors. eta vs tors. theta energy: -37.295 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -781.597131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.597131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.797131 (E_RNA) where: Base-Base interactions energy: -414.709 where: short stacking energy: -221.075 Base-Backbone interact. energy: -3.557 local terms energy: -307.530987 where: bonds (distance) C4'-P energy: -76.833 bonds (distance) P-C4' energy: -67.991 flat angles C4'-P-C4' energy: -76.909 flat angles P-C4'-P energy: -44.519 tors. eta vs tors. theta energy: -41.279 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -730.753960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.753960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.353960 (E_RNA) where: Base-Base interactions energy: -369.456 where: short stacking energy: -202.204 Base-Backbone interact. energy: -0.892 local terms energy: -292.006009 where: bonds (distance) C4'-P energy: -69.723 bonds (distance) P-C4' energy: -83.677 flat angles C4'-P-C4' energy: -72.089 flat angles P-C4'-P energy: -34.798 tors. eta vs tors. theta energy: -31.719 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -588.322635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.322635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.722635 (E_RNA) where: Base-Base interactions energy: -292.729 where: short stacking energy: -146.485 Base-Backbone interact. energy: 1.274 local terms energy: -257.267825 where: bonds (distance) C4'-P energy: -66.733 bonds (distance) P-C4' energy: -78.203 flat angles C4'-P-C4' energy: -58.667 flat angles P-C4'-P energy: -37.200 tors. eta vs tors. theta energy: -16.465 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -549.816026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.816026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.616026 (E_RNA) where: Base-Base interactions energy: -256.350 where: short stacking energy: -143.416 Base-Backbone interact. energy: 0.076 local terms energy: -268.342164 where: bonds (distance) C4'-P energy: -78.851 bonds (distance) P-C4' energy: -69.862 flat angles C4'-P-C4' energy: -67.977 flat angles P-C4'-P energy: -41.910 tors. eta vs tors. theta energy: -9.742 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -376.782826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.782826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.182826 (E_RNA) where: Base-Base interactions energy: -138.873 where: short stacking energy: -94.638 Base-Backbone interact. energy: 4.564 local terms energy: -220.873089 where: bonds (distance) C4'-P energy: -72.857 bonds (distance) P-C4' energy: -76.949 flat angles C4'-P-C4' energy: -51.792 flat angles P-C4'-P energy: -32.548 tors. eta vs tors. theta energy: 13.273 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -323.225286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.225286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.225286 (E_RNA) where: Base-Base interactions energy: -118.263 where: short stacking energy: -65.067 Base-Backbone interact. energy: 3.638 local terms energy: -208.600237 where: bonds (distance) C4'-P energy: -69.751 bonds (distance) P-C4' energy: -75.532 flat angles C4'-P-C4' energy: -46.460 flat angles P-C4'-P energy: -39.139 tors. eta vs tors. theta energy: 22.282 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1029.394329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.394329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.394329 (E_RNA) where: Base-Base interactions energy: -584.005 where: short stacking energy: -295.672 Base-Backbone interact. energy: -3.519 local terms energy: -369.870325 where: bonds (distance) C4'-P energy: -78.920 bonds (distance) P-C4' energy: -83.903 flat angles C4'-P-C4' energy: -89.999 flat angles P-C4'-P energy: -46.486 tors. eta vs tors. theta energy: -70.562 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1010.510270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.510270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.510270 (E_RNA) where: Base-Base interactions energy: -659.293 where: short stacking energy: -293.818 Base-Backbone interact. energy: -3.569 local terms energy: -347.648373 where: bonds (distance) C4'-P energy: -70.172 bonds (distance) P-C4' energy: -83.428 flat angles C4'-P-C4' energy: -75.568 flat angles P-C4'-P energy: -44.580 tors. eta vs tors. theta energy: -73.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -996.842462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.842462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.042462 (E_RNA) where: Base-Base interactions energy: -528.530 where: short stacking energy: -293.719 Base-Backbone interact. energy: 0.549 local terms energy: -368.061366 where: bonds (distance) C4'-P energy: -78.515 bonds (distance) P-C4' energy: -76.914 flat angles C4'-P-C4' energy: -91.686 flat angles P-C4'-P energy: -46.165 tors. eta vs tors. theta energy: -74.780 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -759.423471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.423471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.023471 (E_RNA) where: Base-Base interactions energy: -398.731 where: short stacking energy: -202.471 Base-Backbone interact. energy: -0.527 local terms energy: -309.765378 where: bonds (distance) C4'-P energy: -62.269 bonds (distance) P-C4' energy: -80.044 flat angles C4'-P-C4' energy: -80.924 flat angles P-C4'-P energy: -56.325 tors. eta vs tors. theta energy: -30.204 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -753.720117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.720117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.920117 (E_RNA) where: Base-Base interactions energy: -387.663 where: short stacking energy: -206.977 Base-Backbone interact. energy: -3.363 local terms energy: -306.894860 where: bonds (distance) C4'-P energy: -74.546 bonds (distance) P-C4' energy: -70.752 flat angles C4'-P-C4' energy: -73.139 flat angles P-C4'-P energy: -63.342 tors. eta vs tors. theta energy: -25.117 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -717.384544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.384544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.584544 (E_RNA) where: Base-Base interactions energy: -366.117 where: short stacking energy: -198.034 Base-Backbone interact. energy: -0.650 local terms energy: -276.816763 where: bonds (distance) C4'-P energy: -62.511 bonds (distance) P-C4' energy: -65.903 flat angles C4'-P-C4' energy: -57.204 flat angles P-C4'-P energy: -38.604 tors. eta vs tors. theta energy: -52.594 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -557.008882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.008882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.608882 (E_RNA) where: Base-Base interactions energy: -270.742 where: short stacking energy: -146.209 Base-Backbone interact. energy: 1.550 local terms energy: -246.416153 where: bonds (distance) C4'-P energy: -71.205 bonds (distance) P-C4' energy: -75.560 flat angles C4'-P-C4' energy: -62.935 flat angles P-C4'-P energy: -29.958 tors. eta vs tors. theta energy: -6.758 Dist. restrs. and SS energy: -41.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -538.817906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.817906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.417906 (E_RNA) where: Base-Base interactions energy: -285.278 where: short stacking energy: -161.731 Base-Backbone interact. energy: 0.324 local terms energy: -221.463479 where: bonds (distance) C4'-P energy: -67.457 bonds (distance) P-C4' energy: -71.995 flat angles C4'-P-C4' energy: -48.119 flat angles P-C4'-P energy: -33.023 tors. eta vs tors. theta energy: -0.869 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -330.486810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.486810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.086810 (E_RNA) where: Base-Base interactions energy: -132.306 where: short stacking energy: -80.504 Base-Backbone interact. energy: 2.231 local terms energy: -177.011959 where: bonds (distance) C4'-P energy: -50.891 bonds (distance) P-C4' energy: -75.229 flat angles C4'-P-C4' energy: -54.312 flat angles P-C4'-P energy: -18.483 tors. eta vs tors. theta energy: 21.904 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -300.625165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.625165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.625165 (E_RNA) where: Base-Base interactions energy: -104.901 where: short stacking energy: -82.349 Base-Backbone interact. energy: 0.640 local terms energy: -196.363797 where: bonds (distance) C4'-P energy: -54.467 bonds (distance) P-C4' energy: -74.882 flat angles C4'-P-C4' energy: -57.715 flat angles P-C4'-P energy: -27.110 tors. eta vs tors. theta energy: 17.811 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1052.208790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.208790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.408790 (E_RNA) where: Base-Base interactions energy: -592.997 where: short stacking energy: -326.230 Base-Backbone interact. energy: -1.174 local terms energy: -384.238011 where: bonds (distance) C4'-P energy: -80.932 bonds (distance) P-C4' energy: -71.394 flat angles C4'-P-C4' energy: -92.789 flat angles P-C4'-P energy: -55.045 tors. eta vs tors. theta energy: -84.078 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1017.729938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.729938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.929938 (E_RNA) where: Base-Base interactions energy: -537.559 where: short stacking energy: -285.425 Base-Backbone interact. energy: 0.063 local terms energy: -379.433687 where: bonds (distance) C4'-P energy: -83.271 bonds (distance) P-C4' energy: -85.471 flat angles C4'-P-C4' energy: -85.349 flat angles P-C4'-P energy: -59.303 tors. eta vs tors. theta energy: -66.039 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -987.572413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.572413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.572413 (E_RNA) where: Base-Base interactions energy: -619.507 where: short stacking energy: -267.724 Base-Backbone interact. energy: 0.560 local terms energy: -368.625279 where: bonds (distance) C4'-P energy: -81.979 bonds (distance) P-C4' energy: -81.557 flat angles C4'-P-C4' energy: -87.656 flat angles P-C4'-P energy: -55.438 tors. eta vs tors. theta energy: -61.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -809.473268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -809.473268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.873268 (E_RNA) where: Base-Base interactions energy: -469.209 where: short stacking energy: -232.421 Base-Backbone interact. energy: -1.040 local terms energy: -281.623597 where: bonds (distance) C4'-P energy: -67.367 bonds (distance) P-C4' energy: -56.286 flat angles C4'-P-C4' energy: -69.565 flat angles P-C4'-P energy: -42.255 tors. eta vs tors. theta energy: -46.150 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -733.108022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.108022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.908022 (E_RNA) where: Base-Base interactions energy: -390.807 where: short stacking energy: -209.977 Base-Backbone interact. energy: -0.223 local terms energy: -289.878031 where: bonds (distance) C4'-P energy: -70.374 bonds (distance) P-C4' energy: -82.702 flat angles C4'-P-C4' energy: -58.421 flat angles P-C4'-P energy: -40.946 tors. eta vs tors. theta energy: -37.434 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -752.936898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.936898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.736898 (E_RNA) where: Base-Base interactions energy: -382.806 where: short stacking energy: -212.435 Base-Backbone interact. energy: -1.455 local terms energy: -298.476329 where: bonds (distance) C4'-P energy: -67.213 bonds (distance) P-C4' energy: -73.378 flat angles C4'-P-C4' energy: -68.999 flat angles P-C4'-P energy: -43.289 tors. eta vs tors. theta energy: -45.597 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -594.111286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.111286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.111286 (E_RNA) where: Base-Base interactions energy: -291.445 where: short stacking energy: -157.111 Base-Backbone interact. energy: 0.811 local terms energy: -249.477006 where: bonds (distance) C4'-P energy: -68.133 bonds (distance) P-C4' energy: -70.276 flat angles C4'-P-C4' energy: -56.601 flat angles P-C4'-P energy: -41.609 tors. eta vs tors. theta energy: -12.858 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -552.828606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.828606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.028606 (E_RNA) where: Base-Base interactions energy: -287.883 where: short stacking energy: -157.258 Base-Backbone interact. energy: 7.191 local terms energy: -243.336253 where: bonds (distance) C4'-P energy: -44.577 bonds (distance) P-C4' energy: -66.595 flat angles C4'-P-C4' energy: -66.859 flat angles P-C4'-P energy: -44.596 tors. eta vs tors. theta energy: -20.709 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -409.338684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.338684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.738684 (E_RNA) where: Base-Base interactions energy: -164.083 where: short stacking energy: -94.420 Base-Backbone interact. energy: -1.182 local terms energy: -213.473537 where: bonds (distance) C4'-P energy: -77.225 bonds (distance) P-C4' energy: -75.053 flat angles C4'-P-C4' energy: -41.016 flat angles P-C4'-P energy: -40.501 tors. eta vs tors. theta energy: 20.321 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -288.083214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.083214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.083214 (E_RNA) where: Base-Base interactions energy: -88.813 where: short stacking energy: -59.025 Base-Backbone interact. energy: -0.680 local terms energy: -198.591011 where: bonds (distance) C4'-P energy: -68.485 bonds (distance) P-C4' energy: -73.089 flat angles C4'-P-C4' energy: -44.387 flat angles P-C4'-P energy: -33.047 tors. eta vs tors. theta energy: 20.418 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1068.074743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.074743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.274743 (E_RNA) where: Base-Base interactions energy: -619.295 where: short stacking energy: -304.787 Base-Backbone interact. energy: -0.929 local terms energy: -374.050954 where: bonds (distance) C4'-P energy: -69.752 bonds (distance) P-C4' energy: -86.067 flat angles C4'-P-C4' energy: -92.269 flat angles P-C4'-P energy: -42.666 tors. eta vs tors. theta energy: -83.296 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1015.410487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.410487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.410487 (E_RNA) where: Base-Base interactions energy: -554.807 where: short stacking energy: -290.192 Base-Backbone interact. energy: -4.193 local terms energy: -348.410055 where: bonds (distance) C4'-P energy: -82.067 bonds (distance) P-C4' energy: -76.103 flat angles C4'-P-C4' energy: -77.194 flat angles P-C4'-P energy: -50.055 tors. eta vs tors. theta energy: -62.990 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1001.827165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.827165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.827165 (E_RNA) where: Base-Base interactions energy: -628.337 where: short stacking energy: -302.900 Base-Backbone interact. energy: -1.014 local terms energy: -372.476336 where: bonds (distance) C4'-P energy: -80.547 bonds (distance) P-C4' energy: -69.844 flat angles C4'-P-C4' energy: -88.385 flat angles P-C4'-P energy: -56.524 tors. eta vs tors. theta energy: -77.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -856.409023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.409023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.009023 (E_RNA) where: Base-Base interactions energy: -470.049 where: short stacking energy: -225.694 Base-Backbone interact. energy: -0.245 local terms energy: -326.714653 where: bonds (distance) C4'-P energy: -77.236 bonds (distance) P-C4' energy: -81.723 flat angles C4'-P-C4' energy: -68.016 flat angles P-C4'-P energy: -59.190 tors. eta vs tors. theta energy: -40.551 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -786.159168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.159168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -719.559168 (E_RNA) where: Base-Base interactions energy: -410.579 where: short stacking energy: -210.342 Base-Backbone interact. energy: -0.031 local terms energy: -308.948457 where: bonds (distance) C4'-P energy: -66.815 bonds (distance) P-C4' energy: -82.927 flat angles C4'-P-C4' energy: -75.251 flat angles P-C4'-P energy: -37.385 tors. eta vs tors. theta energy: -46.571 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -696.605755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.605755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.005755 (E_RNA) where: Base-Base interactions energy: -372.314 where: short stacking energy: -189.015 Base-Backbone interact. energy: -1.889 local terms energy: -264.802211 where: bonds (distance) C4'-P energy: -76.063 bonds (distance) P-C4' energy: -67.816 flat angles C4'-P-C4' energy: -61.070 flat angles P-C4'-P energy: -41.644 tors. eta vs tors. theta energy: -18.209 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -645.559023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.559023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.359023 (E_RNA) where: Base-Base interactions energy: -304.596 where: short stacking energy: -144.531 Base-Backbone interact. energy: 4.072 local terms energy: -283.835383 where: bonds (distance) C4'-P energy: -74.661 bonds (distance) P-C4' energy: -73.536 flat angles C4'-P-C4' energy: -68.757 flat angles P-C4'-P energy: -48.343 tors. eta vs tors. theta energy: -18.539 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -579.051343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.051343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.251343 (E_RNA) where: Base-Base interactions energy: -294.824 where: short stacking energy: -150.964 Base-Backbone interact. energy: 0.224 local terms energy: -255.651433 where: bonds (distance) C4'-P energy: -57.892 bonds (distance) P-C4' energy: -76.204 flat angles C4'-P-C4' energy: -68.727 flat angles P-C4'-P energy: -37.173 tors. eta vs tors. theta energy: -15.655 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -380.398776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.398776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.198776 (E_RNA) where: Base-Base interactions energy: -152.738 where: short stacking energy: -83.046 Base-Backbone interact. energy: -2.335 local terms energy: -191.125569 where: bonds (distance) C4'-P energy: -70.313 bonds (distance) P-C4' energy: -54.234 flat angles C4'-P-C4' energy: -55.218 flat angles P-C4'-P energy: -29.984 tors. eta vs tors. theta energy: 18.622 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -369.848228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.848228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.848228 (E_RNA) where: Base-Base interactions energy: -151.796 where: short stacking energy: -111.967 Base-Backbone interact. energy: -0.414 local terms energy: -217.638736 where: bonds (distance) C4'-P energy: -76.554 bonds (distance) P-C4' energy: -62.924 flat angles C4'-P-C4' energy: -64.686 flat angles P-C4'-P energy: -26.296 tors. eta vs tors. theta energy: 12.820 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1062.534395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.534395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.734395 (E_RNA) where: Base-Base interactions energy: -594.062 where: short stacking energy: -307.105 Base-Backbone interact. energy: -1.931 local terms energy: -392.741047 where: bonds (distance) C4'-P energy: -82.686 bonds (distance) P-C4' energy: -85.020 flat angles C4'-P-C4' energy: -88.111 flat angles P-C4'-P energy: -53.260 tors. eta vs tors. theta energy: -83.664 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -988.578136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.578136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.578136 (E_RNA) where: Base-Base interactions energy: -622.180 where: short stacking energy: -288.958 Base-Backbone interact. energy: -3.540 local terms energy: -362.857800 where: bonds (distance) C4'-P energy: -82.020 bonds (distance) P-C4' energy: -79.270 flat angles C4'-P-C4' energy: -83.473 flat angles P-C4'-P energy: -50.514 tors. eta vs tors. theta energy: -67.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -959.876316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.876316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.076316 (E_RNA) where: Base-Base interactions energy: -503.566 where: short stacking energy: -282.857 Base-Backbone interact. energy: -2.291 local terms energy: -362.220232 where: bonds (distance) C4'-P energy: -65.119 bonds (distance) P-C4' energy: -84.390 flat angles C4'-P-C4' energy: -87.509 flat angles P-C4'-P energy: -57.452 tors. eta vs tors. theta energy: -67.750 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -833.860087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.860087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.860087 (E_RNA) where: Base-Base interactions energy: -450.559 where: short stacking energy: -235.780 Base-Backbone interact. energy: 0.987 local terms energy: -312.288192 where: bonds (distance) C4'-P energy: -70.466 bonds (distance) P-C4' energy: -76.396 flat angles C4'-P-C4' energy: -68.617 flat angles P-C4'-P energy: -50.698 tors. eta vs tors. theta energy: -46.112 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -797.393517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.393517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.393517 (E_RNA) where: Base-Base interactions energy: -435.553 where: short stacking energy: -219.825 Base-Backbone interact. energy: -1.493 local terms energy: -306.347322 where: bonds (distance) C4'-P energy: -72.454 bonds (distance) P-C4' energy: -75.161 flat angles C4'-P-C4' energy: -70.801 flat angles P-C4'-P energy: -51.006 tors. eta vs tors. theta energy: -36.925 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -717.134733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.134733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.334733 (E_RNA) where: Base-Base interactions energy: -371.505 where: short stacking energy: -195.970 Base-Backbone interact. energy: -1.706 local terms energy: -288.123913 where: bonds (distance) C4'-P energy: -66.287 bonds (distance) P-C4' energy: -84.132 flat angles C4'-P-C4' energy: -75.701 flat angles P-C4'-P energy: -41.130 tors. eta vs tors. theta energy: -20.874 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -621.066098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.066098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.066098 (E_RNA) where: Base-Base interactions energy: -293.056 where: short stacking energy: -164.301 Base-Backbone interact. energy: -2.021 local terms energy: -271.989629 where: bonds (distance) C4'-P energy: -67.344 bonds (distance) P-C4' energy: -74.199 flat angles C4'-P-C4' energy: -71.406 flat angles P-C4'-P energy: -34.792 tors. eta vs tors. theta energy: -24.248 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -564.427269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.427269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.427269 (E_RNA) where: Base-Base interactions energy: -272.090 where: short stacking energy: -160.527 Base-Backbone interact. energy: 0.168 local terms energy: -256.505151 where: bonds (distance) C4'-P energy: -63.865 bonds (distance) P-C4' energy: -76.131 flat angles C4'-P-C4' energy: -57.645 flat angles P-C4'-P energy: -43.612 tors. eta vs tors. theta energy: -15.252 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -408.398559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.398559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.598559 (E_RNA) where: Base-Base interactions energy: -127.808 where: short stacking energy: -95.831 Base-Backbone interact. energy: 1.297 local terms energy: -253.087369 where: bonds (distance) C4'-P energy: -71.832 bonds (distance) P-C4' energy: -78.936 flat angles C4'-P-C4' energy: -73.840 flat angles P-C4'-P energy: -26.393 tors. eta vs tors. theta energy: -2.086 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -334.848394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.848394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.048394 (E_RNA) where: Base-Base interactions energy: -84.837 where: short stacking energy: -60.009 Base-Backbone interact. energy: -1.461 local terms energy: -246.750615 where: bonds (distance) C4'-P energy: -76.065 bonds (distance) P-C4' energy: -83.034 flat angles C4'-P-C4' energy: -72.464 flat angles P-C4'-P energy: -26.098 tors. eta vs tors. theta energy: 10.911 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1039.195360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.195360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.195360 (E_RNA) where: Base-Base interactions energy: -585.670 where: short stacking energy: -300.889 Base-Backbone interact. energy: -0.471 local terms energy: -381.054761 where: bonds (distance) C4'-P energy: -80.897 bonds (distance) P-C4' energy: -82.647 flat angles C4'-P-C4' energy: -84.523 flat angles P-C4'-P energy: -58.712 tors. eta vs tors. theta energy: -74.275 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -985.849580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.849580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.849580 (E_RNA) where: Base-Base interactions energy: -620.963 where: short stacking energy: -303.643 Base-Backbone interact. energy: -6.092 local terms energy: -358.794714 where: bonds (distance) C4'-P energy: -82.735 bonds (distance) P-C4' energy: -83.430 flat angles C4'-P-C4' energy: -72.639 flat angles P-C4'-P energy: -46.238 tors. eta vs tors. theta energy: -73.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -964.047944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.047944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.847944 (E_RNA) where: Base-Base interactions energy: -518.281 where: short stacking energy: -255.768 Base-Backbone interact. energy: -1.676 local terms energy: -346.891785 where: bonds (distance) C4'-P energy: -78.131 bonds (distance) P-C4' energy: -81.947 flat angles C4'-P-C4' energy: -69.796 flat angles P-C4'-P energy: -56.074 tors. eta vs tors. theta energy: -60.943 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -840.752328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.752328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.152328 (E_RNA) where: Base-Base interactions energy: -452.944 where: short stacking energy: -249.671 Base-Backbone interact. energy: 0.265 local terms energy: -321.473449 where: bonds (distance) C4'-P energy: -79.926 bonds (distance) P-C4' energy: -76.393 flat angles C4'-P-C4' energy: -76.698 flat angles P-C4'-P energy: -40.181 tors. eta vs tors. theta energy: -48.275 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -784.915489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.915489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.315489 (E_RNA) where: Base-Base interactions energy: -420.015 where: short stacking energy: -214.570 Base-Backbone interact. energy: -2.855 local terms energy: -304.445384 where: bonds (distance) C4'-P energy: -75.260 bonds (distance) P-C4' energy: -77.549 flat angles C4'-P-C4' energy: -66.912 flat angles P-C4'-P energy: -47.146 tors. eta vs tors. theta energy: -37.579 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -722.459960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.459960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.459960 (E_RNA) where: Base-Base interactions energy: -402.659 where: short stacking energy: -196.535 Base-Backbone interact. energy: 1.358 local terms energy: -267.158952 where: bonds (distance) C4'-P energy: -66.051 bonds (distance) P-C4' energy: -62.440 flat angles C4'-P-C4' energy: -73.039 flat angles P-C4'-P energy: -35.627 tors. eta vs tors. theta energy: -30.002 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -622.661172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.661172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.261172 (E_RNA) where: Base-Base interactions energy: -297.104 where: short stacking energy: -152.741 Base-Backbone interact. energy: -2.410 local terms energy: -263.747259 where: bonds (distance) C4'-P energy: -63.727 bonds (distance) P-C4' energy: -70.050 flat angles C4'-P-C4' energy: -64.610 flat angles P-C4'-P energy: -52.120 tors. eta vs tors. theta energy: -13.240 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -571.830828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.830828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.830828 (E_RNA) where: Base-Base interactions energy: -300.088 where: short stacking energy: -150.034 Base-Backbone interact. energy: -0.843 local terms energy: -243.899963 where: bonds (distance) C4'-P energy: -71.194 bonds (distance) P-C4' energy: -70.790 flat angles C4'-P-C4' energy: -56.532 flat angles P-C4'-P energy: -30.620 tors. eta vs tors. theta energy: -14.764 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -375.380147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.380147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.580147 (E_RNA) where: Base-Base interactions energy: -121.117 where: short stacking energy: -77.749 Base-Backbone interact. energy: -1.282 local terms energy: -224.180756 where: bonds (distance) C4'-P energy: -61.576 bonds (distance) P-C4' energy: -75.928 flat angles C4'-P-C4' energy: -61.161 flat angles P-C4'-P energy: -43.436 tors. eta vs tors. theta energy: 17.919 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -317.952987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.952987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.952987 (E_RNA) where: Base-Base interactions energy: -122.756 where: short stacking energy: -88.479 Base-Backbone interact. energy: 0.747 local terms energy: -186.943181 where: bonds (distance) C4'-P energy: -69.420 bonds (distance) P-C4' energy: -53.093 flat angles C4'-P-C4' energy: -54.442 flat angles P-C4'-P energy: -35.317 tors. eta vs tors. theta energy: 25.328 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1041.870205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.870205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.870205 (E_RNA) where: Base-Base interactions energy: -602.981 where: short stacking energy: -314.820 Base-Backbone interact. energy: -1.196 local terms energy: -365.692549 where: bonds (distance) C4'-P energy: -77.876 bonds (distance) P-C4' energy: -78.623 flat angles C4'-P-C4' energy: -81.173 flat angles P-C4'-P energy: -45.572 tors. eta vs tors. theta energy: -82.449 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1000.551378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.551378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.551378 (E_RNA) where: Base-Base interactions energy: -601.912 where: short stacking energy: -283.994 Base-Backbone interact. energy: -4.084 local terms energy: -394.554815 where: bonds (distance) C4'-P energy: -87.593 bonds (distance) P-C4' energy: -90.625 flat angles C4'-P-C4' energy: -76.611 flat angles P-C4'-P energy: -53.366 tors. eta vs tors. theta energy: -86.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -949.414272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.414272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.014272 (E_RNA) where: Base-Base interactions energy: -519.756 where: short stacking energy: -281.972 Base-Backbone interact. energy: -0.051 local terms energy: -325.207756 where: bonds (distance) C4'-P energy: -69.611 bonds (distance) P-C4' energy: -74.308 flat angles C4'-P-C4' energy: -78.934 flat angles P-C4'-P energy: -40.648 tors. eta vs tors. theta energy: -61.707 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -835.123191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.123191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.923191 (E_RNA) where: Base-Base interactions energy: -458.533 where: short stacking energy: -229.111 Base-Backbone interact. energy: -3.633 local terms energy: -320.757119 where: bonds (distance) C4'-P energy: -83.757 bonds (distance) P-C4' energy: -76.053 flat angles C4'-P-C4' energy: -75.684 flat angles P-C4'-P energy: -44.981 tors. eta vs tors. theta energy: -40.282 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -812.038962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.038962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.638962 (E_RNA) where: Base-Base interactions energy: -417.250 where: short stacking energy: -229.732 Base-Backbone interact. energy: -0.093 local terms energy: -326.295455 where: bonds (distance) C4'-P energy: -71.959 bonds (distance) P-C4' energy: -82.695 flat angles C4'-P-C4' energy: -79.642 flat angles P-C4'-P energy: -54.705 tors. eta vs tors. theta energy: -37.294 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -687.109231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.109231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.709231 (E_RNA) where: Base-Base interactions energy: -336.567 where: short stacking energy: -186.289 Base-Backbone interact. energy: 0.199 local terms energy: -282.341688 where: bonds (distance) C4'-P energy: -68.571 bonds (distance) P-C4' energy: -64.286 flat angles C4'-P-C4' energy: -75.484 flat angles P-C4'-P energy: -50.212 tors. eta vs tors. theta energy: -23.789 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -701.480088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.480088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.480088 (E_RNA) where: Base-Base interactions energy: -367.961 where: short stacking energy: -171.989 Base-Backbone interact. energy: 0.187 local terms energy: -279.705648 where: bonds (distance) C4'-P energy: -68.534 bonds (distance) P-C4' energy: -70.029 flat angles C4'-P-C4' energy: -62.483 flat angles P-C4'-P energy: -45.583 tors. eta vs tors. theta energy: -33.077 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -553.521627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.521627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.921627 (E_RNA) where: Base-Base interactions energy: -250.317 where: short stacking energy: -130.620 Base-Backbone interact. energy: -2.826 local terms energy: -260.777911 where: bonds (distance) C4'-P energy: -64.468 bonds (distance) P-C4' energy: -82.551 flat angles C4'-P-C4' energy: -55.911 flat angles P-C4'-P energy: -43.094 tors. eta vs tors. theta energy: -14.753 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -414.677500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.677500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.277500 (E_RNA) where: Base-Base interactions energy: -149.363 where: short stacking energy: -97.010 Base-Backbone interact. energy: -0.640 local terms energy: -232.273884 where: bonds (distance) C4'-P energy: -57.492 bonds (distance) P-C4' energy: -78.494 flat angles C4'-P-C4' energy: -59.233 flat angles P-C4'-P energy: -42.255 tors. eta vs tors. theta energy: 5.201 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -307.712606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.712606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.112606 (E_RNA) where: Base-Base interactions energy: -95.940 where: short stacking energy: -77.864 Base-Backbone interact. energy: 0.498 local terms energy: -208.671282 where: bonds (distance) C4'-P energy: -67.790 bonds (distance) P-C4' energy: -64.315 flat angles C4'-P-C4' energy: -67.369 flat angles P-C4'-P energy: -27.339 tors. eta vs tors. theta energy: 18.142 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1027.038527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.038527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.038527 (E_RNA) where: Base-Base interactions energy: -643.216 where: short stacking energy: -306.047 Base-Backbone interact. energy: -2.116 local terms energy: -381.705812 where: bonds (distance) C4'-P energy: -80.409 bonds (distance) P-C4' energy: -90.005 flat angles C4'-P-C4' energy: -75.304 flat angles P-C4'-P energy: -56.966 tors. eta vs tors. theta energy: -79.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1020.707970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.707970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.907970 (E_RNA) where: Base-Base interactions energy: -548.817 where: short stacking energy: -285.965 Base-Backbone interact. energy: -0.737 local terms energy: -397.353910 where: bonds (distance) C4'-P energy: -81.103 bonds (distance) P-C4' energy: -90.048 flat angles C4'-P-C4' energy: -93.513 flat angles P-C4'-P energy: -46.204 tors. eta vs tors. theta energy: -86.486 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -922.241623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.241623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.241623 (E_RNA) where: Base-Base interactions energy: -465.882 where: short stacking energy: -233.007 Base-Backbone interact. energy: -0.052 local terms energy: -348.307207 where: bonds (distance) C4'-P energy: -82.473 bonds (distance) P-C4' energy: -74.150 flat angles C4'-P-C4' energy: -86.160 flat angles P-C4'-P energy: -50.880 tors. eta vs tors. theta energy: -54.645 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -876.998736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.998736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.998736 (E_RNA) where: Base-Base interactions energy: -483.634 where: short stacking energy: -230.158 Base-Backbone interact. energy: -0.837 local terms energy: -338.527774 where: bonds (distance) C4'-P energy: -76.649 bonds (distance) P-C4' energy: -86.064 flat angles C4'-P-C4' energy: -75.633 flat angles P-C4'-P energy: -58.453 tors. eta vs tors. theta energy: -41.729 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -767.544360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.544360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.344360 (E_RNA) where: Base-Base interactions energy: -399.506 where: short stacking energy: -206.827 Base-Backbone interact. energy: 2.327 local terms energy: -300.165908 where: bonds (distance) C4'-P energy: -81.880 bonds (distance) P-C4' energy: -77.334 flat angles C4'-P-C4' energy: -68.827 flat angles P-C4'-P energy: -45.020 tors. eta vs tors. theta energy: -27.104 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -744.407416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.407416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.607416 (E_RNA) where: Base-Base interactions energy: -381.313 where: short stacking energy: -191.807 Base-Backbone interact. energy: 0.678 local terms energy: -298.972415 where: bonds (distance) C4'-P energy: -70.166 bonds (distance) P-C4' energy: -70.717 flat angles C4'-P-C4' energy: -80.106 flat angles P-C4'-P energy: -49.136 tors. eta vs tors. theta energy: -28.848 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -701.947697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.947697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.347697 (E_RNA) where: Base-Base interactions energy: -379.344 where: short stacking energy: -185.940 Base-Backbone interact. energy: -1.126 local terms energy: -272.878089 where: bonds (distance) C4'-P energy: -53.575 bonds (distance) P-C4' energy: -81.487 flat angles C4'-P-C4' energy: -76.339 flat angles P-C4'-P energy: -40.881 tors. eta vs tors. theta energy: -20.596 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -527.648503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.648503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.648503 (E_RNA) where: Base-Base interactions energy: -252.777 where: short stacking energy: -143.877 Base-Backbone interact. energy: -0.160 local terms energy: -238.710979 where: bonds (distance) C4'-P energy: -66.743 bonds (distance) P-C4' energy: -63.437 flat angles C4'-P-C4' energy: -66.791 flat angles P-C4'-P energy: -26.608 tors. eta vs tors. theta energy: -15.132 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -301.888376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.888376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.088376 (E_RNA) where: Base-Base interactions energy: -100.385 where: short stacking energy: -77.912 Base-Backbone interact. energy: -1.120 local terms energy: -198.583409 where: bonds (distance) C4'-P energy: -76.289 bonds (distance) P-C4' energy: -67.076 flat angles C4'-P-C4' energy: -53.214 flat angles P-C4'-P energy: -20.410 tors. eta vs tors. theta energy: 18.406 Dist. restrs. and SS energy: -1.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -388.780936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.780936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.380936 (E_RNA) where: Base-Base interactions energy: -144.391 where: short stacking energy: -92.128 Base-Backbone interact. energy: 3.083 local terms energy: -224.072446 where: bonds (distance) C4'-P energy: -58.803 bonds (distance) P-C4' energy: -64.512 flat angles C4'-P-C4' energy: -64.838 flat angles P-C4'-P energy: -42.713 tors. eta vs tors. theta energy: 6.793 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1053.240466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.240466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.240466 (E_RNA) where: Base-Base interactions energy: -667.932 where: short stacking energy: -319.342 Base-Backbone interact. energy: -3.127 local terms energy: -382.182037 where: bonds (distance) C4'-P energy: -76.376 bonds (distance) P-C4' energy: -86.902 flat angles C4'-P-C4' energy: -72.102 flat angles P-C4'-P energy: -63.601 tors. eta vs tors. theta energy: -83.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1030.986139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.986139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.186139 (E_RNA) where: Base-Base interactions energy: -582.325 where: short stacking energy: -294.444 Base-Backbone interact. energy: -0.140 local terms energy: -374.721301 where: bonds (distance) C4'-P energy: -69.089 bonds (distance) P-C4' energy: -82.626 flat angles C4'-P-C4' energy: -83.978 flat angles P-C4'-P energy: -54.043 tors. eta vs tors. theta energy: -84.985 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -938.025469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.025469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.025469 (E_RNA) where: Base-Base interactions energy: -506.667 where: short stacking energy: -265.378 Base-Backbone interact. energy: 0.072 local terms energy: -332.430240 where: bonds (distance) C4'-P energy: -67.078 bonds (distance) P-C4' energy: -75.441 flat angles C4'-P-C4' energy: -78.249 flat angles P-C4'-P energy: -48.750 tors. eta vs tors. theta energy: -62.913 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -855.750408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.750408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.950408 (E_RNA) where: Base-Base interactions energy: -474.911 where: short stacking energy: -234.415 Base-Backbone interact. energy: 1.245 local terms energy: -326.285177 where: bonds (distance) C4'-P energy: -71.533 bonds (distance) P-C4' energy: -86.419 flat angles C4'-P-C4' energy: -79.973 flat angles P-C4'-P energy: -39.327 tors. eta vs tors. theta energy: -49.033 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -788.084609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.084609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.084609 (E_RNA) where: Base-Base interactions energy: -414.584 where: short stacking energy: -217.394 Base-Backbone interact. energy: -0.528 local terms energy: -300.973027 where: bonds (distance) C4'-P energy: -60.501 bonds (distance) P-C4' energy: -83.443 flat angles C4'-P-C4' energy: -64.603 flat angles P-C4'-P energy: -45.354 tors. eta vs tors. theta energy: -47.072 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -718.645973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.645973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.645973 (E_RNA) where: Base-Base interactions energy: -375.720 where: short stacking energy: -210.796 Base-Backbone interact. energy: -1.979 local terms energy: -286.947600 where: bonds (distance) C4'-P energy: -64.314 bonds (distance) P-C4' energy: -80.702 flat angles C4'-P-C4' energy: -63.184 flat angles P-C4'-P energy: -50.460 tors. eta vs tors. theta energy: -28.288 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -682.483731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.483731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.883731 (E_RNA) where: Base-Base interactions energy: -343.580 where: short stacking energy: -174.156 Base-Backbone interact. energy: 3.891 local terms energy: -267.194708 where: bonds (distance) C4'-P energy: -63.754 bonds (distance) P-C4' energy: -73.000 flat angles C4'-P-C4' energy: -65.140 flat angles P-C4'-P energy: -46.020 tors. eta vs tors. theta energy: -19.281 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -513.680784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.680784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.680784 (E_RNA) where: Base-Base interactions energy: -231.472 where: short stacking energy: -139.731 Base-Backbone interact. energy: -0.682 local terms energy: -245.526761 where: bonds (distance) C4'-P energy: -79.993 bonds (distance) P-C4' energy: -59.657 flat angles C4'-P-C4' energy: -65.099 flat angles P-C4'-P energy: -35.751 tors. eta vs tors. theta energy: -5.028 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -314.840130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -314.840130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.840130 (E_RNA) where: Base-Base interactions energy: -120.557 where: short stacking energy: -77.816 Base-Backbone interact. energy: -1.889 local terms energy: -192.393753 where: bonds (distance) C4'-P energy: -63.126 bonds (distance) P-C4' energy: -70.618 flat angles C4'-P-C4' energy: -55.977 flat angles P-C4'-P energy: -25.518 tors. eta vs tors. theta energy: 22.846 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -365.261781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.261781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.461781 (E_RNA) where: Base-Base interactions energy: -142.681 where: short stacking energy: -88.694 Base-Backbone interact. energy: 0.227 local terms energy: -203.007859 where: bonds (distance) C4'-P energy: -60.674 bonds (distance) P-C4' energy: -72.753 flat angles C4'-P-C4' energy: -64.064 flat angles P-C4'-P energy: -24.722 tors. eta vs tors. theta energy: 19.205 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1050.548108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.548108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.548108 (E_RNA) where: Base-Base interactions energy: -663.386 where: short stacking energy: -325.876 Base-Backbone interact. energy: -1.841 local terms energy: -385.320883 where: bonds (distance) C4'-P energy: -80.712 bonds (distance) P-C4' energy: -80.055 flat angles C4'-P-C4' energy: -79.388 flat angles P-C4'-P energy: -54.272 tors. eta vs tors. theta energy: -90.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -997.501974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.501974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.701974 (E_RNA) where: Base-Base interactions energy: -567.426 where: short stacking energy: -309.921 Base-Backbone interact. energy: -1.352 local terms energy: -354.923601 where: bonds (distance) C4'-P energy: -72.149 bonds (distance) P-C4' energy: -81.087 flat angles C4'-P-C4' energy: -70.742 flat angles P-C4'-P energy: -53.705 tors. eta vs tors. theta energy: -77.241 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -945.281021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.281021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -842.681021 (E_RNA) where: Base-Base interactions energy: -508.480 where: short stacking energy: -268.784 Base-Backbone interact. energy: 1.760 local terms energy: -335.960655 where: bonds (distance) C4'-P energy: -81.083 bonds (distance) P-C4' energy: -77.917 flat angles C4'-P-C4' energy: -75.823 flat angles P-C4'-P energy: -45.004 tors. eta vs tors. theta energy: -56.135 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -848.737743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.737743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.137743 (E_RNA) where: Base-Base interactions energy: -453.134 where: short stacking energy: -230.215 Base-Backbone interact. energy: -0.766 local terms energy: -337.237462 where: bonds (distance) C4'-P energy: -72.841 bonds (distance) P-C4' energy: -85.723 flat angles C4'-P-C4' energy: -79.265 flat angles P-C4'-P energy: -52.599 tors. eta vs tors. theta energy: -46.810 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -847.149603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.149603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.749603 (E_RNA) where: Base-Base interactions energy: -452.415 where: short stacking energy: -242.680 Base-Backbone interact. energy: 1.102 local terms energy: -327.436758 where: bonds (distance) C4'-P energy: -76.383 bonds (distance) P-C4' energy: -76.291 flat angles C4'-P-C4' energy: -75.901 flat angles P-C4'-P energy: -39.211 tors. eta vs tors. theta energy: -59.651 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -703.040401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.040401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.840401 (E_RNA) where: Base-Base interactions energy: -378.037 where: short stacking energy: -201.005 Base-Backbone interact. energy: 1.168 local terms energy: -273.971996 where: bonds (distance) C4'-P energy: -69.849 bonds (distance) P-C4' energy: -67.860 flat angles C4'-P-C4' energy: -70.243 flat angles P-C4'-P energy: -36.280 tors. eta vs tors. theta energy: -29.740 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -650.816186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.816186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.016186 (E_RNA) where: Base-Base interactions energy: -305.560 where: short stacking energy: -172.169 Base-Backbone interact. energy: -0.438 local terms energy: -271.018272 where: bonds (distance) C4'-P energy: -68.748 bonds (distance) P-C4' energy: -66.149 flat angles C4'-P-C4' energy: -69.878 flat angles P-C4'-P energy: -52.463 tors. eta vs tors. theta energy: -13.780 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -536.572690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.572690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.772690 (E_RNA) where: Base-Base interactions energy: -247.584 where: short stacking energy: -158.911 Base-Backbone interact. energy: 1.022 local terms energy: -261.210209 where: bonds (distance) C4'-P energy: -56.025 bonds (distance) P-C4' energy: -75.850 flat angles C4'-P-C4' energy: -71.919 flat angles P-C4'-P energy: -37.092 tors. eta vs tors. theta energy: -20.325 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -367.181315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.181315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.581315 (E_RNA) where: Base-Base interactions energy: -131.587 where: short stacking energy: -83.331 Base-Backbone interact. energy: 0.338 local terms energy: -214.332161 where: bonds (distance) C4'-P energy: -65.358 bonds (distance) P-C4' energy: -62.828 flat angles C4'-P-C4' energy: -63.684 flat angles P-C4'-P energy: -34.064 tors. eta vs tors. theta energy: 11.602 Dist. restrs. and SS energy: -21.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -283.849152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.849152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.849152 (E_RNA) where: Base-Base interactions energy: -81.583 where: short stacking energy: -74.600 Base-Backbone interact. energy: 1.147 local terms energy: -203.413692 where: bonds (distance) C4'-P energy: -70.194 bonds (distance) P-C4' energy: -62.715 flat angles C4'-P-C4' energy: -49.121 flat angles P-C4'-P energy: -47.264 tors. eta vs tors. theta energy: 25.881 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1058.348613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.348613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.348613 (E_RNA) where: Base-Base interactions energy: -668.770 where: short stacking energy: -320.367 Base-Backbone interact. energy: 0.547 local terms energy: -390.125958 where: bonds (distance) C4'-P energy: -83.865 bonds (distance) P-C4' energy: -79.593 flat angles C4'-P-C4' energy: -83.219 flat angles P-C4'-P energy: -57.782 tors. eta vs tors. theta energy: -85.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -974.956529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.956529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.356529 (E_RNA) where: Base-Base interactions energy: -546.611 where: short stacking energy: -254.558 Base-Backbone interact. energy: -1.584 local terms energy: -324.161689 where: bonds (distance) C4'-P energy: -74.898 bonds (distance) P-C4' energy: -81.363 flat angles C4'-P-C4' energy: -78.864 flat angles P-C4'-P energy: -40.550 tors. eta vs tors. theta energy: -48.487 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -992.837962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.837962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.837962 (E_RNA) where: Base-Base interactions energy: -552.399 where: short stacking energy: -298.961 Base-Backbone interact. energy: -0.548 local terms energy: -367.890863 where: bonds (distance) C4'-P energy: -64.961 bonds (distance) P-C4' energy: -77.641 flat angles C4'-P-C4' energy: -87.616 flat angles P-C4'-P energy: -55.601 tors. eta vs tors. theta energy: -82.071 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -870.352884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.352884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.952884 (E_RNA) where: Base-Base interactions energy: -475.722 where: short stacking energy: -242.284 Base-Backbone interact. energy: 0.029 local terms energy: -326.259555 where: bonds (distance) C4'-P energy: -68.286 bonds (distance) P-C4' energy: -75.416 flat angles C4'-P-C4' energy: -77.739 flat angles P-C4'-P energy: -50.325 tors. eta vs tors. theta energy: -54.493 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -826.566582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.566582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.966582 (E_RNA) where: Base-Base interactions energy: -440.502 where: short stacking energy: -233.405 Base-Backbone interact. energy: 0.314 local terms energy: -328.777835 where: bonds (distance) C4'-P energy: -69.742 bonds (distance) P-C4' energy: -82.785 flat angles C4'-P-C4' energy: -81.060 flat angles P-C4'-P energy: -47.607 tors. eta vs tors. theta energy: -47.585 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -688.049229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.049229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.849229 (E_RNA) where: Base-Base interactions energy: -341.473 where: short stacking energy: -199.465 Base-Backbone interact. energy: -1.477 local terms energy: -274.899032 where: bonds (distance) C4'-P energy: -68.926 bonds (distance) P-C4' energy: -75.825 flat angles C4'-P-C4' energy: -69.466 flat angles P-C4'-P energy: -31.424 tors. eta vs tors. theta energy: -29.257 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -677.725569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.725569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.925569 (E_RNA) where: Base-Base interactions energy: -364.285 where: short stacking energy: -179.548 Base-Backbone interact. energy: -2.462 local terms energy: -255.178172 where: bonds (distance) C4'-P energy: -74.302 bonds (distance) P-C4' energy: -62.953 flat angles C4'-P-C4' energy: -54.268 flat angles P-C4'-P energy: -40.208 tors. eta vs tors. theta energy: -23.447 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -550.699767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.699767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.699767 (E_RNA) where: Base-Base interactions energy: -248.917 where: short stacking energy: -148.681 Base-Backbone interact. energy: -2.254 local terms energy: -263.529403 where: bonds (distance) C4'-P energy: -62.650 bonds (distance) P-C4' energy: -74.429 flat angles C4'-P-C4' energy: -73.028 flat angles P-C4'-P energy: -27.550 tors. eta vs tors. theta energy: -25.873 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -403.385432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.385432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.385432 (E_RNA) where: Base-Base interactions energy: -142.761 where: short stacking energy: -104.292 Base-Backbone interact. energy: -0.960 local terms energy: -241.664113 where: bonds (distance) C4'-P energy: -61.985 bonds (distance) P-C4' energy: -74.917 flat angles C4'-P-C4' energy: -71.156 flat angles P-C4'-P energy: -35.546 tors. eta vs tors. theta energy: 1.939 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -319.543238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.543238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.543238 (E_RNA) where: Base-Base interactions energy: -98.038 where: short stacking energy: -63.970 Base-Backbone interact. energy: -0.822 local terms energy: -220.683472 where: bonds (distance) C4'-P energy: -65.166 bonds (distance) P-C4' energy: -86.722 flat angles C4'-P-C4' energy: -55.778 flat angles P-C4'-P energy: -33.950 tors. eta vs tors. theta energy: 20.933 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1038.358884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.358884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.358884 (E_RNA) where: Base-Base interactions energy: -665.863 where: short stacking energy: -309.956 Base-Backbone interact. energy: -0.115 local terms energy: -372.381083 where: bonds (distance) C4'-P energy: -74.263 bonds (distance) P-C4' energy: -79.668 flat angles C4'-P-C4' energy: -78.001 flat angles P-C4'-P energy: -55.216 tors. eta vs tors. theta energy: -85.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -968.177461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.177461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.377461 (E_RNA) where: Base-Base interactions energy: -511.295 where: short stacking energy: -268.384 Base-Backbone interact. energy: -0.862 local terms energy: -355.219789 where: bonds (distance) C4'-P energy: -85.808 bonds (distance) P-C4' energy: -85.160 flat angles C4'-P-C4' energy: -80.054 flat angles P-C4'-P energy: -53.158 tors. eta vs tors. theta energy: -51.040 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -923.337449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.337449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.137449 (E_RNA) where: Base-Base interactions energy: -501.195 where: short stacking energy: -272.544 Base-Backbone interact. energy: -0.216 local terms energy: -351.726493 where: bonds (distance) C4'-P energy: -79.997 bonds (distance) P-C4' energy: -77.289 flat angles C4'-P-C4' energy: -81.576 flat angles P-C4'-P energy: -53.578 tors. eta vs tors. theta energy: -59.286 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -940.378910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.378910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.778910 (E_RNA) where: Base-Base interactions energy: -529.341 where: short stacking energy: -276.364 Base-Backbone interact. energy: 3.464 local terms energy: -338.901915 where: bonds (distance) C4'-P energy: -62.853 bonds (distance) P-C4' energy: -84.391 flat angles C4'-P-C4' energy: -76.379 flat angles P-C4'-P energy: -46.202 tors. eta vs tors. theta energy: -69.077 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -888.941441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.941441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.341441 (E_RNA) where: Base-Base interactions energy: -490.206 where: short stacking energy: -261.052 Base-Backbone interact. energy: -0.420 local terms energy: -340.715455 where: bonds (distance) C4'-P energy: -76.362 bonds (distance) P-C4' energy: -76.336 flat angles C4'-P-C4' energy: -71.832 flat angles P-C4'-P energy: -49.676 tors. eta vs tors. theta energy: -66.510 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -691.482941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.482941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.082941 (E_RNA) where: Base-Base interactions energy: -343.658 where: short stacking energy: -182.632 Base-Backbone interact. energy: -1.839 local terms energy: -277.586690 where: bonds (distance) C4'-P energy: -64.292 bonds (distance) P-C4' energy: -73.355 flat angles C4'-P-C4' energy: -80.182 flat angles P-C4'-P energy: -30.881 tors. eta vs tors. theta energy: -28.877 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -660.993744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.993744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.793744 (E_RNA) where: Base-Base interactions energy: -352.406 where: short stacking energy: -167.664 Base-Backbone interact. energy: -1.049 local terms energy: -255.338591 where: bonds (distance) C4'-P energy: -55.896 bonds (distance) P-C4' energy: -74.228 flat angles C4'-P-C4' energy: -58.701 flat angles P-C4'-P energy: -41.006 tors. eta vs tors. theta energy: -25.507 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -521.394695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.394695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.594695 (E_RNA) where: Base-Base interactions energy: -248.542 where: short stacking energy: -136.096 Base-Backbone interact. energy: -2.404 local terms energy: -232.648222 where: bonds (distance) C4'-P energy: -64.575 bonds (distance) P-C4' energy: -59.392 flat angles C4'-P-C4' energy: -67.602 flat angles P-C4'-P energy: -36.287 tors. eta vs tors. theta energy: -4.792 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -450.883891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.883891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.083891 (E_RNA) where: Base-Base interactions energy: -210.594 where: short stacking energy: -105.311 Base-Backbone interact. energy: 2.262 local terms energy: -222.752161 where: bonds (distance) C4'-P energy: -62.199 bonds (distance) P-C4' energy: -73.216 flat angles C4'-P-C4' energy: -56.129 flat angles P-C4'-P energy: -31.780 tors. eta vs tors. theta energy: 0.572 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -290.826992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.826992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.826992 (E_RNA) where: Base-Base interactions energy: -86.791 where: short stacking energy: -71.717 Base-Backbone interact. energy: 2.642 local terms energy: -206.677961 where: bonds (distance) C4'-P energy: -69.050 bonds (distance) P-C4' energy: -77.073 flat angles C4'-P-C4' energy: -56.088 flat angles P-C4'-P energy: -28.099 tors. eta vs tors. theta energy: 23.632 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1032.033107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.033107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.033107 (E_RNA) where: Base-Base interactions energy: -638.139 where: short stacking energy: -297.460 Base-Backbone interact. energy: -1.744 local terms energy: -392.150683 where: bonds (distance) C4'-P energy: -86.860 bonds (distance) P-C4' energy: -84.948 flat angles C4'-P-C4' energy: -84.668 flat angles P-C4'-P energy: -59.880 tors. eta vs tors. theta energy: -75.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -982.536469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.536469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.736469 (E_RNA) where: Base-Base interactions energy: -547.744 where: short stacking energy: -276.577 Base-Backbone interact. energy: 8.452 local terms energy: -342.443979 where: bonds (distance) C4'-P energy: -69.142 bonds (distance) P-C4' energy: -81.832 flat angles C4'-P-C4' energy: -82.364 flat angles P-C4'-P energy: -56.690 tors. eta vs tors. theta energy: -52.416 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -925.717879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.717879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.117879 (E_RNA) where: Base-Base interactions energy: -493.559 where: short stacking energy: -273.543 Base-Backbone interact. energy: -2.301 local terms energy: -354.257833 where: bonds (distance) C4'-P energy: -77.433 bonds (distance) P-C4' energy: -80.787 flat angles C4'-P-C4' energy: -78.972 flat angles P-C4'-P energy: -56.203 tors. eta vs tors. theta energy: -60.863 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -950.555350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.555350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.355350 (E_RNA) where: Base-Base interactions energy: -553.840 where: short stacking energy: -275.703 Base-Backbone interact. energy: 0.334 local terms energy: -326.849268 where: bonds (distance) C4'-P energy: -75.724 bonds (distance) P-C4' energy: -77.882 flat angles C4'-P-C4' energy: -68.144 flat angles P-C4'-P energy: -41.235 tors. eta vs tors. theta energy: -63.864 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -891.642589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.642589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.042589 (E_RNA) where: Base-Base interactions energy: -519.154 where: short stacking energy: -260.857 Base-Backbone interact. energy: -2.502 local terms energy: -312.386335 where: bonds (distance) C4'-P energy: -69.620 bonds (distance) P-C4' energy: -63.946 flat angles C4'-P-C4' energy: -87.868 flat angles P-C4'-P energy: -37.548 tors. eta vs tors. theta energy: -53.404 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -703.103809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.103809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.503809 (E_RNA) where: Base-Base interactions energy: -356.777 where: short stacking energy: -191.041 Base-Backbone interact. energy: 1.708 local terms energy: -299.434016 where: bonds (distance) C4'-P energy: -68.862 bonds (distance) P-C4' energy: -86.476 flat angles C4'-P-C4' energy: -73.530 flat angles P-C4'-P energy: -48.127 tors. eta vs tors. theta energy: -22.439 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -658.915700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.915700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.315700 (E_RNA) where: Base-Base interactions energy: -328.949 where: short stacking energy: -181.426 Base-Backbone interact. energy: -2.724 local terms energy: -251.642833 where: bonds (distance) C4'-P energy: -78.017 bonds (distance) P-C4' energy: -58.003 flat angles C4'-P-C4' energy: -57.339 flat angles P-C4'-P energy: -33.080 tors. eta vs tors. theta energy: -25.203 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -520.743905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.743905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.743905 (E_RNA) where: Base-Base interactions energy: -222.192 where: short stacking energy: -134.030 Base-Backbone interact. energy: -0.714 local terms energy: -261.837875 where: bonds (distance) C4'-P energy: -73.914 bonds (distance) P-C4' energy: -70.426 flat angles C4'-P-C4' energy: -59.693 flat angles P-C4'-P energy: -45.228 tors. eta vs tors. theta energy: -12.577 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -429.784730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.784730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.784730 (E_RNA) where: Base-Base interactions energy: -180.367 where: short stacking energy: -113.308 Base-Backbone interact. energy: -1.046 local terms energy: -230.372540 where: bonds (distance) C4'-P energy: -45.771 bonds (distance) P-C4' energy: -77.767 flat angles C4'-P-C4' energy: -74.729 flat angles P-C4'-P energy: -37.012 tors. eta vs tors. theta energy: 4.905 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -300.286172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.286172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.286172 (E_RNA) where: Base-Base interactions energy: -74.311 where: short stacking energy: -67.748 Base-Backbone interact. energy: -0.565 local terms energy: -225.410720 where: bonds (distance) C4'-P energy: -66.842 bonds (distance) P-C4' energy: -65.990 flat angles C4'-P-C4' energy: -64.137 flat angles P-C4'-P energy: -45.115 tors. eta vs tors. theta energy: 16.673 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1025.145517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.145517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.145517 (E_RNA) where: Base-Base interactions energy: -637.975 where: short stacking energy: -312.627 Base-Backbone interact. energy: -2.323 local terms energy: -384.848034 where: bonds (distance) C4'-P energy: -76.781 bonds (distance) P-C4' energy: -85.546 flat angles C4'-P-C4' energy: -92.624 flat angles P-C4'-P energy: -54.802 tors. eta vs tors. theta energy: -75.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -991.950884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.950884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.550884 (E_RNA) where: Base-Base interactions energy: -545.019 where: short stacking energy: -255.996 Base-Backbone interact. energy: -0.540 local terms energy: -341.991295 where: bonds (distance) C4'-P energy: -81.345 bonds (distance) P-C4' energy: -73.078 flat angles C4'-P-C4' energy: -82.638 flat angles P-C4'-P energy: -51.933 tors. eta vs tors. theta energy: -52.997 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -952.575332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.575332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.575332 (E_RNA) where: Base-Base interactions energy: -533.679 where: short stacking energy: -284.686 Base-Backbone interact. energy: 0.556 local terms energy: -347.452654 where: bonds (distance) C4'-P energy: -81.401 bonds (distance) P-C4' energy: -73.766 flat angles C4'-P-C4' energy: -78.149 flat angles P-C4'-P energy: -48.612 tors. eta vs tors. theta energy: -65.525 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -863.408483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.408483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.208483 (E_RNA) where: Base-Base interactions energy: -439.853 where: short stacking energy: -241.484 Base-Backbone interact. energy: 0.762 local terms energy: -354.117446 where: bonds (distance) C4'-P energy: -77.972 bonds (distance) P-C4' energy: -88.149 flat angles C4'-P-C4' energy: -83.261 flat angles P-C4'-P energy: -49.196 tors. eta vs tors. theta energy: -55.541 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -883.805979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.805979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.605979 (E_RNA) where: Base-Base interactions energy: -535.663 where: short stacking energy: -264.812 Base-Backbone interact. energy: -1.387 local terms energy: -294.555916 where: bonds (distance) C4'-P energy: -61.437 bonds (distance) P-C4' energy: -58.388 flat angles C4'-P-C4' energy: -81.894 flat angles P-C4'-P energy: -40.405 tors. eta vs tors. theta energy: -52.432 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -687.201114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.201114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.601114 (E_RNA) where: Base-Base interactions energy: -355.184 where: short stacking energy: -186.778 Base-Backbone interact. energy: 1.206 local terms energy: -275.623520 where: bonds (distance) C4'-P energy: -66.854 bonds (distance) P-C4' energy: -69.132 flat angles C4'-P-C4' energy: -67.161 flat angles P-C4'-P energy: -52.180 tors. eta vs tors. theta energy: -20.296 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -662.232516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.232516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.232516 (E_RNA) where: Base-Base interactions energy: -314.956 where: short stacking energy: -167.403 Base-Backbone interact. energy: 0.419 local terms energy: -275.695552 where: bonds (distance) C4'-P energy: -69.060 bonds (distance) P-C4' energy: -77.257 flat angles C4'-P-C4' energy: -55.163 flat angles P-C4'-P energy: -51.178 tors. eta vs tors. theta energy: -23.037 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -523.223295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.223295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.423295 (E_RNA) where: Base-Base interactions energy: -244.814 where: short stacking energy: -138.106 Base-Backbone interact. energy: -1.899 local terms energy: -238.710093 where: bonds (distance) C4'-P energy: -59.440 bonds (distance) P-C4' energy: -74.862 flat angles C4'-P-C4' energy: -63.413 flat angles P-C4'-P energy: -29.532 tors. eta vs tors. theta energy: -11.463 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -489.026855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.026855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.626855 (E_RNA) where: Base-Base interactions energy: -235.433 where: short stacking energy: -118.966 Base-Backbone interact. energy: -1.108 local terms energy: -229.086147 where: bonds (distance) C4'-P energy: -56.023 bonds (distance) P-C4' energy: -69.939 flat angles C4'-P-C4' energy: -59.260 flat angles P-C4'-P energy: -34.725 tors. eta vs tors. theta energy: -9.138 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -317.412930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.412930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.412930 (E_RNA) where: Base-Base interactions energy: -108.937 where: short stacking energy: -82.560 Base-Backbone interact. energy: -0.711 local terms energy: -207.765241 where: bonds (distance) C4'-P energy: -63.165 bonds (distance) P-C4' energy: -59.975 flat angles C4'-P-C4' energy: -64.298 flat angles P-C4'-P energy: -33.165 tors. eta vs tors. theta energy: 12.838 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1021.863438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.863438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.863438 (E_RNA) where: Base-Base interactions energy: -655.327 where: short stacking energy: -307.796 Base-Backbone interact. energy: -0.623 local terms energy: -365.912958 where: bonds (distance) C4'-P energy: -84.180 bonds (distance) P-C4' energy: -73.679 flat angles C4'-P-C4' energy: -86.152 flat angles P-C4'-P energy: -44.625 tors. eta vs tors. theta energy: -77.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1013.337782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.337782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.737782 (E_RNA) where: Base-Base interactions energy: -571.053 where: short stacking energy: -278.185 Base-Backbone interact. energy: 1.150 local terms energy: -340.834774 where: bonds (distance) C4'-P energy: -72.122 bonds (distance) P-C4' energy: -67.982 flat angles C4'-P-C4' energy: -88.213 flat angles P-C4'-P energy: -52.965 tors. eta vs tors. theta energy: -59.552 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -920.161939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.161939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.161939 (E_RNA) where: Base-Base interactions energy: -506.566 where: short stacking energy: -263.283 Base-Backbone interact. energy: 0.177 local terms energy: -341.773879 where: bonds (distance) C4'-P energy: -80.199 bonds (distance) P-C4' energy: -80.268 flat angles C4'-P-C4' energy: -88.633 flat angles P-C4'-P energy: -31.609 tors. eta vs tors. theta energy: -61.066 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -889.830933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.830933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.830933 (E_RNA) where: Base-Base interactions energy: -498.587 where: short stacking energy: -247.564 Base-Backbone interact. energy: -2.210 local terms energy: -335.033907 where: bonds (distance) C4'-P energy: -72.509 bonds (distance) P-C4' energy: -70.440 flat angles C4'-P-C4' energy: -82.840 flat angles P-C4'-P energy: -51.893 tors. eta vs tors. theta energy: -57.352 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -817.876953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.876953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.476953 (E_RNA) where: Base-Base interactions energy: -420.340 where: short stacking energy: -232.805 Base-Backbone interact. energy: 1.173 local terms energy: -330.309482 where: bonds (distance) C4'-P energy: -69.265 bonds (distance) P-C4' energy: -87.399 flat angles C4'-P-C4' energy: -64.623 flat angles P-C4'-P energy: -53.440 tors. eta vs tors. theta energy: -55.582 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -716.591743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.591743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.991743 (E_RNA) where: Base-Base interactions energy: -374.533 where: short stacking energy: -177.831 Base-Backbone interact. energy: 0.246 local terms energy: -293.704709 where: bonds (distance) C4'-P energy: -66.578 bonds (distance) P-C4' energy: -75.229 flat angles C4'-P-C4' energy: -68.339 flat angles P-C4'-P energy: -62.583 tors. eta vs tors. theta energy: -20.976 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -698.830992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.830992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.830992 (E_RNA) where: Base-Base interactions energy: -332.708 where: short stacking energy: -184.917 Base-Backbone interact. energy: 4.809 local terms energy: -289.931212 where: bonds (distance) C4'-P energy: -62.531 bonds (distance) P-C4' energy: -72.223 flat angles C4'-P-C4' energy: -75.024 flat angles P-C4'-P energy: -43.005 tors. eta vs tors. theta energy: -37.147 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -495.566479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.566479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.566479 (E_RNA) where: Base-Base interactions energy: -241.102 where: short stacking energy: -125.849 Base-Backbone interact. energy: 2.665 local terms energy: -230.129599 where: bonds (distance) C4'-P energy: -57.620 bonds (distance) P-C4' energy: -83.746 flat angles C4'-P-C4' energy: -58.482 flat angles P-C4'-P energy: -32.064 tors. eta vs tors. theta energy: 1.783 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -512.253265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.253265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.253265 (E_RNA) where: Base-Base interactions energy: -218.307 where: short stacking energy: -131.399 Base-Backbone interact. energy: -1.374 local terms energy: -256.572238 where: bonds (distance) C4'-P energy: -63.326 bonds (distance) P-C4' energy: -85.118 flat angles C4'-P-C4' energy: -66.467 flat angles P-C4'-P energy: -46.542 tors. eta vs tors. theta energy: 4.882 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -326.466462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.466462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.466462 (E_RNA) where: Base-Base interactions energy: -131.699 where: short stacking energy: -95.569 Base-Backbone interact. energy: -1.418 local terms energy: -193.349581 where: bonds (distance) C4'-P energy: -54.338 bonds (distance) P-C4' energy: -54.031 flat angles C4'-P-C4' energy: -50.644 flat angles P-C4'-P energy: -39.499 tors. eta vs tors. theta energy: 5.163 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1012.829640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.829640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.829640 (E_RNA) where: Base-Base interactions energy: -638.861 where: short stacking energy: -288.407 Base-Backbone interact. energy: -3.038 local terms energy: -370.931272 where: bonds (distance) C4'-P energy: -80.757 bonds (distance) P-C4' energy: -83.885 flat angles C4'-P-C4' energy: -75.905 flat angles P-C4'-P energy: -60.063 tors. eta vs tors. theta energy: -70.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1001.575427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.575427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.775427 (E_RNA) where: Base-Base interactions energy: -555.586 where: short stacking energy: -244.151 Base-Backbone interact. energy: -2.780 local terms energy: -342.409786 where: bonds (distance) C4'-P energy: -80.694 bonds (distance) P-C4' energy: -83.849 flat angles C4'-P-C4' energy: -70.832 flat angles P-C4'-P energy: -49.958 tors. eta vs tors. theta energy: -57.076 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -901.264782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.264782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.264782 (E_RNA) where: Base-Base interactions energy: -479.788 where: short stacking energy: -240.912 Base-Backbone interact. energy: -0.019 local terms energy: -349.457872 where: bonds (distance) C4'-P energy: -77.264 bonds (distance) P-C4' energy: -75.838 flat angles C4'-P-C4' energy: -77.103 flat angles P-C4'-P energy: -55.370 tors. eta vs tors. theta energy: -63.884 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -931.779276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.779276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.779276 (E_RNA) where: Base-Base interactions energy: -550.289 where: short stacking energy: -253.584 Base-Backbone interact. energy: -1.972 local terms energy: -316.518965 where: bonds (distance) C4'-P energy: -75.037 bonds (distance) P-C4' energy: -73.856 flat angles C4'-P-C4' energy: -75.660 flat angles P-C4'-P energy: -36.893 tors. eta vs tors. theta energy: -55.074 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -828.525125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.525125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.725125 (E_RNA) where: Base-Base interactions energy: -424.923 where: short stacking energy: -232.134 Base-Backbone interact. energy: -0.441 local terms energy: -329.361126 where: bonds (distance) C4'-P energy: -74.675 bonds (distance) P-C4' energy: -71.840 flat angles C4'-P-C4' energy: -86.302 flat angles P-C4'-P energy: -45.330 tors. eta vs tors. theta energy: -51.214 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -720.482872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.482872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.682872 (E_RNA) where: Base-Base interactions energy: -398.937 where: short stacking energy: -210.272 Base-Backbone interact. energy: 1.744 local terms energy: -267.490165 where: bonds (distance) C4'-P energy: -61.447 bonds (distance) P-C4' energy: -70.003 flat angles C4'-P-C4' energy: -72.759 flat angles P-C4'-P energy: -38.044 tors. eta vs tors. theta energy: -25.237 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -700.122449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.122449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -619.122449 (E_RNA) where: Base-Base interactions energy: -339.613 where: short stacking energy: -186.470 Base-Backbone interact. energy: 1.229 local terms energy: -280.738579 where: bonds (distance) C4'-P energy: -75.277 bonds (distance) P-C4' energy: -49.440 flat angles C4'-P-C4' energy: -76.907 flat angles P-C4'-P energy: -38.446 tors. eta vs tors. theta energy: -40.669 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -495.276515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.276515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.276515 (E_RNA) where: Base-Base interactions energy: -203.434 where: short stacking energy: -133.420 Base-Backbone interact. energy: -3.562 local terms energy: -270.280347 where: bonds (distance) C4'-P energy: -75.995 bonds (distance) P-C4' energy: -68.132 flat angles C4'-P-C4' energy: -74.769 flat angles P-C4'-P energy: -38.889 tors. eta vs tors. theta energy: -12.496 Dist. restrs. and SS energy: -18.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -520.245489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.245489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.845489 (E_RNA) where: Base-Base interactions energy: -232.807 where: short stacking energy: -145.334 Base-Backbone interact. energy: -1.461 local terms energy: -253.577864 where: bonds (distance) C4'-P energy: -53.603 bonds (distance) P-C4' energy: -69.781 flat angles C4'-P-C4' energy: -66.640 flat angles P-C4'-P energy: -44.071 tors. eta vs tors. theta energy: -19.482 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -316.350895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.350895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.350895 (E_RNA) where: Base-Base interactions energy: -110.623 where: short stacking energy: -90.286 Base-Backbone interact. energy: -3.622 local terms energy: -202.106843 where: bonds (distance) C4'-P energy: -55.802 bonds (distance) P-C4' energy: -68.410 flat angles C4'-P-C4' energy: -46.442 flat angles P-C4'-P energy: -40.353 tors. eta vs tors. theta energy: 8.900 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1009.754958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.754958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.754958 (E_RNA) where: Base-Base interactions energy: -641.605 where: short stacking energy: -307.892 Base-Backbone interact. energy: -2.096 local terms energy: -366.054135 where: bonds (distance) C4'-P energy: -75.609 bonds (distance) P-C4' energy: -80.026 flat angles C4'-P-C4' energy: -86.948 flat angles P-C4'-P energy: -59.290 tors. eta vs tors. theta energy: -64.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -988.284316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.284316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.484316 (E_RNA) where: Base-Base interactions energy: -564.386 where: short stacking energy: -318.520 Base-Backbone interact. energy: 0.624 local terms energy: -350.722889 where: bonds (distance) C4'-P energy: -70.359 bonds (distance) P-C4' energy: -76.574 flat angles C4'-P-C4' energy: -78.701 flat angles P-C4'-P energy: -46.712 tors. eta vs tors. theta energy: -78.377 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -934.125235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.125235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.125235 (E_RNA) where: Base-Base interactions energy: -479.791 where: short stacking energy: -234.706 Base-Backbone interact. energy: -4.105 local terms energy: -342.229680 where: bonds (distance) C4'-P energy: -84.169 bonds (distance) P-C4' energy: -77.915 flat angles C4'-P-C4' energy: -61.237 flat angles P-C4'-P energy: -64.641 tors. eta vs tors. theta energy: -54.268 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -932.083414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.083414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.483414 (E_RNA) where: Base-Base interactions energy: -534.414 where: short stacking energy: -266.691 Base-Backbone interact. energy: 1.483 local terms energy: -341.552309 where: bonds (distance) C4'-P energy: -80.088 bonds (distance) P-C4' energy: -75.314 flat angles C4'-P-C4' energy: -83.808 flat angles P-C4'-P energy: -46.412 tors. eta vs tors. theta energy: -55.931 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -804.424481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.424481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.424481 (E_RNA) where: Base-Base interactions energy: -408.441 where: short stacking energy: -219.012 Base-Backbone interact. energy: -1.200 local terms energy: -322.784191 where: bonds (distance) C4'-P energy: -77.932 bonds (distance) P-C4' energy: -70.265 flat angles C4'-P-C4' energy: -72.428 flat angles P-C4'-P energy: -53.273 tors. eta vs tors. theta energy: -48.886 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -728.152830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.152830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.152830 (E_RNA) where: Base-Base interactions energy: -391.753 where: short stacking energy: -202.340 Base-Backbone interact. energy: -1.006 local terms energy: -281.394261 where: bonds (distance) C4'-P energy: -71.832 bonds (distance) P-C4' energy: -64.628 flat angles C4'-P-C4' energy: -65.894 flat angles P-C4'-P energy: -49.554 tors. eta vs tors. theta energy: -29.487 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -654.912382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.912382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.912382 (E_RNA) where: Base-Base interactions energy: -326.329 where: short stacking energy: -182.417 Base-Backbone interact. energy: -0.950 local terms energy: -255.633301 where: bonds (distance) C4'-P energy: -48.648 bonds (distance) P-C4' energy: -74.149 flat angles C4'-P-C4' energy: -69.666 flat angles P-C4'-P energy: -38.107 tors. eta vs tors. theta energy: -25.064 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -519.172346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.172346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.172346 (E_RNA) where: Base-Base interactions energy: -248.746 where: short stacking energy: -152.195 Base-Backbone interact. energy: -1.102 local terms energy: -233.324101 where: bonds (distance) C4'-P energy: -59.644 bonds (distance) P-C4' energy: -77.066 flat angles C4'-P-C4' energy: -55.789 flat angles P-C4'-P energy: -41.688 tors. eta vs tors. theta energy: 0.863 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -486.929279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.929279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.529279 (E_RNA) where: Base-Base interactions energy: -226.943 where: short stacking energy: -147.695 Base-Backbone interact. energy: 1.950 local terms energy: -238.536260 where: bonds (distance) C4'-P energy: -58.686 bonds (distance) P-C4' energy: -72.327 flat angles C4'-P-C4' energy: -62.594 flat angles P-C4'-P energy: -22.038 tors. eta vs tors. theta energy: -22.891 Dist. restrs. and SS energy: -23.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -339.095528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.095528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.095528 (E_RNA) where: Base-Base interactions energy: -127.237 where: short stacking energy: -95.961 Base-Backbone interact. energy: 0.978 local terms energy: -212.836054 where: bonds (distance) C4'-P energy: -57.664 bonds (distance) P-C4' energy: -78.264 flat angles C4'-P-C4' energy: -64.355 flat angles P-C4'-P energy: -24.633 tors. eta vs tors. theta energy: 12.080 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1029.490785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.490785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.490785 (E_RNA) where: Base-Base interactions energy: -646.713 where: short stacking energy: -290.087 Base-Backbone interact. energy: -2.212 local terms energy: -380.565139 where: bonds (distance) C4'-P energy: -79.335 bonds (distance) P-C4' energy: -82.527 flat angles C4'-P-C4' energy: -89.672 flat angles P-C4'-P energy: -49.630 tors. eta vs tors. theta energy: -79.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -972.510265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.510265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.310265 (E_RNA) where: Base-Base interactions energy: -533.490 where: short stacking energy: -285.019 Base-Backbone interact. energy: -1.154 local terms energy: -367.666252 where: bonds (distance) C4'-P energy: -79.413 bonds (distance) P-C4' energy: -80.334 flat angles C4'-P-C4' energy: -87.099 flat angles P-C4'-P energy: -61.814 tors. eta vs tors. theta energy: -59.006 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1012.363703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.363703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.563703 (E_RNA) where: Base-Base interactions energy: -591.285 where: short stacking energy: -291.274 Base-Backbone interact. energy: 1.080 local terms energy: -357.358520 where: bonds (distance) C4'-P energy: -76.948 bonds (distance) P-C4' energy: -71.571 flat angles C4'-P-C4' energy: -86.072 flat angles P-C4'-P energy: -48.587 tors. eta vs tors. theta energy: -74.180 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -899.139123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -899.139123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.939123 (E_RNA) where: Base-Base interactions energy: -475.364 where: short stacking energy: -225.329 Base-Backbone interact. energy: -0.898 local terms energy: -316.677197 where: bonds (distance) C4'-P energy: -73.841 bonds (distance) P-C4' energy: -76.289 flat angles C4'-P-C4' energy: -65.232 flat angles P-C4'-P energy: -53.442 tors. eta vs tors. theta energy: -47.873 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -812.423836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.423836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.023836 (E_RNA) where: Base-Base interactions energy: -437.937 where: short stacking energy: -226.361 Base-Backbone interact. energy: -0.286 local terms energy: -305.801297 where: bonds (distance) C4'-P energy: -71.040 bonds (distance) P-C4' energy: -65.635 flat angles C4'-P-C4' energy: -66.591 flat angles P-C4'-P energy: -45.035 tors. eta vs tors. theta energy: -57.499 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -744.820726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.820726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.020726 (E_RNA) where: Base-Base interactions energy: -395.092 where: short stacking energy: -192.319 Base-Backbone interact. energy: -1.566 local terms energy: -292.362841 where: bonds (distance) C4'-P energy: -78.534 bonds (distance) P-C4' energy: -80.173 flat angles C4'-P-C4' energy: -74.750 flat angles P-C4'-P energy: -32.322 tors. eta vs tors. theta energy: -26.584 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -628.049772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.049772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.449772 (E_RNA) where: Base-Base interactions energy: -274.426 where: short stacking energy: -151.835 Base-Backbone interact. energy: 1.876 local terms energy: -279.899423 where: bonds (distance) C4'-P energy: -71.215 bonds (distance) P-C4' energy: -64.729 flat angles C4'-P-C4' energy: -80.207 flat angles P-C4'-P energy: -49.417 tors. eta vs tors. theta energy: -14.331 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -519.142196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.142196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.142196 (E_RNA) where: Base-Base interactions energy: -226.524 where: short stacking energy: -136.640 Base-Backbone interact. energy: 0.277 local terms energy: -256.895306 where: bonds (distance) C4'-P energy: -68.070 bonds (distance) P-C4' energy: -76.830 flat angles C4'-P-C4' energy: -70.953 flat angles P-C4'-P energy: -32.529 tors. eta vs tors. theta energy: -8.512 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -524.628547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.628547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.028547 (E_RNA) where: Base-Base interactions energy: -244.556 where: short stacking energy: -151.169 Base-Backbone interact. energy: 2.510 local terms energy: -251.982147 where: bonds (distance) C4'-P energy: -64.892 bonds (distance) P-C4' energy: -65.165 flat angles C4'-P-C4' energy: -63.182 flat angles P-C4'-P energy: -39.415 tors. eta vs tors. theta energy: -19.328 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -326.850938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.850938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.850938 (E_RNA) where: Base-Base interactions energy: -131.442 where: short stacking energy: -94.706 Base-Backbone interact. energy: -0.913 local terms energy: -194.495083 where: bonds (distance) C4'-P energy: -56.693 bonds (distance) P-C4' energy: -58.536 flat angles C4'-P-C4' energy: -70.610 flat angles P-C4'-P energy: -16.136 tors. eta vs tors. theta energy: 7.480 Dist. restrs. and SS energy: -0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1051.297002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.297002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.297002 (E_RNA) where: Base-Base interactions energy: -679.432 where: short stacking energy: -307.879 Base-Backbone interact. energy: -2.022 local terms energy: -369.842398 where: bonds (distance) C4'-P energy: -69.572 bonds (distance) P-C4' energy: -84.133 flat angles C4'-P-C4' energy: -84.014 flat angles P-C4'-P energy: -53.888 tors. eta vs tors. theta energy: -78.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1050.535183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.535183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.935183 (E_RNA) where: Base-Base interactions energy: -618.686 where: short stacking energy: -315.288 Base-Backbone interact. energy: 0.252 local terms energy: -365.501094 where: bonds (distance) C4'-P energy: -76.536 bonds (distance) P-C4' energy: -72.804 flat angles C4'-P-C4' energy: -83.421 flat angles P-C4'-P energy: -55.295 tors. eta vs tors. theta energy: -77.444 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -973.802900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.802900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.002900 (E_RNA) where: Base-Base interactions energy: -544.347 where: short stacking energy: -288.117 Base-Backbone interact. energy: 0.613 local terms energy: -356.268689 where: bonds (distance) C4'-P energy: -76.392 bonds (distance) P-C4' energy: -87.195 flat angles C4'-P-C4' energy: -81.170 flat angles P-C4'-P energy: -44.929 tors. eta vs tors. theta energy: -66.581 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -878.008051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.008051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.808051 (E_RNA) where: Base-Base interactions energy: -452.421 where: short stacking energy: -217.462 Base-Backbone interact. energy: -3.399 local terms energy: -315.988403 where: bonds (distance) C4'-P energy: -82.547 bonds (distance) P-C4' energy: -69.595 flat angles C4'-P-C4' energy: -72.002 flat angles P-C4'-P energy: -39.198 tors. eta vs tors. theta energy: -52.647 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -817.367353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.367353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.167353 (E_RNA) where: Base-Base interactions energy: -427.625 where: short stacking energy: -219.154 Base-Backbone interact. energy: -1.831 local terms energy: -317.711194 where: bonds (distance) C4'-P energy: -73.286 bonds (distance) P-C4' energy: -79.467 flat angles C4'-P-C4' energy: -69.123 flat angles P-C4'-P energy: -50.589 tors. eta vs tors. theta energy: -45.247 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -667.841537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -667.841537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.441537 (E_RNA) where: Base-Base interactions energy: -290.382 where: short stacking energy: -164.498 Base-Backbone interact. energy: -1.153 local terms energy: -298.905824 where: bonds (distance) C4'-P energy: -61.191 bonds (distance) P-C4' energy: -88.457 flat angles C4'-P-C4' energy: -77.350 flat angles P-C4'-P energy: -45.682 tors. eta vs tors. theta energy: -26.226 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -708.104811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.104811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.304811 (E_RNA) where: Base-Base interactions energy: -402.321 where: short stacking energy: -194.934 Base-Backbone interact. energy: 4.792 local terms energy: -254.776283 where: bonds (distance) C4'-P energy: -62.475 bonds (distance) P-C4' energy: -71.817 flat angles C4'-P-C4' energy: -58.714 flat angles P-C4'-P energy: -42.304 tors. eta vs tors. theta energy: -19.467 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -557.820987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.820987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.220987 (E_RNA) where: Base-Base interactions energy: -260.495 where: short stacking energy: -136.683 Base-Backbone interact. energy: -1.155 local terms energy: -265.570980 where: bonds (distance) C4'-P energy: -64.985 bonds (distance) P-C4' energy: -80.222 flat angles C4'-P-C4' energy: -61.590 flat angles P-C4'-P energy: -51.044 tors. eta vs tors. theta energy: -7.730 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -480.843178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.843178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.843178 (E_RNA) where: Base-Base interactions energy: -212.618 where: short stacking energy: -118.081 Base-Backbone interact. energy: -0.390 local terms energy: -231.834980 where: bonds (distance) C4'-P energy: -59.454 bonds (distance) P-C4' energy: -70.892 flat angles C4'-P-C4' energy: -55.351 flat angles P-C4'-P energy: -42.529 tors. eta vs tors. theta energy: -3.608 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -360.638167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.638167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.038167 (E_RNA) where: Base-Base interactions energy: -132.365 where: short stacking energy: -88.127 Base-Backbone interact. energy: -0.701 local terms energy: -223.971651 where: bonds (distance) C4'-P energy: -70.306 bonds (distance) P-C4' energy: -61.997 flat angles C4'-P-C4' energy: -60.692 flat angles P-C4'-P energy: -50.747 tors. eta vs tors. theta energy: 19.770 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1091.261075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.261075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.661075 (E_RNA) where: Base-Base interactions energy: -622.204 where: short stacking energy: -310.365 Base-Backbone interact. energy: 1.092 local terms energy: -403.548972 where: bonds (distance) C4'-P energy: -85.683 bonds (distance) P-C4' energy: -92.390 flat angles C4'-P-C4' energy: -84.398 flat angles P-C4'-P energy: -64.148 tors. eta vs tors. theta energy: -76.930 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1045.292971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.292971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.292971 (E_RNA) where: Base-Base interactions energy: -653.711 where: short stacking energy: -305.978 Base-Backbone interact. energy: -4.192 local terms energy: -387.390014 where: bonds (distance) C4'-P energy: -67.115 bonds (distance) P-C4' energy: -89.511 flat angles C4'-P-C4' energy: -85.552 flat angles P-C4'-P energy: -61.204 tors. eta vs tors. theta energy: -84.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -898.592637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.592637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.792637 (E_RNA) where: Base-Base interactions energy: -482.174 where: short stacking energy: -249.517 Base-Backbone interact. energy: 3.666 local terms energy: -319.284800 where: bonds (distance) C4'-P energy: -73.343 bonds (distance) P-C4' energy: -80.635 flat angles C4'-P-C4' energy: -63.883 flat angles P-C4'-P energy: -44.364 tors. eta vs tors. theta energy: -57.059 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -937.771960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.771960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.971960 (E_RNA) where: Base-Base interactions energy: -500.729 where: short stacking energy: -270.323 Base-Backbone interact. energy: -2.043 local terms energy: -361.200039 where: bonds (distance) C4'-P energy: -70.603 bonds (distance) P-C4' energy: -87.058 flat angles C4'-P-C4' energy: -85.115 flat angles P-C4'-P energy: -46.279 tors. eta vs tors. theta energy: -72.145 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -771.703948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.703948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.303948 (E_RNA) where: Base-Base interactions energy: -428.426 where: short stacking energy: -208.971 Base-Backbone interact. energy: -0.998 local terms energy: -273.879787 where: bonds (distance) C4'-P energy: -58.856 bonds (distance) P-C4' energy: -66.942 flat angles C4'-P-C4' energy: -57.628 flat angles P-C4'-P energy: -43.343 tors. eta vs tors. theta energy: -47.110 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -671.254400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.254400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.054400 (E_RNA) where: Base-Base interactions energy: -326.909 where: short stacking energy: -172.628 Base-Backbone interact. energy: -0.340 local terms energy: -255.805399 where: bonds (distance) C4'-P energy: -61.997 bonds (distance) P-C4' energy: -63.940 flat angles C4'-P-C4' energy: -71.858 flat angles P-C4'-P energy: -46.446 tors. eta vs tors. theta energy: -11.564 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -763.306461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.306461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.506461 (E_RNA) where: Base-Base interactions energy: -398.378 where: short stacking energy: -209.366 Base-Backbone interact. energy: -2.799 local terms energy: -306.330185 where: bonds (distance) C4'-P energy: -70.121 bonds (distance) P-C4' energy: -76.338 flat angles C4'-P-C4' energy: -79.355 flat angles P-C4'-P energy: -41.084 tors. eta vs tors. theta energy: -39.432 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -532.334421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.334421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.934421 (E_RNA) where: Base-Base interactions energy: -234.022 where: short stacking energy: -149.549 Base-Backbone interact. energy: -2.234 local terms energy: -263.678513 where: bonds (distance) C4'-P energy: -75.775 bonds (distance) P-C4' energy: -68.438 flat angles C4'-P-C4' energy: -67.660 flat angles P-C4'-P energy: -34.319 tors. eta vs tors. theta energy: -17.487 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -514.203077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.203077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.403077 (E_RNA) where: Base-Base interactions energy: -248.825 where: short stacking energy: -153.202 Base-Backbone interact. energy: -0.745 local terms energy: -226.833177 where: bonds (distance) C4'-P energy: -57.097 bonds (distance) P-C4' energy: -77.469 flat angles C4'-P-C4' energy: -53.814 flat angles P-C4'-P energy: -30.378 tors. eta vs tors. theta energy: -8.074 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -356.899807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.899807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.699807 (E_RNA) where: Base-Base interactions energy: -126.438 where: short stacking energy: -78.845 Base-Backbone interact. energy: 0.941 local terms energy: -224.203040 where: bonds (distance) C4'-P energy: -65.083 bonds (distance) P-C4' energy: -76.479 flat angles C4'-P-C4' energy: -62.347 flat angles P-C4'-P energy: -38.207 tors. eta vs tors. theta energy: 17.912 Dist. restrs. and SS energy: -7.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1073.713897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.713897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.513897 (E_RNA) where: Base-Base interactions energy: -634.541 where: short stacking energy: -322.844 Base-Backbone interact. energy: -0.841 local terms energy: -377.131933 where: bonds (distance) C4'-P energy: -82.768 bonds (distance) P-C4' energy: -80.849 flat angles C4'-P-C4' energy: -70.950 flat angles P-C4'-P energy: -65.289 tors. eta vs tors. theta energy: -77.277 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1023.806993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.806993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.806993 (E_RNA) where: Base-Base interactions energy: -649.784 where: short stacking energy: -304.362 Base-Backbone interact. energy: 0.467 local terms energy: -374.489702 where: bonds (distance) C4'-P energy: -77.365 bonds (distance) P-C4' energy: -80.226 flat angles C4'-P-C4' energy: -82.417 flat angles P-C4'-P energy: -46.773 tors. eta vs tors. theta energy: -87.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -889.285470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.285470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.085470 (E_RNA) where: Base-Base interactions energy: -464.255 where: short stacking energy: -236.535 Base-Backbone interact. energy: -2.024 local terms energy: -316.806210 where: bonds (distance) C4'-P energy: -69.186 bonds (distance) P-C4' energy: -81.900 flat angles C4'-P-C4' energy: -66.249 flat angles P-C4'-P energy: -56.608 tors. eta vs tors. theta energy: -42.864 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -922.955601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.955601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -854.555601 (E_RNA) where: Base-Base interactions energy: -521.340 where: short stacking energy: -275.430 Base-Backbone interact. energy: 0.112 local terms energy: -333.327811 where: bonds (distance) C4'-P energy: -69.991 bonds (distance) P-C4' energy: -79.224 flat angles C4'-P-C4' energy: -78.968 flat angles P-C4'-P energy: -41.517 tors. eta vs tors. theta energy: -63.627 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -799.341300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.341300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.141300 (E_RNA) where: Base-Base interactions energy: -422.115 where: short stacking energy: -230.782 Base-Backbone interact. energy: 2.884 local terms energy: -309.911052 where: bonds (distance) C4'-P energy: -63.423 bonds (distance) P-C4' energy: -71.630 flat angles C4'-P-C4' energy: -78.038 flat angles P-C4'-P energy: -48.940 tors. eta vs tors. theta energy: -47.881 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -737.404579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.404579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.604579 (E_RNA) where: Base-Base interactions energy: -381.212 where: short stacking energy: -203.987 Base-Backbone interact. energy: -3.266 local terms energy: -297.125886 where: bonds (distance) C4'-P energy: -75.414 bonds (distance) P-C4' energy: -77.330 flat angles C4'-P-C4' energy: -66.525 flat angles P-C4'-P energy: -43.024 tors. eta vs tors. theta energy: -34.832 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -700.045232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.045232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.445232 (E_RNA) where: Base-Base interactions energy: -341.063 where: short stacking energy: -162.630 Base-Backbone interact. energy: 0.615 local terms energy: -274.997198 where: bonds (distance) C4'-P energy: -62.532 bonds (distance) P-C4' energy: -75.949 flat angles C4'-P-C4' energy: -79.711 flat angles P-C4'-P energy: -42.802 tors. eta vs tors. theta energy: -14.003 Dist. restrs. and SS energy: -84.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -521.179605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.179605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.379605 (E_RNA) where: Base-Base interactions energy: -236.058 where: short stacking energy: -150.463 Base-Backbone interact. energy: -0.178 local terms energy: -247.143957 where: bonds (distance) C4'-P energy: -71.945 bonds (distance) P-C4' energy: -48.895 flat angles C4'-P-C4' energy: -71.727 flat angles P-C4'-P energy: -42.700 tors. eta vs tors. theta energy: -11.877 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -526.287437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.287437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.087437 (E_RNA) where: Base-Base interactions energy: -239.251 where: short stacking energy: -150.050 Base-Backbone interact. energy: -2.092 local terms energy: -250.744619 where: bonds (distance) C4'-P energy: -53.309 bonds (distance) P-C4' energy: -74.745 flat angles C4'-P-C4' energy: -74.650 flat angles P-C4'-P energy: -29.677 tors. eta vs tors. theta energy: -18.363 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -357.059542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.059542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.059542 (E_RNA) where: Base-Base interactions energy: -116.604 where: short stacking energy: -81.166 Base-Backbone interact. energy: -0.622 local terms energy: -230.834067 where: bonds (distance) C4'-P energy: -67.478 bonds (distance) P-C4' energy: -65.982 flat angles C4'-P-C4' energy: -71.576 flat angles P-C4'-P energy: -32.691 tors. eta vs tors. theta energy: 6.893 Dist. restrs. and SS energy: -9.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1063.083371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.083371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.483371 (E_RNA) where: Base-Base interactions energy: -634.876 where: short stacking energy: -321.993 Base-Backbone interact. energy: 1.656 local terms energy: -363.262783 where: bonds (distance) C4'-P energy: -65.521 bonds (distance) P-C4' energy: -68.248 flat angles C4'-P-C4' energy: -87.514 flat angles P-C4'-P energy: -61.278 tors. eta vs tors. theta energy: -80.701 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1002.834107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.834107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.834107 (E_RNA) where: Base-Base interactions energy: -614.729 where: short stacking energy: -281.824 Base-Backbone interact. energy: -3.125 local terms energy: -384.980047 where: bonds (distance) C4'-P energy: -84.113 bonds (distance) P-C4' energy: -74.923 flat angles C4'-P-C4' energy: -92.412 flat angles P-C4'-P energy: -62.166 tors. eta vs tors. theta energy: -71.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -956.490017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.490017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.490017 (E_RNA) where: Base-Base interactions energy: -516.990 where: short stacking energy: -280.237 Base-Backbone interact. energy: 1.421 local terms energy: -368.920357 where: bonds (distance) C4'-P energy: -78.670 bonds (distance) P-C4' energy: -80.489 flat angles C4'-P-C4' energy: -91.239 flat angles P-C4'-P energy: -48.483 tors. eta vs tors. theta energy: -70.041 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -839.177761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.177761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.977761 (E_RNA) where: Base-Base interactions energy: -437.004 where: short stacking energy: -222.330 Base-Backbone interact. energy: 3.700 local terms energy: -299.673814 where: bonds (distance) C4'-P energy: -78.731 bonds (distance) P-C4' energy: -68.987 flat angles C4'-P-C4' energy: -71.161 flat angles P-C4'-P energy: -40.347 tors. eta vs tors. theta energy: -40.447 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -825.595103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.595103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.595103 (E_RNA) where: Base-Base interactions energy: -431.574 where: short stacking energy: -241.644 Base-Backbone interact. energy: -1.023 local terms energy: -320.998568 where: bonds (distance) C4'-P energy: -66.642 bonds (distance) P-C4' energy: -73.978 flat angles C4'-P-C4' energy: -80.120 flat angles P-C4'-P energy: -47.885 tors. eta vs tors. theta energy: -52.373 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -739.485465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.485465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.885465 (E_RNA) where: Base-Base interactions energy: -395.423 where: short stacking energy: -202.540 Base-Backbone interact. energy: -0.701 local terms energy: -285.760811 where: bonds (distance) C4'-P energy: -67.109 bonds (distance) P-C4' energy: -71.252 flat angles C4'-P-C4' energy: -77.787 flat angles P-C4'-P energy: -41.654 tors. eta vs tors. theta energy: -27.958 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -716.191035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.191035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.791035 (E_RNA) where: Base-Base interactions energy: -361.789 where: short stacking energy: -187.769 Base-Backbone interact. energy: -1.496 local terms energy: -266.505116 where: bonds (distance) C4'-P energy: -60.707 bonds (distance) P-C4' energy: -75.025 flat angles C4'-P-C4' energy: -73.183 flat angles P-C4'-P energy: -31.482 tors. eta vs tors. theta energy: -26.108 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -490.443491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.443491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.443491 (E_RNA) where: Base-Base interactions energy: -223.168 where: short stacking energy: -140.808 Base-Backbone interact. energy: -1.182 local terms energy: -230.093325 where: bonds (distance) C4'-P energy: -63.177 bonds (distance) P-C4' energy: -62.348 flat angles C4'-P-C4' energy: -69.946 flat angles P-C4'-P energy: -25.471 tors. eta vs tors. theta energy: -9.151 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -483.226444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.226444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.426444 (E_RNA) where: Base-Base interactions energy: -210.063 where: short stacking energy: -140.799 Base-Backbone interact. energy: 2.942 local terms energy: -247.306085 where: bonds (distance) C4'-P energy: -67.763 bonds (distance) P-C4' energy: -61.177 flat angles C4'-P-C4' energy: -67.330 flat angles P-C4'-P energy: -33.751 tors. eta vs tors. theta energy: -17.284 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -358.018440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.018440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.418440 (E_RNA) where: Base-Base interactions energy: -122.819 where: short stacking energy: -96.666 Base-Backbone interact. energy: -1.631 local terms energy: -229.968345 where: bonds (distance) C4'-P energy: -70.315 bonds (distance) P-C4' energy: -71.291 flat angles C4'-P-C4' energy: -57.501 flat angles P-C4'-P energy: -30.924 tors. eta vs tors. theta energy: 0.061 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1103.234504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.234504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.234504 (E_RNA) where: Base-Base interactions energy: -652.474 where: short stacking energy: -333.239 Base-Backbone interact. energy: -1.031 local terms energy: -386.729973 where: bonds (distance) C4'-P energy: -86.076 bonds (distance) P-C4' energy: -69.411 flat angles C4'-P-C4' energy: -91.738 flat angles P-C4'-P energy: -63.267 tors. eta vs tors. theta energy: -76.237 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -999.582636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.582636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.582636 (E_RNA) where: Base-Base interactions energy: -611.263 where: short stacking energy: -296.643 Base-Backbone interact. energy: -0.085 local terms energy: -388.234955 where: bonds (distance) C4'-P energy: -73.360 bonds (distance) P-C4' energy: -84.400 flat angles C4'-P-C4' energy: -85.919 flat angles P-C4'-P energy: -60.200 tors. eta vs tors. theta energy: -84.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -959.755044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.755044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -885.955044 (E_RNA) where: Base-Base interactions energy: -522.624 where: short stacking energy: -288.149 Base-Backbone interact. energy: -1.707 local terms energy: -361.624210 where: bonds (distance) C4'-P energy: -77.762 bonds (distance) P-C4' energy: -81.836 flat angles C4'-P-C4' energy: -92.046 flat angles P-C4'-P energy: -48.367 tors. eta vs tors. theta energy: -61.612 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -889.692421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.692421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.692421 (E_RNA) where: Base-Base interactions energy: -480.610 where: short stacking energy: -264.058 Base-Backbone interact. energy: -0.886 local terms energy: -309.195799 where: bonds (distance) C4'-P energy: -73.336 bonds (distance) P-C4' energy: -79.656 flat angles C4'-P-C4' energy: -59.877 flat angles P-C4'-P energy: -47.880 tors. eta vs tors. theta energy: -48.446 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -801.035460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.035460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.435460 (E_RNA) where: Base-Base interactions energy: -429.453 where: short stacking energy: -234.735 Base-Backbone interact. energy: 0.964 local terms energy: -305.946406 where: bonds (distance) C4'-P energy: -54.848 bonds (distance) P-C4' energy: -79.939 flat angles C4'-P-C4' energy: -85.085 flat angles P-C4'-P energy: -40.206 tors. eta vs tors. theta energy: -45.868 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -782.915927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.915927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.115927 (E_RNA) where: Base-Base interactions energy: -414.862 where: short stacking energy: -218.146 Base-Backbone interact. energy: -2.999 local terms energy: -309.255483 where: bonds (distance) C4'-P energy: -74.993 bonds (distance) P-C4' energy: -68.038 flat angles C4'-P-C4' energy: -77.599 flat angles P-C4'-P energy: -49.288 tors. eta vs tors. theta energy: -39.338 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -693.589735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.589735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.589735 (E_RNA) where: Base-Base interactions energy: -361.641 where: short stacking energy: -166.148 Base-Backbone interact. energy: -0.736 local terms energy: -241.211980 where: bonds (distance) C4'-P energy: -65.870 bonds (distance) P-C4' energy: -72.145 flat angles C4'-P-C4' energy: -49.453 flat angles P-C4'-P energy: -36.932 tors. eta vs tors. theta energy: -16.813 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -488.970038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.970038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.970038 (E_RNA) where: Base-Base interactions energy: -229.219 where: short stacking energy: -127.659 Base-Backbone interact. energy: -1.549 local terms energy: -222.202684 where: bonds (distance) C4'-P energy: -60.106 bonds (distance) P-C4' energy: -64.946 flat angles C4'-P-C4' energy: -58.834 flat angles P-C4'-P energy: -31.553 tors. eta vs tors. theta energy: -6.764 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -426.792667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.792667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.992667 (E_RNA) where: Base-Base interactions energy: -177.014 where: short stacking energy: -108.678 Base-Backbone interact. energy: -0.691 local terms energy: -220.288238 where: bonds (distance) C4'-P energy: -55.501 bonds (distance) P-C4' energy: -73.817 flat angles C4'-P-C4' energy: -52.290 flat angles P-C4'-P energy: -35.797 tors. eta vs tors. theta energy: -2.883 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -350.452357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.452357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.652357 (E_RNA) where: Base-Base interactions energy: -150.147 where: short stacking energy: -94.602 Base-Backbone interact. energy: 2.238 local terms energy: -191.743895 where: bonds (distance) C4'-P energy: -52.981 bonds (distance) P-C4' energy: -74.375 flat angles C4'-P-C4' energy: -51.952 flat angles P-C4'-P energy: -27.986 tors. eta vs tors. theta energy: 15.549 Dist. restrs. and SS energy: -10.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1117.311247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.311247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.911247 (E_RNA) where: Base-Base interactions energy: -642.749 where: short stacking energy: -333.921 Base-Backbone interact. energy: -1.357 local terms energy: -404.805392 where: bonds (distance) C4'-P energy: -93.291 bonds (distance) P-C4' energy: -79.616 flat angles C4'-P-C4' energy: -95.247 flat angles P-C4'-P energy: -58.515 tors. eta vs tors. theta energy: -78.136 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1005.655393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.655393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.655393 (E_RNA) where: Base-Base interactions energy: -615.952 where: short stacking energy: -283.592 Base-Backbone interact. energy: -3.572 local terms energy: -386.130768 where: bonds (distance) C4'-P energy: -84.132 bonds (distance) P-C4' energy: -80.386 flat angles C4'-P-C4' energy: -82.964 flat angles P-C4'-P energy: -57.377 tors. eta vs tors. theta energy: -81.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -960.371613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.371613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.371613 (E_RNA) where: Base-Base interactions energy: -522.873 where: short stacking energy: -280.281 Base-Backbone interact. energy: 0.779 local terms energy: -366.277641 where: bonds (distance) C4'-P energy: -70.166 bonds (distance) P-C4' energy: -76.032 flat angles C4'-P-C4' energy: -86.778 flat angles P-C4'-P energy: -67.853 tors. eta vs tors. theta energy: -65.449 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -902.688607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.688607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -798.288607 (E_RNA) where: Base-Base interactions energy: -472.954 where: short stacking energy: -250.844 Base-Backbone interact. energy: -1.168 local terms energy: -324.166303 where: bonds (distance) C4'-P energy: -71.941 bonds (distance) P-C4' energy: -89.140 flat angles C4'-P-C4' energy: -74.903 flat angles P-C4'-P energy: -36.093 tors. eta vs tors. theta energy: -52.088 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -826.858134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.858134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.658134 (E_RNA) where: Base-Base interactions energy: -428.097 where: short stacking energy: -228.675 Base-Backbone interact. energy: -0.489 local terms energy: -328.072110 where: bonds (distance) C4'-P energy: -60.822 bonds (distance) P-C4' energy: -93.179 flat angles C4'-P-C4' energy: -79.024 flat angles P-C4'-P energy: -49.394 tors. eta vs tors. theta energy: -45.653 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -751.910352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.910352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.310352 (E_RNA) where: Base-Base interactions energy: -404.890 where: short stacking energy: -209.619 Base-Backbone interact. energy: -2.675 local terms energy: -286.746024 where: bonds (distance) C4'-P energy: -58.654 bonds (distance) P-C4' energy: -72.247 flat angles C4'-P-C4' energy: -60.684 flat angles P-C4'-P energy: -48.366 tors. eta vs tors. theta energy: -46.795 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -694.074628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.074628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.074628 (E_RNA) where: Base-Base interactions energy: -333.943 where: short stacking energy: -177.818 Base-Backbone interact. energy: -1.087 local terms energy: -269.044163 where: bonds (distance) C4'-P energy: -72.249 bonds (distance) P-C4' energy: -66.409 flat angles C4'-P-C4' energy: -55.215 flat angles P-C4'-P energy: -46.233 tors. eta vs tors. theta energy: -28.938 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -503.653662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.653662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.253662 (E_RNA) where: Base-Base interactions energy: -232.048 where: short stacking energy: -122.588 Base-Backbone interact. energy: 2.908 local terms energy: -242.114223 where: bonds (distance) C4'-P energy: -63.171 bonds (distance) P-C4' energy: -60.589 flat angles C4'-P-C4' energy: -74.458 flat angles P-C4'-P energy: -41.577 tors. eta vs tors. theta energy: -2.319 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -464.396178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.396178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.396178 (E_RNA) where: Base-Base interactions energy: -200.507 where: short stacking energy: -102.513 Base-Backbone interact. energy: -1.313 local terms energy: -235.576306 where: bonds (distance) C4'-P energy: -64.499 bonds (distance) P-C4' energy: -79.363 flat angles C4'-P-C4' energy: -59.502 flat angles P-C4'-P energy: -41.860 tors. eta vs tors. theta energy: 9.648 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -316.930896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.930896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.330896 (E_RNA) where: Base-Base interactions energy: -94.867 where: short stacking energy: -70.580 Base-Backbone interact. energy: -1.405 local terms energy: -208.059278 where: bonds (distance) C4'-P energy: -64.116 bonds (distance) P-C4' energy: -79.037 flat angles C4'-P-C4' energy: -40.362 flat angles P-C4'-P energy: -40.187 tors. eta vs tors. theta energy: 15.644 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1098.397585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.397585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.797585 (E_RNA) where: Base-Base interactions energy: -646.108 where: short stacking energy: -346.476 Base-Backbone interact. energy: -1.070 local terms energy: -384.619142 where: bonds (distance) C4'-P energy: -81.998 bonds (distance) P-C4' energy: -85.649 flat angles C4'-P-C4' energy: -83.507 flat angles P-C4'-P energy: -48.421 tors. eta vs tors. theta energy: -85.044 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1035.104700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.104700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.104700 (E_RNA) where: Base-Base interactions energy: -669.290 where: short stacking energy: -294.229 Base-Backbone interact. energy: -3.865 local terms energy: -361.949609 where: bonds (distance) C4'-P energy: -74.463 bonds (distance) P-C4' energy: -76.314 flat angles C4'-P-C4' energy: -79.949 flat angles P-C4'-P energy: -55.472 tors. eta vs tors. theta energy: -75.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -959.511310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.511310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.511310 (E_RNA) where: Base-Base interactions energy: -516.784 where: short stacking energy: -281.853 Base-Backbone interact. energy: -0.374 local terms energy: -370.353430 where: bonds (distance) C4'-P energy: -86.407 bonds (distance) P-C4' energy: -73.847 flat angles C4'-P-C4' energy: -75.985 flat angles P-C4'-P energy: -53.391 tors. eta vs tors. theta energy: -80.724 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -892.279618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.279618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.479618 (E_RNA) where: Base-Base interactions energy: -459.786 where: short stacking energy: -225.965 Base-Backbone interact. energy: -0.516 local terms energy: -331.178081 where: bonds (distance) C4'-P energy: -67.629 bonds (distance) P-C4' energy: -83.710 flat angles C4'-P-C4' energy: -70.134 flat angles P-C4'-P energy: -52.244 tors. eta vs tors. theta energy: -57.461 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -803.421105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.421105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.021105 (E_RNA) where: Base-Base interactions energy: -443.313 where: short stacking energy: -238.200 Base-Backbone interact. energy: 0.054 local terms energy: -291.761904 where: bonds (distance) C4'-P energy: -69.583 bonds (distance) P-C4' energy: -66.661 flat angles C4'-P-C4' energy: -69.430 flat angles P-C4'-P energy: -42.888 tors. eta vs tors. theta energy: -43.200 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -793.305524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.305524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.505524 (E_RNA) where: Base-Base interactions energy: -438.460 where: short stacking energy: -223.075 Base-Backbone interact. energy: 0.576 local terms energy: -299.621110 where: bonds (distance) C4'-P energy: -66.361 bonds (distance) P-C4' energy: -83.781 flat angles C4'-P-C4' energy: -64.015 flat angles P-C4'-P energy: -43.467 tors. eta vs tors. theta energy: -41.996 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -686.572433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.572433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.772433 (E_RNA) where: Base-Base interactions energy: -329.194 where: short stacking energy: -176.168 Base-Backbone interact. energy: 0.219 local terms energy: -265.797957 where: bonds (distance) C4'-P energy: -50.494 bonds (distance) P-C4' energy: -78.567 flat angles C4'-P-C4' energy: -65.427 flat angles P-C4'-P energy: -53.446 tors. eta vs tors. theta energy: -17.864 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -500.038544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.038544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.238544 (E_RNA) where: Base-Base interactions energy: -239.003 where: short stacking energy: -131.831 Base-Backbone interact. energy: 0.145 local terms energy: -223.380093 where: bonds (distance) C4'-P energy: -52.662 bonds (distance) P-C4' energy: -67.845 flat angles C4'-P-C4' energy: -69.402 flat angles P-C4'-P energy: -41.381 tors. eta vs tors. theta energy: 7.910 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -491.762059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.762059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.762059 (E_RNA) where: Base-Base interactions energy: -228.592 where: short stacking energy: -121.210 Base-Backbone interact. energy: 0.730 local terms energy: -227.900184 where: bonds (distance) C4'-P energy: -62.456 bonds (distance) P-C4' energy: -62.934 flat angles C4'-P-C4' energy: -68.872 flat angles P-C4'-P energy: -48.255 tors. eta vs tors. theta energy: 14.616 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -331.332641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.332641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.732641 (E_RNA) where: Base-Base interactions energy: -128.276 where: short stacking energy: -76.011 Base-Backbone interact. energy: -1.331 local terms energy: -198.126207 where: bonds (distance) C4'-P energy: -62.834 bonds (distance) P-C4' energy: -49.843 flat angles C4'-P-C4' energy: -65.712 flat angles P-C4'-P energy: -30.500 tors. eta vs tors. theta energy: 10.763 Dist. restrs. and SS energy: -3.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1036.651632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.651632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.651632 (E_RNA) where: Base-Base interactions energy: -644.199 where: short stacking energy: -296.470 Base-Backbone interact. energy: -2.352 local terms energy: -390.101198 where: bonds (distance) C4'-P energy: -74.031 bonds (distance) P-C4' energy: -83.609 flat angles C4'-P-C4' energy: -97.442 flat angles P-C4'-P energy: -57.197 tors. eta vs tors. theta energy: -77.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1074.269879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.269879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.869879 (E_RNA) where: Base-Base interactions energy: -628.642 where: short stacking energy: -300.272 Base-Backbone interact. energy: -1.978 local terms energy: -375.250125 where: bonds (distance) C4'-P energy: -68.476 bonds (distance) P-C4' energy: -77.851 flat angles C4'-P-C4' energy: -96.050 flat angles P-C4'-P energy: -56.012 tors. eta vs tors. theta energy: -76.861 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1003.479067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.479067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.279067 (E_RNA) where: Base-Base interactions energy: -544.345 where: short stacking energy: -310.768 Base-Backbone interact. energy: -2.152 local terms energy: -377.781585 where: bonds (distance) C4'-P energy: -65.810 bonds (distance) P-C4' energy: -79.490 flat angles C4'-P-C4' energy: -90.062 flat angles P-C4'-P energy: -50.286 tors. eta vs tors. theta energy: -92.133 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -857.547462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.547462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.147462 (E_RNA) where: Base-Base interactions energy: -441.565 where: short stacking energy: -234.128 Base-Backbone interact. energy: -1.506 local terms energy: -319.075623 where: bonds (distance) C4'-P energy: -65.134 bonds (distance) P-C4' energy: -74.023 flat angles C4'-P-C4' energy: -79.972 flat angles P-C4'-P energy: -52.506 tors. eta vs tors. theta energy: -47.441 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -840.073889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.073889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.273889 (E_RNA) where: Base-Base interactions energy: -449.042 where: short stacking energy: -229.584 Base-Backbone interact. energy: -1.348 local terms energy: -315.883671 where: bonds (distance) C4'-P energy: -70.278 bonds (distance) P-C4' energy: -71.411 flat angles C4'-P-C4' energy: -78.712 flat angles P-C4'-P energy: -33.763 tors. eta vs tors. theta energy: -61.720 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -786.270731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.270731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.670731 (E_RNA) where: Base-Base interactions energy: -415.520 where: short stacking energy: -225.176 Base-Backbone interact. energy: -0.305 local terms energy: -312.844926 where: bonds (distance) C4'-P energy: -71.231 bonds (distance) P-C4' energy: -75.736 flat angles C4'-P-C4' energy: -61.103 flat angles P-C4'-P energy: -49.068 tors. eta vs tors. theta energy: -55.706 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -709.177944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.177944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.177944 (E_RNA) where: Base-Base interactions energy: -350.119 where: short stacking energy: -176.292 Base-Backbone interact. energy: 3.947 local terms energy: -264.005744 where: bonds (distance) C4'-P energy: -51.335 bonds (distance) P-C4' energy: -63.917 flat angles C4'-P-C4' energy: -72.433 flat angles P-C4'-P energy: -40.609 tors. eta vs tors. theta energy: -35.711 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -484.246834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.246834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.046834 (E_RNA) where: Base-Base interactions energy: -217.667 where: short stacking energy: -109.290 Base-Backbone interact. energy: 0.369 local terms energy: -232.748776 where: bonds (distance) C4'-P energy: -60.884 bonds (distance) P-C4' energy: -64.570 flat angles C4'-P-C4' energy: -69.216 flat angles P-C4'-P energy: -44.768 tors. eta vs tors. theta energy: 6.688 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -488.842654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.842654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.042654 (E_RNA) where: Base-Base interactions energy: -229.079 where: short stacking energy: -139.568 Base-Backbone interact. energy: 0.723 local terms energy: -222.686836 where: bonds (distance) C4'-P energy: -75.669 bonds (distance) P-C4' energy: -58.322 flat angles C4'-P-C4' energy: -57.883 flat angles P-C4'-P energy: -26.989 tors. eta vs tors. theta energy: -3.825 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -357.567209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.567209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.967209 (E_RNA) where: Base-Base interactions energy: -129.502 where: short stacking energy: -75.090 Base-Backbone interact. energy: 0.010 local terms energy: -215.474939 where: bonds (distance) C4'-P energy: -71.483 bonds (distance) P-C4' energy: -62.936 flat angles C4'-P-C4' energy: -61.623 flat angles P-C4'-P energy: -35.020 tors. eta vs tors. theta energy: 15.587 Dist. restrs. and SS energy: -12.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1058.058882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.058882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.058882 (E_RNA) where: Base-Base interactions energy: -654.097 where: short stacking energy: -319.237 Base-Backbone interact. energy: -4.324 local terms energy: -399.637936 where: bonds (distance) C4'-P energy: -82.391 bonds (distance) P-C4' energy: -89.837 flat angles C4'-P-C4' energy: -91.228 flat angles P-C4'-P energy: -58.120 tors. eta vs tors. theta energy: -78.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1102.955935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.955935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.155935 (E_RNA) where: Base-Base interactions energy: -639.167 where: short stacking energy: -326.700 Base-Backbone interact. energy: -2.777 local terms energy: -396.211266 where: bonds (distance) C4'-P energy: -86.753 bonds (distance) P-C4' energy: -77.985 flat angles C4'-P-C4' energy: -95.500 flat angles P-C4'-P energy: -60.089 tors. eta vs tors. theta energy: -75.884 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1003.932388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.932388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.932388 (E_RNA) where: Base-Base interactions energy: -541.314 where: short stacking energy: -295.780 Base-Backbone interact. energy: 0.299 local terms energy: -381.917208 where: bonds (distance) C4'-P energy: -85.599 bonds (distance) P-C4' energy: -77.427 flat angles C4'-P-C4' energy: -81.411 flat angles P-C4'-P energy: -45.624 tors. eta vs tors. theta energy: -91.856 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -854.613600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -854.613600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.613600 (E_RNA) where: Base-Base interactions energy: -448.897 where: short stacking energy: -208.124 Base-Backbone interact. energy: 2.076 local terms energy: -335.792823 where: bonds (distance) C4'-P energy: -77.840 bonds (distance) P-C4' energy: -94.912 flat angles C4'-P-C4' energy: -72.164 flat angles P-C4'-P energy: -48.529 tors. eta vs tors. theta energy: -42.349 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -841.997721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.997721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.397721 (E_RNA) where: Base-Base interactions energy: -439.514 where: short stacking energy: -211.793 Base-Backbone interact. energy: -1.507 local terms energy: -298.377265 where: bonds (distance) C4'-P energy: -66.845 bonds (distance) P-C4' energy: -77.790 flat angles C4'-P-C4' energy: -78.735 flat angles P-C4'-P energy: -24.772 tors. eta vs tors. theta energy: -50.236 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -777.956830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.956830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.956830 (E_RNA) where: Base-Base interactions energy: -406.523 where: short stacking energy: -201.644 Base-Backbone interact. energy: -2.052 local terms energy: -306.381660 where: bonds (distance) C4'-P energy: -67.935 bonds (distance) P-C4' energy: -80.728 flat angles C4'-P-C4' energy: -72.364 flat angles P-C4'-P energy: -43.824 tors. eta vs tors. theta energy: -41.530 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -736.239633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.239633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.239633 (E_RNA) where: Base-Base interactions energy: -369.801 where: short stacking energy: -193.013 Base-Backbone interact. energy: 0.913 local terms energy: -277.351908 where: bonds (distance) C4'-P energy: -58.520 bonds (distance) P-C4' energy: -70.333 flat angles C4'-P-C4' energy: -67.004 flat angles P-C4'-P energy: -54.197 tors. eta vs tors. theta energy: -27.298 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -502.624844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.624844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.624844 (E_RNA) where: Base-Base interactions energy: -243.425 where: short stacking energy: -147.051 Base-Backbone interact. energy: 0.487 local terms energy: -223.686211 where: bonds (distance) C4'-P energy: -65.065 bonds (distance) P-C4' energy: -62.981 flat angles C4'-P-C4' energy: -51.386 flat angles P-C4'-P energy: -34.620 tors. eta vs tors. theta energy: -9.634 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -416.305588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.305588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.505588 (E_RNA) where: Base-Base interactions energy: -175.693 where: short stacking energy: -105.430 Base-Backbone interact. energy: 1.512 local terms energy: -213.324041 where: bonds (distance) C4'-P energy: -64.140 bonds (distance) P-C4' energy: -65.588 flat angles C4'-P-C4' energy: -53.520 flat angles P-C4'-P energy: -34.034 tors. eta vs tors. theta energy: 3.958 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -357.490602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.490602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.890602 (E_RNA) where: Base-Base interactions energy: -143.304 where: short stacking energy: -103.477 Base-Backbone interact. energy: -0.350 local terms energy: -183.236155 where: bonds (distance) C4'-P energy: -60.171 bonds (distance) P-C4' energy: -66.286 flat angles C4'-P-C4' energy: -37.702 flat angles P-C4'-P energy: -29.461 tors. eta vs tors. theta energy: 10.385 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1107.582278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.582278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.782278 (E_RNA) where: Base-Base interactions energy: -664.100 where: short stacking energy: -341.636 Base-Backbone interact. energy: -2.267 local terms energy: -376.415548 where: bonds (distance) C4'-P energy: -76.099 bonds (distance) P-C4' energy: -93.766 flat angles C4'-P-C4' energy: -77.389 flat angles P-C4'-P energy: -52.370 tors. eta vs tors. theta energy: -76.792 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1060.646489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.646489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.646489 (E_RNA) where: Base-Base interactions energy: -665.519 where: short stacking energy: -312.461 Base-Backbone interact. energy: 1.584 local terms energy: -396.711780 where: bonds (distance) C4'-P energy: -76.376 bonds (distance) P-C4' energy: -88.008 flat angles C4'-P-C4' energy: -82.874 flat angles P-C4'-P energy: -61.640 tors. eta vs tors. theta energy: -87.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -990.657574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.657574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.857574 (E_RNA) where: Base-Base interactions energy: -531.275 where: short stacking energy: -280.877 Base-Backbone interact. energy: -2.241 local terms energy: -383.340721 where: bonds (distance) C4'-P energy: -82.175 bonds (distance) P-C4' energy: -78.666 flat angles C4'-P-C4' energy: -86.004 flat angles P-C4'-P energy: -55.493 tors. eta vs tors. theta energy: -81.004 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -894.164248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.164248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.364248 (E_RNA) where: Base-Base interactions energy: -508.453 where: short stacking energy: -235.090 Base-Backbone interact. energy: 0.174 local terms energy: -312.085299 where: bonds (distance) C4'-P energy: -75.140 bonds (distance) P-C4' energy: -68.756 flat angles C4'-P-C4' energy: -70.249 flat angles P-C4'-P energy: -43.871 tors. eta vs tors. theta energy: -54.068 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -828.060993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.060993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.660993 (E_RNA) where: Base-Base interactions energy: -433.991 where: short stacking energy: -256.982 Base-Backbone interact. energy: -1.429 local terms energy: -297.241003 where: bonds (distance) C4'-P energy: -70.974 bonds (distance) P-C4' energy: -72.861 flat angles C4'-P-C4' energy: -64.836 flat angles P-C4'-P energy: -45.417 tors. eta vs tors. theta energy: -43.153 Dist. restrs. and SS energy: -95.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -796.942689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.942689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.342689 (E_RNA) where: Base-Base interactions energy: -440.969 where: short stacking energy: -209.513 Base-Backbone interact. energy: 0.024 local terms energy: -298.398551 where: bonds (distance) C4'-P energy: -70.879 bonds (distance) P-C4' energy: -71.163 flat angles C4'-P-C4' energy: -68.625 flat angles P-C4'-P energy: -45.019 tors. eta vs tors. theta energy: -42.712 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -701.708975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.708975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.108975 (E_RNA) where: Base-Base interactions energy: -320.520 where: short stacking energy: -183.486 Base-Backbone interact. energy: -1.044 local terms energy: -286.545206 where: bonds (distance) C4'-P energy: -66.730 bonds (distance) P-C4' energy: -71.166 flat angles C4'-P-C4' energy: -62.878 flat angles P-C4'-P energy: -46.559 tors. eta vs tors. theta energy: -39.212 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -507.498104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.498104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.498104 (E_RNA) where: Base-Base interactions energy: -261.859 where: short stacking energy: -153.316 Base-Backbone interact. energy: 6.697 local terms energy: -216.335691 where: bonds (distance) C4'-P energy: -39.633 bonds (distance) P-C4' energy: -74.451 flat angles C4'-P-C4' energy: -59.054 flat angles P-C4'-P energy: -38.546 tors. eta vs tors. theta energy: -4.652 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -464.742448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.742448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.942448 (E_RNA) where: Base-Base interactions energy: -196.890 where: short stacking energy: -108.470 Base-Backbone interact. energy: -0.269 local terms energy: -229.783340 where: bonds (distance) C4'-P energy: -64.543 bonds (distance) P-C4' energy: -71.236 flat angles C4'-P-C4' energy: -54.169 flat angles P-C4'-P energy: -51.301 tors. eta vs tors. theta energy: 11.466 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -389.846974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.846974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.446974 (E_RNA) where: Base-Base interactions energy: -148.043 where: short stacking energy: -100.434 Base-Backbone interact. energy: -0.787 local terms energy: -208.616187 where: bonds (distance) C4'-P energy: -59.020 bonds (distance) P-C4' energy: -66.843 flat angles C4'-P-C4' energy: -63.670 flat angles P-C4'-P energy: -34.024 tors. eta vs tors. theta energy: 14.941 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1128.067005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.067005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.467005 (E_RNA) where: Base-Base interactions energy: -670.396 where: short stacking energy: -321.532 Base-Backbone interact. energy: -0.555 local terms energy: -390.515735 where: bonds (distance) C4'-P energy: -83.124 bonds (distance) P-C4' energy: -92.518 flat angles C4'-P-C4' energy: -85.054 flat angles P-C4'-P energy: -54.675 tors. eta vs tors. theta energy: -75.145 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1035.411310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.411310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.411310 (E_RNA) where: Base-Base interactions energy: -639.857 where: short stacking energy: -308.142 Base-Backbone interact. energy: -0.346 local terms energy: -395.208622 where: bonds (distance) C4'-P energy: -69.254 bonds (distance) P-C4' energy: -91.735 flat angles C4'-P-C4' energy: -89.048 flat angles P-C4'-P energy: -55.763 tors. eta vs tors. theta energy: -89.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1007.014769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.014769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.814769 (E_RNA) where: Base-Base interactions energy: -550.525 where: short stacking energy: -285.944 Base-Backbone interact. energy: 1.731 local terms energy: -379.021564 where: bonds (distance) C4'-P energy: -87.526 bonds (distance) P-C4' energy: -70.368 flat angles C4'-P-C4' energy: -81.450 flat angles P-C4'-P energy: -61.382 tors. eta vs tors. theta energy: -78.295 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -887.160346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.160346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.160346 (E_RNA) where: Base-Base interactions energy: -455.017 where: short stacking energy: -266.764 Base-Backbone interact. energy: -1.865 local terms energy: -331.279222 where: bonds (distance) C4'-P energy: -73.757 bonds (distance) P-C4' energy: -76.561 flat angles C4'-P-C4' energy: -77.465 flat angles P-C4'-P energy: -48.627 tors. eta vs tors. theta energy: -54.868 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -824.451723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.451723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.651723 (E_RNA) where: Base-Base interactions energy: -456.046 where: short stacking energy: -225.333 Base-Backbone interact. energy: 1.018 local terms energy: -295.623174 where: bonds (distance) C4'-P energy: -70.566 bonds (distance) P-C4' energy: -66.954 flat angles C4'-P-C4' energy: -59.242 flat angles P-C4'-P energy: -53.036 tors. eta vs tors. theta energy: -45.826 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -819.548511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.548511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.748511 (E_RNA) where: Base-Base interactions energy: -454.776 where: short stacking energy: -241.913 Base-Backbone interact. energy: -0.300 local terms energy: -299.672419 where: bonds (distance) C4'-P energy: -72.849 bonds (distance) P-C4' energy: -67.167 flat angles C4'-P-C4' energy: -69.748 flat angles P-C4'-P energy: -41.547 tors. eta vs tors. theta energy: -48.362 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -698.841059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.841059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.041059 (E_RNA) where: Base-Base interactions energy: -324.988 where: short stacking energy: -178.394 Base-Backbone interact. energy: -0.895 local terms energy: -281.158334 where: bonds (distance) C4'-P energy: -72.592 bonds (distance) P-C4' energy: -71.614 flat angles C4'-P-C4' energy: -65.136 flat angles P-C4'-P energy: -39.516 tors. eta vs tors. theta energy: -32.300 Dist. restrs. and SS energy: -91.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -462.680395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.680395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.480395 (E_RNA) where: Base-Base interactions energy: -189.741 where: short stacking energy: -99.093 Base-Backbone interact. energy: -0.490 local terms energy: -238.249116 where: bonds (distance) C4'-P energy: -60.246 bonds (distance) P-C4' energy: -82.970 flat angles C4'-P-C4' energy: -63.943 flat angles P-C4'-P energy: -36.324 tors. eta vs tors. theta energy: 5.234 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -468.114584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.114584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.914584 (E_RNA) where: Base-Base interactions energy: -218.589 where: short stacking energy: -130.649 Base-Backbone interact. energy: 5.437 local terms energy: -220.762166 where: bonds (distance) C4'-P energy: -63.484 bonds (distance) P-C4' energy: -61.891 flat angles C4'-P-C4' energy: -54.460 flat angles P-C4'-P energy: -42.555 tors. eta vs tors. theta energy: 1.627 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -384.010244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.010244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.010244 (E_RNA) where: Base-Base interactions energy: -147.598 where: short stacking energy: -112.783 Base-Backbone interact. energy: -1.170 local terms energy: -208.242891 where: bonds (distance) C4'-P energy: -54.077 bonds (distance) P-C4' energy: -64.665 flat angles C4'-P-C4' energy: -46.398 flat angles P-C4'-P energy: -37.212 tors. eta vs tors. theta energy: -5.891 Dist. restrs. and SS energy: -27.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1118.788660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.788660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.188660 (E_RNA) where: Base-Base interactions energy: -689.588 where: short stacking energy: -320.424 Base-Backbone interact. energy: -2.605 local terms energy: -359.995415 where: bonds (distance) C4'-P energy: -67.507 bonds (distance) P-C4' energy: -69.084 flat angles C4'-P-C4' energy: -95.664 flat angles P-C4'-P energy: -48.000 tors. eta vs tors. theta energy: -79.740 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1034.290611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.290611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.290611 (E_RNA) where: Base-Base interactions energy: -643.020 where: short stacking energy: -325.285 Base-Backbone interact. energy: -4.257 local terms energy: -387.012770 where: bonds (distance) C4'-P energy: -81.763 bonds (distance) P-C4' energy: -72.343 flat angles C4'-P-C4' energy: -80.338 flat angles P-C4'-P energy: -66.529 tors. eta vs tors. theta energy: -86.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -991.008840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.008840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.608840 (E_RNA) where: Base-Base interactions energy: -551.547 where: short stacking energy: -298.116 Base-Backbone interact. energy: -1.281 local terms energy: -360.781166 where: bonds (distance) C4'-P energy: -80.041 bonds (distance) P-C4' energy: -84.989 flat angles C4'-P-C4' energy: -75.069 flat angles P-C4'-P energy: -53.363 tors. eta vs tors. theta energy: -67.320 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -878.656709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.656709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.056709 (E_RNA) where: Base-Base interactions energy: -457.663 where: short stacking energy: -246.099 Base-Backbone interact. energy: -1.131 local terms energy: -317.263247 where: bonds (distance) C4'-P energy: -55.377 bonds (distance) P-C4' energy: -83.312 flat angles C4'-P-C4' energy: -80.803 flat angles P-C4'-P energy: -41.340 tors. eta vs tors. theta energy: -56.431 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -834.356241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.356241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.356241 (E_RNA) where: Base-Base interactions energy: -473.469 where: short stacking energy: -218.194 Base-Backbone interact. energy: 2.117 local terms energy: -291.004555 where: bonds (distance) C4'-P energy: -69.482 bonds (distance) P-C4' energy: -70.769 flat angles C4'-P-C4' energy: -67.401 flat angles P-C4'-P energy: -43.433 tors. eta vs tors. theta energy: -39.919 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -817.026533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.026533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.826533 (E_RNA) where: Base-Base interactions energy: -421.334 where: short stacking energy: -224.078 Base-Backbone interact. energy: -0.010 local terms energy: -325.482839 where: bonds (distance) C4'-P energy: -85.245 bonds (distance) P-C4' energy: -76.200 flat angles C4'-P-C4' energy: -72.196 flat angles P-C4'-P energy: -46.805 tors. eta vs tors. theta energy: -45.036 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -703.574160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.574160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.574160 (E_RNA) where: Base-Base interactions energy: -349.024 where: short stacking energy: -195.022 Base-Backbone interact. energy: -1.449 local terms energy: -263.101119 where: bonds (distance) C4'-P energy: -65.769 bonds (distance) P-C4' energy: -59.680 flat angles C4'-P-C4' energy: -64.804 flat angles P-C4'-P energy: -43.302 tors. eta vs tors. theta energy: -29.546 Dist. restrs. and SS energy: -90.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -472.225333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.225333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.425333 (E_RNA) where: Base-Base interactions energy: -192.630 where: short stacking energy: -110.831 Base-Backbone interact. energy: -1.566 local terms energy: -249.229523 where: bonds (distance) C4'-P energy: -68.660 bonds (distance) P-C4' energy: -63.682 flat angles C4'-P-C4' energy: -75.790 flat angles P-C4'-P energy: -41.640 tors. eta vs tors. theta energy: 0.542 Dist. restrs. and SS energy: -28.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -456.883383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.883383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.683383 (E_RNA) where: Base-Base interactions energy: -227.081 where: short stacking energy: -137.944 Base-Backbone interact. energy: 2.688 local terms energy: -198.290256 where: bonds (distance) C4'-P energy: -49.047 bonds (distance) P-C4' energy: -63.962 flat angles C4'-P-C4' energy: -59.862 flat angles P-C4'-P energy: -24.619 tors. eta vs tors. theta energy: -0.800 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -407.938260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.938260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.938260 (E_RNA) where: Base-Base interactions energy: -157.586 where: short stacking energy: -127.240 Base-Backbone interact. energy: 0.399 local terms energy: -214.751321 where: bonds (distance) C4'-P energy: -57.956 bonds (distance) P-C4' energy: -52.037 flat angles C4'-P-C4' energy: -56.113 flat angles P-C4'-P energy: -37.667 tors. eta vs tors. theta energy: -10.978 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1135.243554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.243554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.443554 (E_RNA) where: Base-Base interactions energy: -677.940 where: short stacking energy: -326.395 Base-Backbone interact. energy: -0.018 local terms energy: -392.485156 where: bonds (distance) C4'-P energy: -87.852 bonds (distance) P-C4' energy: -79.387 flat angles C4'-P-C4' energy: -90.113 flat angles P-C4'-P energy: -49.582 tors. eta vs tors. theta energy: -85.551 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1047.246341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.246341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.246341 (E_RNA) where: Base-Base interactions energy: -677.946 where: short stacking energy: -328.516 Base-Backbone interact. energy: -2.193 local terms energy: -367.107080 where: bonds (distance) C4'-P energy: -77.957 bonds (distance) P-C4' energy: -70.372 flat angles C4'-P-C4' energy: -83.159 flat angles P-C4'-P energy: -57.067 tors. eta vs tors. theta energy: -78.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -978.266560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.266560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.866560 (E_RNA) where: Base-Base interactions energy: -535.484 where: short stacking energy: -267.885 Base-Backbone interact. energy: -1.771 local terms energy: -363.611870 where: bonds (distance) C4'-P energy: -75.780 bonds (distance) P-C4' energy: -72.431 flat angles C4'-P-C4' energy: -88.870 flat angles P-C4'-P energy: -55.578 tors. eta vs tors. theta energy: -70.953 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -929.596650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.596650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.796650 (E_RNA) where: Base-Base interactions energy: -507.298 where: short stacking energy: -261.430 Base-Backbone interact. energy: -0.879 local terms energy: -347.620339 where: bonds (distance) C4'-P energy: -84.374 bonds (distance) P-C4' energy: -79.403 flat angles C4'-P-C4' energy: -79.945 flat angles P-C4'-P energy: -51.090 tors. eta vs tors. theta energy: -52.808 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -838.403541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.403541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.803541 (E_RNA) where: Base-Base interactions energy: -426.918 where: short stacking energy: -212.551 Base-Backbone interact. energy: 1.942 local terms energy: -310.827123 where: bonds (distance) C4'-P energy: -62.831 bonds (distance) P-C4' energy: -79.514 flat angles C4'-P-C4' energy: -69.850 flat angles P-C4'-P energy: -46.787 tors. eta vs tors. theta energy: -51.845 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -810.197735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.197735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.597735 (E_RNA) where: Base-Base interactions energy: -409.045 where: short stacking energy: -210.815 Base-Backbone interact. energy: 0.214 local terms energy: -334.767204 where: bonds (distance) C4'-P energy: -84.625 bonds (distance) P-C4' energy: -67.209 flat angles C4'-P-C4' energy: -78.213 flat angles P-C4'-P energy: -53.671 tors. eta vs tors. theta energy: -51.049 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -714.527015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.527015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.327015 (E_RNA) where: Base-Base interactions energy: -353.347 where: short stacking energy: -196.153 Base-Backbone interact. energy: -3.131 local terms energy: -260.849111 where: bonds (distance) C4'-P energy: -66.478 bonds (distance) P-C4' energy: -44.948 flat angles C4'-P-C4' energy: -74.395 flat angles P-C4'-P energy: -51.425 tors. eta vs tors. theta energy: -23.602 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -505.849765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.849765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.849765 (E_RNA) where: Base-Base interactions energy: -232.122 where: short stacking energy: -132.446 Base-Backbone interact. energy: -0.597 local terms energy: -237.131192 where: bonds (distance) C4'-P energy: -70.021 bonds (distance) P-C4' energy: -62.574 flat angles C4'-P-C4' energy: -63.067 flat angles P-C4'-P energy: -43.641 tors. eta vs tors. theta energy: 2.172 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -430.128469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.128469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.728469 (E_RNA) where: Base-Base interactions energy: -182.664 where: short stacking energy: -111.039 Base-Backbone interact. energy: -2.696 local terms energy: -212.368681 where: bonds (distance) C4'-P energy: -54.457 bonds (distance) P-C4' energy: -54.793 flat angles C4'-P-C4' energy: -58.103 flat angles P-C4'-P energy: -41.943 tors. eta vs tors. theta energy: -3.073 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -421.436402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.436402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.436402 (E_RNA) where: Base-Base interactions energy: -178.728 where: short stacking energy: -129.253 Base-Backbone interact. energy: 2.681 local terms energy: -209.389569 where: bonds (distance) C4'-P energy: -63.547 bonds (distance) P-C4' energy: -70.639 flat angles C4'-P-C4' energy: -50.792 flat angles P-C4'-P energy: -34.049 tors. eta vs tors. theta energy: 9.638 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1146.794913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.794913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.994913 (E_RNA) where: Base-Base interactions energy: -704.030 where: short stacking energy: -338.557 Base-Backbone interact. energy: -3.755 local terms energy: -374.209481 where: bonds (distance) C4'-P energy: -76.502 bonds (distance) P-C4' energy: -72.642 flat angles C4'-P-C4' energy: -89.317 flat angles P-C4'-P energy: -67.035 tors. eta vs tors. theta energy: -68.715 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1053.114263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.114263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.114263 (E_RNA) where: Base-Base interactions energy: -656.075 where: short stacking energy: -312.604 Base-Backbone interact. energy: -4.670 local terms energy: -392.369865 where: bonds (distance) C4'-P energy: -95.427 bonds (distance) P-C4' energy: -78.232 flat angles C4'-P-C4' energy: -80.173 flat angles P-C4'-P energy: -55.728 tors. eta vs tors. theta energy: -82.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -982.116430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.116430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.116430 (E_RNA) where: Base-Base interactions energy: -552.881 where: short stacking energy: -257.647 Base-Backbone interact. energy: -0.008 local terms energy: -348.227644 where: bonds (distance) C4'-P energy: -79.488 bonds (distance) P-C4' energy: -79.303 flat angles C4'-P-C4' energy: -82.325 flat angles P-C4'-P energy: -47.081 tors. eta vs tors. theta energy: -60.030 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -909.421940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.421940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.221940 (E_RNA) where: Base-Base interactions energy: -519.670 where: short stacking energy: -253.349 Base-Backbone interact. energy: -1.756 local terms energy: -317.796169 where: bonds (distance) C4'-P energy: -77.024 bonds (distance) P-C4' energy: -65.093 flat angles C4'-P-C4' energy: -75.722 flat angles P-C4'-P energy: -48.234 tors. eta vs tors. theta energy: -51.723 Dist. restrs. and SS energy: -70.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -825.275202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.275202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.475202 (E_RNA) where: Base-Base interactions energy: -418.393 where: short stacking energy: -238.083 Base-Backbone interact. energy: -0.060 local terms energy: -333.022387 where: bonds (distance) C4'-P energy: -68.923 bonds (distance) P-C4' energy: -78.587 flat angles C4'-P-C4' energy: -87.091 flat angles P-C4'-P energy: -47.271 tors. eta vs tors. theta energy: -51.150 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -785.963892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.963892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.763892 (E_RNA) where: Base-Base interactions energy: -397.164 where: short stacking energy: -212.643 Base-Backbone interact. energy: -0.763 local terms energy: -290.837275 where: bonds (distance) C4'-P energy: -68.275 bonds (distance) P-C4' energy: -71.746 flat angles C4'-P-C4' energy: -75.473 flat angles P-C4'-P energy: -32.955 tors. eta vs tors. theta energy: -42.388 Dist. restrs. and SS energy: -97.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -740.456806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.456806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -632.456806 (E_RNA) where: Base-Base interactions energy: -354.657 where: short stacking energy: -172.139 Base-Backbone interact. energy: 0.895 local terms energy: -278.694448 where: bonds (distance) C4'-P energy: -75.069 bonds (distance) P-C4' energy: -67.787 flat angles C4'-P-C4' energy: -65.381 flat angles P-C4'-P energy: -43.548 tors. eta vs tors. theta energy: -26.908 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -506.238435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.238435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.238435 (E_RNA) where: Base-Base interactions energy: -224.574 where: short stacking energy: -124.063 Base-Backbone interact. energy: -2.159 local terms energy: -243.505398 where: bonds (distance) C4'-P energy: -84.684 bonds (distance) P-C4' energy: -75.204 flat angles C4'-P-C4' energy: -55.050 flat angles P-C4'-P energy: -26.376 tors. eta vs tors. theta energy: -2.191 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -465.151468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.151468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.351468 (E_RNA) where: Base-Base interactions energy: -181.042 where: short stacking energy: -131.610 Base-Backbone interact. energy: 1.529 local terms energy: -247.838376 where: bonds (distance) C4'-P energy: -62.556 bonds (distance) P-C4' energy: -76.712 flat angles C4'-P-C4' energy: -57.887 flat angles P-C4'-P energy: -37.545 tors. eta vs tors. theta energy: -13.138 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -430.451286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.451286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.851286 (E_RNA) where: Base-Base interactions energy: -187.519 where: short stacking energy: -117.936 Base-Backbone interact. energy: -0.160 local terms energy: -212.172067 where: bonds (distance) C4'-P energy: -62.091 bonds (distance) P-C4' energy: -56.922 flat angles C4'-P-C4' energy: -56.258 flat angles P-C4'-P energy: -33.388 tors. eta vs tors. theta energy: -3.513 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1107.108144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.108144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.508144 (E_RNA) where: Base-Base interactions energy: -660.688 where: short stacking energy: -312.998 Base-Backbone interact. energy: -3.022 local terms energy: -376.797881 where: bonds (distance) C4'-P energy: -69.968 bonds (distance) P-C4' energy: -84.302 flat angles C4'-P-C4' energy: -86.813 flat angles P-C4'-P energy: -57.385 tors. eta vs tors. theta energy: -78.330 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1088.843604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.843604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.843604 (E_RNA) where: Base-Base interactions energy: -698.326 where: short stacking energy: -322.936 Base-Backbone interact. energy: 0.265 local terms energy: -390.782412 where: bonds (distance) C4'-P energy: -89.875 bonds (distance) P-C4' energy: -81.817 flat angles C4'-P-C4' energy: -86.665 flat angles P-C4'-P energy: -49.025 tors. eta vs tors. theta energy: -83.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -982.741117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.741117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -903.541117 (E_RNA) where: Base-Base interactions energy: -545.941 where: short stacking energy: -289.254 Base-Backbone interact. energy: -1.293 local terms energy: -356.306429 where: bonds (distance) C4'-P energy: -78.432 bonds (distance) P-C4' energy: -79.756 flat angles C4'-P-C4' energy: -87.219 flat angles P-C4'-P energy: -43.328 tors. eta vs tors. theta energy: -67.572 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -864.957403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.957403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.157403 (E_RNA) where: Base-Base interactions energy: -476.417 where: short stacking energy: -227.939 Base-Backbone interact. energy: -0.132 local terms energy: -314.608697 where: bonds (distance) C4'-P energy: -72.143 bonds (distance) P-C4' energy: -84.298 flat angles C4'-P-C4' energy: -73.127 flat angles P-C4'-P energy: -48.858 tors. eta vs tors. theta energy: -36.182 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -831.649700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.649700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.849700 (E_RNA) where: Base-Base interactions energy: -449.289 where: short stacking energy: -235.374 Base-Backbone interact. energy: -2.710 local terms energy: -305.850217 where: bonds (distance) C4'-P energy: -74.388 bonds (distance) P-C4' energy: -76.513 flat angles C4'-P-C4' energy: -64.802 flat angles P-C4'-P energy: -47.029 tors. eta vs tors. theta energy: -43.118 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -778.681561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.681561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.281561 (E_RNA) where: Base-Base interactions energy: -393.016 where: short stacking energy: -195.821 Base-Backbone interact. energy: 0.956 local terms energy: -282.221427 where: bonds (distance) C4'-P energy: -56.203 bonds (distance) P-C4' energy: -75.118 flat angles C4'-P-C4' energy: -66.803 flat angles P-C4'-P energy: -51.076 tors. eta vs tors. theta energy: -33.022 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -761.656261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.656261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.656261 (E_RNA) where: Base-Base interactions energy: -365.849 where: short stacking energy: -174.500 Base-Backbone interact. energy: -0.142 local terms energy: -296.664467 where: bonds (distance) C4'-P energy: -75.668 bonds (distance) P-C4' energy: -88.029 flat angles C4'-P-C4' energy: -68.228 flat angles P-C4'-P energy: -33.683 tors. eta vs tors. theta energy: -31.056 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -549.025540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.025540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.025540 (E_RNA) where: Base-Base interactions energy: -260.891 where: short stacking energy: -134.082 Base-Backbone interact. energy: -0.752 local terms energy: -251.382629 where: bonds (distance) C4'-P energy: -66.171 bonds (distance) P-C4' energy: -78.777 flat angles C4'-P-C4' energy: -63.507 flat angles P-C4'-P energy: -39.356 tors. eta vs tors. theta energy: -3.572 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -448.975287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.975287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.975287 (E_RNA) where: Base-Base interactions energy: -163.181 where: short stacking energy: -115.107 Base-Backbone interact. energy: -1.074 local terms energy: -248.719843 where: bonds (distance) C4'-P energy: -71.048 bonds (distance) P-C4' energy: -66.557 flat angles C4'-P-C4' energy: -62.408 flat angles P-C4'-P energy: -41.686 tors. eta vs tors. theta energy: -7.021 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -394.085628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.085628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.685628 (E_RNA) where: Base-Base interactions energy: -147.638 where: short stacking energy: -99.780 Base-Backbone interact. energy: -0.647 local terms energy: -213.401048 where: bonds (distance) C4'-P energy: -69.679 bonds (distance) P-C4' energy: -58.396 flat angles C4'-P-C4' energy: -55.365 flat angles P-C4'-P energy: -37.603 tors. eta vs tors. theta energy: 7.642 Dist. restrs. and SS energy: -32.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1145.247213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.247213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.447213 (E_RNA) where: Base-Base interactions energy: -699.860 where: short stacking energy: -333.454 Base-Backbone interact. energy: -4.263 local terms energy: -376.323658 where: bonds (distance) C4'-P energy: -84.813 bonds (distance) P-C4' energy: -80.798 flat angles C4'-P-C4' energy: -80.979 flat angles P-C4'-P energy: -54.510 tors. eta vs tors. theta energy: -75.223 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1036.155913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.155913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.155913 (E_RNA) where: Base-Base interactions energy: -645.450 where: short stacking energy: -283.436 Base-Backbone interact. energy: 0.481 local terms energy: -391.187081 where: bonds (distance) C4'-P energy: -81.695 bonds (distance) P-C4' energy: -74.665 flat angles C4'-P-C4' energy: -92.881 flat angles P-C4'-P energy: -58.653 tors. eta vs tors. theta energy: -83.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -996.366109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.366109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.966109 (E_RNA) where: Base-Base interactions energy: -556.559 where: short stacking energy: -266.968 Base-Backbone interact. energy: 1.262 local terms energy: -363.669260 where: bonds (distance) C4'-P energy: -77.379 bonds (distance) P-C4' energy: -68.454 flat angles C4'-P-C4' energy: -88.584 flat angles P-C4'-P energy: -60.379 tors. eta vs tors. theta energy: -68.873 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -911.172785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.172785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.172785 (E_RNA) where: Base-Base interactions energy: -480.340 where: short stacking energy: -255.401 Base-Backbone interact. energy: -2.072 local terms energy: -356.759988 where: bonds (distance) C4'-P energy: -79.374 bonds (distance) P-C4' energy: -87.552 flat angles C4'-P-C4' energy: -76.810 flat angles P-C4'-P energy: -56.137 tors. eta vs tors. theta energy: -56.886 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -812.963695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.963695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.163695 (E_RNA) where: Base-Base interactions energy: -415.182 where: short stacking energy: -207.279 Base-Backbone interact. energy: -0.693 local terms energy: -296.288558 where: bonds (distance) C4'-P energy: -68.611 bonds (distance) P-C4' energy: -74.503 flat angles C4'-P-C4' energy: -67.746 flat angles P-C4'-P energy: -47.579 tors. eta vs tors. theta energy: -37.849 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -811.321643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.321643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.921643 (E_RNA) where: Base-Base interactions energy: -415.366 where: short stacking energy: -219.427 Base-Backbone interact. energy: -1.845 local terms energy: -316.711018 where: bonds (distance) C4'-P energy: -78.985 bonds (distance) P-C4' energy: -68.974 flat angles C4'-P-C4' energy: -76.338 flat angles P-C4'-P energy: -44.820 tors. eta vs tors. theta energy: -47.593 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -789.090261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.090261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.890261 (E_RNA) where: Base-Base interactions energy: -384.013 where: short stacking energy: -177.205 Base-Backbone interact. energy: -0.964 local terms energy: -288.913216 where: bonds (distance) C4'-P energy: -67.885 bonds (distance) P-C4' energy: -66.395 flat angles C4'-P-C4' energy: -77.630 flat angles P-C4'-P energy: -44.267 tors. eta vs tors. theta energy: -32.736 Dist. restrs. and SS energy: -115.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -533.634004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.634004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.634004 (E_RNA) where: Base-Base interactions energy: -238.591 where: short stacking energy: -125.951 Base-Backbone interact. energy: 0.263 local terms energy: -259.305569 where: bonds (distance) C4'-P energy: -74.818 bonds (distance) P-C4' energy: -77.924 flat angles C4'-P-C4' energy: -62.904 flat angles P-C4'-P energy: -37.785 tors. eta vs tors. theta energy: -5.875 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -430.468934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.468934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.268934 (E_RNA) where: Base-Base interactions energy: -164.665 where: short stacking energy: -106.975 Base-Backbone interact. energy: 1.735 local terms energy: -224.339018 where: bonds (distance) C4'-P energy: -64.293 bonds (distance) P-C4' energy: -78.488 flat angles C4'-P-C4' energy: -59.096 flat angles P-C4'-P energy: -33.598 tors. eta vs tors. theta energy: 11.136 Dist. restrs. and SS energy: -43.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -490.612361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.612361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.812361 (E_RNA) where: Base-Base interactions energy: -200.217 where: short stacking energy: -120.284 Base-Backbone interact. energy: 1.236 local terms energy: -244.830711 where: bonds (distance) C4'-P energy: -73.299 bonds (distance) P-C4' energy: -68.884 flat angles C4'-P-C4' energy: -58.285 flat angles P-C4'-P energy: -45.968 tors. eta vs tors. theta energy: 1.605 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1119.818627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.818627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.018627 (E_RNA) where: Base-Base interactions energy: -687.227 where: short stacking energy: -314.904 Base-Backbone interact. energy: -0.137 local terms energy: -367.655497 where: bonds (distance) C4'-P energy: -79.616 bonds (distance) P-C4' energy: -81.992 flat angles C4'-P-C4' energy: -86.093 flat angles P-C4'-P energy: -46.686 tors. eta vs tors. theta energy: -73.269 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1047.057690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.057690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.057690 (E_RNA) where: Base-Base interactions energy: -661.556 where: short stacking energy: -304.714 Base-Backbone interact. energy: -2.962 local terms energy: -382.539495 where: bonds (distance) C4'-P energy: -83.403 bonds (distance) P-C4' energy: -76.677 flat angles C4'-P-C4' energy: -85.348 flat angles P-C4'-P energy: -58.992 tors. eta vs tors. theta energy: -78.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -979.465397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.465397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.065397 (E_RNA) where: Base-Base interactions energy: -534.059 where: short stacking energy: -270.842 Base-Backbone interact. energy: -3.923 local terms energy: -364.082958 where: bonds (distance) C4'-P energy: -77.491 bonds (distance) P-C4' energy: -83.749 flat angles C4'-P-C4' energy: -78.190 flat angles P-C4'-P energy: -63.677 tors. eta vs tors. theta energy: -60.975 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -939.743768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.743768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.743768 (E_RNA) where: Base-Base interactions energy: -531.129 where: short stacking energy: -275.356 Base-Backbone interact. energy: -0.589 local terms energy: -336.025975 where: bonds (distance) C4'-P energy: -71.076 bonds (distance) P-C4' energy: -72.347 flat angles C4'-P-C4' energy: -80.755 flat angles P-C4'-P energy: -52.127 tors. eta vs tors. theta energy: -59.721 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -770.631902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.631902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.631902 (E_RNA) where: Base-Base interactions energy: -369.941 where: short stacking energy: -176.046 Base-Backbone interact. energy: 0.657 local terms energy: -302.347796 where: bonds (distance) C4'-P energy: -80.407 bonds (distance) P-C4' energy: -75.894 flat angles C4'-P-C4' energy: -71.612 flat angles P-C4'-P energy: -48.932 tors. eta vs tors. theta energy: -25.503 Dist. restrs. and SS energy: -99.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -821.843164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.843164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -717.443164 (E_RNA) where: Base-Base interactions energy: -416.805 where: short stacking energy: -208.103 Base-Backbone interact. energy: -2.273 local terms energy: -298.364680 where: bonds (distance) C4'-P energy: -79.701 bonds (distance) P-C4' energy: -67.813 flat angles C4'-P-C4' energy: -74.855 flat angles P-C4'-P energy: -38.632 tors. eta vs tors. theta energy: -37.365 Dist. restrs. and SS energy: -104.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -779.039706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.039706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -712.439706 (E_RNA) where: Base-Base interactions energy: -401.749 where: short stacking energy: -199.836 Base-Backbone interact. energy: -0.727 local terms energy: -309.963185 where: bonds (distance) C4'-P energy: -68.526 bonds (distance) P-C4' energy: -65.077 flat angles C4'-P-C4' energy: -81.721 flat angles P-C4'-P energy: -49.679 tors. eta vs tors. theta energy: -44.960 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -533.240965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.240965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.240965 (E_RNA) where: Base-Base interactions energy: -254.601 where: short stacking energy: -146.726 Base-Backbone interact. energy: 1.970 local terms energy: -244.609231 where: bonds (distance) C4'-P energy: -68.097 bonds (distance) P-C4' energy: -75.127 flat angles C4'-P-C4' energy: -53.161 flat angles P-C4'-P energy: -37.563 tors. eta vs tors. theta energy: -10.661 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -450.784195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.784195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.384195 (E_RNA) where: Base-Base interactions energy: -190.521 where: short stacking energy: -120.808 Base-Backbone interact. energy: 0.077 local terms energy: -218.939922 where: bonds (distance) C4'-P energy: -75.409 bonds (distance) P-C4' energy: -61.568 flat angles C4'-P-C4' energy: -51.438 flat angles P-C4'-P energy: -25.410 tors. eta vs tors. theta energy: -5.115 Dist. restrs. and SS energy: -41.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -491.188691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.188691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.588691 (E_RNA) where: Base-Base interactions energy: -244.731 where: short stacking energy: -115.695 Base-Backbone interact. energy: -2.895 local terms energy: -212.962278 where: bonds (distance) C4'-P energy: -74.214 bonds (distance) P-C4' energy: -72.428 flat angles C4'-P-C4' energy: -41.936 flat angles P-C4'-P energy: -35.487 tors. eta vs tors. theta energy: 11.102 Dist. restrs. and SS energy: -30.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1160.269145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.269145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.669145 (E_RNA) where: Base-Base interactions energy: -704.296 where: short stacking energy: -316.323 Base-Backbone interact. energy: -2.869 local terms energy: -386.503389 where: bonds (distance) C4'-P energy: -75.076 bonds (distance) P-C4' energy: -86.143 flat angles C4'-P-C4' energy: -90.200 flat angles P-C4'-P energy: -56.962 tors. eta vs tors. theta energy: -78.123 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1044.511772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.511772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.511772 (E_RNA) where: Base-Base interactions energy: -673.323 where: short stacking energy: -311.537 Base-Backbone interact. energy: -3.750 local terms energy: -367.439399 where: bonds (distance) C4'-P energy: -75.620 bonds (distance) P-C4' energy: -78.831 flat angles C4'-P-C4' energy: -90.391 flat angles P-C4'-P energy: -53.309 tors. eta vs tors. theta energy: -69.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -989.497460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.497460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.097460 (E_RNA) where: Base-Base interactions energy: -552.694 where: short stacking energy: -258.374 Base-Backbone interact. energy: -1.335 local terms energy: -358.068227 where: bonds (distance) C4'-P energy: -79.830 bonds (distance) P-C4' energy: -77.958 flat angles C4'-P-C4' energy: -90.418 flat angles P-C4'-P energy: -37.732 tors. eta vs tors. theta energy: -72.131 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -919.449238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.449238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.049238 (E_RNA) where: Base-Base interactions energy: -512.912 where: short stacking energy: -266.747 Base-Backbone interact. energy: -2.306 local terms energy: -335.831608 where: bonds (distance) C4'-P energy: -74.641 bonds (distance) P-C4' energy: -68.815 flat angles C4'-P-C4' energy: -77.767 flat angles P-C4'-P energy: -44.894 tors. eta vs tors. theta energy: -69.715 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -904.669472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.669472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.269472 (E_RNA) where: Base-Base interactions energy: -496.932 where: short stacking energy: -241.353 Base-Backbone interact. energy: 0.567 local terms energy: -294.904322 where: bonds (distance) C4'-P energy: -77.307 bonds (distance) P-C4' energy: -75.953 flat angles C4'-P-C4' energy: -62.455 flat angles P-C4'-P energy: -34.515 tors. eta vs tors. theta energy: -44.674 Dist. restrs. and SS energy: -113.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -750.941557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.941557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.341557 (E_RNA) where: Base-Base interactions energy: -354.475 where: short stacking energy: -179.501 Base-Backbone interact. energy: -1.672 local terms energy: -292.194614 where: bonds (distance) C4'-P energy: -84.282 bonds (distance) P-C4' energy: -68.137 flat angles C4'-P-C4' energy: -67.857 flat angles P-C4'-P energy: -43.193 tors. eta vs tors. theta energy: -28.726 Dist. restrs. and SS energy: -102.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -777.368300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.368300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.368300 (E_RNA) where: Base-Base interactions energy: -403.502 where: short stacking energy: -193.658 Base-Backbone interact. energy: -3.826 local terms energy: -289.040479 where: bonds (distance) C4'-P energy: -59.899 bonds (distance) P-C4' energy: -71.937 flat angles C4'-P-C4' energy: -66.161 flat angles P-C4'-P energy: -45.213 tors. eta vs tors. theta energy: -45.831 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -559.478935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.478935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.278935 (E_RNA) where: Base-Base interactions energy: -264.966 where: short stacking energy: -145.368 Base-Backbone interact. energy: 0.142 local terms energy: -260.454724 where: bonds (distance) C4'-P energy: -68.348 bonds (distance) P-C4' energy: -79.482 flat angles C4'-P-C4' energy: -73.339 flat angles P-C4'-P energy: -38.307 tors. eta vs tors. theta energy: -0.979 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -536.851366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.851366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.651366 (E_RNA) where: Base-Base interactions energy: -257.726 where: short stacking energy: -152.318 Base-Backbone interact. energy: 0.752 local terms energy: -227.676732 where: bonds (distance) C4'-P energy: -49.473 bonds (distance) P-C4' energy: -67.966 flat angles C4'-P-C4' energy: -63.261 flat angles P-C4'-P energy: -34.869 tors. eta vs tors. theta energy: -12.109 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -392.330265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.330265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.730265 (E_RNA) where: Base-Base interactions energy: -128.779 where: short stacking energy: -84.125 Base-Backbone interact. energy: 2.399 local terms energy: -217.350400 where: bonds (distance) C4'-P energy: -72.429 bonds (distance) P-C4' energy: -72.008 flat angles C4'-P-C4' energy: -58.143 flat angles P-C4'-P energy: -30.776 tors. eta vs tors. theta energy: 16.005 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1159.475962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.475962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1092.875962 (E_RNA) where: Base-Base interactions energy: -714.161 where: short stacking energy: -324.082 Base-Backbone interact. energy: 0.106 local terms energy: -378.820601 where: bonds (distance) C4'-P energy: -87.119 bonds (distance) P-C4' energy: -79.532 flat angles C4'-P-C4' energy: -77.743 flat angles P-C4'-P energy: -58.930 tors. eta vs tors. theta energy: -75.495 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1019.286153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.286153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.686153 (E_RNA) where: Base-Base interactions energy: -582.780 where: short stacking energy: -288.381 Base-Backbone interact. energy: -2.822 local terms energy: -358.084134 where: bonds (distance) C4'-P energy: -74.174 bonds (distance) P-C4' energy: -72.688 flat angles C4'-P-C4' energy: -92.566 flat angles P-C4'-P energy: -55.398 tors. eta vs tors. theta energy: -63.258 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -989.429908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.429908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.429908 (E_RNA) where: Base-Base interactions energy: -635.587 where: short stacking energy: -274.568 Base-Backbone interact. energy: -1.432 local terms energy: -352.410750 where: bonds (distance) C4'-P energy: -83.222 bonds (distance) P-C4' energy: -79.673 flat angles C4'-P-C4' energy: -79.427 flat angles P-C4'-P energy: -50.570 tors. eta vs tors. theta energy: -59.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -906.090549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.090549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.690549 (E_RNA) where: Base-Base interactions energy: -515.102 where: short stacking energy: -253.645 Base-Backbone interact. energy: -0.620 local terms energy: -321.968380 where: bonds (distance) C4'-P energy: -68.428 bonds (distance) P-C4' energy: -78.962 flat angles C4'-P-C4' energy: -70.980 flat angles P-C4'-P energy: -44.204 tors. eta vs tors. theta energy: -59.394 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -906.052111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -906.052111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.452111 (E_RNA) where: Base-Base interactions energy: -465.220 where: short stacking energy: -207.731 Base-Backbone interact. energy: -3.397 local terms energy: -325.834858 where: bonds (distance) C4'-P energy: -73.737 bonds (distance) P-C4' energy: -79.730 flat angles C4'-P-C4' energy: -81.643 flat angles P-C4'-P energy: -44.912 tors. eta vs tors. theta energy: -45.812 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -767.931589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.931589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.531589 (E_RNA) where: Base-Base interactions energy: -403.224 where: short stacking energy: -207.064 Base-Backbone interact. energy: -2.705 local terms energy: -284.602704 where: bonds (distance) C4'-P energy: -72.977 bonds (distance) P-C4' energy: -71.136 flat angles C4'-P-C4' energy: -57.719 flat angles P-C4'-P energy: -31.724 tors. eta vs tors. theta energy: -51.047 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -745.597947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.597947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.597947 (E_RNA) where: Base-Base interactions energy: -347.856 where: short stacking energy: -180.915 Base-Backbone interact. energy: -0.008 local terms energy: -289.734221 where: bonds (distance) C4'-P energy: -68.035 bonds (distance) P-C4' energy: -91.123 flat angles C4'-P-C4' energy: -68.281 flat angles P-C4'-P energy: -28.575 tors. eta vs tors. theta energy: -33.721 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -578.636740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.636740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.636740 (E_RNA) where: Base-Base interactions energy: -291.629 where: short stacking energy: -156.057 Base-Backbone interact. energy: 6.583 local terms energy: -248.590913 where: bonds (distance) C4'-P energy: -63.478 bonds (distance) P-C4' energy: -54.264 flat angles C4'-P-C4' energy: -69.008 flat angles P-C4'-P energy: -37.131 tors. eta vs tors. theta energy: -24.709 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -502.187706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.187706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.187706 (E_RNA) where: Base-Base interactions energy: -234.307 where: short stacking energy: -126.876 Base-Backbone interact. energy: 0.820 local terms energy: -232.700479 where: bonds (distance) C4'-P energy: -74.121 bonds (distance) P-C4' energy: -67.613 flat angles C4'-P-C4' energy: -43.868 flat angles P-C4'-P energy: -47.133 tors. eta vs tors. theta energy: 0.035 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -410.504598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.504598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.904598 (E_RNA) where: Base-Base interactions energy: -190.592 where: short stacking energy: -109.409 Base-Backbone interact. energy: -2.016 local terms energy: -169.296831 where: bonds (distance) C4'-P energy: -52.406 bonds (distance) P-C4' energy: -64.126 flat angles C4'-P-C4' energy: -52.673 flat angles P-C4'-P energy: -31.405 tors. eta vs tors. theta energy: 31.313 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1125.333838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.333838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.533838 (E_RNA) where: Base-Base interactions energy: -702.496 where: short stacking energy: -327.434 Base-Backbone interact. energy: -1.783 local terms energy: -356.254964 where: bonds (distance) C4'-P energy: -83.156 bonds (distance) P-C4' energy: -84.179 flat angles C4'-P-C4' energy: -72.097 flat angles P-C4'-P energy: -47.048 tors. eta vs tors. theta energy: -69.775 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1034.499901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.499901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.299901 (E_RNA) where: Base-Base interactions energy: -570.602 where: short stacking energy: -285.033 Base-Backbone interact. energy: -1.264 local terms energy: -383.433946 where: bonds (distance) C4'-P energy: -72.512 bonds (distance) P-C4' energy: -91.849 flat angles C4'-P-C4' energy: -82.603 flat angles P-C4'-P energy: -57.449 tors. eta vs tors. theta energy: -79.021 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -970.626894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.626894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.626894 (E_RNA) where: Base-Base interactions energy: -625.167 where: short stacking energy: -264.758 Base-Backbone interact. energy: -2.155 local terms energy: -343.305459 where: bonds (distance) C4'-P energy: -69.107 bonds (distance) P-C4' energy: -76.606 flat angles C4'-P-C4' energy: -78.744 flat angles P-C4'-P energy: -48.740 tors. eta vs tors. theta energy: -70.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -895.287148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.287148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.287148 (E_RNA) where: Base-Base interactions energy: -510.562 where: short stacking energy: -264.242 Base-Backbone interact. energy: -0.390 local terms energy: -312.334566 where: bonds (distance) C4'-P energy: -70.833 bonds (distance) P-C4' energy: -75.523 flat angles C4'-P-C4' energy: -68.008 flat angles P-C4'-P energy: -38.506 tors. eta vs tors. theta energy: -59.464 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -927.768015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.768015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.168015 (E_RNA) where: Base-Base interactions energy: -477.243 where: short stacking energy: -230.589 Base-Backbone interact. energy: -3.281 local terms energy: -335.644423 where: bonds (distance) C4'-P energy: -73.674 bonds (distance) P-C4' energy: -78.157 flat angles C4'-P-C4' energy: -78.766 flat angles P-C4'-P energy: -48.038 tors. eta vs tors. theta energy: -57.009 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -761.423096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.423096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.023096 (E_RNA) where: Base-Base interactions energy: -399.873 where: short stacking energy: -216.634 Base-Backbone interact. energy: -0.837 local terms energy: -283.312883 where: bonds (distance) C4'-P energy: -56.474 bonds (distance) P-C4' energy: -73.668 flat angles C4'-P-C4' energy: -72.075 flat angles P-C4'-P energy: -27.199 tors. eta vs tors. theta energy: -53.897 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -732.447501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.447501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.447501 (E_RNA) where: Base-Base interactions energy: -340.725 where: short stacking energy: -190.629 Base-Backbone interact. energy: -1.124 local terms energy: -282.598432 where: bonds (distance) C4'-P energy: -68.901 bonds (distance) P-C4' energy: -75.968 flat angles C4'-P-C4' energy: -59.327 flat angles P-C4'-P energy: -43.291 tors. eta vs tors. theta energy: -35.111 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -603.157538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.157538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.757538 (E_RNA) where: Base-Base interactions energy: -314.814 where: short stacking energy: -152.226 Base-Backbone interact. energy: 2.054 local terms energy: -230.997250 where: bonds (distance) C4'-P energy: -63.554 bonds (distance) P-C4' energy: -56.430 flat angles C4'-P-C4' energy: -59.295 flat angles P-C4'-P energy: -32.475 tors. eta vs tors. theta energy: -19.244 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -519.356721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.356721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.156721 (E_RNA) where: Base-Base interactions energy: -243.560 where: short stacking energy: -117.253 Base-Backbone interact. energy: 1.654 local terms energy: -243.251391 where: bonds (distance) C4'-P energy: -69.636 bonds (distance) P-C4' energy: -76.960 flat angles C4'-P-C4' energy: -52.151 flat angles P-C4'-P energy: -40.448 tors. eta vs tors. theta energy: -4.056 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -427.691389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.691389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.491389 (E_RNA) where: Base-Base interactions energy: -184.503 where: short stacking energy: -92.937 Base-Backbone interact. energy: 0.964 local terms energy: -191.952299 where: bonds (distance) C4'-P energy: -62.782 bonds (distance) P-C4' energy: -66.842 flat angles C4'-P-C4' energy: -53.321 flat angles P-C4'-P energy: -23.201 tors. eta vs tors. theta energy: 14.193 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1148.321458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1148.321458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.721458 (E_RNA) where: Base-Base interactions energy: -702.509 where: short stacking energy: -339.408 Base-Backbone interact. energy: -2.291 local terms energy: -376.921995 where: bonds (distance) C4'-P energy: -78.537 bonds (distance) P-C4' energy: -83.744 flat angles C4'-P-C4' energy: -89.877 flat angles P-C4'-P energy: -51.403 tors. eta vs tors. theta energy: -73.361 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1000.757988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.757988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.757988 (E_RNA) where: Base-Base interactions energy: -640.954 where: short stacking energy: -276.784 Base-Backbone interact. energy: -2.209 local terms energy: -357.594993 where: bonds (distance) C4'-P energy: -70.236 bonds (distance) P-C4' energy: -76.531 flat angles C4'-P-C4' energy: -79.851 flat angles P-C4'-P energy: -58.053 tors. eta vs tors. theta energy: -72.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1041.026282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.026282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.626282 (E_RNA) where: Base-Base interactions energy: -593.459 where: short stacking energy: -294.554 Base-Backbone interact. energy: -1.942 local terms energy: -368.225233 where: bonds (distance) C4'-P energy: -73.355 bonds (distance) P-C4' energy: -78.353 flat angles C4'-P-C4' energy: -86.613 flat angles P-C4'-P energy: -53.053 tors. eta vs tors. theta energy: -76.852 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -987.160965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.160965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.560965 (E_RNA) where: Base-Base interactions energy: -553.644 where: short stacking energy: -253.581 Base-Backbone interact. energy: -0.758 local terms energy: -321.158714 where: bonds (distance) C4'-P energy: -70.866 bonds (distance) P-C4' energy: -65.981 flat angles C4'-P-C4' energy: -84.884 flat angles P-C4'-P energy: -49.278 tors. eta vs tors. theta energy: -50.149 Dist. restrs. and SS energy: -111.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -889.431919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.431919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.431919 (E_RNA) where: Base-Base interactions energy: -479.571 where: short stacking energy: -238.788 Base-Backbone interact. energy: -0.796 local terms energy: -337.065103 where: bonds (distance) C4'-P energy: -76.458 bonds (distance) P-C4' energy: -78.834 flat angles C4'-P-C4' energy: -71.749 flat angles P-C4'-P energy: -58.609 tors. eta vs tors. theta energy: -51.415 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -735.798606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -735.798606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.798606 (E_RNA) where: Base-Base interactions energy: -350.860 where: short stacking energy: -167.314 Base-Backbone interact. energy: 1.266 local terms energy: -278.203998 where: bonds (distance) C4'-P energy: -66.457 bonds (distance) P-C4' energy: -70.722 flat angles C4'-P-C4' energy: -61.558 flat angles P-C4'-P energy: -50.028 tors. eta vs tors. theta energy: -29.439 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -701.297900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -701.297900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.697900 (E_RNA) where: Base-Base interactions energy: -354.585 where: short stacking energy: -171.092 Base-Backbone interact. energy: -3.000 local terms energy: -268.112903 where: bonds (distance) C4'-P energy: -70.947 bonds (distance) P-C4' energy: -79.192 flat angles C4'-P-C4' energy: -43.965 flat angles P-C4'-P energy: -41.501 tors. eta vs tors. theta energy: -32.508 Dist. restrs. and SS energy: -75.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -628.116895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.116895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.116895 (E_RNA) where: Base-Base interactions energy: -316.919 where: short stacking energy: -194.362 Base-Backbone interact. energy: -2.791 local terms energy: -254.407256 where: bonds (distance) C4'-P energy: -63.143 bonds (distance) P-C4' energy: -60.630 flat angles C4'-P-C4' energy: -66.949 flat angles P-C4'-P energy: -31.642 tors. eta vs tors. theta energy: -32.044 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -488.237760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.237760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.037760 (E_RNA) where: Base-Base interactions energy: -218.364 where: short stacking energy: -106.030 Base-Backbone interact. energy: -1.871 local terms energy: -233.802683 where: bonds (distance) C4'-P energy: -65.226 bonds (distance) P-C4' energy: -77.964 flat angles C4'-P-C4' energy: -59.739 flat angles P-C4'-P energy: -34.320 tors. eta vs tors. theta energy: 3.448 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -439.686491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.686491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.086491 (E_RNA) where: Base-Base interactions energy: -181.544 where: short stacking energy: -94.117 Base-Backbone interact. energy: 6.632 local terms energy: -216.174499 where: bonds (distance) C4'-P energy: -55.146 bonds (distance) P-C4' energy: -67.233 flat angles C4'-P-C4' energy: -62.418 flat angles P-C4'-P energy: -32.930 tors. eta vs tors. theta energy: 1.553 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1145.505205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.505205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.705205 (E_RNA) where: Base-Base interactions energy: -691.097 where: short stacking energy: -323.430 Base-Backbone interact. energy: 2.543 local terms energy: -392.151698 where: bonds (distance) C4'-P energy: -72.737 bonds (distance) P-C4' energy: -90.699 flat angles C4'-P-C4' energy: -91.252 flat angles P-C4'-P energy: -60.292 tors. eta vs tors. theta energy: -77.170 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1018.422447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.422447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.422447 (E_RNA) where: Base-Base interactions energy: -652.379 where: short stacking energy: -294.601 Base-Backbone interact. energy: -4.383 local terms energy: -361.661021 where: bonds (distance) C4'-P energy: -75.751 bonds (distance) P-C4' energy: -71.499 flat angles C4'-P-C4' energy: -77.515 flat angles P-C4'-P energy: -59.462 tors. eta vs tors. theta energy: -77.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1014.663973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.663973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.463973 (E_RNA) where: Base-Base interactions energy: -558.161 where: short stacking energy: -292.181 Base-Backbone interact. energy: -1.172 local terms energy: -376.131181 where: bonds (distance) C4'-P energy: -73.732 bonds (distance) P-C4' energy: -85.040 flat angles C4'-P-C4' energy: -88.348 flat angles P-C4'-P energy: -51.023 tors. eta vs tors. theta energy: -77.988 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1000.900141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.900141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.100141 (E_RNA) where: Base-Base interactions energy: -550.763 where: short stacking energy: -286.602 Base-Backbone interact. energy: -3.114 local terms energy: -337.223182 where: bonds (distance) C4'-P energy: -79.797 bonds (distance) P-C4' energy: -68.200 flat angles C4'-P-C4' energy: -79.123 flat angles P-C4'-P energy: -54.954 tors. eta vs tors. theta energy: -55.149 Dist. restrs. and SS energy: -109.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -905.298909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.298909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.298909 (E_RNA) where: Base-Base interactions energy: -495.562 where: short stacking energy: -265.105 Base-Backbone interact. energy: 0.239 local terms energy: -337.975961 where: bonds (distance) C4'-P energy: -78.951 bonds (distance) P-C4' energy: -71.747 flat angles C4'-P-C4' energy: -74.543 flat angles P-C4'-P energy: -58.269 tors. eta vs tors. theta energy: -54.466 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -759.167472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.167472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -652.967472 (E_RNA) where: Base-Base interactions energy: -355.448 where: short stacking energy: -184.633 Base-Backbone interact. energy: -2.464 local terms energy: -295.055144 where: bonds (distance) C4'-P energy: -72.603 bonds (distance) P-C4' energy: -71.421 flat angles C4'-P-C4' energy: -64.491 flat angles P-C4'-P energy: -44.089 tors. eta vs tors. theta energy: -42.452 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -724.650211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.650211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.450211 (E_RNA) where: Base-Base interactions energy: -343.997 where: short stacking energy: -159.515 Base-Backbone interact. energy: -0.657 local terms energy: -291.796278 where: bonds (distance) C4'-P energy: -79.620 bonds (distance) P-C4' energy: -69.922 flat angles C4'-P-C4' energy: -58.191 flat angles P-C4'-P energy: -46.574 tors. eta vs tors. theta energy: -37.489 Dist. restrs. and SS energy: -88.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -609.831527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.831527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.231527 (E_RNA) where: Base-Base interactions energy: -301.765 where: short stacking energy: -179.355 Base-Backbone interact. energy: 0.009 local terms energy: -250.474649 where: bonds (distance) C4'-P energy: -74.862 bonds (distance) P-C4' energy: -69.350 flat angles C4'-P-C4' energy: -50.954 flat angles P-C4'-P energy: -24.735 tors. eta vs tors. theta energy: -30.575 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -461.205650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.205650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.005650 (E_RNA) where: Base-Base interactions energy: -186.253 where: short stacking energy: -114.174 Base-Backbone interact. energy: -2.991 local terms energy: -219.761440 where: bonds (distance) C4'-P energy: -60.163 bonds (distance) P-C4' energy: -65.110 flat angles C4'-P-C4' energy: -51.976 flat angles P-C4'-P energy: -40.482 tors. eta vs tors. theta energy: -2.029 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -459.548776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.548776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.748776 (E_RNA) where: Base-Base interactions energy: -203.652 where: short stacking energy: -102.233 Base-Backbone interact. energy: -0.046 local terms energy: -218.051185 where: bonds (distance) C4'-P energy: -70.202 bonds (distance) P-C4' energy: -68.433 flat angles C4'-P-C4' energy: -49.296 flat angles P-C4'-P energy: -44.334 tors. eta vs tors. theta energy: 14.214 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1141.793264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.793264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.793264 (E_RNA) where: Base-Base interactions energy: -692.135 where: short stacking energy: -298.859 Base-Backbone interact. energy: -0.852 local terms energy: -385.805783 where: bonds (distance) C4'-P energy: -80.436 bonds (distance) P-C4' energy: -86.977 flat angles C4'-P-C4' energy: -85.905 flat angles P-C4'-P energy: -53.902 tors. eta vs tors. theta energy: -78.587 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1000.977453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.977453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.977453 (E_RNA) where: Base-Base interactions energy: -634.421 where: short stacking energy: -281.635 Base-Backbone interact. energy: -2.749 local terms energy: -363.807292 where: bonds (distance) C4'-P energy: -76.199 bonds (distance) P-C4' energy: -83.613 flat angles C4'-P-C4' energy: -77.605 flat angles P-C4'-P energy: -50.636 tors. eta vs tors. theta energy: -75.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1000.921875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.921875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.521875 (E_RNA) where: Base-Base interactions energy: -566.955 where: short stacking energy: -271.876 Base-Backbone interact. energy: -1.680 local terms energy: -354.886440 where: bonds (distance) C4'-P energy: -83.535 bonds (distance) P-C4' energy: -72.871 flat angles C4'-P-C4' energy: -81.743 flat angles P-C4'-P energy: -50.914 tors. eta vs tors. theta energy: -65.824 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -978.777947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.777947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.777947 (E_RNA) where: Base-Base interactions energy: -533.859 where: short stacking energy: -248.111 Base-Backbone interact. energy: -1.403 local terms energy: -326.515475 where: bonds (distance) C4'-P energy: -73.328 bonds (distance) P-C4' energy: -69.725 flat angles C4'-P-C4' energy: -71.929 flat angles P-C4'-P energy: -56.816 tors. eta vs tors. theta energy: -54.718 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -885.035537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.035537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.035537 (E_RNA) where: Base-Base interactions energy: -514.790 where: short stacking energy: -255.562 Base-Backbone interact. energy: -0.853 local terms energy: -297.392870 where: bonds (distance) C4'-P energy: -54.251 bonds (distance) P-C4' energy: -74.368 flat angles C4'-P-C4' energy: -74.727 flat angles P-C4'-P energy: -37.072 tors. eta vs tors. theta energy: -56.975 Dist. restrs. and SS energy: -72.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -770.517029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.517029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.717029 (E_RNA) where: Base-Base interactions energy: -354.182 where: short stacking energy: -179.758 Base-Backbone interact. energy: 0.027 local terms energy: -315.562127 where: bonds (distance) C4'-P energy: -69.165 bonds (distance) P-C4' energy: -88.673 flat angles C4'-P-C4' energy: -77.274 flat angles P-C4'-P energy: -45.547 tors. eta vs tors. theta energy: -34.903 Dist. restrs. and SS energy: -100.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -744.919373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.919373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.919373 (E_RNA) where: Base-Base interactions energy: -385.549 where: short stacking energy: -181.465 Base-Backbone interact. energy: -2.128 local terms energy: -276.242735 where: bonds (distance) C4'-P energy: -61.135 bonds (distance) P-C4' energy: -81.492 flat angles C4'-P-C4' energy: -67.830 flat angles P-C4'-P energy: -34.950 tors. eta vs tors. theta energy: -30.836 Dist. restrs. and SS energy: -81.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -643.681083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.681083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.481083 (E_RNA) where: Base-Base interactions energy: -312.025 where: short stacking energy: -163.026 Base-Backbone interact. energy: -1.157 local terms energy: -278.299157 where: bonds (distance) C4'-P energy: -75.438 bonds (distance) P-C4' energy: -80.848 flat angles C4'-P-C4' energy: -58.912 flat angles P-C4'-P energy: -46.295 tors. eta vs tors. theta energy: -16.806 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -453.135814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.135814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.335814 (E_RNA) where: Base-Base interactions energy: -188.396 where: short stacking energy: -111.352 Base-Backbone interact. energy: -1.642 local terms energy: -216.297488 where: bonds (distance) C4'-P energy: -61.044 bonds (distance) P-C4' energy: -70.132 flat angles C4'-P-C4' energy: -59.546 flat angles P-C4'-P energy: -35.394 tors. eta vs tors. theta energy: 9.818 Dist. restrs. and SS energy: -46.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -529.583607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.583607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.983607 (E_RNA) where: Base-Base interactions energy: -235.354 where: short stacking energy: -125.032 Base-Backbone interact. energy: 1.419 local terms energy: -256.047949 where: bonds (distance) C4'-P energy: -71.438 bonds (distance) P-C4' energy: -59.431 flat angles C4'-P-C4' energy: -63.447 flat angles P-C4'-P energy: -47.144 tors. eta vs tors. theta energy: -14.588 Dist. restrs. and SS energy: -39.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1132.664941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1132.664941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.064941 (E_RNA) where: Base-Base interactions energy: -703.695 where: short stacking energy: -320.110 Base-Backbone interact. energy: -1.219 local terms energy: -361.150663 where: bonds (distance) C4'-P energy: -74.944 bonds (distance) P-C4' energy: -82.649 flat angles C4'-P-C4' energy: -77.217 flat angles P-C4'-P energy: -61.400 tors. eta vs tors. theta energy: -64.941 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1014.015729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.015729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.015729 (E_RNA) where: Base-Base interactions energy: -646.313 where: short stacking energy: -290.466 Base-Backbone interact. energy: -3.390 local terms energy: -364.312959 where: bonds (distance) C4'-P energy: -76.897 bonds (distance) P-C4' energy: -82.859 flat angles C4'-P-C4' energy: -83.205 flat angles P-C4'-P energy: -51.020 tors. eta vs tors. theta energy: -70.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1011.866296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.866296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.666296 (E_RNA) where: Base-Base interactions energy: -577.714 where: short stacking energy: -297.534 Base-Backbone interact. energy: -1.617 local terms energy: -353.335747 where: bonds (distance) C4'-P energy: -75.728 bonds (distance) P-C4' energy: -74.424 flat angles C4'-P-C4' energy: -75.471 flat angles P-C4'-P energy: -57.298 tors. eta vs tors. theta energy: -70.414 Dist. restrs. and SS energy: -79.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -991.451601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.451601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.451601 (E_RNA) where: Base-Base interactions energy: -543.473 where: short stacking energy: -258.725 Base-Backbone interact. energy: -1.453 local terms energy: -329.524790 where: bonds (distance) C4'-P energy: -69.287 bonds (distance) P-C4' energy: -72.609 flat angles C4'-P-C4' energy: -68.184 flat angles P-C4'-P energy: -51.527 tors. eta vs tors. theta energy: -67.918 Dist. restrs. and SS energy: -117.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -894.357236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.357236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.557236 (E_RNA) where: Base-Base interactions energy: -485.428 where: short stacking energy: -266.904 Base-Backbone interact. energy: -1.726 local terms energy: -333.402549 where: bonds (distance) C4'-P energy: -67.827 bonds (distance) P-C4' energy: -79.071 flat angles C4'-P-C4' energy: -82.167 flat angles P-C4'-P energy: -48.066 tors. eta vs tors. theta energy: -56.271 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -754.286120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.286120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.286120 (E_RNA) where: Base-Base interactions energy: -339.953 where: short stacking energy: -176.990 Base-Backbone interact. energy: -1.940 local terms energy: -304.393687 where: bonds (distance) C4'-P energy: -74.643 bonds (distance) P-C4' energy: -79.818 flat angles C4'-P-C4' energy: -76.156 flat angles P-C4'-P energy: -35.909 tors. eta vs tors. theta energy: -37.867 Dist. restrs. and SS energy: -108.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -772.264324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.264324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.864324 (E_RNA) where: Base-Base interactions energy: -413.851 where: short stacking energy: -191.938 Base-Backbone interact. energy: 0.956 local terms energy: -272.968609 where: bonds (distance) C4'-P energy: -66.900 bonds (distance) P-C4' energy: -72.100 flat angles C4'-P-C4' energy: -60.748 flat angles P-C4'-P energy: -41.250 tors. eta vs tors. theta energy: -31.970 Dist. restrs. and SS energy: -86.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -589.042810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.042810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.242810 (E_RNA) where: Base-Base interactions energy: -271.303 where: short stacking energy: -131.078 Base-Backbone interact. energy: -1.218 local terms energy: -260.721417 where: bonds (distance) C4'-P energy: -64.559 bonds (distance) P-C4' energy: -77.333 flat angles C4'-P-C4' energy: -65.451 flat angles P-C4'-P energy: -40.897 tors. eta vs tors. theta energy: -12.481 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -543.169845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.169845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.369845 (E_RNA) where: Base-Base interactions energy: -252.618 where: short stacking energy: -149.202 Base-Backbone interact. energy: -0.892 local terms energy: -251.860514 where: bonds (distance) C4'-P energy: -53.630 bonds (distance) P-C4' energy: -80.541 flat angles C4'-P-C4' energy: -57.913 flat angles P-C4'-P energy: -52.910 tors. eta vs tors. theta energy: -6.866 Dist. restrs. and SS energy: -37.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -420.043165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.043165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.843165 (E_RNA) where: Base-Base interactions energy: -158.807 where: short stacking energy: -94.085 Base-Backbone interact. energy: 2.641 local terms energy: -220.677115 where: bonds (distance) C4'-P energy: -75.939 bonds (distance) P-C4' energy: -58.497 flat angles C4'-P-C4' energy: -54.079 flat angles P-C4'-P energy: -48.315 tors. eta vs tors. theta energy: 16.153 Dist. restrs. and SS energy: -43.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1130.626512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1130.626512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.026512 (E_RNA) where: Base-Base interactions energy: -685.324 where: short stacking energy: -306.552 Base-Backbone interact. energy: -2.027 local terms energy: -376.675762 where: bonds (distance) C4'-P energy: -81.087 bonds (distance) P-C4' energy: -84.734 flat angles C4'-P-C4' energy: -80.191 flat angles P-C4'-P energy: -63.887 tors. eta vs tors. theta energy: -66.777 Dist. restrs. and SS energy: -66.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1032.739086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.739086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.339086 (E_RNA) where: Base-Base interactions energy: -588.493 where: short stacking energy: -291.694 Base-Backbone interact. energy: -1.900 local terms energy: -364.946261 where: bonds (distance) C4'-P energy: -81.918 bonds (distance) P-C4' energy: -70.556 flat angles C4'-P-C4' energy: -85.877 flat angles P-C4'-P energy: -51.782 tors. eta vs tors. theta energy: -74.813 Dist. restrs. and SS energy: -77.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -987.017167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.017167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.017167 (E_RNA) where: Base-Base interactions energy: -622.542 where: short stacking energy: -295.284 Base-Backbone interact. energy: -2.736 local terms energy: -361.739330 where: bonds (distance) C4'-P energy: -84.343 bonds (distance) P-C4' energy: -76.739 flat angles C4'-P-C4' energy: -82.602 flat angles P-C4'-P energy: -41.857 tors. eta vs tors. theta energy: -76.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1009.098987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.098987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.298987 (E_RNA) where: Base-Base interactions energy: -548.997 where: short stacking energy: -272.313 Base-Backbone interact. energy: 1.917 local terms energy: -334.218344 where: bonds (distance) C4'-P energy: -77.502 bonds (distance) P-C4' energy: -70.808 flat angles C4'-P-C4' energy: -76.933 flat angles P-C4'-P energy: -46.795 tors. eta vs tors. theta energy: -62.180 Dist. restrs. and SS energy: -127.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -912.944908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.944908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -839.144908 (E_RNA) where: Base-Base interactions energy: -510.115 where: short stacking energy: -270.263 Base-Backbone interact. energy: -2.034 local terms energy: -326.996319 where: bonds (distance) C4'-P energy: -73.226 bonds (distance) P-C4' energy: -81.227 flat angles C4'-P-C4' energy: -76.128 flat angles P-C4'-P energy: -31.874 tors. eta vs tors. theta energy: -64.542 Dist. restrs. and SS energy: -73.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -804.264025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.264025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.664025 (E_RNA) where: Base-Base interactions energy: -405.341 where: short stacking energy: -203.620 Base-Backbone interact. energy: -0.563 local terms energy: -304.760026 where: bonds (distance) C4'-P energy: -61.282 bonds (distance) P-C4' energy: -83.252 flat angles C4'-P-C4' energy: -76.424 flat angles P-C4'-P energy: -47.463 tors. eta vs tors. theta energy: -36.340 Dist. restrs. and SS energy: -93.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -757.826063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.826063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.626063 (E_RNA) where: Base-Base interactions energy: -356.199 where: short stacking energy: -186.922 Base-Backbone interact. energy: -0.966 local terms energy: -294.461017 where: bonds (distance) C4'-P energy: -71.205 bonds (distance) P-C4' energy: -82.477 flat angles C4'-P-C4' energy: -65.571 flat angles P-C4'-P energy: -45.405 tors. eta vs tors. theta energy: -29.803 Dist. restrs. and SS energy: -106.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -587.786866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.786866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.386866 (E_RNA) where: Base-Base interactions energy: -270.569 where: short stacking energy: -142.775 Base-Backbone interact. energy: -2.945 local terms energy: -254.873717 where: bonds (distance) C4'-P energy: -74.183 bonds (distance) P-C4' energy: -69.134 flat angles C4'-P-C4' energy: -69.862 flat angles P-C4'-P energy: -34.445 tors. eta vs tors. theta energy: -7.249 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -501.167073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.167073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.167073 (E_RNA) where: Base-Base interactions energy: -242.305 where: short stacking energy: -146.704 Base-Backbone interact. energy: 0.254 local terms energy: -223.115179 where: bonds (distance) C4'-P energy: -42.134 bonds (distance) P-C4' energy: -67.140 flat angles C4'-P-C4' energy: -53.800 flat angles P-C4'-P energy: -46.234 tors. eta vs tors. theta energy: -13.806 Dist. restrs. and SS energy: -36.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -409.448613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.448613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.448613 (E_RNA) where: Base-Base interactions energy: -152.486 where: short stacking energy: -95.461 Base-Backbone interact. energy: 0.262 local terms energy: -212.224718 where: bonds (distance) C4'-P energy: -61.038 bonds (distance) P-C4' energy: -69.432 flat angles C4'-P-C4' energy: -56.509 flat angles P-C4'-P energy: -37.697 tors. eta vs tors. theta energy: 12.450 Dist. restrs. and SS energy: -45.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 6 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 2366495 moves confirmed later: 2794499 all moves confirmed: 5160994 percent of confirmed moves: 32.256212 current total energy: -1083.363389 recalc. total energy: -1083.363389 replica 10 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 2112786 moves confirmed later: 2455651 all moves confirmed: 4568437 percent of confirmed moves: 28.552731 current total energy: -999.290797 recalc. total energy: -999.290797 replica 5 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 2493225 moves confirmed later: 2951410 all moves confirmed: 5444635 percent of confirmed moves: 34.028969 current total energy: -935.711930 recalc. total energy: -935.711930 replica 3 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 1854351 moves confirmed later: 2072967 all moves confirmed: 3927318 percent of confirmed moves: 24.545738 current total energy: -979.671254 recalc. total energy: -979.671254 replica 4 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 2378434 moves confirmed later: 2818200 all moves confirmed: 5196634 percent of confirmed moves: 32.478963 current total energy: -843.222809 recalc. total energy: -843.222809 replica 7 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 2394487 moves confirmed later: 2830618 all moves confirmed: 5225105 percent of confirmed moves: 32.656906 current total energy: -753.761989 recalc. total energy: -753.761989 replica 9 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 2290189 moves confirmed later: 2692317 all moves confirmed: 4982506 percent of confirmed moves: 31.140663 current total energy: -658.475835 recalc. total energy: -658.475835 replica 2 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 2735539 moves confirmed later: 3245101 all moves confirmed: 5980640 percent of confirmed moves: 37.379000 current total energy: -457.688918 recalc. total energy: -457.688918 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 2903157 moves confirmed later: 3501231 all moves confirmed: 6404388 percent of confirmed moves: 40.027425 current total energy: -400.532148 recalc. total energy: -400.532148 replica 1 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 3015354 moves confirmed later: 3648735 all moves confirmed: 6664089 percent of confirmed moves: 41.650556 current total energy: -335.283978 recalc. total energy: -335.283978 out arg RESULTS//1/RNA_2_edited-a3f731bd_01 Time of doing 160000 iterations: 2345.198 seconds