SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ON9-U1-a759de55/inputs/seq.fa: 2 curr_seq: _GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC_ curr_seq: _UACUUACC_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: GGGAGUCAAGGGAGAGAGGGAGGAGCCCCCAAUUCUUCCAGGUAAGUACCUCUAAAACAUACCAGAUUUCGGUCUGGAGAGGUGAAGAAUACGACCACCUAUGUACCCCACGACCCUAUCACC chainId: B, chainSeq: UACUUACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 123 nucleotides chain B contains 8 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 665 n_atoms_counter: 665 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 131.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 131.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -501.777068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.777068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.527068 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -510.481815 where: bonds (distance) C4'-P energy: -127.277 bonds (distance) P-C4' energy: -118.989 flat angles C4'-P-C4' energy: -96.183 flat angles P-C4'-P energy: -110.024 tors. eta vs tors. theta energy: -58.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -635.001846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.001846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.751846 (E_RNA) where: Base-Base interactions energy: -274.966 where: short stacking energy: -269.492 Base-Backbone interact. energy: -0.161 local terms energy: -392.625276 where: bonds (distance) C4'-P energy: -84.271 bonds (distance) P-C4' energy: -85.605 flat angles C4'-P-C4' energy: -87.885 flat angles P-C4'-P energy: -60.215 tors. eta vs tors. theta energy: -74.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -633.822257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.822257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.572257 (E_RNA) where: Base-Base interactions energy: -299.284 where: short stacking energy: -286.920 Base-Backbone interact. energy: -0.184 local terms energy: -367.103551 where: bonds (distance) C4'-P energy: -75.524 bonds (distance) P-C4' energy: -77.536 flat angles C4'-P-C4' energy: -84.252 flat angles P-C4'-P energy: -62.126 tors. eta vs tors. theta energy: -67.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -592.393102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.393102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.143102 (E_RNA) where: Base-Base interactions energy: -273.956 where: short stacking energy: -268.172 Base-Backbone interact. energy: -0.224 local terms energy: -352.044362 where: bonds (distance) C4'-P energy: -82.226 bonds (distance) P-C4' energy: -75.498 flat angles C4'-P-C4' energy: -72.688 flat angles P-C4'-P energy: -50.725 tors. eta vs tors. theta energy: -70.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.081 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -528.051873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.051873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.801873 (E_RNA) where: Base-Base interactions energy: -232.056 where: short stacking energy: -222.393 Base-Backbone interact. energy: 1.010 local terms energy: -329.755702 where: bonds (distance) C4'-P energy: -83.874 bonds (distance) P-C4' energy: -78.007 flat angles C4'-P-C4' energy: -77.310 flat angles P-C4'-P energy: -48.866 tors. eta vs tors. theta energy: -41.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -505.688738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.688738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.438738 (E_RNA) where: Base-Base interactions energy: -69.978 where: short stacking energy: -69.978 Base-Backbone interact. energy: -0.000 local terms energy: -468.460214 where: bonds (distance) C4'-P energy: -109.834 bonds (distance) P-C4' energy: -100.422 flat angles C4'-P-C4' energy: -95.159 flat angles P-C4'-P energy: -101.482 tors. eta vs tors. theta energy: -61.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -504.071634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.071634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.821634 (E_RNA) where: Base-Base interactions energy: -37.352 where: short stacking energy: -37.352 Base-Backbone interact. energy: -0.000 local terms energy: -499.469052 where: bonds (distance) C4'-P energy: -121.031 bonds (distance) P-C4' energy: -114.498 flat angles C4'-P-C4' energy: -95.343 flat angles P-C4'-P energy: -108.251 tors. eta vs tors. theta energy: -60.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -507.831102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.831102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.581102 (E_RNA) where: Base-Base interactions energy: -73.465 where: short stacking energy: -73.465 Base-Backbone interact. energy: -0.000 local terms energy: -467.115485 where: bonds (distance) C4'-P energy: -105.841 bonds (distance) P-C4' energy: -104.646 flat angles C4'-P-C4' energy: -93.814 flat angles P-C4'-P energy: -101.293 tors. eta vs tors. theta energy: -61.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -501.270846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.270846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.020846 (E_RNA) where: Base-Base interactions energy: -24.543 where: short stacking energy: -24.543 Base-Backbone interact. energy: -0.000 local terms energy: -509.477367 where: bonds (distance) C4'-P energy: -127.045 bonds (distance) P-C4' energy: -118.975 flat angles C4'-P-C4' energy: -95.302 flat angles P-C4'-P energy: -109.864 tors. eta vs tors. theta energy: -58.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -501.269554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.269554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.019554 (E_RNA) where: Base-Base interactions energy: -24.542 where: short stacking energy: -24.542 Base-Backbone interact. energy: -0.000 local terms energy: -509.477367 where: bonds (distance) C4'-P energy: -127.045 bonds (distance) P-C4' energy: -118.975 flat angles C4'-P-C4' energy: -95.302 flat angles P-C4'-P energy: -109.864 tors. eta vs tors. theta energy: -58.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -501.186001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.186001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.936001 (E_RNA) where: Base-Base interactions energy: -24.045 where: short stacking energy: -24.045 Base-Backbone interact. energy: -0.000 local terms energy: -509.890748 where: bonds (distance) C4'-P energy: -127.161 bonds (distance) P-C4' energy: -118.982 flat angles C4'-P-C4' energy: -95.598 flat angles P-C4'-P energy: -109.986 tors. eta vs tors. theta energy: -58.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -635.593692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.593692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.343692 (E_RNA) where: Base-Base interactions energy: -302.412 where: short stacking energy: -299.435 Base-Backbone interact. energy: -0.675 local terms energy: -365.256833 where: bonds (distance) C4'-P energy: -75.222 bonds (distance) P-C4' energy: -83.570 flat angles C4'-P-C4' energy: -90.549 flat angles P-C4'-P energy: -53.074 tors. eta vs tors. theta energy: -62.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -629.814250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.814250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.564250 (E_RNA) where: Base-Base interactions energy: -299.971 where: short stacking energy: -277.476 Base-Backbone interact. energy: -0.593 local terms energy: -362.000221 where: bonds (distance) C4'-P energy: -86.076 bonds (distance) P-C4' energy: -84.697 flat angles C4'-P-C4' energy: -77.507 flat angles P-C4'-P energy: -40.637 tors. eta vs tors. theta energy: -73.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -576.470298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.470298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.220298 (E_RNA) where: Base-Base interactions energy: -278.936 where: short stacking energy: -230.042 Base-Backbone interact. energy: -1.065 local terms energy: -329.219192 where: bonds (distance) C4'-P energy: -76.509 bonds (distance) P-C4' energy: -82.133 flat angles C4'-P-C4' energy: -75.427 flat angles P-C4'-P energy: -46.016 tors. eta vs tors. theta energy: -49.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -502.433991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.433991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.183991 (E_RNA) where: Base-Base interactions energy: -200.672 where: short stacking energy: -190.416 Base-Backbone interact. energy: -0.900 local terms energy: -333.611856 where: bonds (distance) C4'-P energy: -69.514 bonds (distance) P-C4' energy: -78.798 flat angles C4'-P-C4' energy: -82.611 flat angles P-C4'-P energy: -56.902 tors. eta vs tors. theta energy: -45.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -483.429648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.429648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.179648 (E_RNA) where: Base-Base interactions energy: -208.355 where: short stacking energy: -149.409 Base-Backbone interact. energy: -2.028 local terms energy: -305.797042 where: bonds (distance) C4'-P energy: -78.854 bonds (distance) P-C4' energy: -75.159 flat angles C4'-P-C4' energy: -72.920 flat angles P-C4'-P energy: -56.161 tors. eta vs tors. theta energy: -22.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -407.855557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.855557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.605557 (E_RNA) where: Base-Base interactions energy: -154.047 where: short stacking energy: -147.789 Base-Backbone interact. energy: -1.357 local terms energy: -285.201207 where: bonds (distance) C4'-P energy: -68.780 bonds (distance) P-C4' energy: -75.076 flat angles C4'-P-C4' energy: -72.698 flat angles P-C4'-P energy: -56.793 tors. eta vs tors. theta energy: -11.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -412.563081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.563081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.313081 (E_RNA) where: Base-Base interactions energy: -189.710 where: short stacking energy: -138.001 Base-Backbone interact. energy: 4.443 local terms energy: -260.045594 where: bonds (distance) C4'-P energy: -72.123 bonds (distance) P-C4' energy: -78.912 flat angles C4'-P-C4' energy: -72.789 flat angles P-C4'-P energy: -33.065 tors. eta vs tors. theta energy: -3.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -385.015413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.015413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.765413 (E_RNA) where: Base-Base interactions energy: -193.285 where: short stacking energy: -135.952 Base-Backbone interact. energy: -1.307 local terms energy: -224.975453 where: bonds (distance) C4'-P energy: -64.422 bonds (distance) P-C4' energy: -72.009 flat angles C4'-P-C4' energy: -58.433 flat angles P-C4'-P energy: -41.523 tors. eta vs tors. theta energy: 11.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.802 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -407.316321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.316321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.066321 (E_RNA) where: Base-Base interactions energy: -209.038 where: short stacking energy: -138.972 Base-Backbone interact. energy: 1.878 local terms energy: -232.906050 where: bonds (distance) C4'-P energy: -63.601 bonds (distance) P-C4' energy: -78.751 flat angles C4'-P-C4' energy: -60.904 flat angles P-C4'-P energy: -31.032 tors. eta vs tors. theta energy: 1.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -300.737916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.737916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.487916 (E_RNA) where: Base-Base interactions energy: -117.719 where: short stacking energy: -102.221 Base-Backbone interact. energy: 4.568 local terms energy: -220.336367 where: bonds (distance) C4'-P energy: -65.856 bonds (distance) P-C4' energy: -75.290 flat angles C4'-P-C4' energy: -56.782 flat angles P-C4'-P energy: -33.297 tors. eta vs tors. theta energy: 10.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -747.374839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.374839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.124839 (E_RNA) where: Base-Base interactions energy: -390.975 where: short stacking energy: -293.304 Base-Backbone interact. energy: -0.624 local terms energy: -388.577004 where: bonds (distance) C4'-P energy: -86.967 bonds (distance) P-C4' energy: -92.288 flat angles C4'-P-C4' energy: -85.284 flat angles P-C4'-P energy: -53.311 tors. eta vs tors. theta energy: -70.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.051 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -671.323303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.323303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.073303 (E_RNA) where: Base-Base interactions energy: -334.271 where: short stacking energy: -247.556 Base-Backbone interact. energy: -1.588 local terms energy: -368.214249 where: bonds (distance) C4'-P energy: -89.208 bonds (distance) P-C4' energy: -85.652 flat angles C4'-P-C4' energy: -86.367 flat angles P-C4'-P energy: -55.847 tors. eta vs tors. theta energy: -51.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -629.361200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.361200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.111200 (E_RNA) where: Base-Base interactions energy: -348.495 where: short stacking energy: -237.838 Base-Backbone interact. energy: -2.500 local terms energy: -311.116650 where: bonds (distance) C4'-P energy: -79.276 bonds (distance) P-C4' energy: -82.851 flat angles C4'-P-C4' energy: -74.671 flat angles P-C4'-P energy: -36.391 tors. eta vs tors. theta energy: -37.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -543.455853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.455853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.205853 (E_RNA) where: Base-Base interactions energy: -268.769 where: short stacking energy: -181.986 Base-Backbone interact. energy: -1.495 local terms energy: -305.941800 where: bonds (distance) C4'-P energy: -68.340 bonds (distance) P-C4' energy: -81.658 flat angles C4'-P-C4' energy: -77.393 flat angles P-C4'-P energy: -53.184 tors. eta vs tors. theta energy: -25.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -563.789378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.789378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.539378 (E_RNA) where: Base-Base interactions energy: -322.710 where: short stacking energy: -180.090 Base-Backbone interact. energy: 0.618 local terms energy: -274.446677 where: bonds (distance) C4'-P energy: -67.504 bonds (distance) P-C4' energy: -59.391 flat angles C4'-P-C4' energy: -87.134 flat angles P-C4'-P energy: -39.602 tors. eta vs tors. theta energy: -20.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -466.398713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.398713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.148713 (E_RNA) where: Base-Base interactions energy: -235.089 where: short stacking energy: -160.718 Base-Backbone interact. energy: 0.785 local terms energy: -264.844914 where: bonds (distance) C4'-P energy: -61.110 bonds (distance) P-C4' energy: -76.269 flat angles C4'-P-C4' energy: -64.804 flat angles P-C4'-P energy: -38.277 tors. eta vs tors. theta energy: -24.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -437.680403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.680403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.430403 (E_RNA) where: Base-Base interactions energy: -220.661 where: short stacking energy: -158.330 Base-Backbone interact. energy: -0.337 local terms energy: -249.433137 where: bonds (distance) C4'-P energy: -72.299 bonds (distance) P-C4' energy: -60.804 flat angles C4'-P-C4' energy: -69.328 flat angles P-C4'-P energy: -33.865 tors. eta vs tors. theta energy: -13.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -350.090882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.090882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.840882 (E_RNA) where: Base-Base interactions energy: -119.262 where: short stacking energy: -113.052 Base-Backbone interact. energy: -1.639 local terms energy: -261.939912 where: bonds (distance) C4'-P energy: -73.922 bonds (distance) P-C4' energy: -78.817 flat angles C4'-P-C4' energy: -71.922 flat angles P-C4'-P energy: -31.561 tors. eta vs tors. theta energy: -5.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -387.765172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.765172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.515172 (E_RNA) where: Base-Base interactions energy: -197.255 where: short stacking energy: -111.920 Base-Backbone interact. energy: 2.069 local terms energy: -225.329152 where: bonds (distance) C4'-P energy: -63.061 bonds (distance) P-C4' energy: -71.024 flat angles C4'-P-C4' energy: -66.116 flat angles P-C4'-P energy: -30.783 tors. eta vs tors. theta energy: 5.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -303.742467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.742467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.492467 (E_RNA) where: Base-Base interactions energy: -129.948 where: short stacking energy: -88.374 Base-Backbone interact. energy: 0.715 local terms energy: -207.260160 where: bonds (distance) C4'-P energy: -70.452 bonds (distance) P-C4' energy: -74.903 flat angles C4'-P-C4' energy: -52.562 flat angles P-C4'-P energy: -31.061 tors. eta vs tors. theta energy: 21.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -785.935594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.935594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.685594 (E_RNA) where: Base-Base interactions energy: -442.215 where: short stacking energy: -319.749 Base-Backbone interact. energy: -1.022 local terms energy: -375.447750 where: bonds (distance) C4'-P energy: -76.624 bonds (distance) P-C4' energy: -80.995 flat angles C4'-P-C4' energy: -91.374 flat angles P-C4'-P energy: -47.092 tors. eta vs tors. theta energy: -79.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -699.019070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.019070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.769070 (E_RNA) where: Base-Base interactions energy: -375.602 where: short stacking energy: -245.687 Base-Backbone interact. energy: -1.687 local terms energy: -354.815232 where: bonds (distance) C4'-P energy: -92.314 bonds (distance) P-C4' energy: -85.473 flat angles C4'-P-C4' energy: -78.582 flat angles P-C4'-P energy: -49.074 tors. eta vs tors. theta energy: -49.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.335 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -643.360946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.360946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.110946 (E_RNA) where: Base-Base interactions energy: -353.797 where: short stacking energy: -246.081 Base-Backbone interact. energy: 1.884 local terms energy: -324.197965 where: bonds (distance) C4'-P energy: -71.939 bonds (distance) P-C4' energy: -80.020 flat angles C4'-P-C4' energy: -85.632 flat angles P-C4'-P energy: -44.250 tors. eta vs tors. theta energy: -42.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -681.974136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.974136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.724136 (E_RNA) where: Base-Base interactions energy: -368.267 where: short stacking energy: -241.697 Base-Backbone interact. energy: -1.759 local terms energy: -344.698620 where: bonds (distance) C4'-P energy: -73.483 bonds (distance) P-C4' energy: -86.229 flat angles C4'-P-C4' energy: -82.318 flat angles P-C4'-P energy: -43.034 tors. eta vs tors. theta energy: -59.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -663.417122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.417122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.167122 (E_RNA) where: Base-Base interactions energy: -380.975 where: short stacking energy: -206.182 Base-Backbone interact. energy: -2.751 local terms energy: -312.848039 where: bonds (distance) C4'-P energy: -67.481 bonds (distance) P-C4' energy: -85.336 flat angles C4'-P-C4' energy: -76.356 flat angles P-C4'-P energy: -44.362 tors. eta vs tors. theta energy: -39.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.407 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -500.689211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.689211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.439211 (E_RNA) where: Base-Base interactions energy: -244.682 where: short stacking energy: -179.959 Base-Backbone interact. energy: 0.996 local terms energy: -289.753260 where: bonds (distance) C4'-P energy: -60.427 bonds (distance) P-C4' energy: -78.036 flat angles C4'-P-C4' energy: -79.741 flat angles P-C4'-P energy: -48.887 tors. eta vs tors. theta energy: -22.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -461.615034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.615034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.365034 (E_RNA) where: Base-Base interactions energy: -219.800 where: short stacking energy: -156.331 Base-Backbone interact. energy: 2.368 local terms energy: -276.932800 where: bonds (distance) C4'-P energy: -75.650 bonds (distance) P-C4' energy: -75.682 flat angles C4'-P-C4' energy: -72.442 flat angles P-C4'-P energy: -34.366 tors. eta vs tors. theta energy: -18.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -434.870274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.870274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.620274 (E_RNA) where: Base-Base interactions energy: -209.903 where: short stacking energy: -142.277 Base-Backbone interact. energy: -0.196 local terms energy: -257.520494 where: bonds (distance) C4'-P energy: -77.853 bonds (distance) P-C4' energy: -72.001 flat angles C4'-P-C4' energy: -65.604 flat angles P-C4'-P energy: -34.216 tors. eta vs tors. theta energy: -7.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -392.672090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.672090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.422090 (E_RNA) where: Base-Base interactions energy: -200.180 where: short stacking energy: -123.461 Base-Backbone interact. energy: -0.859 local terms energy: -224.382865 where: bonds (distance) C4'-P energy: -75.649 bonds (distance) P-C4' energy: -64.671 flat angles C4'-P-C4' energy: -56.598 flat angles P-C4'-P energy: -29.865 tors. eta vs tors. theta energy: 2.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -308.884858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.884858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.634858 (E_RNA) where: Base-Base interactions energy: -137.901 where: short stacking energy: -98.337 Base-Backbone interact. energy: -2.415 local terms energy: -201.318472 where: bonds (distance) C4'-P energy: -53.636 bonds (distance) P-C4' energy: -67.106 flat angles C4'-P-C4' energy: -52.226 flat angles P-C4'-P energy: -32.322 tors. eta vs tors. theta energy: 3.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -866.776528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.776528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.526528 (E_RNA) where: Base-Base interactions energy: -506.734 where: short stacking energy: -312.939 Base-Backbone interact. energy: -0.263 local terms energy: -392.530092 where: bonds (distance) C4'-P energy: -91.520 bonds (distance) P-C4' energy: -93.114 flat angles C4'-P-C4' energy: -79.072 flat angles P-C4'-P energy: -62.439 tors. eta vs tors. theta energy: -66.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -746.326620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.326620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.076620 (E_RNA) where: Base-Base interactions energy: -429.094 where: short stacking energy: -272.679 Base-Backbone interact. energy: -0.019 local terms energy: -349.963360 where: bonds (distance) C4'-P energy: -84.990 bonds (distance) P-C4' energy: -86.272 flat angles C4'-P-C4' energy: -80.791 flat angles P-C4'-P energy: -49.724 tors. eta vs tors. theta energy: -48.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -791.138584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.138584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.888584 (E_RNA) where: Base-Base interactions energy: -466.422 where: short stacking energy: -298.756 Base-Backbone interact. energy: -2.046 local terms energy: -355.420537 where: bonds (distance) C4'-P energy: -75.647 bonds (distance) P-C4' energy: -75.664 flat angles C4'-P-C4' energy: -82.840 flat angles P-C4'-P energy: -56.888 tors. eta vs tors. theta energy: -64.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -645.946482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.946482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.696482 (E_RNA) where: Base-Base interactions energy: -375.085 where: short stacking energy: -226.465 Base-Backbone interact. energy: -1.800 local terms energy: -301.810989 where: bonds (distance) C4'-P energy: -69.945 bonds (distance) P-C4' energy: -74.454 flat angles C4'-P-C4' energy: -68.818 flat angles P-C4'-P energy: -43.149 tors. eta vs tors. theta energy: -45.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -652.185132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.185132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.935132 (E_RNA) where: Base-Base interactions energy: -370.180 where: short stacking energy: -211.441 Base-Backbone interact. energy: -0.177 local terms energy: -314.577980 where: bonds (distance) C4'-P energy: -68.900 bonds (distance) P-C4' energy: -86.959 flat angles C4'-P-C4' energy: -68.919 flat angles P-C4'-P energy: -53.719 tors. eta vs tors. theta energy: -36.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -526.791683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.791683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.541683 (E_RNA) where: Base-Base interactions energy: -274.837 where: short stacking energy: -181.417 Base-Backbone interact. energy: 0.208 local terms energy: -286.262651 where: bonds (distance) C4'-P energy: -74.412 bonds (distance) P-C4' energy: -70.602 flat angles C4'-P-C4' energy: -74.926 flat angles P-C4'-P energy: -44.861 tors. eta vs tors. theta energy: -21.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.350 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -501.545945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.545945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.295945 (E_RNA) where: Base-Base interactions energy: -289.570 where: short stacking energy: -160.688 Base-Backbone interact. energy: 0.670 local terms energy: -245.395664 where: bonds (distance) C4'-P energy: -73.162 bonds (distance) P-C4' energy: -74.169 flat angles C4'-P-C4' energy: -57.093 flat angles P-C4'-P energy: -32.925 tors. eta vs tors. theta energy: -8.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -419.343881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.343881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.093881 (E_RNA) where: Base-Base interactions energy: -204.002 where: short stacking energy: -135.575 Base-Backbone interact. energy: 0.126 local terms energy: -248.218378 where: bonds (distance) C4'-P energy: -65.775 bonds (distance) P-C4' energy: -76.997 flat angles C4'-P-C4' energy: -50.461 flat angles P-C4'-P energy: -47.440 tors. eta vs tors. theta energy: -7.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -383.251303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.251303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.001303 (E_RNA) where: Base-Base interactions energy: -181.293 where: short stacking energy: -122.343 Base-Backbone interact. energy: -1.606 local terms energy: -233.102757 where: bonds (distance) C4'-P energy: -62.322 bonds (distance) P-C4' energy: -81.273 flat angles C4'-P-C4' energy: -47.394 flat angles P-C4'-P energy: -45.857 tors. eta vs tors. theta energy: 3.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -378.861229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.861229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.611229 (E_RNA) where: Base-Base interactions energy: -188.000 where: short stacking energy: -126.647 Base-Backbone interact. energy: 3.388 local terms energy: -226.999753 where: bonds (distance) C4'-P energy: -73.140 bonds (distance) P-C4' energy: -55.988 flat angles C4'-P-C4' energy: -59.000 flat angles P-C4'-P energy: -34.916 tors. eta vs tors. theta energy: -3.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -849.826295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.826295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.576295 (E_RNA) where: Base-Base interactions energy: -529.531 where: short stacking energy: -326.935 Base-Backbone interact. energy: -0.785 local terms energy: -352.259891 where: bonds (distance) C4'-P energy: -81.239 bonds (distance) P-C4' energy: -83.099 flat angles C4'-P-C4' energy: -83.213 flat angles P-C4'-P energy: -48.879 tors. eta vs tors. theta energy: -55.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -743.779674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.779674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.529674 (E_RNA) where: Base-Base interactions energy: -414.911 where: short stacking energy: -262.557 Base-Backbone interact. energy: -4.486 local terms energy: -357.132631 where: bonds (distance) C4'-P energy: -84.897 bonds (distance) P-C4' energy: -79.295 flat angles C4'-P-C4' energy: -89.780 flat angles P-C4'-P energy: -47.094 tors. eta vs tors. theta energy: -56.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -801.426146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.426146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.176146 (E_RNA) where: Base-Base interactions energy: -497.352 where: short stacking energy: -264.172 Base-Backbone interact. energy: 0.823 local terms energy: -337.647653 where: bonds (distance) C4'-P energy: -78.781 bonds (distance) P-C4' energy: -72.295 flat angles C4'-P-C4' energy: -78.209 flat angles P-C4'-P energy: -57.934 tors. eta vs tors. theta energy: -50.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -723.984249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.984249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.734249 (E_RNA) where: Base-Base interactions energy: -438.663 where: short stacking energy: -254.941 Base-Backbone interact. energy: -1.359 local terms energy: -316.712222 where: bonds (distance) C4'-P energy: -71.097 bonds (distance) P-C4' energy: -78.789 flat angles C4'-P-C4' energy: -84.983 flat angles P-C4'-P energy: -41.766 tors. eta vs tors. theta energy: -40.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -602.989802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.989802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.739802 (E_RNA) where: Base-Base interactions energy: -337.387 where: short stacking energy: -220.863 Base-Backbone interact. energy: -1.465 local terms energy: -296.888378 where: bonds (distance) C4'-P energy: -74.891 bonds (distance) P-C4' energy: -68.228 flat angles C4'-P-C4' energy: -82.147 flat angles P-C4'-P energy: -31.430 tors. eta vs tors. theta energy: -40.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -629.681562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.681562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.431562 (E_RNA) where: Base-Base interactions energy: -385.119 where: short stacking energy: -195.636 Base-Backbone interact. energy: 0.331 local terms energy: -277.643850 where: bonds (distance) C4'-P energy: -65.156 bonds (distance) P-C4' energy: -74.117 flat angles C4'-P-C4' energy: -69.396 flat angles P-C4'-P energy: -44.228 tors. eta vs tors. theta energy: -24.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -548.890806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.890806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.640806 (E_RNA) where: Base-Base interactions energy: -298.815 where: short stacking energy: -176.553 Base-Backbone interact. energy: 2.273 local terms energy: -285.098084 where: bonds (distance) C4'-P energy: -64.998 bonds (distance) P-C4' energy: -70.121 flat angles C4'-P-C4' energy: -62.760 flat angles P-C4'-P energy: -55.024 tors. eta vs tors. theta energy: -32.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -511.384878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.384878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.134878 (E_RNA) where: Base-Base interactions energy: -260.339 where: short stacking energy: -154.643 Base-Backbone interact. energy: -1.245 local terms energy: -282.550881 where: bonds (distance) C4'-P energy: -66.517 bonds (distance) P-C4' energy: -82.359 flat angles C4'-P-C4' energy: -68.211 flat angles P-C4'-P energy: -45.366 tors. eta vs tors. theta energy: -20.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -393.073592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.073592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.823592 (E_RNA) where: Base-Base interactions energy: -191.346 where: short stacking energy: -125.220 Base-Backbone interact. energy: 0.863 local terms energy: -235.340773 where: bonds (distance) C4'-P energy: -63.813 bonds (distance) P-C4' energy: -71.903 flat angles C4'-P-C4' energy: -51.662 flat angles P-C4'-P energy: -50.845 tors. eta vs tors. theta energy: 2.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -367.334245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.334245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.084245 (E_RNA) where: Base-Base interactions energy: -185.647 where: short stacking energy: -127.608 Base-Backbone interact. energy: 3.595 local terms energy: -218.032001 where: bonds (distance) C4'-P energy: -63.320 bonds (distance) P-C4' energy: -63.169 flat angles C4'-P-C4' energy: -51.707 flat angles P-C4'-P energy: -40.397 tors. eta vs tors. theta energy: 0.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -856.973083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.973083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.723083 (E_RNA) where: Base-Base interactions energy: -498.578 where: short stacking energy: -290.152 Base-Backbone interact. energy: -1.897 local terms energy: -389.247675 where: bonds (distance) C4'-P energy: -89.504 bonds (distance) P-C4' energy: -89.149 flat angles C4'-P-C4' energy: -81.599 flat angles P-C4'-P energy: -60.646 tors. eta vs tors. theta energy: -68.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -799.430452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.430452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.180452 (E_RNA) where: Base-Base interactions energy: -472.884 where: short stacking energy: -271.070 Base-Backbone interact. energy: -2.482 local terms energy: -356.813762 where: bonds (distance) C4'-P energy: -79.035 bonds (distance) P-C4' energy: -79.175 flat angles C4'-P-C4' energy: -81.208 flat angles P-C4'-P energy: -50.528 tors. eta vs tors. theta energy: -66.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -837.634586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.634586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -870.384586 (E_RNA) where: Base-Base interactions energy: -518.008 where: short stacking energy: -276.885 Base-Backbone interact. energy: -1.365 local terms energy: -351.011373 where: bonds (distance) C4'-P energy: -70.511 bonds (distance) P-C4' energy: -82.885 flat angles C4'-P-C4' energy: -87.960 flat angles P-C4'-P energy: -51.351 tors. eta vs tors. theta energy: -58.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -757.638052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -757.638052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.388052 (E_RNA) where: Base-Base interactions energy: -458.671 where: short stacking energy: -266.334 Base-Backbone interact. energy: -0.073 local terms energy: -331.644157 where: bonds (distance) C4'-P energy: -75.508 bonds (distance) P-C4' energy: -69.820 flat angles C4'-P-C4' energy: -78.818 flat angles P-C4'-P energy: -49.741 tors. eta vs tors. theta energy: -57.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -754.265646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.265646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -787.015646 (E_RNA) where: Base-Base interactions energy: -478.480 where: short stacking energy: -225.400 Base-Backbone interact. energy: -1.305 local terms energy: -307.230044 where: bonds (distance) C4'-P energy: -82.056 bonds (distance) P-C4' energy: -71.843 flat angles C4'-P-C4' energy: -60.406 flat angles P-C4'-P energy: -43.752 tors. eta vs tors. theta energy: -49.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -598.033908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.033908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.783908 (E_RNA) where: Base-Base interactions energy: -341.045 where: short stacking energy: -201.430 Base-Backbone interact. energy: 0.385 local terms energy: -290.123715 where: bonds (distance) C4'-P energy: -58.822 bonds (distance) P-C4' energy: -66.447 flat angles C4'-P-C4' energy: -71.532 flat angles P-C4'-P energy: -50.433 tors. eta vs tors. theta energy: -42.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -602.248651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.248651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -634.998651 (E_RNA) where: Base-Base interactions energy: -332.324 where: short stacking energy: -206.728 Base-Backbone interact. energy: 3.643 local terms energy: -306.317447 where: bonds (distance) C4'-P energy: -67.283 bonds (distance) P-C4' energy: -76.989 flat angles C4'-P-C4' energy: -85.700 flat angles P-C4'-P energy: -44.444 tors. eta vs tors. theta energy: -31.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -465.486057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.486057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.236057 (E_RNA) where: Base-Base interactions energy: -269.757 where: short stacking energy: -125.395 Base-Backbone interact. energy: -1.308 local terms energy: -227.171239 where: bonds (distance) C4'-P energy: -72.703 bonds (distance) P-C4' energy: -78.451 flat angles C4'-P-C4' energy: -56.373 flat angles P-C4'-P energy: -29.737 tors. eta vs tors. theta energy: 10.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -402.383622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.383622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.133622 (E_RNA) where: Base-Base interactions energy: -189.612 where: short stacking energy: -127.303 Base-Backbone interact. energy: 8.889 local terms energy: -254.554252 where: bonds (distance) C4'-P energy: -63.468 bonds (distance) P-C4' energy: -84.253 flat angles C4'-P-C4' energy: -55.302 flat angles P-C4'-P energy: -42.103 tors. eta vs tors. theta energy: -9.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.144 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -408.145559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.145559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.895559 (E_RNA) where: Base-Base interactions energy: -212.634 where: short stacking energy: -134.174 Base-Backbone interact. energy: 3.551 local terms energy: -231.812339 where: bonds (distance) C4'-P energy: -58.894 bonds (distance) P-C4' energy: -82.970 flat angles C4'-P-C4' energy: -57.449 flat angles P-C4'-P energy: -41.626 tors. eta vs tors. theta energy: 9.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -866.420406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.420406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.170406 (E_RNA) where: Base-Base interactions energy: -530.360 where: short stacking energy: -286.877 Base-Backbone interact. energy: -1.178 local terms energy: -367.632224 where: bonds (distance) C4'-P energy: -85.353 bonds (distance) P-C4' energy: -80.329 flat angles C4'-P-C4' energy: -86.881 flat angles P-C4'-P energy: -55.475 tors. eta vs tors. theta energy: -59.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -880.224997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.224997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.974997 (E_RNA) where: Base-Base interactions energy: -558.483 where: short stacking energy: -251.508 Base-Backbone interact. energy: -1.400 local terms energy: -353.091366 where: bonds (distance) C4'-P energy: -79.284 bonds (distance) P-C4' energy: -85.039 flat angles C4'-P-C4' energy: -74.404 flat angles P-C4'-P energy: -57.458 tors. eta vs tors. theta energy: -56.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -820.189427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.189427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.939427 (E_RNA) where: Base-Base interactions energy: -498.855 where: short stacking energy: -278.344 Base-Backbone interact. energy: -0.264 local terms energy: -353.820416 where: bonds (distance) C4'-P energy: -70.694 bonds (distance) P-C4' energy: -79.360 flat angles C4'-P-C4' energy: -81.428 flat angles P-C4'-P energy: -57.404 tors. eta vs tors. theta energy: -64.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -810.486753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.486753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.236753 (E_RNA) where: Base-Base interactions energy: -498.056 where: short stacking energy: -304.793 Base-Backbone interact. energy: 0.337 local terms energy: -345.517403 where: bonds (distance) C4'-P energy: -68.894 bonds (distance) P-C4' energy: -78.178 flat angles C4'-P-C4' energy: -84.359 flat angles P-C4'-P energy: -42.665 tors. eta vs tors. theta energy: -71.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -798.696291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -798.696291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.446291 (E_RNA) where: Base-Base interactions energy: -497.611 where: short stacking energy: -260.053 Base-Backbone interact. energy: 0.382 local terms energy: -334.217496 where: bonds (distance) C4'-P energy: -67.719 bonds (distance) P-C4' energy: -81.930 flat angles C4'-P-C4' energy: -81.689 flat angles P-C4'-P energy: -54.249 tors. eta vs tors. theta energy: -48.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -604.505472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.505472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.255472 (E_RNA) where: Base-Base interactions energy: -350.926 where: short stacking energy: -206.578 Base-Backbone interact. energy: -2.061 local terms energy: -284.268739 where: bonds (distance) C4'-P energy: -70.487 bonds (distance) P-C4' energy: -64.428 flat angles C4'-P-C4' energy: -78.650 flat angles P-C4'-P energy: -44.854 tors. eta vs tors. theta energy: -25.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -548.952847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.952847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.702847 (E_RNA) where: Base-Base interactions energy: -309.651 where: short stacking energy: -186.267 Base-Backbone interact. energy: -0.989 local terms energy: -271.062681 where: bonds (distance) C4'-P energy: -83.125 bonds (distance) P-C4' energy: -70.718 flat angles C4'-P-C4' energy: -54.654 flat angles P-C4'-P energy: -43.923 tors. eta vs tors. theta energy: -18.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -510.569487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.569487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.319487 (E_RNA) where: Base-Base interactions energy: -269.987 where: short stacking energy: -156.483 Base-Backbone interact. energy: 3.787 local terms energy: -277.119789 where: bonds (distance) C4'-P energy: -74.209 bonds (distance) P-C4' energy: -76.281 flat angles C4'-P-C4' energy: -69.358 flat angles P-C4'-P energy: -32.780 tors. eta vs tors. theta energy: -24.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -408.973806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.973806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.723806 (E_RNA) where: Base-Base interactions energy: -216.833 where: short stacking energy: -129.953 Base-Backbone interact. energy: 0.307 local terms energy: -226.865680 where: bonds (distance) C4'-P energy: -59.101 bonds (distance) P-C4' energy: -73.251 flat angles C4'-P-C4' energy: -46.875 flat angles P-C4'-P energy: -45.325 tors. eta vs tors. theta energy: -2.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.668 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -382.407463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.407463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.157463 (E_RNA) where: Base-Base interactions energy: -196.790 where: short stacking energy: -125.811 Base-Backbone interact. energy: 2.429 local terms energy: -220.797175 where: bonds (distance) C4'-P energy: -67.691 bonds (distance) P-C4' energy: -70.949 flat angles C4'-P-C4' energy: -61.889 flat angles P-C4'-P energy: -24.268 tors. eta vs tors. theta energy: 4.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -980.844675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.844675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.594675 (E_RNA) where: Base-Base interactions energy: -630.222 where: short stacking energy: -316.508 Base-Backbone interact. energy: -1.293 local terms energy: -382.079208 where: bonds (distance) C4'-P energy: -85.753 bonds (distance) P-C4' energy: -82.805 flat angles C4'-P-C4' energy: -89.384 flat angles P-C4'-P energy: -57.432 tors. eta vs tors. theta energy: -66.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -857.297941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.297941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.047941 (E_RNA) where: Base-Base interactions energy: -531.148 where: short stacking energy: -292.875 Base-Backbone interact. energy: -1.525 local terms energy: -357.374585 where: bonds (distance) C4'-P energy: -77.404 bonds (distance) P-C4' energy: -79.070 flat angles C4'-P-C4' energy: -80.776 flat angles P-C4'-P energy: -52.991 tors. eta vs tors. theta energy: -67.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -891.266727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -891.266727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -924.016727 (E_RNA) where: Base-Base interactions energy: -540.549 where: short stacking energy: -306.386 Base-Backbone interact. energy: -1.848 local terms energy: -381.619134 where: bonds (distance) C4'-P energy: -67.866 bonds (distance) P-C4' energy: -90.175 flat angles C4'-P-C4' energy: -87.877 flat angles P-C4'-P energy: -53.613 tors. eta vs tors. theta energy: -82.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -894.971918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.971918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.721918 (E_RNA) where: Base-Base interactions energy: -588.141 where: short stacking energy: -326.362 Base-Backbone interact. energy: 1.856 local terms energy: -341.437687 where: bonds (distance) C4'-P energy: -73.099 bonds (distance) P-C4' energy: -78.149 flat angles C4'-P-C4' energy: -67.876 flat angles P-C4'-P energy: -42.312 tors. eta vs tors. theta energy: -80.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -839.655065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -839.655065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.405065 (E_RNA) where: Base-Base interactions energy: -533.666 where: short stacking energy: -272.795 Base-Backbone interact. energy: -3.360 local terms energy: -335.379310 where: bonds (distance) C4'-P energy: -62.102 bonds (distance) P-C4' energy: -82.072 flat angles C4'-P-C4' energy: -76.910 flat angles P-C4'-P energy: -53.628 tors. eta vs tors. theta energy: -60.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -573.185451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.185451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.935451 (E_RNA) where: Base-Base interactions energy: -317.430 where: short stacking energy: -198.224 Base-Backbone interact. energy: -0.371 local terms energy: -288.135136 where: bonds (distance) C4'-P energy: -68.123 bonds (distance) P-C4' energy: -81.412 flat angles C4'-P-C4' energy: -73.441 flat angles P-C4'-P energy: -35.941 tors. eta vs tors. theta energy: -29.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -529.300507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.300507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.050507 (E_RNA) where: Base-Base interactions energy: -289.661 where: short stacking energy: -175.192 Base-Backbone interact. energy: 0.214 local terms energy: -272.603719 where: bonds (distance) C4'-P energy: -60.106 bonds (distance) P-C4' energy: -71.211 flat angles C4'-P-C4' energy: -71.240 flat angles P-C4'-P energy: -45.640 tors. eta vs tors. theta energy: -24.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -481.173396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.173396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.923396 (E_RNA) where: Base-Base interactions energy: -249.746 where: short stacking energy: -136.401 Base-Backbone interact. energy: -1.361 local terms energy: -262.817208 where: bonds (distance) C4'-P energy: -72.395 bonds (distance) P-C4' energy: -67.319 flat angles C4'-P-C4' energy: -67.074 flat angles P-C4'-P energy: -40.202 tors. eta vs tors. theta energy: -15.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -421.178559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.178559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.928559 (E_RNA) where: Base-Base interactions energy: -238.523 where: short stacking energy: -130.726 Base-Backbone interact. energy: -1.582 local terms energy: -213.824521 where: bonds (distance) C4'-P energy: -49.079 bonds (distance) P-C4' energy: -64.335 flat angles C4'-P-C4' energy: -62.863 flat angles P-C4'-P energy: -43.533 tors. eta vs tors. theta energy: 5.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -370.478773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.478773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.228773 (E_RNA) where: Base-Base interactions energy: -179.356 where: short stacking energy: -136.943 Base-Backbone interact. energy: 1.138 local terms energy: -225.010183 where: bonds (distance) C4'-P energy: -70.014 bonds (distance) P-C4' energy: -72.665 flat angles C4'-P-C4' energy: -60.532 flat angles P-C4'-P energy: -25.477 tors. eta vs tors. theta energy: 3.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -989.442341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.442341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.192341 (E_RNA) where: Base-Base interactions energy: -634.405 where: short stacking energy: -286.219 Base-Backbone interact. energy: -1.798 local terms energy: -385.990238 where: bonds (distance) C4'-P energy: -92.324 bonds (distance) P-C4' energy: -90.885 flat angles C4'-P-C4' energy: -89.278 flat angles P-C4'-P energy: -57.100 tors. eta vs tors. theta energy: -56.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -910.884408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.884408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.634408 (E_RNA) where: Base-Base interactions energy: -586.341 where: short stacking energy: -273.716 Base-Backbone interact. energy: -0.814 local terms energy: -356.479538 where: bonds (distance) C4'-P energy: -73.783 bonds (distance) P-C4' energy: -82.592 flat angles C4'-P-C4' energy: -80.854 flat angles P-C4'-P energy: -54.295 tors. eta vs tors. theta energy: -64.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -861.326983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.326983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.076983 (E_RNA) where: Base-Base interactions energy: -558.653 where: short stacking energy: -285.338 Base-Backbone interact. energy: -2.038 local terms energy: -333.385608 where: bonds (distance) C4'-P energy: -72.801 bonds (distance) P-C4' energy: -76.453 flat angles C4'-P-C4' energy: -78.705 flat angles P-C4'-P energy: -51.046 tors. eta vs tors. theta energy: -54.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -859.954541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.954541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.704541 (E_RNA) where: Base-Base interactions energy: -549.999 where: short stacking energy: -281.406 Base-Backbone interact. energy: -0.130 local terms energy: -342.575448 where: bonds (distance) C4'-P energy: -82.636 bonds (distance) P-C4' energy: -74.175 flat angles C4'-P-C4' energy: -81.622 flat angles P-C4'-P energy: -43.908 tors. eta vs tors. theta energy: -60.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -858.458715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.458715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -891.208715 (E_RNA) where: Base-Base interactions energy: -524.471 where: short stacking energy: -293.986 Base-Backbone interact. energy: -1.355 local terms energy: -365.381766 where: bonds (distance) C4'-P energy: -75.180 bonds (distance) P-C4' energy: -71.941 flat angles C4'-P-C4' energy: -86.545 flat angles P-C4'-P energy: -45.422 tors. eta vs tors. theta energy: -86.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -618.435296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.435296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.185296 (E_RNA) where: Base-Base interactions energy: -356.620 where: short stacking energy: -187.656 Base-Backbone interact. energy: 4.252 local terms energy: -298.816979 where: bonds (distance) C4'-P energy: -79.709 bonds (distance) P-C4' energy: -80.140 flat angles C4'-P-C4' energy: -72.798 flat angles P-C4'-P energy: -44.337 tors. eta vs tors. theta energy: -21.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -540.033656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.033656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.783656 (E_RNA) where: Base-Base interactions energy: -272.499 where: short stacking energy: -175.105 Base-Backbone interact. energy: -1.251 local terms energy: -299.033195 where: bonds (distance) C4'-P energy: -79.819 bonds (distance) P-C4' energy: -69.145 flat angles C4'-P-C4' energy: -65.898 flat angles P-C4'-P energy: -51.450 tors. eta vs tors. theta energy: -32.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -456.464229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.464229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.214229 (E_RNA) where: Base-Base interactions energy: -263.304 where: short stacking energy: -149.120 Base-Backbone interact. energy: -1.209 local terms energy: -225.118893 where: bonds (distance) C4'-P energy: -58.626 bonds (distance) P-C4' energy: -65.613 flat angles C4'-P-C4' energy: -65.437 flat angles P-C4'-P energy: -28.622 tors. eta vs tors. theta energy: -6.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.417 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -438.013166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.013166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.763166 (E_RNA) where: Base-Base interactions energy: -221.953 where: short stacking energy: -143.545 Base-Backbone interact. energy: 0.974 local terms energy: -249.783772 where: bonds (distance) C4'-P energy: -63.334 bonds (distance) P-C4' energy: -77.835 flat angles C4'-P-C4' energy: -61.573 flat angles P-C4'-P energy: -36.376 tors. eta vs tors. theta energy: -10.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -387.957308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.957308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.707308 (E_RNA) where: Base-Base interactions energy: -194.320 where: short stacking energy: -137.758 Base-Backbone interact. energy: 4.816 local terms energy: -231.203728 where: bonds (distance) C4'-P energy: -55.107 bonds (distance) P-C4' energy: -75.354 flat angles C4'-P-C4' energy: -67.163 flat angles P-C4'-P energy: -20.153 tors. eta vs tors. theta energy: -13.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1017.480034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.480034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.230034 (E_RNA) where: Base-Base interactions energy: -663.834 where: short stacking energy: -304.663 Base-Backbone interact. energy: -2.220 local terms energy: -384.176630 where: bonds (distance) C4'-P energy: -86.141 bonds (distance) P-C4' energy: -86.016 flat angles C4'-P-C4' energy: -88.583 flat angles P-C4'-P energy: -59.603 tors. eta vs tors. theta energy: -63.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -982.027170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.027170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.777170 (E_RNA) where: Base-Base interactions energy: -634.914 where: short stacking energy: -326.227 Base-Backbone interact. energy: -0.780 local terms energy: -379.083230 where: bonds (distance) C4'-P energy: -91.676 bonds (distance) P-C4' energy: -73.263 flat angles C4'-P-C4' energy: -72.196 flat angles P-C4'-P energy: -60.491 tors. eta vs tors. theta energy: -81.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -923.866635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.866635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.616635 (E_RNA) where: Base-Base interactions energy: -591.472 where: short stacking energy: -290.933 Base-Backbone interact. energy: -1.504 local terms energy: -363.640616 where: bonds (distance) C4'-P energy: -83.369 bonds (distance) P-C4' energy: -77.980 flat angles C4'-P-C4' energy: -81.027 flat angles P-C4'-P energy: -51.230 tors. eta vs tors. theta energy: -70.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -777.712798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.712798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.462798 (E_RNA) where: Base-Base interactions energy: -491.951 where: short stacking energy: -249.644 Base-Backbone interact. energy: -1.105 local terms energy: -317.407684 where: bonds (distance) C4'-P energy: -86.252 bonds (distance) P-C4' energy: -71.708 flat angles C4'-P-C4' energy: -71.825 flat angles P-C4'-P energy: -50.733 tors. eta vs tors. theta energy: -36.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -889.796900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.796900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.546900 (E_RNA) where: Base-Base interactions energy: -538.103 where: short stacking energy: -278.083 Base-Backbone interact. energy: -1.569 local terms energy: -382.874473 where: bonds (distance) C4'-P energy: -79.300 bonds (distance) P-C4' energy: -89.067 flat angles C4'-P-C4' energy: -84.873 flat angles P-C4'-P energy: -47.318 tors. eta vs tors. theta energy: -82.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -621.846065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.846065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.596065 (E_RNA) where: Base-Base interactions energy: -337.505 where: short stacking energy: -202.686 Base-Backbone interact. energy: -0.086 local terms energy: -317.005115 where: bonds (distance) C4'-P energy: -74.828 bonds (distance) P-C4' energy: -80.486 flat angles C4'-P-C4' energy: -84.513 flat angles P-C4'-P energy: -27.111 tors. eta vs tors. theta energy: -50.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -480.516847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.516847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.266847 (E_RNA) where: Base-Base interactions energy: -245.250 where: short stacking energy: -161.281 Base-Backbone interact. energy: -2.941 local terms energy: -266.717622 where: bonds (distance) C4'-P energy: -73.181 bonds (distance) P-C4' energy: -65.942 flat angles C4'-P-C4' energy: -77.609 flat angles P-C4'-P energy: -41.371 tors. eta vs tors. theta energy: -8.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.642 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -512.909667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.909667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.659667 (E_RNA) where: Base-Base interactions energy: -294.721 where: short stacking energy: -179.626 Base-Backbone interact. energy: -0.208 local terms energy: -250.730935 where: bonds (distance) C4'-P energy: -61.207 bonds (distance) P-C4' energy: -69.196 flat angles C4'-P-C4' energy: -61.136 flat angles P-C4'-P energy: -37.403 tors. eta vs tors. theta energy: -21.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -382.047001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.047001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.797001 (E_RNA) where: Base-Base interactions energy: -185.499 where: short stacking energy: -126.450 Base-Backbone interact. energy: -2.053 local terms energy: -227.245721 where: bonds (distance) C4'-P energy: -67.863 bonds (distance) P-C4' energy: -62.681 flat angles C4'-P-C4' energy: -59.825 flat angles P-C4'-P energy: -33.937 tors. eta vs tors. theta energy: -2.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -409.261439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.261439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.011439 (E_RNA) where: Base-Base interactions energy: -197.377 where: short stacking energy: -126.738 Base-Backbone interact. energy: 2.254 local terms energy: -246.888148 where: bonds (distance) C4'-P energy: -70.705 bonds (distance) P-C4' energy: -72.631 flat angles C4'-P-C4' energy: -60.998 flat angles P-C4'-P energy: -44.623 tors. eta vs tors. theta energy: 2.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1052.291627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.291627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.041627 (E_RNA) where: Base-Base interactions energy: -696.826 where: short stacking energy: -346.239 Base-Backbone interact. energy: -3.104 local terms energy: -385.111183 where: bonds (distance) C4'-P energy: -84.292 bonds (distance) P-C4' energy: -76.246 flat angles C4'-P-C4' energy: -86.793 flat angles P-C4'-P energy: -57.330 tors. eta vs tors. theta energy: -80.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1114.616927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.616927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.366927 (E_RNA) where: Base-Base interactions energy: -728.836 where: short stacking energy: -372.599 Base-Backbone interact. energy: -0.488 local terms energy: -418.042815 where: bonds (distance) C4'-P energy: -79.766 bonds (distance) P-C4' energy: -80.477 flat angles C4'-P-C4' energy: -85.785 flat angles P-C4'-P energy: -65.629 tors. eta vs tors. theta energy: -106.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -923.847796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.847796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.597796 (E_RNA) where: Base-Base interactions energy: -592.326 where: short stacking energy: -294.253 Base-Backbone interact. energy: -0.125 local terms energy: -364.147440 where: bonds (distance) C4'-P energy: -84.172 bonds (distance) P-C4' energy: -72.791 flat angles C4'-P-C4' energy: -80.195 flat angles P-C4'-P energy: -53.522 tors. eta vs tors. theta energy: -73.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -869.923977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.923977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.673977 (E_RNA) where: Base-Base interactions energy: -553.372 where: short stacking energy: -278.560 Base-Backbone interact. energy: -2.959 local terms energy: -346.343905 where: bonds (distance) C4'-P energy: -74.316 bonds (distance) P-C4' energy: -82.048 flat angles C4'-P-C4' energy: -75.053 flat angles P-C4'-P energy: -49.359 tors. eta vs tors. theta energy: -65.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -737.254269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.254269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.004269 (E_RNA) where: Base-Base interactions energy: -455.266 where: short stacking energy: -216.866 Base-Backbone interact. energy: 4.939 local terms energy: -319.676552 where: bonds (distance) C4'-P energy: -73.662 bonds (distance) P-C4' energy: -75.717 flat angles C4'-P-C4' energy: -80.124 flat angles P-C4'-P energy: -51.582 tors. eta vs tors. theta energy: -38.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -605.447524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.447524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.197524 (E_RNA) where: Base-Base interactions energy: -332.242 where: short stacking energy: -194.010 Base-Backbone interact. energy: -1.093 local terms energy: -304.920255 where: bonds (distance) C4'-P energy: -85.446 bonds (distance) P-C4' energy: -71.658 flat angles C4'-P-C4' energy: -72.997 flat angles P-C4'-P energy: -42.389 tors. eta vs tors. theta energy: -32.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.057 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -457.156343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.156343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.906343 (E_RNA) where: Base-Base interactions energy: -252.854 where: short stacking energy: -151.106 Base-Backbone interact. energy: 1.793 local terms energy: -239.016637 where: bonds (distance) C4'-P energy: -80.357 bonds (distance) P-C4' energy: -73.911 flat angles C4'-P-C4' energy: -59.013 flat angles P-C4'-P energy: -23.906 tors. eta vs tors. theta energy: -1.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.171 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -484.223294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.223294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.973294 (E_RNA) where: Base-Base interactions energy: -272.666 where: short stacking energy: -138.038 Base-Backbone interact. energy: 2.242 local terms energy: -246.549340 where: bonds (distance) C4'-P energy: -69.701 bonds (distance) P-C4' energy: -73.853 flat angles C4'-P-C4' energy: -61.259 flat angles P-C4'-P energy: -36.125 tors. eta vs tors. theta energy: -5.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -394.817476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.817476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.567476 (E_RNA) where: Base-Base interactions energy: -188.728 where: short stacking energy: -120.295 Base-Backbone interact. energy: 3.552 local terms energy: -242.392067 where: bonds (distance) C4'-P energy: -61.392 bonds (distance) P-C4' energy: -70.548 flat angles C4'-P-C4' energy: -71.104 flat angles P-C4'-P energy: -37.008 tors. eta vs tors. theta energy: -2.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -400.282046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.282046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.032046 (E_RNA) where: Base-Base interactions energy: -197.375 where: short stacking energy: -107.072 Base-Backbone interact. energy: 1.311 local terms energy: -239.232749 where: bonds (distance) C4'-P energy: -71.139 bonds (distance) P-C4' energy: -73.336 flat angles C4'-P-C4' energy: -62.644 flat angles P-C4'-P energy: -42.161 tors. eta vs tors. theta energy: 10.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.265 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1150.575463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.575463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1183.325463 (E_RNA) where: Base-Base interactions energy: -766.487 where: short stacking energy: -374.171 Base-Backbone interact. energy: -0.015 local terms energy: -416.823113 where: bonds (distance) C4'-P energy: -81.376 bonds (distance) P-C4' energy: -73.490 flat angles C4'-P-C4' energy: -90.980 flat angles P-C4'-P energy: -60.787 tors. eta vs tors. theta energy: -110.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1019.223659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.223659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.973659 (E_RNA) where: Base-Base interactions energy: -685.952 where: short stacking energy: -321.147 Base-Backbone interact. energy: -2.704 local terms energy: -363.317012 where: bonds (distance) C4'-P energy: -86.647 bonds (distance) P-C4' energy: -71.778 flat angles C4'-P-C4' energy: -79.114 flat angles P-C4'-P energy: -37.150 tors. eta vs tors. theta energy: -88.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -936.610029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.610029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.360029 (E_RNA) where: Base-Base interactions energy: -603.007 where: short stacking energy: -287.095 Base-Backbone interact. energy: -3.628 local terms energy: -362.724479 where: bonds (distance) C4'-P energy: -76.826 bonds (distance) P-C4' energy: -82.236 flat angles C4'-P-C4' energy: -84.859 flat angles P-C4'-P energy: -42.775 tors. eta vs tors. theta energy: -76.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -853.593265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.593265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -886.343265 (E_RNA) where: Base-Base interactions energy: -539.966 where: short stacking energy: -290.887 Base-Backbone interact. energy: -0.753 local terms energy: -345.624541 where: bonds (distance) C4'-P energy: -73.662 bonds (distance) P-C4' energy: -76.845 flat angles C4'-P-C4' energy: -75.219 flat angles P-C4'-P energy: -54.200 tors. eta vs tors. theta energy: -65.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -705.322572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.322572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.072572 (E_RNA) where: Base-Base interactions energy: -435.265 where: short stacking energy: -223.338 Base-Backbone interact. energy: -2.699 local terms energy: -301.151033 where: bonds (distance) C4'-P energy: -71.998 bonds (distance) P-C4' energy: -79.281 flat angles C4'-P-C4' energy: -69.080 flat angles P-C4'-P energy: -39.688 tors. eta vs tors. theta energy: -41.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.043 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -613.988964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.988964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.738964 (E_RNA) where: Base-Base interactions energy: -347.498 where: short stacking energy: -202.205 Base-Backbone interact. energy: 3.457 local terms energy: -302.698679 where: bonds (distance) C4'-P energy: -73.290 bonds (distance) P-C4' energy: -73.700 flat angles C4'-P-C4' energy: -80.671 flat angles P-C4'-P energy: -43.963 tors. eta vs tors. theta energy: -31.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -637.721157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.721157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.471157 (E_RNA) where: Base-Base interactions energy: -392.420 where: short stacking energy: -211.328 Base-Backbone interact. energy: -1.049 local terms energy: -277.002402 where: bonds (distance) C4'-P energy: -66.919 bonds (distance) P-C4' energy: -67.874 flat angles C4'-P-C4' energy: -70.352 flat angles P-C4'-P energy: -37.172 tors. eta vs tors. theta energy: -34.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -412.945419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.945419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.695419 (E_RNA) where: Base-Base interactions energy: -193.391 where: short stacking energy: -138.436 Base-Backbone interact. energy: -0.953 local terms energy: -251.351068 where: bonds (distance) C4'-P energy: -78.425 bonds (distance) P-C4' energy: -75.384 flat angles C4'-P-C4' energy: -68.316 flat angles P-C4'-P energy: -28.239 tors. eta vs tors. theta energy: -0.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -452.270110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.270110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.020110 (E_RNA) where: Base-Base interactions energy: -240.582 where: short stacking energy: -127.750 Base-Backbone interact. energy: -1.150 local terms energy: -243.287783 where: bonds (distance) C4'-P energy: -69.281 bonds (distance) P-C4' energy: -69.044 flat angles C4'-P-C4' energy: -62.233 flat angles P-C4'-P energy: -38.831 tors. eta vs tors. theta energy: -3.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -348.700699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.700699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.450699 (E_RNA) where: Base-Base interactions energy: -156.208 where: short stacking energy: -99.439 Base-Backbone interact. energy: -0.099 local terms energy: -225.143022 where: bonds (distance) C4'-P energy: -68.201 bonds (distance) P-C4' energy: -77.545 flat angles C4'-P-C4' energy: -56.081 flat angles P-C4'-P energy: -30.553 tors. eta vs tors. theta energy: 7.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1167.947999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.947999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.697999 (E_RNA) where: Base-Base interactions energy: -785.513 where: short stacking energy: -371.311 Base-Backbone interact. energy: -1.515 local terms energy: -413.670237 where: bonds (distance) C4'-P energy: -67.503 bonds (distance) P-C4' energy: -86.276 flat angles C4'-P-C4' energy: -97.459 flat angles P-C4'-P energy: -60.043 tors. eta vs tors. theta energy: -102.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -990.035800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.035800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.785800 (E_RNA) where: Base-Base interactions energy: -636.064 where: short stacking energy: -334.334 Base-Backbone interact. energy: 0.062 local terms energy: -386.783094 where: bonds (distance) C4'-P energy: -87.491 bonds (distance) P-C4' energy: -80.244 flat angles C4'-P-C4' energy: -72.846 flat angles P-C4'-P energy: -54.974 tors. eta vs tors. theta energy: -91.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -969.709506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.709506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.459506 (E_RNA) where: Base-Base interactions energy: -624.118 where: short stacking energy: -296.110 Base-Backbone interact. energy: -2.553 local terms energy: -375.788140 where: bonds (distance) C4'-P energy: -76.438 bonds (distance) P-C4' energy: -78.769 flat angles C4'-P-C4' energy: -82.141 flat angles P-C4'-P energy: -64.298 tors. eta vs tors. theta energy: -74.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -871.952897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.952897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.702897 (E_RNA) where: Base-Base interactions energy: -559.480 where: short stacking energy: -281.627 Base-Backbone interact. energy: 1.987 local terms energy: -347.209641 where: bonds (distance) C4'-P energy: -76.176 bonds (distance) P-C4' energy: -66.282 flat angles C4'-P-C4' energy: -90.700 flat angles P-C4'-P energy: -45.853 tors. eta vs tors. theta energy: -68.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -738.411582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.411582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.161582 (E_RNA) where: Base-Base interactions energy: -450.557 where: short stacking energy: -225.273 Base-Backbone interact. energy: -3.197 local terms energy: -317.407621 where: bonds (distance) C4'-P energy: -64.842 bonds (distance) P-C4' energy: -91.543 flat angles C4'-P-C4' energy: -82.708 flat angles P-C4'-P energy: -39.800 tors. eta vs tors. theta energy: -38.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -690.843368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.843368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -723.593368 (E_RNA) where: Base-Base interactions energy: -409.849 where: short stacking energy: -225.015 Base-Backbone interact. energy: -2.187 local terms energy: -311.557110 where: bonds (distance) C4'-P energy: -59.304 bonds (distance) P-C4' energy: -82.613 flat angles C4'-P-C4' energy: -76.327 flat angles P-C4'-P energy: -51.339 tors. eta vs tors. theta energy: -41.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -579.321667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.321667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.071667 (E_RNA) where: Base-Base interactions energy: -330.806 where: short stacking energy: -174.527 Base-Backbone interact. energy: 0.108 local terms energy: -281.372930 where: bonds (distance) C4'-P energy: -75.179 bonds (distance) P-C4' energy: -71.024 flat angles C4'-P-C4' energy: -64.096 flat angles P-C4'-P energy: -48.429 tors. eta vs tors. theta energy: -22.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -481.902969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.902969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.652969 (E_RNA) where: Base-Base interactions energy: -243.284 where: short stacking energy: -158.638 Base-Backbone interact. energy: -1.216 local terms energy: -270.365242 where: bonds (distance) C4'-P energy: -72.251 bonds (distance) P-C4' energy: -72.289 flat angles C4'-P-C4' energy: -65.756 flat angles P-C4'-P energy: -42.392 tors. eta vs tors. theta energy: -17.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.212 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -422.518922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.518922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.268922 (E_RNA) where: Base-Base interactions energy: -205.624 where: short stacking energy: -128.547 Base-Backbone interact. energy: -4.002 local terms energy: -245.642594 where: bonds (distance) C4'-P energy: -62.051 bonds (distance) P-C4' energy: -63.847 flat angles C4'-P-C4' energy: -78.945 flat angles P-C4'-P energy: -31.518 tors. eta vs tors. theta energy: -9.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -326.983846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.983846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.733846 (E_RNA) where: Base-Base interactions energy: -141.739 where: short stacking energy: -113.434 Base-Backbone interact. energy: 2.894 local terms energy: -220.888922 where: bonds (distance) C4'-P energy: -59.472 bonds (distance) P-C4' energy: -73.664 flat angles C4'-P-C4' energy: -47.200 flat angles P-C4'-P energy: -44.808 tors. eta vs tors. theta energy: 4.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1163.959498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.959498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.709498 (E_RNA) where: Base-Base interactions energy: -766.912 where: short stacking energy: -352.973 Base-Backbone interact. energy: -0.281 local terms energy: -429.516241 where: bonds (distance) C4'-P energy: -85.446 bonds (distance) P-C4' energy: -90.233 flat angles C4'-P-C4' energy: -92.844 flat angles P-C4'-P energy: -57.936 tors. eta vs tors. theta energy: -103.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1002.287554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.287554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.037554 (E_RNA) where: Base-Base interactions energy: -659.113 where: short stacking energy: -313.858 Base-Backbone interact. energy: 0.125 local terms energy: -376.049248 where: bonds (distance) C4'-P energy: -68.471 bonds (distance) P-C4' energy: -90.069 flat angles C4'-P-C4' energy: -87.904 flat angles P-C4'-P energy: -58.131 tors. eta vs tors. theta energy: -71.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -950.254345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.254345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.004345 (E_RNA) where: Base-Base interactions energy: -620.342 where: short stacking energy: -305.834 Base-Backbone interact. energy: -1.103 local terms energy: -361.559760 where: bonds (distance) C4'-P energy: -76.903 bonds (distance) P-C4' energy: -81.393 flat angles C4'-P-C4' energy: -83.413 flat angles P-C4'-P energy: -48.199 tors. eta vs tors. theta energy: -71.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -908.792843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.792843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.542843 (E_RNA) where: Base-Base interactions energy: -583.306 where: short stacking energy: -268.912 Base-Backbone interact. energy: -1.356 local terms energy: -356.881190 where: bonds (distance) C4'-P energy: -88.235 bonds (distance) P-C4' energy: -85.920 flat angles C4'-P-C4' energy: -71.880 flat angles P-C4'-P energy: -37.841 tors. eta vs tors. theta energy: -73.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -802.974420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.974420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.724420 (E_RNA) where: Base-Base interactions energy: -507.273 where: short stacking energy: -268.307 Base-Backbone interact. energy: -0.131 local terms energy: -328.319518 where: bonds (distance) C4'-P energy: -59.838 bonds (distance) P-C4' energy: -82.699 flat angles C4'-P-C4' energy: -75.580 flat angles P-C4'-P energy: -51.855 tors. eta vs tors. theta energy: -58.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -714.274195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.274195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.024195 (E_RNA) where: Base-Base interactions energy: -434.866 where: short stacking energy: -220.482 Base-Backbone interact. energy: 0.104 local terms energy: -312.262298 where: bonds (distance) C4'-P energy: -71.527 bonds (distance) P-C4' energy: -82.015 flat angles C4'-P-C4' energy: -73.890 flat angles P-C4'-P energy: -45.695 tors. eta vs tors. theta energy: -39.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -518.222942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.222942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.972942 (E_RNA) where: Base-Base interactions energy: -288.758 where: short stacking energy: -155.904 Base-Backbone interact. energy: -1.410 local terms energy: -260.804860 where: bonds (distance) C4'-P energy: -72.672 bonds (distance) P-C4' energy: -64.914 flat angles C4'-P-C4' energy: -75.532 flat angles P-C4'-P energy: -39.612 tors. eta vs tors. theta energy: -8.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -548.952142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.952142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.702142 (E_RNA) where: Base-Base interactions energy: -318.404 where: short stacking energy: -172.675 Base-Backbone interact. energy: 0.354 local terms energy: -263.652320 where: bonds (distance) C4'-P energy: -56.815 bonds (distance) P-C4' energy: -72.188 flat angles C4'-P-C4' energy: -67.621 flat angles P-C4'-P energy: -35.636 tors. eta vs tors. theta energy: -31.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -454.255561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.255561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.005561 (E_RNA) where: Base-Base interactions energy: -258.908 where: short stacking energy: -151.895 Base-Backbone interact. energy: -1.237 local terms energy: -226.860508 where: bonds (distance) C4'-P energy: -43.857 bonds (distance) P-C4' energy: -74.181 flat angles C4'-P-C4' energy: -74.768 flat angles P-C4'-P energy: -32.439 tors. eta vs tors. theta energy: -1.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -321.361565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.361565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.111565 (E_RNA) where: Base-Base interactions energy: -132.482 where: short stacking energy: -76.592 Base-Backbone interact. energy: 1.908 local terms energy: -223.537458 where: bonds (distance) C4'-P energy: -72.393 bonds (distance) P-C4' energy: -82.557 flat angles C4'-P-C4' energy: -50.794 flat angles P-C4'-P energy: -31.472 tors. eta vs tors. theta energy: 13.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1194.097400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.097400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.847400 (E_RNA) where: Base-Base interactions energy: -812.577 where: short stacking energy: -357.912 Base-Backbone interact. energy: -1.751 local terms energy: -412.519517 where: bonds (distance) C4'-P energy: -81.077 bonds (distance) P-C4' energy: -80.906 flat angles C4'-P-C4' energy: -82.264 flat angles P-C4'-P energy: -58.635 tors. eta vs tors. theta energy: -109.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1051.324373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.324373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.074373 (E_RNA) where: Base-Base interactions energy: -697.121 where: short stacking energy: -319.877 Base-Backbone interact. energy: -0.811 local terms energy: -386.142435 where: bonds (distance) C4'-P energy: -80.640 bonds (distance) P-C4' energy: -86.455 flat angles C4'-P-C4' energy: -79.712 flat angles P-C4'-P energy: -60.929 tors. eta vs tors. theta energy: -78.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -955.280498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.280498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.030498 (E_RNA) where: Base-Base interactions energy: -625.537 where: short stacking energy: -291.169 Base-Backbone interact. energy: -3.029 local terms energy: -359.463775 where: bonds (distance) C4'-P energy: -70.932 bonds (distance) P-C4' energy: -74.998 flat angles C4'-P-C4' energy: -91.703 flat angles P-C4'-P energy: -56.981 tors. eta vs tors. theta energy: -64.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -946.242653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.242653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.992653 (E_RNA) where: Base-Base interactions energy: -619.963 where: short stacking energy: -302.504 Base-Backbone interact. energy: -2.018 local terms energy: -357.011587 where: bonds (distance) C4'-P energy: -76.664 bonds (distance) P-C4' energy: -81.872 flat angles C4'-P-C4' energy: -67.373 flat angles P-C4'-P energy: -56.114 tors. eta vs tors. theta energy: -74.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -801.425161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -801.425161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.175161 (E_RNA) where: Base-Base interactions energy: -503.182 where: short stacking energy: -266.872 Base-Backbone interact. energy: 1.782 local terms energy: -332.775813 where: bonds (distance) C4'-P energy: -77.239 bonds (distance) P-C4' energy: -75.255 flat angles C4'-P-C4' energy: -75.683 flat angles P-C4'-P energy: -50.582 tors. eta vs tors. theta energy: -54.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -654.980933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.980933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.730933 (E_RNA) where: Base-Base interactions energy: -386.318 where: short stacking energy: -204.830 Base-Backbone interact. energy: -1.689 local terms energy: -299.724448 where: bonds (distance) C4'-P energy: -80.714 bonds (distance) P-C4' energy: -75.101 flat angles C4'-P-C4' energy: -74.440 flat angles P-C4'-P energy: -33.672 tors. eta vs tors. theta energy: -35.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -608.414688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.414688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.164688 (E_RNA) where: Base-Base interactions energy: -379.222 where: short stacking energy: -184.564 Base-Backbone interact. energy: 0.451 local terms energy: -262.717051 where: bonds (distance) C4'-P energy: -65.093 bonds (distance) P-C4' energy: -70.876 flat angles C4'-P-C4' energy: -70.778 flat angles P-C4'-P energy: -29.441 tors. eta vs tors. theta energy: -26.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.323 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -597.731966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.731966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.481966 (E_RNA) where: Base-Base interactions energy: -342.208 where: short stacking energy: -191.107 Base-Backbone interact. energy: -2.470 local terms energy: -285.803417 where: bonds (distance) C4'-P energy: -68.715 bonds (distance) P-C4' energy: -71.617 flat angles C4'-P-C4' energy: -65.330 flat angles P-C4'-P energy: -49.553 tors. eta vs tors. theta energy: -30.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -423.855731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.855731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.605731 (E_RNA) where: Base-Base interactions energy: -216.356 where: short stacking energy: -122.745 Base-Backbone interact. energy: 6.280 local terms energy: -246.529766 where: bonds (distance) C4'-P energy: -81.008 bonds (distance) P-C4' energy: -69.401 flat angles C4'-P-C4' energy: -45.569 flat angles P-C4'-P energy: -44.165 tors. eta vs tors. theta energy: -6.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -274.946674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.946674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.696674 (E_RNA) where: Base-Base interactions energy: -107.370 where: short stacking energy: -85.347 Base-Backbone interact. energy: 2.177 local terms energy: -202.503354 where: bonds (distance) C4'-P energy: -68.430 bonds (distance) P-C4' energy: -84.021 flat angles C4'-P-C4' energy: -44.628 flat angles P-C4'-P energy: -33.054 tors. eta vs tors. theta energy: 27.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1176.623252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.623252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1209.373252 (E_RNA) where: Base-Base interactions energy: -797.602 where: short stacking energy: -360.998 Base-Backbone interact. energy: -2.835 local terms energy: -408.935446 where: bonds (distance) C4'-P energy: -66.528 bonds (distance) P-C4' energy: -89.268 flat angles C4'-P-C4' energy: -94.245 flat angles P-C4'-P energy: -62.134 tors. eta vs tors. theta energy: -96.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1034.638462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.638462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.388462 (E_RNA) where: Base-Base interactions energy: -666.694 where: short stacking energy: -325.746 Base-Backbone interact. energy: -1.807 local terms energy: -398.886874 where: bonds (distance) C4'-P energy: -83.005 bonds (distance) P-C4' energy: -84.187 flat angles C4'-P-C4' energy: -86.815 flat angles P-C4'-P energy: -58.155 tors. eta vs tors. theta energy: -86.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -987.150898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.150898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.900898 (E_RNA) where: Base-Base interactions energy: -658.577 where: short stacking energy: -285.084 Base-Backbone interact. energy: -0.939 local terms energy: -360.384911 where: bonds (distance) C4'-P energy: -72.872 bonds (distance) P-C4' energy: -79.697 flat angles C4'-P-C4' energy: -85.091 flat angles P-C4'-P energy: -53.118 tors. eta vs tors. theta energy: -69.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -926.803651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.803651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.553651 (E_RNA) where: Base-Base interactions energy: -610.049 where: short stacking energy: -280.264 Base-Backbone interact. energy: -2.071 local terms energy: -347.433942 where: bonds (distance) C4'-P energy: -73.154 bonds (distance) P-C4' energy: -85.207 flat angles C4'-P-C4' energy: -70.997 flat angles P-C4'-P energy: -50.771 tors. eta vs tors. theta energy: -67.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -792.887836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.887836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.637836 (E_RNA) where: Base-Base interactions energy: -506.426 where: short stacking energy: -256.697 Base-Backbone interact. energy: -2.169 local terms energy: -317.043189 where: bonds (distance) C4'-P energy: -64.486 bonds (distance) P-C4' energy: -78.738 flat angles C4'-P-C4' energy: -71.344 flat angles P-C4'-P energy: -48.848 tors. eta vs tors. theta energy: -53.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -747.125988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.125988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.875988 (E_RNA) where: Base-Base interactions energy: -476.684 where: short stacking energy: -242.817 Base-Backbone interact. energy: -2.262 local terms energy: -300.930240 where: bonds (distance) C4'-P energy: -65.716 bonds (distance) P-C4' energy: -76.669 flat angles C4'-P-C4' energy: -68.346 flat angles P-C4'-P energy: -46.744 tors. eta vs tors. theta energy: -43.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -624.212650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.212650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.962650 (E_RNA) where: Base-Base interactions energy: -363.230 where: short stacking energy: -168.267 Base-Backbone interact. energy: -0.220 local terms energy: -293.513045 where: bonds (distance) C4'-P energy: -85.752 bonds (distance) P-C4' energy: -75.371 flat angles C4'-P-C4' energy: -73.066 flat angles P-C4'-P energy: -39.627 tors. eta vs tors. theta energy: -19.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -553.579297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.579297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.329297 (E_RNA) where: Base-Base interactions energy: -344.473 where: short stacking energy: -152.456 Base-Backbone interact. energy: 3.225 local terms energy: -245.081588 where: bonds (distance) C4'-P energy: -72.621 bonds (distance) P-C4' energy: -63.106 flat angles C4'-P-C4' energy: -70.581 flat angles P-C4'-P energy: -26.451 tors. eta vs tors. theta energy: -12.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -393.699278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.699278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.449278 (E_RNA) where: Base-Base interactions energy: -188.523 where: short stacking energy: -117.160 Base-Backbone interact. energy: 0.444 local terms energy: -238.370064 where: bonds (distance) C4'-P energy: -67.033 bonds (distance) P-C4' energy: -75.997 flat angles C4'-P-C4' energy: -69.340 flat angles P-C4'-P energy: -25.557 tors. eta vs tors. theta energy: -0.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -302.732536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.732536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.482536 (E_RNA) where: Base-Base interactions energy: -113.445 where: short stacking energy: -85.555 Base-Backbone interact. energy: -2.155 local terms energy: -219.882467 where: bonds (distance) C4'-P energy: -67.073 bonds (distance) P-C4' energy: -77.584 flat angles C4'-P-C4' energy: -57.818 flat angles P-C4'-P energy: -34.700 tors. eta vs tors. theta energy: 17.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1179.927329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.927329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.677329 (E_RNA) where: Base-Base interactions energy: -801.317 where: short stacking energy: -343.331 Base-Backbone interact. energy: -1.906 local terms energy: -409.454461 where: bonds (distance) C4'-P energy: -86.505 bonds (distance) P-C4' energy: -89.363 flat angles C4'-P-C4' energy: -87.213 flat angles P-C4'-P energy: -52.532 tors. eta vs tors. theta energy: -93.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1021.130336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.130336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.880336 (E_RNA) where: Base-Base interactions energy: -648.233 where: short stacking energy: -317.162 Base-Backbone interact. energy: -1.198 local terms energy: -404.449572 where: bonds (distance) C4'-P energy: -93.369 bonds (distance) P-C4' energy: -78.564 flat angles C4'-P-C4' energy: -84.096 flat angles P-C4'-P energy: -59.018 tors. eta vs tors. theta energy: -89.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1044.957274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.957274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.707274 (E_RNA) where: Base-Base interactions energy: -719.498 where: short stacking energy: -317.266 Base-Backbone interact. energy: -3.626 local terms energy: -354.583097 where: bonds (distance) C4'-P energy: -84.383 bonds (distance) P-C4' energy: -70.576 flat angles C4'-P-C4' energy: -81.526 flat angles P-C4'-P energy: -42.264 tors. eta vs tors. theta energy: -75.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -920.488690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.488690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.238690 (E_RNA) where: Base-Base interactions energy: -612.578 where: short stacking energy: -302.392 Base-Backbone interact. energy: -0.628 local terms energy: -340.032977 where: bonds (distance) C4'-P energy: -76.884 bonds (distance) P-C4' energy: -71.676 flat angles C4'-P-C4' energy: -71.291 flat angles P-C4'-P energy: -55.429 tors. eta vs tors. theta energy: -64.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -775.384217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.384217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.134217 (E_RNA) where: Base-Base interactions energy: -487.093 where: short stacking energy: -256.803 Base-Backbone interact. energy: -1.038 local terms energy: -320.003039 where: bonds (distance) C4'-P energy: -72.564 bonds (distance) P-C4' energy: -71.811 flat angles C4'-P-C4' energy: -89.838 flat angles P-C4'-P energy: -34.812 tors. eta vs tors. theta energy: -50.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -669.198430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.198430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -701.948430 (E_RNA) where: Base-Base interactions energy: -405.337 where: short stacking energy: -219.983 Base-Backbone interact. energy: 0.921 local terms energy: -297.532603 where: bonds (distance) C4'-P energy: -75.533 bonds (distance) P-C4' energy: -79.114 flat angles C4'-P-C4' energy: -72.799 flat angles P-C4'-P energy: -38.585 tors. eta vs tors. theta energy: -31.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -658.594181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -658.594181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.344181 (E_RNA) where: Base-Base interactions energy: -416.720 where: short stacking energy: -186.309 Base-Backbone interact. energy: 0.254 local terms energy: -274.878416 where: bonds (distance) C4'-P energy: -68.605 bonds (distance) P-C4' energy: -82.583 flat angles C4'-P-C4' energy: -71.831 flat angles P-C4'-P energy: -38.293 tors. eta vs tors. theta energy: -13.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -558.610106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.610106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.360106 (E_RNA) where: Base-Base interactions energy: -336.264 where: short stacking energy: -166.443 Base-Backbone interact. energy: -1.827 local terms energy: -253.268606 where: bonds (distance) C4'-P energy: -58.088 bonds (distance) P-C4' energy: -69.979 flat angles C4'-P-C4' energy: -63.891 flat angles P-C4'-P energy: -40.277 tors. eta vs tors. theta energy: -21.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -441.114688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.114688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.864688 (E_RNA) where: Base-Base interactions energy: -237.147 where: short stacking energy: -138.209 Base-Backbone interact. energy: -2.618 local terms energy: -234.100015 where: bonds (distance) C4'-P energy: -49.087 bonds (distance) P-C4' energy: -76.679 flat angles C4'-P-C4' energy: -59.468 flat angles P-C4'-P energy: -47.161 tors. eta vs tors. theta energy: -1.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -304.065755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.065755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.815755 (E_RNA) where: Base-Base interactions energy: -119.323 where: short stacking energy: -103.204 Base-Backbone interact. energy: 1.254 local terms energy: -218.745913 where: bonds (distance) C4'-P energy: -62.689 bonds (distance) P-C4' energy: -59.309 flat angles C4'-P-C4' energy: -65.427 flat angles P-C4'-P energy: -44.975 tors. eta vs tors. theta energy: 13.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1203.876849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.876849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1236.626849 (E_RNA) where: Base-Base interactions energy: -813.824 where: short stacking energy: -364.185 Base-Backbone interact. energy: 1.653 local terms energy: -424.455797 where: bonds (distance) C4'-P energy: -86.775 bonds (distance) P-C4' energy: -77.383 flat angles C4'-P-C4' energy: -96.727 flat angles P-C4'-P energy: -63.225 tors. eta vs tors. theta energy: -100.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -997.987552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.987552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.737552 (E_RNA) where: Base-Base interactions energy: -663.841 where: short stacking energy: -312.268 Base-Backbone interact. energy: 2.333 local terms energy: -369.229536 where: bonds (distance) C4'-P energy: -72.866 bonds (distance) P-C4' energy: -75.815 flat angles C4'-P-C4' energy: -88.720 flat angles P-C4'-P energy: -62.941 tors. eta vs tors. theta energy: -68.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1038.748386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.748386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.498386 (E_RNA) where: Base-Base interactions energy: -707.538 where: short stacking energy: -303.398 Base-Backbone interact. energy: -4.015 local terms energy: -359.945725 where: bonds (distance) C4'-P energy: -83.237 bonds (distance) P-C4' energy: -77.872 flat angles C4'-P-C4' energy: -68.868 flat angles P-C4'-P energy: -57.183 tors. eta vs tors. theta energy: -72.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -885.533264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.533264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.283264 (E_RNA) where: Base-Base interactions energy: -571.451 where: short stacking energy: -287.264 Base-Backbone interact. energy: 0.872 local terms energy: -347.704173 where: bonds (distance) C4'-P energy: -71.050 bonds (distance) P-C4' energy: -87.521 flat angles C4'-P-C4' energy: -82.645 flat angles P-C4'-P energy: -38.061 tors. eta vs tors. theta energy: -68.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -782.903091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.903091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.653091 (E_RNA) where: Base-Base interactions energy: -477.306 where: short stacking energy: -245.542 Base-Backbone interact. energy: -2.442 local terms energy: -335.904707 where: bonds (distance) C4'-P energy: -68.972 bonds (distance) P-C4' energy: -90.940 flat angles C4'-P-C4' energy: -69.276 flat angles P-C4'-P energy: -47.585 tors. eta vs tors. theta energy: -59.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -705.524169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.524169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.274169 (E_RNA) where: Base-Base interactions energy: -441.924 where: short stacking energy: -218.086 Base-Backbone interact. energy: 1.346 local terms energy: -297.696475 where: bonds (distance) C4'-P energy: -64.408 bonds (distance) P-C4' energy: -71.020 flat angles C4'-P-C4' energy: -61.797 flat angles P-C4'-P energy: -43.856 tors. eta vs tors. theta energy: -56.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -610.819991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.819991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -643.569991 (E_RNA) where: Base-Base interactions energy: -336.044 where: short stacking energy: -186.111 Base-Backbone interact. energy: -1.477 local terms energy: -306.484723 where: bonds (distance) C4'-P energy: -80.537 bonds (distance) P-C4' energy: -79.422 flat angles C4'-P-C4' energy: -77.391 flat angles P-C4'-P energy: -42.767 tors. eta vs tors. theta energy: -26.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.436 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -534.147694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.147694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.897694 (E_RNA) where: Base-Base interactions energy: -319.824 where: short stacking energy: -174.512 Base-Backbone interact. energy: -1.005 local terms energy: -246.069143 where: bonds (distance) C4'-P energy: -57.176 bonds (distance) P-C4' energy: -82.510 flat angles C4'-P-C4' energy: -60.918 flat angles P-C4'-P energy: -28.136 tors. eta vs tors. theta energy: -17.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -367.446277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.446277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.196277 (E_RNA) where: Base-Base interactions energy: -153.017 where: short stacking energy: -140.009 Base-Backbone interact. energy: -0.231 local terms energy: -246.948729 where: bonds (distance) C4'-P energy: -45.339 bonds (distance) P-C4' energy: -78.265 flat angles C4'-P-C4' energy: -76.560 flat angles P-C4'-P energy: -34.659 tors. eta vs tors. theta energy: -12.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -342.375726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.375726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.125726 (E_RNA) where: Base-Base interactions energy: -161.174 where: short stacking energy: -108.826 Base-Backbone interact. energy: -2.505 local terms energy: -211.446527 where: bonds (distance) C4'-P energy: -64.463 bonds (distance) P-C4' energy: -81.866 flat angles C4'-P-C4' energy: -50.449 flat angles P-C4'-P energy: -25.379 tors. eta vs tors. theta energy: 10.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1184.586105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.586105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.336105 (E_RNA) where: Base-Base interactions energy: -802.116 where: short stacking energy: -374.213 Base-Backbone interact. energy: -1.157 local terms energy: -414.063262 where: bonds (distance) C4'-P energy: -81.482 bonds (distance) P-C4' energy: -79.572 flat angles C4'-P-C4' energy: -91.581 flat angles P-C4'-P energy: -59.304 tors. eta vs tors. theta energy: -102.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1130.485853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1130.485853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.235853 (E_RNA) where: Base-Base interactions energy: -782.579 where: short stacking energy: -333.106 Base-Backbone interact. energy: -3.356 local terms energy: -377.300956 where: bonds (distance) C4'-P energy: -70.548 bonds (distance) P-C4' energy: -82.710 flat angles C4'-P-C4' energy: -79.295 flat angles P-C4'-P energy: -56.872 tors. eta vs tors. theta energy: -87.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1028.468784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.468784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.218784 (E_RNA) where: Base-Base interactions energy: -685.445 where: short stacking energy: -314.097 Base-Backbone interact. energy: -0.734 local terms energy: -375.040605 where: bonds (distance) C4'-P energy: -77.799 bonds (distance) P-C4' energy: -80.404 flat angles C4'-P-C4' energy: -81.103 flat angles P-C4'-P energy: -58.470 tors. eta vs tors. theta energy: -77.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -922.801565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.801565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.551565 (E_RNA) where: Base-Base interactions energy: -587.124 where: short stacking energy: -301.923 Base-Backbone interact. energy: -1.759 local terms energy: -367.149577 where: bonds (distance) C4'-P energy: -72.412 bonds (distance) P-C4' energy: -81.852 flat angles C4'-P-C4' energy: -75.978 flat angles P-C4'-P energy: -65.132 tors. eta vs tors. theta energy: -71.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.481 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -791.721925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.721925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.471925 (E_RNA) where: Base-Base interactions energy: -523.517 where: short stacking energy: -268.701 Base-Backbone interact. energy: -2.607 local terms energy: -298.348456 where: bonds (distance) C4'-P energy: -63.129 bonds (distance) P-C4' energy: -71.487 flat angles C4'-P-C4' energy: -70.598 flat angles P-C4'-P energy: -42.276 tors. eta vs tors. theta energy: -50.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -737.355638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -737.355638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.105638 (E_RNA) where: Base-Base interactions energy: -429.509 where: short stacking energy: -233.352 Base-Backbone interact. energy: -1.151 local terms energy: -339.445822 where: bonds (distance) C4'-P energy: -70.746 bonds (distance) P-C4' energy: -86.380 flat angles C4'-P-C4' energy: -74.509 flat angles P-C4'-P energy: -55.002 tors. eta vs tors. theta energy: -52.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -608.619147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.619147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.369147 (E_RNA) where: Base-Base interactions energy: -366.275 where: short stacking energy: -189.243 Base-Backbone interact. energy: -0.132 local terms energy: -274.961931 where: bonds (distance) C4'-P energy: -58.270 bonds (distance) P-C4' energy: -78.207 flat angles C4'-P-C4' energy: -66.909 flat angles P-C4'-P energy: -44.339 tors. eta vs tors. theta energy: -27.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -530.659727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.659727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.409727 (E_RNA) where: Base-Base interactions energy: -300.881 where: short stacking energy: -159.920 Base-Backbone interact. energy: -1.280 local terms energy: -261.249159 where: bonds (distance) C4'-P energy: -76.390 bonds (distance) P-C4' energy: -61.249 flat angles C4'-P-C4' energy: -60.106 flat angles P-C4'-P energy: -36.386 tors. eta vs tors. theta energy: -27.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -340.458491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.458491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.208491 (E_RNA) where: Base-Base interactions energy: -140.188 where: short stacking energy: -99.948 Base-Backbone interact. energy: -0.743 local terms energy: -232.276977 where: bonds (distance) C4'-P energy: -64.582 bonds (distance) P-C4' energy: -79.504 flat angles C4'-P-C4' energy: -62.764 flat angles P-C4'-P energy: -27.174 tors. eta vs tors. theta energy: 1.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -362.591684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.591684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.341684 (E_RNA) where: Base-Base interactions energy: -173.773 where: short stacking energy: -128.734 Base-Backbone interact. energy: 4.026 local terms energy: -225.594076 where: bonds (distance) C4'-P energy: -62.050 bonds (distance) P-C4' energy: -71.002 flat angles C4'-P-C4' energy: -75.044 flat angles P-C4'-P energy: -25.812 tors. eta vs tors. theta energy: 8.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1213.815974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.815974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.565974 (E_RNA) where: Base-Base interactions energy: -804.771 where: short stacking energy: -369.122 Base-Backbone interact. energy: -0.575 local terms energy: -441.219778 where: bonds (distance) C4'-P energy: -83.384 bonds (distance) P-C4' energy: -96.865 flat angles C4'-P-C4' energy: -91.045 flat angles P-C4'-P energy: -66.316 tors. eta vs tors. theta energy: -103.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1123.708864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.708864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1156.458864 (E_RNA) where: Base-Base interactions energy: -779.507 where: short stacking energy: -338.302 Base-Backbone interact. energy: -1.015 local terms energy: -375.936907 where: bonds (distance) C4'-P energy: -76.483 bonds (distance) P-C4' energy: -86.550 flat angles C4'-P-C4' energy: -79.324 flat angles P-C4'-P energy: -52.749 tors. eta vs tors. theta energy: -80.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -993.534090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.534090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.284090 (E_RNA) where: Base-Base interactions energy: -646.910 where: short stacking energy: -304.819 Base-Backbone interact. energy: -2.828 local terms energy: -376.545847 where: bonds (distance) C4'-P energy: -60.419 bonds (distance) P-C4' energy: -89.080 flat angles C4'-P-C4' energy: -92.739 flat angles P-C4'-P energy: -62.238 tors. eta vs tors. theta energy: -72.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -960.873169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.873169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.623169 (E_RNA) where: Base-Base interactions energy: -603.354 where: short stacking energy: -311.513 Base-Backbone interact. energy: -0.358 local terms energy: -389.911107 where: bonds (distance) C4'-P energy: -85.294 bonds (distance) P-C4' energy: -79.221 flat angles C4'-P-C4' energy: -82.620 flat angles P-C4'-P energy: -57.518 tors. eta vs tors. theta energy: -85.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -872.589627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.589627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.339627 (E_RNA) where: Base-Base interactions energy: -567.120 where: short stacking energy: -274.840 Base-Backbone interact. energy: 0.102 local terms energy: -338.321081 where: bonds (distance) C4'-P energy: -74.541 bonds (distance) P-C4' energy: -72.520 flat angles C4'-P-C4' energy: -80.587 flat angles P-C4'-P energy: -47.778 tors. eta vs tors. theta energy: -62.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -717.547359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.547359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.297359 (E_RNA) where: Base-Base interactions energy: -446.989 where: short stacking energy: -242.562 Base-Backbone interact. energy: 0.228 local terms energy: -303.536458 where: bonds (distance) C4'-P energy: -62.167 bonds (distance) P-C4' energy: -82.238 flat angles C4'-P-C4' energy: -72.553 flat angles P-C4'-P energy: -43.295 tors. eta vs tors. theta energy: -43.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -651.791473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.791473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.541473 (E_RNA) where: Base-Base interactions energy: -413.616 where: short stacking energy: -186.173 Base-Backbone interact. energy: 0.510 local terms energy: -271.435048 where: bonds (distance) C4'-P energy: -67.200 bonds (distance) P-C4' energy: -77.074 flat angles C4'-P-C4' energy: -70.816 flat angles P-C4'-P energy: -32.648 tors. eta vs tors. theta energy: -23.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -573.848549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.848549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.598549 (E_RNA) where: Base-Base interactions energy: -337.647 where: short stacking energy: -171.506 Base-Backbone interact. energy: -1.795 local terms energy: -267.157152 where: bonds (distance) C4'-P energy: -69.310 bonds (distance) P-C4' energy: -68.175 flat angles C4'-P-C4' energy: -65.708 flat angles P-C4'-P energy: -39.367 tors. eta vs tors. theta energy: -24.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -387.533643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.533643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.283643 (E_RNA) where: Base-Base interactions energy: -173.517 where: short stacking energy: -113.186 Base-Backbone interact. energy: -2.045 local terms energy: -249.849398 where: bonds (distance) C4'-P energy: -72.064 bonds (distance) P-C4' energy: -78.342 flat angles C4'-P-C4' energy: -69.879 flat angles P-C4'-P energy: -37.133 tors. eta vs tors. theta energy: 7.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 5.128 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -281.109360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.109360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.859360 (E_RNA) where: Base-Base interactions energy: -103.881 where: short stacking energy: -86.689 Base-Backbone interact. energy: 3.218 local terms energy: -213.197014 where: bonds (distance) C4'-P energy: -72.094 bonds (distance) P-C4' energy: -68.164 flat angles C4'-P-C4' energy: -59.573 flat angles P-C4'-P energy: -40.477 tors. eta vs tors. theta energy: 27.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1211.377642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.377642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.127642 (E_RNA) where: Base-Base interactions energy: -810.594 where: short stacking energy: -353.262 Base-Backbone interact. energy: -2.148 local terms energy: -431.385674 where: bonds (distance) C4'-P energy: -85.395 bonds (distance) P-C4' energy: -89.908 flat angles C4'-P-C4' energy: -89.657 flat angles P-C4'-P energy: -59.210 tors. eta vs tors. theta energy: -107.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1126.290906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.290906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.040906 (E_RNA) where: Base-Base interactions energy: -776.762 where: short stacking energy: -343.323 Base-Backbone interact. energy: -2.172 local terms energy: -380.106546 where: bonds (distance) C4'-P energy: -79.284 bonds (distance) P-C4' energy: -78.286 flat angles C4'-P-C4' energy: -79.206 flat angles P-C4'-P energy: -54.416 tors. eta vs tors. theta energy: -88.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -996.983030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.983030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.733030 (E_RNA) where: Base-Base interactions energy: -644.580 where: short stacking energy: -313.461 Base-Backbone interact. energy: -3.753 local terms energy: -381.399404 where: bonds (distance) C4'-P energy: -74.316 bonds (distance) P-C4' energy: -82.069 flat angles C4'-P-C4' energy: -86.281 flat angles P-C4'-P energy: -58.925 tors. eta vs tors. theta energy: -79.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -942.310677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.310677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.060677 (E_RNA) where: Base-Base interactions energy: -616.108 where: short stacking energy: -308.290 Base-Backbone interact. energy: -0.255 local terms energy: -358.697687 where: bonds (distance) C4'-P energy: -64.216 bonds (distance) P-C4' energy: -72.289 flat angles C4'-P-C4' energy: -80.631 flat angles P-C4'-P energy: -62.150 tors. eta vs tors. theta energy: -79.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -872.137471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.137471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.887471 (E_RNA) where: Base-Base interactions energy: -548.359 where: short stacking energy: -245.716 Base-Backbone interact. energy: -1.114 local terms energy: -355.414288 where: bonds (distance) C4'-P energy: -72.855 bonds (distance) P-C4' energy: -88.506 flat angles C4'-P-C4' energy: -84.743 flat angles P-C4'-P energy: -48.840 tors. eta vs tors. theta energy: -60.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -734.955354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.955354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.705354 (E_RNA) where: Base-Base interactions energy: -446.722 where: short stacking energy: -224.644 Base-Backbone interact. energy: -1.150 local terms energy: -319.833793 where: bonds (distance) C4'-P energy: -65.733 bonds (distance) P-C4' energy: -81.221 flat angles C4'-P-C4' energy: -67.719 flat angles P-C4'-P energy: -52.329 tors. eta vs tors. theta energy: -52.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -652.313321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -652.313321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.063321 (E_RNA) where: Base-Base interactions energy: -407.980 where: short stacking energy: -206.120 Base-Backbone interact. energy: 1.955 local terms energy: -279.038437 where: bonds (distance) C4'-P energy: -68.999 bonds (distance) P-C4' energy: -69.599 flat angles C4'-P-C4' energy: -51.370 flat angles P-C4'-P energy: -52.547 tors. eta vs tors. theta energy: -36.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -555.641919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.641919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.391919 (E_RNA) where: Base-Base interactions energy: -332.169 where: short stacking energy: -166.117 Base-Backbone interact. energy: 1.766 local terms energy: -257.989314 where: bonds (distance) C4'-P energy: -68.862 bonds (distance) P-C4' energy: -78.154 flat angles C4'-P-C4' energy: -64.591 flat angles P-C4'-P energy: -37.755 tors. eta vs tors. theta energy: -8.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -424.480783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.480783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.230783 (E_RNA) where: Base-Base interactions energy: -218.832 where: short stacking energy: -132.025 Base-Backbone interact. energy: 2.658 local terms energy: -241.057498 where: bonds (distance) C4'-P energy: -60.251 bonds (distance) P-C4' energy: -68.766 flat angles C4'-P-C4' energy: -63.720 flat angles P-C4'-P energy: -49.018 tors. eta vs tors. theta energy: 0.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -308.713086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.713086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.463086 (E_RNA) where: Base-Base interactions energy: -106.862 where: short stacking energy: -97.689 Base-Backbone interact. energy: 3.324 local terms energy: -237.924985 where: bonds (distance) C4'-P energy: -75.642 bonds (distance) P-C4' energy: -72.228 flat angles C4'-P-C4' energy: -73.331 flat angles P-C4'-P energy: -33.315 tors. eta vs tors. theta energy: 16.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1183.617863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1183.617863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.367863 (E_RNA) where: Base-Base interactions energy: -789.255 where: short stacking energy: -355.860 Base-Backbone interact. energy: -0.470 local terms energy: -426.642805 where: bonds (distance) C4'-P energy: -83.502 bonds (distance) P-C4' energy: -92.333 flat angles C4'-P-C4' energy: -81.418 flat angles P-C4'-P energy: -63.077 tors. eta vs tors. theta energy: -106.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1186.738867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.738867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.488867 (E_RNA) where: Base-Base interactions energy: -812.939 where: short stacking energy: -359.467 Base-Backbone interact. energy: -4.989 local terms energy: -401.560448 where: bonds (distance) C4'-P energy: -66.937 bonds (distance) P-C4' energy: -77.040 flat angles C4'-P-C4' energy: -86.248 flat angles P-C4'-P energy: -59.852 tors. eta vs tors. theta energy: -111.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -978.419863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.419863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.169863 (E_RNA) where: Base-Base interactions energy: -635.276 where: short stacking energy: -301.482 Base-Backbone interact. energy: -2.881 local terms energy: -373.982866 where: bonds (distance) C4'-P energy: -74.066 bonds (distance) P-C4' energy: -75.472 flat angles C4'-P-C4' energy: -79.208 flat angles P-C4'-P energy: -60.688 tors. eta vs tors. theta energy: -84.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.970 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -966.986394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.986394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.736394 (E_RNA) where: Base-Base interactions energy: -640.961 where: short stacking energy: -300.027 Base-Backbone interact. energy: -0.075 local terms energy: -358.700007 where: bonds (distance) C4'-P energy: -80.348 bonds (distance) P-C4' energy: -73.719 flat angles C4'-P-C4' energy: -82.896 flat angles P-C4'-P energy: -55.958 tors. eta vs tors. theta energy: -65.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -903.209837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.209837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.959837 (E_RNA) where: Base-Base interactions energy: -578.984 where: short stacking energy: -274.382 Base-Backbone interact. energy: -2.491 local terms energy: -354.484118 where: bonds (distance) C4'-P energy: -76.925 bonds (distance) P-C4' energy: -79.820 flat angles C4'-P-C4' energy: -80.733 flat angles P-C4'-P energy: -50.441 tors. eta vs tors. theta energy: -66.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -785.163316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.163316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.913316 (E_RNA) where: Base-Base interactions energy: -507.217 where: short stacking energy: -248.975 Base-Backbone interact. energy: -2.270 local terms energy: -308.426278 where: bonds (distance) C4'-P energy: -65.631 bonds (distance) P-C4' energy: -86.487 flat angles C4'-P-C4' energy: -71.230 flat angles P-C4'-P energy: -36.811 tors. eta vs tors. theta energy: -48.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -612.507051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.507051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.257051 (E_RNA) where: Base-Base interactions energy: -343.259 where: short stacking energy: -179.357 Base-Backbone interact. energy: -1.130 local terms energy: -300.868258 where: bonds (distance) C4'-P energy: -71.952 bonds (distance) P-C4' energy: -82.984 flat angles C4'-P-C4' energy: -65.909 flat angles P-C4'-P energy: -46.931 tors. eta vs tors. theta energy: -33.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -578.042067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.042067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.792067 (E_RNA) where: Base-Base interactions energy: -360.792 where: short stacking energy: -166.727 Base-Backbone interact. energy: -1.403 local terms energy: -248.596785 where: bonds (distance) C4'-P energy: -68.451 bonds (distance) P-C4' energy: -65.413 flat angles C4'-P-C4' energy: -69.103 flat angles P-C4'-P energy: -29.634 tors. eta vs tors. theta energy: -15.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -421.077944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.077944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.827944 (E_RNA) where: Base-Base interactions energy: -205.779 where: short stacking energy: -142.011 Base-Backbone interact. energy: -1.322 local terms energy: -246.726928 where: bonds (distance) C4'-P energy: -66.396 bonds (distance) P-C4' energy: -80.726 flat angles C4'-P-C4' energy: -58.643 flat angles P-C4'-P energy: -36.283 tors. eta vs tors. theta energy: -4.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -300.122530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.122530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.872530 (E_RNA) where: Base-Base interactions energy: -127.916 where: short stacking energy: -98.260 Base-Backbone interact. energy: 2.040 local terms energy: -206.996011 where: bonds (distance) C4'-P energy: -67.058 bonds (distance) P-C4' energy: -66.037 flat angles C4'-P-C4' energy: -66.930 flat angles P-C4'-P energy: -23.032 tors. eta vs tors. theta energy: 16.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1176.050665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.050665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.800665 (E_RNA) where: Base-Base interactions energy: -804.504 where: short stacking energy: -357.814 Base-Backbone interact. energy: -2.245 local terms energy: -402.051592 where: bonds (distance) C4'-P energy: -79.488 bonds (distance) P-C4' energy: -82.562 flat angles C4'-P-C4' energy: -82.172 flat angles P-C4'-P energy: -60.632 tors. eta vs tors. theta energy: -97.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1179.017766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.017766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.767766 (E_RNA) where: Base-Base interactions energy: -817.959 where: short stacking energy: -382.034 Base-Backbone interact. energy: -1.845 local terms energy: -391.963805 where: bonds (distance) C4'-P energy: -74.986 bonds (distance) P-C4' energy: -80.842 flat angles C4'-P-C4' energy: -80.131 flat angles P-C4'-P energy: -57.874 tors. eta vs tors. theta energy: -98.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1049.733180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.733180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1082.483180 (E_RNA) where: Base-Base interactions energy: -728.137 where: short stacking energy: -321.284 Base-Backbone interact. energy: 0.340 local terms energy: -354.686180 where: bonds (distance) C4'-P energy: -83.142 bonds (distance) P-C4' energy: -78.494 flat angles C4'-P-C4' energy: -68.040 flat angles P-C4'-P energy: -51.486 tors. eta vs tors. theta energy: -73.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -963.710465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.710465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.460465 (E_RNA) where: Base-Base interactions energy: -628.395 where: short stacking energy: -289.528 Base-Backbone interact. energy: 0.136 local terms energy: -368.201538 where: bonds (distance) C4'-P energy: -82.280 bonds (distance) P-C4' energy: -83.117 flat angles C4'-P-C4' energy: -81.719 flat angles P-C4'-P energy: -55.166 tors. eta vs tors. theta energy: -65.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -927.363499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.363499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.113499 (E_RNA) where: Base-Base interactions energy: -613.772 where: short stacking energy: -289.663 Base-Backbone interact. energy: -2.159 local terms energy: -344.606784 where: bonds (distance) C4'-P energy: -58.272 bonds (distance) P-C4' energy: -83.802 flat angles C4'-P-C4' energy: -81.233 flat angles P-C4'-P energy: -50.511 tors. eta vs tors. theta energy: -70.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.424 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -738.182948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.182948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.932948 (E_RNA) where: Base-Base interactions energy: -446.098 where: short stacking energy: -218.271 Base-Backbone interact. energy: -0.559 local terms energy: -324.276552 where: bonds (distance) C4'-P energy: -66.430 bonds (distance) P-C4' energy: -80.892 flat angles C4'-P-C4' energy: -78.788 flat angles P-C4'-P energy: -50.433 tors. eta vs tors. theta energy: -47.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -616.520368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.520368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.270368 (E_RNA) where: Base-Base interactions energy: -365.516 where: short stacking energy: -186.344 Base-Backbone interact. energy: 2.656 local terms energy: -286.410944 where: bonds (distance) C4'-P energy: -83.530 bonds (distance) P-C4' energy: -68.321 flat angles C4'-P-C4' energy: -67.669 flat angles P-C4'-P energy: -44.877 tors. eta vs tors. theta energy: -22.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -618.073604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.073604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.823604 (E_RNA) where: Base-Base interactions energy: -369.609 where: short stacking energy: -161.758 Base-Backbone interact. energy: -1.158 local terms energy: -280.056528 where: bonds (distance) C4'-P energy: -77.882 bonds (distance) P-C4' energy: -75.298 flat angles C4'-P-C4' energy: -59.768 flat angles P-C4'-P energy: -41.143 tors. eta vs tors. theta energy: -25.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -421.896213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.896213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.646213 (E_RNA) where: Base-Base interactions energy: -229.212 where: short stacking energy: -142.298 Base-Backbone interact. energy: 1.390 local terms energy: -226.824382 where: bonds (distance) C4'-P energy: -61.848 bonds (distance) P-C4' energy: -64.178 flat angles C4'-P-C4' energy: -64.073 flat angles P-C4'-P energy: -33.321 tors. eta vs tors. theta energy: -3.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -310.861447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.861447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.611447 (E_RNA) where: Base-Base interactions energy: -108.348 where: short stacking energy: -91.950 Base-Backbone interact. energy: 0.471 local terms energy: -235.734290 where: bonds (distance) C4'-P energy: -69.734 bonds (distance) P-C4' energy: -75.287 flat angles C4'-P-C4' energy: -72.892 flat angles P-C4'-P energy: -38.016 tors. eta vs tors. theta energy: 20.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1210.337351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.337351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.087351 (E_RNA) where: Base-Base interactions energy: -811.318 where: short stacking energy: -371.906 Base-Backbone interact. energy: -0.796 local terms energy: -430.973972 where: bonds (distance) C4'-P energy: -85.957 bonds (distance) P-C4' energy: -81.983 flat angles C4'-P-C4' energy: -92.616 flat angles P-C4'-P energy: -65.519 tors. eta vs tors. theta energy: -104.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1155.486302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.486302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.236302 (E_RNA) where: Base-Base interactions energy: -790.281 where: short stacking energy: -337.753 Base-Backbone interact. energy: -0.416 local terms energy: -397.539418 where: bonds (distance) C4'-P energy: -83.479 bonds (distance) P-C4' energy: -79.096 flat angles C4'-P-C4' energy: -88.140 flat angles P-C4'-P energy: -56.851 tors. eta vs tors. theta energy: -89.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1105.892108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.892108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.642108 (E_RNA) where: Base-Base interactions energy: -744.419 where: short stacking energy: -338.116 Base-Backbone interact. energy: -2.897 local terms energy: -391.326303 where: bonds (distance) C4'-P energy: -72.099 bonds (distance) P-C4' energy: -86.094 flat angles C4'-P-C4' energy: -84.837 flat angles P-C4'-P energy: -56.391 tors. eta vs tors. theta energy: -91.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -943.643131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.643131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -976.393131 (E_RNA) where: Base-Base interactions energy: -624.999 where: short stacking energy: -293.960 Base-Backbone interact. energy: -0.051 local terms energy: -351.343569 where: bonds (distance) C4'-P energy: -74.842 bonds (distance) P-C4' energy: -73.592 flat angles C4'-P-C4' energy: -82.963 flat angles P-C4'-P energy: -45.760 tors. eta vs tors. theta energy: -74.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -898.296530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.296530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.046530 (E_RNA) where: Base-Base interactions energy: -584.135 where: short stacking energy: -281.779 Base-Backbone interact. energy: -0.841 local terms energy: -346.070572 where: bonds (distance) C4'-P energy: -60.030 bonds (distance) P-C4' energy: -81.996 flat angles C4'-P-C4' energy: -77.965 flat angles P-C4'-P energy: -58.272 tors. eta vs tors. theta energy: -67.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -758.849378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.849378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.599378 (E_RNA) where: Base-Base interactions energy: -464.197 where: short stacking energy: -225.399 Base-Backbone interact. energy: 3.098 local terms energy: -330.499817 where: bonds (distance) C4'-P energy: -78.973 bonds (distance) P-C4' energy: -79.968 flat angles C4'-P-C4' energy: -80.739 flat angles P-C4'-P energy: -42.264 tors. eta vs tors. theta energy: -48.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -644.738463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.738463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.488463 (E_RNA) where: Base-Base interactions energy: -389.979 where: short stacking energy: -195.159 Base-Backbone interact. energy: -1.381 local terms energy: -286.128543 where: bonds (distance) C4'-P energy: -63.175 bonds (distance) P-C4' energy: -73.886 flat angles C4'-P-C4' energy: -76.054 flat angles P-C4'-P energy: -44.971 tors. eta vs tors. theta energy: -28.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -640.706204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -640.706204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.456204 (E_RNA) where: Base-Base interactions energy: -417.468 where: short stacking energy: -184.689 Base-Backbone interact. energy: 6.845 local terms energy: -262.833505 where: bonds (distance) C4'-P energy: -64.032 bonds (distance) P-C4' energy: -77.772 flat angles C4'-P-C4' energy: -61.672 flat angles P-C4'-P energy: -29.627 tors. eta vs tors. theta energy: -29.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -433.117357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.117357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.867357 (E_RNA) where: Base-Base interactions energy: -225.963 where: short stacking energy: -145.954 Base-Backbone interact. energy: -0.149 local terms energy: -239.754476 where: bonds (distance) C4'-P energy: -81.093 bonds (distance) P-C4' energy: -78.210 flat angles C4'-P-C4' energy: -63.613 flat angles P-C4'-P energy: -29.249 tors. eta vs tors. theta energy: 12.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -349.200345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.200345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.950345 (E_RNA) where: Base-Base interactions energy: -178.937 where: short stacking energy: -98.832 Base-Backbone interact. energy: 0.228 local terms energy: -203.241155 where: bonds (distance) C4'-P energy: -73.811 bonds (distance) P-C4' energy: -55.858 flat angles C4'-P-C4' energy: -56.765 flat angles P-C4'-P energy: -40.198 tors. eta vs tors. theta energy: 23.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1190.437612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.437612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.187612 (E_RNA) where: Base-Base interactions energy: -802.686 where: short stacking energy: -358.324 Base-Backbone interact. energy: -1.568 local terms energy: -418.933819 where: bonds (distance) C4'-P energy: -74.327 bonds (distance) P-C4' energy: -80.264 flat angles C4'-P-C4' energy: -90.942 flat angles P-C4'-P energy: -66.971 tors. eta vs tors. theta energy: -106.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1208.358604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.358604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.108604 (E_RNA) where: Base-Base interactions energy: -823.989 where: short stacking energy: -375.049 Base-Backbone interact. energy: -2.145 local terms energy: -414.974880 where: bonds (distance) C4'-P energy: -83.048 bonds (distance) P-C4' energy: -93.415 flat angles C4'-P-C4' energy: -90.093 flat angles P-C4'-P energy: -51.907 tors. eta vs tors. theta energy: -96.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1087.844958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.844958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.594958 (E_RNA) where: Base-Base interactions energy: -733.384 where: short stacking energy: -331.170 Base-Backbone interact. energy: -1.029 local terms energy: -386.181644 where: bonds (distance) C4'-P energy: -68.370 bonds (distance) P-C4' energy: -91.132 flat angles C4'-P-C4' energy: -82.612 flat angles P-C4'-P energy: -57.131 tors. eta vs tors. theta energy: -86.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -949.979966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.979966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.729966 (E_RNA) where: Base-Base interactions energy: -635.465 where: short stacking energy: -290.478 Base-Backbone interact. energy: -1.528 local terms energy: -345.737369 where: bonds (distance) C4'-P energy: -70.367 bonds (distance) P-C4' energy: -79.286 flat angles C4'-P-C4' energy: -77.943 flat angles P-C4'-P energy: -46.810 tors. eta vs tors. theta energy: -71.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -937.904950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.904950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.654950 (E_RNA) where: Base-Base interactions energy: -596.258 where: short stacking energy: -301.255 Base-Backbone interact. energy: -2.040 local terms energy: -372.357066 where: bonds (distance) C4'-P energy: -76.259 bonds (distance) P-C4' energy: -75.036 flat angles C4'-P-C4' energy: -85.924 flat angles P-C4'-P energy: -66.411 tors. eta vs tors. theta energy: -68.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -696.145042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.145042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.895042 (E_RNA) where: Base-Base interactions energy: -442.705 where: short stacking energy: -210.615 Base-Backbone interact. energy: -2.531 local terms energy: -283.659686 where: bonds (distance) C4'-P energy: -62.560 bonds (distance) P-C4' energy: -86.364 flat angles C4'-P-C4' energy: -60.129 flat angles P-C4'-P energy: -36.840 tors. eta vs tors. theta energy: -37.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -708.807902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.807902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.557902 (E_RNA) where: Base-Base interactions energy: -429.836 where: short stacking energy: -206.048 Base-Backbone interact. energy: 0.975 local terms energy: -312.696549 where: bonds (distance) C4'-P energy: -71.078 bonds (distance) P-C4' energy: -81.095 flat angles C4'-P-C4' energy: -71.344 flat angles P-C4'-P energy: -48.864 tors. eta vs tors. theta energy: -40.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -628.703841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.703841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.453841 (E_RNA) where: Base-Base interactions energy: -421.931 where: short stacking energy: -187.625 Base-Backbone interact. energy: 0.026 local terms energy: -239.549207 where: bonds (distance) C4'-P energy: -60.305 bonds (distance) P-C4' energy: -58.080 flat angles C4'-P-C4' energy: -56.197 flat angles P-C4'-P energy: -36.022 tors. eta vs tors. theta energy: -28.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -482.989000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.989000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.739000 (E_RNA) where: Base-Base interactions energy: -275.747 where: short stacking energy: -153.809 Base-Backbone interact. energy: 1.296 local terms energy: -241.287595 where: bonds (distance) C4'-P energy: -59.297 bonds (distance) P-C4' energy: -80.328 flat angles C4'-P-C4' energy: -53.958 flat angles P-C4'-P energy: -44.329 tors. eta vs tors. theta energy: -3.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -393.806503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.806503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.556503 (E_RNA) where: Base-Base interactions energy: -203.808 where: short stacking energy: -109.799 Base-Backbone interact. energy: -1.532 local terms energy: -221.216543 where: bonds (distance) C4'-P energy: -64.839 bonds (distance) P-C4' energy: -62.668 flat angles C4'-P-C4' energy: -58.987 flat angles P-C4'-P energy: -35.071 tors. eta vs tors. theta energy: 0.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1234.806221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.806221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.556221 (E_RNA) where: Base-Base interactions energy: -838.136 where: short stacking energy: -376.610 Base-Backbone interact. energy: -1.162 local terms energy: -428.258676 where: bonds (distance) C4'-P energy: -76.051 bonds (distance) P-C4' energy: -85.125 flat angles C4'-P-C4' energy: -95.040 flat angles P-C4'-P energy: -63.952 tors. eta vs tors. theta energy: -108.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1212.795620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.795620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.545620 (E_RNA) where: Base-Base interactions energy: -819.914 where: short stacking energy: -357.721 Base-Backbone interact. energy: -3.111 local terms energy: -422.520762 where: bonds (distance) C4'-P energy: -81.499 bonds (distance) P-C4' energy: -90.540 flat angles C4'-P-C4' energy: -90.291 flat angles P-C4'-P energy: -61.202 tors. eta vs tors. theta energy: -98.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1069.787813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.787813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.537813 (E_RNA) where: Base-Base interactions energy: -719.956 where: short stacking energy: -326.327 Base-Backbone interact. energy: -1.821 local terms energy: -380.760951 where: bonds (distance) C4'-P energy: -66.877 bonds (distance) P-C4' energy: -80.969 flat angles C4'-P-C4' energy: -96.211 flat angles P-C4'-P energy: -53.582 tors. eta vs tors. theta energy: -83.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -987.140009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.140009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.890009 (E_RNA) where: Base-Base interactions energy: -655.270 where: short stacking energy: -284.140 Base-Backbone interact. energy: 0.272 local terms energy: -364.891808 where: bonds (distance) C4'-P energy: -79.575 bonds (distance) P-C4' energy: -76.629 flat angles C4'-P-C4' energy: -84.210 flat angles P-C4'-P energy: -56.609 tors. eta vs tors. theta energy: -67.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -941.161855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.161855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.911855 (E_RNA) where: Base-Base interactions energy: -612.633 where: short stacking energy: -290.554 Base-Backbone interact. energy: 2.338 local terms energy: -364.432409 where: bonds (distance) C4'-P energy: -63.075 bonds (distance) P-C4' energy: -86.432 flat angles C4'-P-C4' energy: -91.022 flat angles P-C4'-P energy: -47.486 tors. eta vs tors. theta energy: -76.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.815 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -703.560706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.560706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.310706 (E_RNA) where: Base-Base interactions energy: -432.610 where: short stacking energy: -200.068 Base-Backbone interact. energy: 0.462 local terms energy: -304.163200 where: bonds (distance) C4'-P energy: -62.988 bonds (distance) P-C4' energy: -82.517 flat angles C4'-P-C4' energy: -67.958 flat angles P-C4'-P energy: -48.444 tors. eta vs tors. theta energy: -42.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -660.164678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.164678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.914678 (E_RNA) where: Base-Base interactions energy: -393.072 where: short stacking energy: -216.070 Base-Backbone interact. energy: 2.965 local terms energy: -302.807635 where: bonds (distance) C4'-P energy: -66.668 bonds (distance) P-C4' energy: -69.431 flat angles C4'-P-C4' energy: -63.880 flat angles P-C4'-P energy: -57.776 tors. eta vs tors. theta energy: -45.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -590.287285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.287285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.037285 (E_RNA) where: Base-Base interactions energy: -332.489 where: short stacking energy: -166.974 Base-Backbone interact. energy: -1.786 local terms energy: -288.762865 where: bonds (distance) C4'-P energy: -83.768 bonds (distance) P-C4' energy: -68.529 flat angles C4'-P-C4' energy: -63.999 flat angles P-C4'-P energy: -44.123 tors. eta vs tors. theta energy: -28.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -432.092572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.092572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.842572 (E_RNA) where: Base-Base interactions energy: -223.949 where: short stacking energy: -130.716 Base-Backbone interact. energy: 0.466 local terms energy: -241.359796 where: bonds (distance) C4'-P energy: -61.974 bonds (distance) P-C4' energy: -74.849 flat angles C4'-P-C4' energy: -61.519 flat angles P-C4'-P energy: -33.531 tors. eta vs tors. theta energy: -9.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -393.493662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.493662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.243662 (E_RNA) where: Base-Base interactions energy: -207.880 where: short stacking energy: -128.701 Base-Backbone interact. energy: 0.163 local terms energy: -218.526899 where: bonds (distance) C4'-P energy: -42.951 bonds (distance) P-C4' energy: -74.598 flat angles C4'-P-C4' energy: -58.936 flat angles P-C4'-P energy: -34.187 tors. eta vs tors. theta energy: -7.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1237.902570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.902570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.652570 (E_RNA) where: Base-Base interactions energy: -869.655 where: short stacking energy: -384.513 Base-Backbone interact. energy: -1.349 local terms energy: -399.649038 where: bonds (distance) C4'-P energy: -72.128 bonds (distance) P-C4' energy: -81.249 flat angles C4'-P-C4' energy: -97.416 flat angles P-C4'-P energy: -39.751 tors. eta vs tors. theta energy: -109.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1195.684706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.684706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.434706 (E_RNA) where: Base-Base interactions energy: -803.491 where: short stacking energy: -367.833 Base-Backbone interact. energy: -2.829 local terms energy: -422.114950 where: bonds (distance) C4'-P energy: -81.811 bonds (distance) P-C4' energy: -87.296 flat angles C4'-P-C4' energy: -84.941 flat angles P-C4'-P energy: -62.558 tors. eta vs tors. theta energy: -105.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1032.737060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.737060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1065.487060 (E_RNA) where: Base-Base interactions energy: -704.390 where: short stacking energy: -298.834 Base-Backbone interact. energy: -2.312 local terms energy: -358.785295 where: bonds (distance) C4'-P energy: -60.077 bonds (distance) P-C4' energy: -84.275 flat angles C4'-P-C4' energy: -87.088 flat angles P-C4'-P energy: -56.616 tors. eta vs tors. theta energy: -70.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -975.347671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.347671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.097671 (E_RNA) where: Base-Base interactions energy: -657.567 where: short stacking energy: -314.566 Base-Backbone interact. energy: -0.324 local terms energy: -350.207432 where: bonds (distance) C4'-P energy: -69.419 bonds (distance) P-C4' energy: -66.218 flat angles C4'-P-C4' energy: -85.395 flat angles P-C4'-P energy: -54.078 tors. eta vs tors. theta energy: -75.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -952.265084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.265084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.015084 (E_RNA) where: Base-Base interactions energy: -645.944 where: short stacking energy: -307.970 Base-Backbone interact. energy: 0.013 local terms energy: -339.083808 where: bonds (distance) C4'-P energy: -73.948 bonds (distance) P-C4' energy: -74.175 flat angles C4'-P-C4' energy: -64.156 flat angles P-C4'-P energy: -36.935 tors. eta vs tors. theta energy: -89.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -743.748030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.748030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.498030 (E_RNA) where: Base-Base interactions energy: -472.893 where: short stacking energy: -247.561 Base-Backbone interact. energy: -0.808 local terms energy: -302.796701 where: bonds (distance) C4'-P energy: -75.262 bonds (distance) P-C4' energy: -72.108 flat angles C4'-P-C4' energy: -73.567 flat angles P-C4'-P energy: -39.610 tors. eta vs tors. theta energy: -42.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -646.496704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.496704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.246704 (E_RNA) where: Base-Base interactions energy: -401.269 where: short stacking energy: -204.615 Base-Backbone interact. energy: -0.981 local terms energy: -276.996314 where: bonds (distance) C4'-P energy: -71.599 bonds (distance) P-C4' energy: -77.156 flat angles C4'-P-C4' energy: -70.967 flat angles P-C4'-P energy: -35.190 tors. eta vs tors. theta energy: -22.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -487.369945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.369945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.119945 (E_RNA) where: Base-Base interactions energy: -281.441 where: short stacking energy: -149.582 Base-Backbone interact. energy: 1.120 local terms energy: -240.263213 where: bonds (distance) C4'-P energy: -66.266 bonds (distance) P-C4' energy: -72.073 flat angles C4'-P-C4' energy: -57.101 flat angles P-C4'-P energy: -39.519 tors. eta vs tors. theta energy: -5.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.465 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -447.313223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.313223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.063223 (E_RNA) where: Base-Base interactions energy: -238.489 where: short stacking energy: -114.532 Base-Backbone interact. energy: 2.146 local terms energy: -243.720405 where: bonds (distance) C4'-P energy: -59.283 bonds (distance) P-C4' energy: -81.571 flat angles C4'-P-C4' energy: -65.620 flat angles P-C4'-P energy: -36.058 tors. eta vs tors. theta energy: -1.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -389.541229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.541229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.291229 (E_RNA) where: Base-Base interactions energy: -196.303 where: short stacking energy: -118.080 Base-Backbone interact. energy: 0.794 local terms energy: -226.781427 where: bonds (distance) C4'-P energy: -73.174 bonds (distance) P-C4' energy: -60.442 flat angles C4'-P-C4' energy: -67.263 flat angles P-C4'-P energy: -24.949 tors. eta vs tors. theta energy: -0.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1226.122188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.122188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.872188 (E_RNA) where: Base-Base interactions energy: -848.146 where: short stacking energy: -372.968 Base-Backbone interact. energy: -0.228 local terms energy: -410.498721 where: bonds (distance) C4'-P energy: -75.258 bonds (distance) P-C4' energy: -91.734 flat angles C4'-P-C4' energy: -85.367 flat angles P-C4'-P energy: -54.155 tors. eta vs tors. theta energy: -103.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1184.107064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.107064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.857064 (E_RNA) where: Base-Base interactions energy: -824.956 where: short stacking energy: -351.925 Base-Backbone interact. energy: -2.539 local terms energy: -389.361805 where: bonds (distance) C4'-P energy: -66.658 bonds (distance) P-C4' energy: -81.250 flat angles C4'-P-C4' energy: -87.665 flat angles P-C4'-P energy: -55.017 tors. eta vs tors. theta energy: -98.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1082.890555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.890555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1115.640555 (E_RNA) where: Base-Base interactions energy: -722.355 where: short stacking energy: -328.135 Base-Backbone interact. energy: -2.331 local terms energy: -390.954027 where: bonds (distance) C4'-P energy: -78.551 bonds (distance) P-C4' energy: -80.469 flat angles C4'-P-C4' energy: -93.198 flat angles P-C4'-P energy: -57.289 tors. eta vs tors. theta energy: -81.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1003.529162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.529162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.279162 (E_RNA) where: Base-Base interactions energy: -691.582 where: short stacking energy: -297.643 Base-Backbone interact. energy: -0.235 local terms energy: -344.462942 where: bonds (distance) C4'-P energy: -63.199 bonds (distance) P-C4' energy: -72.586 flat angles C4'-P-C4' energy: -79.914 flat angles P-C4'-P energy: -55.572 tors. eta vs tors. theta energy: -73.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -957.272983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.272983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.022983 (E_RNA) where: Base-Base interactions energy: -632.991 where: short stacking energy: -283.449 Base-Backbone interact. energy: -0.308 local terms energy: -356.723837 where: bonds (distance) C4'-P energy: -71.939 bonds (distance) P-C4' energy: -78.410 flat angles C4'-P-C4' energy: -79.199 flat angles P-C4'-P energy: -53.058 tors. eta vs tors. theta energy: -74.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -759.717726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.717726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.467726 (E_RNA) where: Base-Base interactions energy: -472.303 where: short stacking energy: -239.244 Base-Backbone interact. energy: -1.539 local terms energy: -318.625628 where: bonds (distance) C4'-P energy: -70.286 bonds (distance) P-C4' energy: -87.794 flat angles C4'-P-C4' energy: -88.039 flat angles P-C4'-P energy: -32.486 tors. eta vs tors. theta energy: -40.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -691.757777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.757777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.507777 (E_RNA) where: Base-Base interactions energy: -431.121 where: short stacking energy: -219.810 Base-Backbone interact. energy: -2.652 local terms energy: -290.735617 where: bonds (distance) C4'-P energy: -67.088 bonds (distance) P-C4' energy: -72.213 flat angles C4'-P-C4' energy: -78.210 flat angles P-C4'-P energy: -41.601 tors. eta vs tors. theta energy: -31.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -494.464673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.464673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.214673 (E_RNA) where: Base-Base interactions energy: -271.818 where: short stacking energy: -143.166 Base-Backbone interact. energy: 0.041 local terms energy: -255.437909 where: bonds (distance) C4'-P energy: -52.972 bonds (distance) P-C4' energy: -76.211 flat angles C4'-P-C4' energy: -72.992 flat angles P-C4'-P energy: -56.498 tors. eta vs tors. theta energy: 3.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -470.784682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.784682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.534682 (E_RNA) where: Base-Base interactions energy: -269.074 where: short stacking energy: -132.836 Base-Backbone interact. energy: 2.995 local terms energy: -237.454932 where: bonds (distance) C4'-P energy: -67.754 bonds (distance) P-C4' energy: -62.908 flat angles C4'-P-C4' energy: -67.673 flat angles P-C4'-P energy: -34.351 tors. eta vs tors. theta energy: -4.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -370.965277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.965277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.715277 (E_RNA) where: Base-Base interactions energy: -200.293 where: short stacking energy: -111.091 Base-Backbone interact. energy: 0.158 local terms energy: -203.580990 where: bonds (distance) C4'-P energy: -59.004 bonds (distance) P-C4' energy: -75.518 flat angles C4'-P-C4' energy: -49.730 flat angles P-C4'-P energy: -28.346 tors. eta vs tors. theta energy: 9.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1234.044265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.044265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.794265 (E_RNA) where: Base-Base interactions energy: -855.569 where: short stacking energy: -383.089 Base-Backbone interact. energy: -1.025 local terms energy: -410.200689 where: bonds (distance) C4'-P energy: -71.742 bonds (distance) P-C4' energy: -83.385 flat angles C4'-P-C4' energy: -90.455 flat angles P-C4'-P energy: -58.877 tors. eta vs tors. theta energy: -105.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1207.500121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.500121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.250121 (E_RNA) where: Base-Base interactions energy: -838.313 where: short stacking energy: -377.749 Base-Backbone interact. energy: 0.852 local terms energy: -402.788428 where: bonds (distance) C4'-P energy: -73.264 bonds (distance) P-C4' energy: -87.336 flat angles C4'-P-C4' energy: -91.109 flat angles P-C4'-P energy: -49.137 tors. eta vs tors. theta energy: -101.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1058.127512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.127512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.877512 (E_RNA) where: Base-Base interactions energy: -723.220 where: short stacking energy: -309.961 Base-Backbone interact. energy: -2.642 local terms energy: -365.015279 where: bonds (distance) C4'-P energy: -72.694 bonds (distance) P-C4' energy: -81.745 flat angles C4'-P-C4' energy: -77.814 flat angles P-C4'-P energy: -55.050 tors. eta vs tors. theta energy: -77.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1005.427065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.427065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.177065 (E_RNA) where: Base-Base interactions energy: -692.957 where: short stacking energy: -329.601 Base-Backbone interact. energy: -1.702 local terms energy: -343.517963 where: bonds (distance) C4'-P energy: -61.932 bonds (distance) P-C4' energy: -71.343 flat angles C4'-P-C4' energy: -87.564 flat angles P-C4'-P energy: -47.813 tors. eta vs tors. theta energy: -74.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -939.783065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.783065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.533065 (E_RNA) where: Base-Base interactions energy: -617.406 where: short stacking energy: -298.198 Base-Backbone interact. energy: -0.871 local terms energy: -354.256535 where: bonds (distance) C4'-P energy: -75.847 bonds (distance) P-C4' energy: -84.009 flat angles C4'-P-C4' energy: -77.731 flat angles P-C4'-P energy: -42.549 tors. eta vs tors. theta energy: -74.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -774.882305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.882305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -807.632305 (E_RNA) where: Base-Base interactions energy: -503.207 where: short stacking energy: -240.489 Base-Backbone interact. energy: -1.554 local terms energy: -302.871439 where: bonds (distance) C4'-P energy: -73.611 bonds (distance) P-C4' energy: -74.766 flat angles C4'-P-C4' energy: -67.508 flat angles P-C4'-P energy: -38.385 tors. eta vs tors. theta energy: -48.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -643.675097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -643.675097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.425097 (E_RNA) where: Base-Base interactions energy: -394.423 where: short stacking energy: -178.143 Base-Backbone interact. energy: -0.386 local terms energy: -281.616378 where: bonds (distance) C4'-P energy: -67.198 bonds (distance) P-C4' energy: -79.804 flat angles C4'-P-C4' energy: -61.093 flat angles P-C4'-P energy: -45.859 tors. eta vs tors. theta energy: -27.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -493.986437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.986437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.736437 (E_RNA) where: Base-Base interactions energy: -249.317 where: short stacking energy: -132.236 Base-Backbone interact. energy: 1.072 local terms energy: -278.491405 where: bonds (distance) C4'-P energy: -71.301 bonds (distance) P-C4' energy: -85.595 flat angles C4'-P-C4' energy: -76.244 flat angles P-C4'-P energy: -41.799 tors. eta vs tors. theta energy: -3.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -454.849099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.849099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.599099 (E_RNA) where: Base-Base interactions energy: -246.305 where: short stacking energy: -132.139 Base-Backbone interact. energy: 0.178 local terms energy: -243.266948 where: bonds (distance) C4'-P energy: -54.370 bonds (distance) P-C4' energy: -76.005 flat angles C4'-P-C4' energy: -69.620 flat angles P-C4'-P energy: -37.760 tors. eta vs tors. theta energy: -5.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.795 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -380.749486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.749486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.499486 (E_RNA) where: Base-Base interactions energy: -187.423 where: short stacking energy: -120.841 Base-Backbone interact. energy: -0.190 local terms energy: -225.885964 where: bonds (distance) C4'-P energy: -68.108 bonds (distance) P-C4' energy: -72.937 flat angles C4'-P-C4' energy: -62.070 flat angles P-C4'-P energy: -32.971 tors. eta vs tors. theta energy: 10.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1263.570706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.570706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.320706 (E_RNA) where: Base-Base interactions energy: -893.641 where: short stacking energy: -366.512 Base-Backbone interact. energy: -2.053 local terms energy: -400.625812 where: bonds (distance) C4'-P energy: -77.246 bonds (distance) P-C4' energy: -88.771 flat angles C4'-P-C4' energy: -83.273 flat angles P-C4'-P energy: -54.641 tors. eta vs tors. theta energy: -96.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1197.315973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.315973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.065973 (E_RNA) where: Base-Base interactions energy: -839.732 where: short stacking energy: -378.152 Base-Backbone interact. energy: -1.148 local terms energy: -389.186097 where: bonds (distance) C4'-P energy: -80.636 bonds (distance) P-C4' energy: -70.225 flat angles C4'-P-C4' energy: -91.181 flat angles P-C4'-P energy: -50.659 tors. eta vs tors. theta energy: -96.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1064.725739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.725739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.475739 (E_RNA) where: Base-Base interactions energy: -735.334 where: short stacking energy: -336.434 Base-Backbone interact. energy: -1.289 local terms energy: -360.852717 where: bonds (distance) C4'-P energy: -59.349 bonds (distance) P-C4' energy: -73.093 flat angles C4'-P-C4' energy: -86.799 flat angles P-C4'-P energy: -59.421 tors. eta vs tors. theta energy: -82.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1026.215839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.215839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.965839 (E_RNA) where: Base-Base interactions energy: -683.002 where: short stacking energy: -290.730 Base-Backbone interact. energy: -1.540 local terms energy: -374.423443 where: bonds (distance) C4'-P energy: -74.204 bonds (distance) P-C4' energy: -85.896 flat angles C4'-P-C4' energy: -83.616 flat angles P-C4'-P energy: -45.428 tors. eta vs tors. theta energy: -85.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -950.353586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.353586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.103586 (E_RNA) where: Base-Base interactions energy: -661.001 where: short stacking energy: -303.205 Base-Backbone interact. energy: 1.443 local terms energy: -323.545723 where: bonds (distance) C4'-P energy: -69.268 bonds (distance) P-C4' energy: -71.548 flat angles C4'-P-C4' energy: -69.475 flat angles P-C4'-P energy: -44.996 tors. eta vs tors. theta energy: -68.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -793.983391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.983391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.733391 (E_RNA) where: Base-Base interactions energy: -503.967 where: short stacking energy: -233.576 Base-Backbone interact. energy: 0.037 local terms energy: -322.803992 where: bonds (distance) C4'-P energy: -68.654 bonds (distance) P-C4' energy: -71.843 flat angles C4'-P-C4' energy: -83.310 flat angles P-C4'-P energy: -49.710 tors. eta vs tors. theta energy: -49.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -696.010783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.010783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.760783 (E_RNA) where: Base-Base interactions energy: -433.136 where: short stacking energy: -233.695 Base-Backbone interact. energy: -3.708 local terms energy: -291.916728 where: bonds (distance) C4'-P energy: -56.040 bonds (distance) P-C4' energy: -74.731 flat angles C4'-P-C4' energy: -67.231 flat angles P-C4'-P energy: -42.409 tors. eta vs tors. theta energy: -51.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -457.364515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.364515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.114515 (E_RNA) where: Base-Base interactions energy: -230.560 where: short stacking energy: -147.120 Base-Backbone interact. energy: -1.314 local terms energy: -258.241175 where: bonds (distance) C4'-P energy: -64.000 bonds (distance) P-C4' energy: -82.422 flat angles C4'-P-C4' energy: -57.826 flat angles P-C4'-P energy: -41.694 tors. eta vs tors. theta energy: -12.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -442.507100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.507100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.257100 (E_RNA) where: Base-Base interactions energy: -238.281 where: short stacking energy: -143.478 Base-Backbone interact. energy: -1.401 local terms energy: -235.574504 where: bonds (distance) C4'-P energy: -72.130 bonds (distance) P-C4' energy: -75.391 flat angles C4'-P-C4' energy: -49.298 flat angles P-C4'-P energy: -34.183 tors. eta vs tors. theta energy: -4.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -349.248320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.248320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.998320 (E_RNA) where: Base-Base interactions energy: -173.167 where: short stacking energy: -96.327 Base-Backbone interact. energy: 5.506 local terms energy: -214.337650 where: bonds (distance) C4'-P energy: -57.666 bonds (distance) P-C4' energy: -64.587 flat angles C4'-P-C4' energy: -67.165 flat angles P-C4'-P energy: -33.663 tors. eta vs tors. theta energy: 8.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1291.948330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.948330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.698330 (E_RNA) where: Base-Base interactions energy: -895.717 where: short stacking energy: -389.046 Base-Backbone interact. energy: -2.794 local terms energy: -426.188139 where: bonds (distance) C4'-P energy: -95.143 bonds (distance) P-C4' energy: -75.498 flat angles C4'-P-C4' energy: -91.993 flat angles P-C4'-P energy: -65.368 tors. eta vs tors. theta energy: -98.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1155.263727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.263727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.013727 (E_RNA) where: Base-Base interactions energy: -777.140 where: short stacking energy: -335.693 Base-Backbone interact. energy: 2.238 local terms energy: -413.112153 where: bonds (distance) C4'-P energy: -73.566 bonds (distance) P-C4' energy: -90.895 flat angles C4'-P-C4' energy: -90.526 flat angles P-C4'-P energy: -66.064 tors. eta vs tors. theta energy: -92.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1062.751352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.751352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.501352 (E_RNA) where: Base-Base interactions energy: -719.462 where: short stacking energy: -312.551 Base-Backbone interact. energy: 1.663 local terms energy: -377.702337 where: bonds (distance) C4'-P energy: -82.679 bonds (distance) P-C4' energy: -81.663 flat angles C4'-P-C4' energy: -78.339 flat angles P-C4'-P energy: -56.841 tors. eta vs tors. theta energy: -78.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1063.194552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.194552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.944552 (E_RNA) where: Base-Base interactions energy: -717.603 where: short stacking energy: -340.981 Base-Backbone interact. energy: -0.673 local terms energy: -377.668807 where: bonds (distance) C4'-P energy: -73.161 bonds (distance) P-C4' energy: -70.224 flat angles C4'-P-C4' energy: -81.767 flat angles P-C4'-P energy: -50.512 tors. eta vs tors. theta energy: -102.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -926.169526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.169526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.919526 (E_RNA) where: Base-Base interactions energy: -615.921 where: short stacking energy: -293.255 Base-Backbone interact. energy: 5.472 local terms energy: -348.470944 where: bonds (distance) C4'-P energy: -65.617 bonds (distance) P-C4' energy: -75.191 flat angles C4'-P-C4' energy: -84.315 flat angles P-C4'-P energy: -53.318 tors. eta vs tors. theta energy: -70.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -824.776683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.776683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.526683 (E_RNA) where: Base-Base interactions energy: -517.306 where: short stacking energy: -249.855 Base-Backbone interact. energy: -1.108 local terms energy: -339.112914 where: bonds (distance) C4'-P energy: -82.759 bonds (distance) P-C4' energy: -75.699 flat angles C4'-P-C4' energy: -78.033 flat angles P-C4'-P energy: -48.292 tors. eta vs tors. theta energy: -54.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -660.095790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.095790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.845790 (E_RNA) where: Base-Base interactions energy: -398.171 where: short stacking energy: -213.235 Base-Backbone interact. energy: 3.391 local terms energy: -298.066037 where: bonds (distance) C4'-P energy: -68.020 bonds (distance) P-C4' energy: -82.450 flat angles C4'-P-C4' energy: -66.911 flat angles P-C4'-P energy: -48.406 tors. eta vs tors. theta energy: -32.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -477.679826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.679826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.429826 (E_RNA) where: Base-Base interactions energy: -245.409 where: short stacking energy: -141.110 Base-Backbone interact. energy: -0.624 local terms energy: -264.396747 where: bonds (distance) C4'-P energy: -62.384 bonds (distance) P-C4' energy: -75.676 flat angles C4'-P-C4' energy: -59.437 flat angles P-C4'-P energy: -44.680 tors. eta vs tors. theta energy: -22.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -388.531516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.531516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.281516 (E_RNA) where: Base-Base interactions energy: -216.556 where: short stacking energy: -121.253 Base-Backbone interact. energy: 0.914 local terms energy: -205.638989 where: bonds (distance) C4'-P energy: -72.478 bonds (distance) P-C4' energy: -56.825 flat angles C4'-P-C4' energy: -61.773 flat angles P-C4'-P energy: -23.627 tors. eta vs tors. theta energy: 9.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -377.746585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.746585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.496585 (E_RNA) where: Base-Base interactions energy: -170.702 where: short stacking energy: -120.925 Base-Backbone interact. energy: -1.628 local terms energy: -238.166269 where: bonds (distance) C4'-P energy: -71.961 bonds (distance) P-C4' energy: -71.379 flat angles C4'-P-C4' energy: -47.696 flat angles P-C4'-P energy: -42.182 tors. eta vs tors. theta energy: -4.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1277.520851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.520851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.270851 (E_RNA) where: Base-Base interactions energy: -883.117 where: short stacking energy: -377.192 Base-Backbone interact. energy: -3.093 local terms energy: -424.061228 where: bonds (distance) C4'-P energy: -83.153 bonds (distance) P-C4' energy: -89.447 flat angles C4'-P-C4' energy: -87.003 flat angles P-C4'-P energy: -52.925 tors. eta vs tors. theta energy: -111.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1175.215967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.215967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.965967 (E_RNA) where: Base-Base interactions energy: -798.138 where: short stacking energy: -351.839 Base-Backbone interact. energy: -1.896 local terms energy: -407.931676 where: bonds (distance) C4'-P energy: -78.446 bonds (distance) P-C4' energy: -71.492 flat angles C4'-P-C4' energy: -91.822 flat angles P-C4'-P energy: -57.471 tors. eta vs tors. theta energy: -108.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1036.700301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.700301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.450301 (E_RNA) where: Base-Base interactions energy: -702.233 where: short stacking energy: -303.485 Base-Backbone interact. energy: 1.196 local terms energy: -368.414099 where: bonds (distance) C4'-P energy: -69.158 bonds (distance) P-C4' energy: -86.029 flat angles C4'-P-C4' energy: -83.763 flat angles P-C4'-P energy: -47.114 tors. eta vs tors. theta energy: -82.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1085.418210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.418210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.168210 (E_RNA) where: Base-Base interactions energy: -738.410 where: short stacking energy: -339.215 Base-Backbone interact. energy: -0.788 local terms energy: -378.970181 where: bonds (distance) C4'-P energy: -81.794 bonds (distance) P-C4' energy: -76.881 flat angles C4'-P-C4' energy: -79.932 flat angles P-C4'-P energy: -50.342 tors. eta vs tors. theta energy: -90.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -955.623513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.623513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.373513 (E_RNA) where: Base-Base interactions energy: -630.624 where: short stacking energy: -298.638 Base-Backbone interact. energy: -1.451 local terms energy: -356.298689 where: bonds (distance) C4'-P energy: -69.472 bonds (distance) P-C4' energy: -85.068 flat angles C4'-P-C4' energy: -79.608 flat angles P-C4'-P energy: -48.507 tors. eta vs tors. theta energy: -73.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -804.402999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.402999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.152999 (E_RNA) where: Base-Base interactions energy: -521.573 where: short stacking energy: -225.569 Base-Backbone interact. energy: -2.886 local terms energy: -312.694112 where: bonds (distance) C4'-P energy: -75.109 bonds (distance) P-C4' energy: -83.442 flat angles C4'-P-C4' energy: -70.796 flat angles P-C4'-P energy: -42.591 tors. eta vs tors. theta energy: -40.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -693.939694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.939694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.689694 (E_RNA) where: Base-Base interactions energy: -422.179 where: short stacking energy: -210.009 Base-Backbone interact. energy: -2.117 local terms energy: -302.393672 where: bonds (distance) C4'-P energy: -71.770 bonds (distance) P-C4' energy: -70.991 flat angles C4'-P-C4' energy: -66.701 flat angles P-C4'-P energy: -50.913 tors. eta vs tors. theta energy: -42.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -472.206430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.206430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.956430 (E_RNA) where: Base-Base interactions energy: -266.131 where: short stacking energy: -155.618 Base-Backbone interact. energy: -0.017 local terms energy: -238.809124 where: bonds (distance) C4'-P energy: -62.978 bonds (distance) P-C4' energy: -65.817 flat angles C4'-P-C4' energy: -60.562 flat angles P-C4'-P energy: -36.376 tors. eta vs tors. theta energy: -13.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -351.952223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.952223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.702223 (E_RNA) where: Base-Base interactions energy: -159.541 where: short stacking energy: -102.178 Base-Backbone interact. energy: 0.918 local terms energy: -226.078956 where: bonds (distance) C4'-P energy: -71.686 bonds (distance) P-C4' energy: -83.312 flat angles C4'-P-C4' energy: -48.567 flat angles P-C4'-P energy: -30.754 tors. eta vs tors. theta energy: 8.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -387.132230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.132230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.882230 (E_RNA) where: Base-Base interactions energy: -204.707 where: short stacking energy: -114.691 Base-Backbone interact. energy: -1.509 local terms energy: -213.666189 where: bonds (distance) C4'-P energy: -62.096 bonds (distance) P-C4' energy: -64.618 flat angles C4'-P-C4' energy: -62.596 flat angles P-C4'-P energy: -39.351 tors. eta vs tors. theta energy: 14.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1289.467736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.467736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.217736 (E_RNA) where: Base-Base interactions energy: -907.670 where: short stacking energy: -394.448 Base-Backbone interact. energy: 2.741 local terms energy: -417.288271 where: bonds (distance) C4'-P energy: -79.313 bonds (distance) P-C4' energy: -77.390 flat angles C4'-P-C4' energy: -89.828 flat angles P-C4'-P energy: -62.827 tors. eta vs tors. theta energy: -107.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1180.311262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.311262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.061262 (E_RNA) where: Base-Base interactions energy: -793.592 where: short stacking energy: -363.670 Base-Backbone interact. energy: -1.828 local terms energy: -417.641347 where: bonds (distance) C4'-P energy: -82.367 bonds (distance) P-C4' energy: -87.980 flat angles C4'-P-C4' energy: -89.057 flat angles P-C4'-P energy: -57.775 tors. eta vs tors. theta energy: -100.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1067.793382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.793382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.543382 (E_RNA) where: Base-Base interactions energy: -694.696 where: short stacking energy: -301.430 Base-Backbone interact. energy: -3.001 local terms energy: -402.846250 where: bonds (distance) C4'-P energy: -76.681 bonds (distance) P-C4' energy: -87.953 flat angles C4'-P-C4' energy: -97.531 flat angles P-C4'-P energy: -67.563 tors. eta vs tors. theta energy: -73.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1068.814785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.814785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.564785 (E_RNA) where: Base-Base interactions energy: -722.862 where: short stacking energy: -338.339 Base-Backbone interact. energy: -0.460 local terms energy: -378.242719 where: bonds (distance) C4'-P energy: -79.203 bonds (distance) P-C4' energy: -63.180 flat angles C4'-P-C4' energy: -82.276 flat angles P-C4'-P energy: -65.227 tors. eta vs tors. theta energy: -88.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -918.183411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.183411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.933411 (E_RNA) where: Base-Base interactions energy: -618.561 where: short stacking energy: -287.212 Base-Backbone interact. energy: -0.782 local terms energy: -331.589905 where: bonds (distance) C4'-P energy: -66.078 bonds (distance) P-C4' energy: -82.049 flat angles C4'-P-C4' energy: -75.418 flat angles P-C4'-P energy: -47.857 tors. eta vs tors. theta energy: -60.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -797.514222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.514222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -830.264222 (E_RNA) where: Base-Base interactions energy: -527.767 where: short stacking energy: -237.995 Base-Backbone interact. energy: -1.723 local terms energy: -300.773899 where: bonds (distance) C4'-P energy: -72.553 bonds (distance) P-C4' energy: -69.426 flat angles C4'-P-C4' energy: -72.892 flat angles P-C4'-P energy: -43.332 tors. eta vs tors. theta energy: -42.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -704.523882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.523882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.273882 (E_RNA) where: Base-Base interactions energy: -428.437 where: short stacking energy: -208.782 Base-Backbone interact. energy: -0.702 local terms energy: -308.135026 where: bonds (distance) C4'-P energy: -76.454 bonds (distance) P-C4' energy: -77.218 flat angles C4'-P-C4' energy: -72.349 flat angles P-C4'-P energy: -45.981 tors. eta vs tors. theta energy: -36.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -393.106253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.106253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.856253 (E_RNA) where: Base-Base interactions energy: -192.550 where: short stacking energy: -110.264 Base-Backbone interact. energy: -0.259 local terms energy: -233.047342 where: bonds (distance) C4'-P energy: -63.610 bonds (distance) P-C4' energy: -76.065 flat angles C4'-P-C4' energy: -65.993 flat angles P-C4'-P energy: -40.203 tors. eta vs tors. theta energy: 12.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -460.671045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.671045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.421045 (E_RNA) where: Base-Base interactions energy: -247.236 where: short stacking energy: -157.059 Base-Backbone interact. energy: 6.148 local terms energy: -252.332642 where: bonds (distance) C4'-P energy: -53.603 bonds (distance) P-C4' energy: -67.079 flat angles C4'-P-C4' energy: -58.001 flat angles P-C4'-P energy: -59.632 tors. eta vs tors. theta energy: -14.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -390.997133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.997133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.747133 (E_RNA) where: Base-Base interactions energy: -200.892 where: short stacking energy: -143.374 Base-Backbone interact. energy: -0.896 local terms energy: -221.958332 where: bonds (distance) C4'-P energy: -58.530 bonds (distance) P-C4' energy: -74.227 flat angles C4'-P-C4' energy: -52.297 flat angles P-C4'-P energy: -35.017 tors. eta vs tors. theta energy: -1.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1298.812692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.812692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.562692 (E_RNA) where: Base-Base interactions energy: -911.469 where: short stacking energy: -387.792 Base-Backbone interact. energy: -2.604 local terms energy: -417.490219 where: bonds (distance) C4'-P energy: -83.977 bonds (distance) P-C4' energy: -80.486 flat angles C4'-P-C4' energy: -89.932 flat angles P-C4'-P energy: -63.330 tors. eta vs tors. theta energy: -99.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1193.583954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.583954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.333954 (E_RNA) where: Base-Base interactions energy: -808.027 where: short stacking energy: -364.211 Base-Backbone interact. energy: 1.061 local terms energy: -419.367127 where: bonds (distance) C4'-P energy: -85.335 bonds (distance) P-C4' energy: -78.307 flat angles C4'-P-C4' energy: -91.843 flat angles P-C4'-P energy: -53.663 tors. eta vs tors. theta energy: -110.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1076.639420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.639420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.389420 (E_RNA) where: Base-Base interactions energy: -718.618 where: short stacking energy: -324.266 Base-Backbone interact. energy: -3.314 local terms energy: -387.457581 where: bonds (distance) C4'-P energy: -82.845 bonds (distance) P-C4' energy: -74.560 flat angles C4'-P-C4' energy: -88.568 flat angles P-C4'-P energy: -49.955 tors. eta vs tors. theta energy: -91.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1060.899496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.899496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.649496 (E_RNA) where: Base-Base interactions energy: -728.471 where: short stacking energy: -326.951 Base-Backbone interact. energy: -1.610 local terms energy: -363.569034 where: bonds (distance) C4'-P energy: -69.393 bonds (distance) P-C4' energy: -77.314 flat angles C4'-P-C4' energy: -86.380 flat angles P-C4'-P energy: -46.124 tors. eta vs tors. theta energy: -84.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -945.325382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.325382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.075382 (E_RNA) where: Base-Base interactions energy: -633.090 where: short stacking energy: -318.180 Base-Backbone interact. energy: -1.136 local terms energy: -343.849270 where: bonds (distance) C4'-P energy: -58.969 bonds (distance) P-C4' energy: -76.310 flat angles C4'-P-C4' energy: -80.102 flat angles P-C4'-P energy: -47.480 tors. eta vs tors. theta energy: -80.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -788.840795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.840795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.590795 (E_RNA) where: Base-Base interactions energy: -504.422 where: short stacking energy: -241.126 Base-Backbone interact. energy: 0.191 local terms energy: -317.359714 where: bonds (distance) C4'-P energy: -71.029 bonds (distance) P-C4' energy: -68.430 flat angles C4'-P-C4' energy: -67.105 flat angles P-C4'-P energy: -54.414 tors. eta vs tors. theta energy: -56.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -706.913299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -706.913299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.663299 (E_RNA) where: Base-Base interactions energy: -462.503 where: short stacking energy: -191.233 Base-Backbone interact. energy: -3.562 local terms energy: -273.597858 where: bonds (distance) C4'-P energy: -61.068 bonds (distance) P-C4' energy: -70.127 flat angles C4'-P-C4' energy: -67.781 flat angles P-C4'-P energy: -39.216 tors. eta vs tors. theta energy: -35.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -461.073650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.073650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.823650 (E_RNA) where: Base-Base interactions energy: -257.138 where: short stacking energy: -142.864 Base-Backbone interact. energy: 2.124 local terms energy: -238.810176 where: bonds (distance) C4'-P energy: -75.051 bonds (distance) P-C4' energy: -68.403 flat angles C4'-P-C4' energy: -63.208 flat angles P-C4'-P energy: -27.651 tors. eta vs tors. theta energy: -4.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -440.722137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.722137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.472137 (E_RNA) where: Base-Base interactions energy: -217.816 where: short stacking energy: -123.312 Base-Backbone interact. energy: -0.596 local terms energy: -255.059739 where: bonds (distance) C4'-P energy: -69.863 bonds (distance) P-C4' energy: -77.322 flat angles C4'-P-C4' energy: -56.630 flat angles P-C4'-P energy: -51.053 tors. eta vs tors. theta energy: -0.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -363.145221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.145221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.895221 (E_RNA) where: Base-Base interactions energy: -182.323 where: short stacking energy: -105.521 Base-Backbone interact. energy: 0.452 local terms energy: -214.024293 where: bonds (distance) C4'-P energy: -44.647 bonds (distance) P-C4' energy: -76.860 flat angles C4'-P-C4' energy: -63.944 flat angles P-C4'-P energy: -38.358 tors. eta vs tors. theta energy: 9.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1287.389573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.389573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.139573 (E_RNA) where: Base-Base interactions energy: -893.756 where: short stacking energy: -382.841 Base-Backbone interact. energy: -4.319 local terms energy: -422.063604 where: bonds (distance) C4'-P energy: -81.690 bonds (distance) P-C4' energy: -82.263 flat angles C4'-P-C4' energy: -91.137 flat angles P-C4'-P energy: -58.472 tors. eta vs tors. theta energy: -108.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1197.241543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.241543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.991543 (E_RNA) where: Base-Base interactions energy: -819.177 where: short stacking energy: -370.340 Base-Backbone interact. energy: -1.866 local terms energy: -408.948517 where: bonds (distance) C4'-P energy: -83.233 bonds (distance) P-C4' energy: -82.069 flat angles C4'-P-C4' energy: -85.925 flat angles P-C4'-P energy: -45.801 tors. eta vs tors. theta energy: -111.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1011.576510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.576510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.326510 (E_RNA) where: Base-Base interactions energy: -670.837 where: short stacking energy: -300.896 Base-Backbone interact. energy: 1.167 local terms energy: -374.656506 where: bonds (distance) C4'-P energy: -63.745 bonds (distance) P-C4' energy: -77.707 flat angles C4'-P-C4' energy: -96.664 flat angles P-C4'-P energy: -53.649 tors. eta vs tors. theta energy: -82.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1039.667189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.667189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.417189 (E_RNA) where: Base-Base interactions energy: -716.321 where: short stacking energy: -304.761 Base-Backbone interact. energy: -1.392 local terms energy: -354.704488 where: bonds (distance) C4'-P energy: -88.048 bonds (distance) P-C4' energy: -78.867 flat angles C4'-P-C4' energy: -70.969 flat angles P-C4'-P energy: -58.298 tors. eta vs tors. theta energy: -58.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -931.459755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.459755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.209755 (E_RNA) where: Base-Base interactions energy: -624.947 where: short stacking energy: -272.174 Base-Backbone interact. energy: 1.301 local terms energy: -340.563976 where: bonds (distance) C4'-P energy: -66.785 bonds (distance) P-C4' energy: -91.321 flat angles C4'-P-C4' energy: -70.546 flat angles P-C4'-P energy: -47.189 tors. eta vs tors. theta energy: -64.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -803.658332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.658332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.408332 (E_RNA) where: Base-Base interactions energy: -520.694 where: short stacking energy: -258.628 Base-Backbone interact. energy: -3.426 local terms energy: -312.289060 where: bonds (distance) C4'-P energy: -76.241 bonds (distance) P-C4' energy: -57.072 flat angles C4'-P-C4' energy: -81.605 flat angles P-C4'-P energy: -45.485 tors. eta vs tors. theta energy: -51.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -697.661765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -697.661765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.411765 (E_RNA) where: Base-Base interactions energy: -461.276 where: short stacking energy: -220.534 Base-Backbone interact. energy: 3.808 local terms energy: -272.944370 where: bonds (distance) C4'-P energy: -64.258 bonds (distance) P-C4' energy: -60.355 flat angles C4'-P-C4' energy: -71.931 flat angles P-C4'-P energy: -41.867 tors. eta vs tors. theta energy: -34.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -520.595713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.595713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.345713 (E_RNA) where: Base-Base interactions energy: -294.965 where: short stacking energy: -162.006 Base-Backbone interact. energy: -1.400 local terms energy: -256.981036 where: bonds (distance) C4'-P energy: -54.171 bonds (distance) P-C4' energy: -73.277 flat angles C4'-P-C4' energy: -59.164 flat angles P-C4'-P energy: -33.339 tors. eta vs tors. theta energy: -37.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -445.939862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.939862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.689862 (E_RNA) where: Base-Base interactions energy: -241.319 where: short stacking energy: -126.230 Base-Backbone interact. energy: -0.857 local terms energy: -236.513911 where: bonds (distance) C4'-P energy: -57.872 bonds (distance) P-C4' energy: -69.109 flat angles C4'-P-C4' energy: -58.984 flat angles P-C4'-P energy: -40.472 tors. eta vs tors. theta energy: -10.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -443.785139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.785139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.535139 (E_RNA) where: Base-Base interactions energy: -229.590 where: short stacking energy: -141.683 Base-Backbone interact. energy: -0.983 local terms energy: -245.962426 where: bonds (distance) C4'-P energy: -59.167 bonds (distance) P-C4' energy: -73.057 flat angles C4'-P-C4' energy: -69.036 flat angles P-C4'-P energy: -38.815 tors. eta vs tors. theta energy: -5.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1296.501616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.501616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1329.251616 (E_RNA) where: Base-Base interactions energy: -902.118 where: short stacking energy: -399.913 Base-Backbone interact. energy: -3.344 local terms energy: -423.789404 where: bonds (distance) C4'-P energy: -81.706 bonds (distance) P-C4' energy: -90.158 flat angles C4'-P-C4' energy: -81.458 flat angles P-C4'-P energy: -61.921 tors. eta vs tors. theta energy: -108.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1213.695855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.695855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.445855 (E_RNA) where: Base-Base interactions energy: -844.985 where: short stacking energy: -365.034 Base-Backbone interact. energy: 1.900 local terms energy: -403.360690 where: bonds (distance) C4'-P energy: -72.688 bonds (distance) P-C4' energy: -85.382 flat angles C4'-P-C4' energy: -90.049 flat angles P-C4'-P energy: -49.171 tors. eta vs tors. theta energy: -106.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1069.597355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.597355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.347355 (E_RNA) where: Base-Base interactions energy: -705.652 where: short stacking energy: -301.272 Base-Backbone interact. energy: -2.279 local terms energy: -394.416641 where: bonds (distance) C4'-P energy: -82.387 bonds (distance) P-C4' energy: -81.629 flat angles C4'-P-C4' energy: -91.698 flat angles P-C4'-P energy: -53.272 tors. eta vs tors. theta energy: -85.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1027.273993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.273993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.023993 (E_RNA) where: Base-Base interactions energy: -702.445 where: short stacking energy: -310.806 Base-Backbone interact. energy: -0.996 local terms energy: -356.582988 where: bonds (distance) C4'-P energy: -64.215 bonds (distance) P-C4' energy: -69.003 flat angles C4'-P-C4' energy: -80.477 flat angles P-C4'-P energy: -55.933 tors. eta vs tors. theta energy: -86.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -971.207189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.207189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.957189 (E_RNA) where: Base-Base interactions energy: -654.102 where: short stacking energy: -306.672 Base-Backbone interact. energy: 0.085 local terms energy: -349.940384 where: bonds (distance) C4'-P energy: -64.935 bonds (distance) P-C4' energy: -79.995 flat angles C4'-P-C4' energy: -82.915 flat angles P-C4'-P energy: -45.308 tors. eta vs tors. theta energy: -76.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -830.708713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -830.708713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.458713 (E_RNA) where: Base-Base interactions energy: -529.382 where: short stacking energy: -270.469 Base-Backbone interact. energy: 0.557 local terms energy: -334.634106 where: bonds (distance) C4'-P energy: -68.932 bonds (distance) P-C4' energy: -72.298 flat angles C4'-P-C4' energy: -84.699 flat angles P-C4'-P energy: -52.416 tors. eta vs tors. theta energy: -56.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -717.233720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.233720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.983720 (E_RNA) where: Base-Base interactions energy: -431.582 where: short stacking energy: -215.644 Base-Backbone interact. energy: 4.098 local terms energy: -322.499638 where: bonds (distance) C4'-P energy: -82.911 bonds (distance) P-C4' energy: -72.999 flat angles C4'-P-C4' energy: -74.385 flat angles P-C4'-P energy: -39.091 tors. eta vs tors. theta energy: -53.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -639.916182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.916182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.666182 (E_RNA) where: Base-Base interactions energy: -383.748 where: short stacking energy: -199.656 Base-Backbone interact. energy: 3.438 local terms energy: -292.651190 where: bonds (distance) C4'-P energy: -62.322 bonds (distance) P-C4' energy: -87.517 flat angles C4'-P-C4' energy: -69.627 flat angles P-C4'-P energy: -38.174 tors. eta vs tors. theta energy: -35.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.295 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -425.837440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.837440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.587440 (E_RNA) where: Base-Base interactions energy: -233.275 where: short stacking energy: -116.691 Base-Backbone interact. energy: -0.816 local terms energy: -224.496704 where: bonds (distance) C4'-P energy: -49.662 bonds (distance) P-C4' energy: -66.813 flat angles C4'-P-C4' energy: -81.760 flat angles P-C4'-P energy: -33.547 tors. eta vs tors. theta energy: 7.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -387.724930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.724930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.474930 (E_RNA) where: Base-Base interactions energy: -204.890 where: short stacking energy: -129.032 Base-Backbone interact. energy: 1.802 local terms energy: -217.387354 where: bonds (distance) C4'-P energy: -64.140 bonds (distance) P-C4' energy: -72.765 flat angles C4'-P-C4' energy: -54.291 flat angles P-C4'-P energy: -34.520 tors. eta vs tors. theta energy: 8.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1310.095891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.095891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.845891 (E_RNA) where: Base-Base interactions energy: -898.934 where: short stacking energy: -400.145 Base-Backbone interact. energy: -1.232 local terms energy: -442.679996 where: bonds (distance) C4'-P energy: -87.495 bonds (distance) P-C4' energy: -80.522 flat angles C4'-P-C4' energy: -92.880 flat angles P-C4'-P energy: -69.609 tors. eta vs tors. theta energy: -112.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1248.255349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.255349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.005349 (E_RNA) where: Base-Base interactions energy: -843.119 where: short stacking energy: -383.529 Base-Backbone interact. energy: -0.212 local terms energy: -437.674821 where: bonds (distance) C4'-P energy: -84.739 bonds (distance) P-C4' energy: -81.246 flat angles C4'-P-C4' energy: -90.287 flat angles P-C4'-P energy: -65.322 tors. eta vs tors. theta energy: -116.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1079.511832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.511832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.261832 (E_RNA) where: Base-Base interactions energy: -734.442 where: short stacking energy: -337.999 Base-Backbone interact. energy: 1.134 local terms energy: -378.953533 where: bonds (distance) C4'-P energy: -71.993 bonds (distance) P-C4' energy: -75.992 flat angles C4'-P-C4' energy: -93.557 flat angles P-C4'-P energy: -55.016 tors. eta vs tors. theta energy: -82.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1027.916599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.916599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.666599 (E_RNA) where: Base-Base interactions energy: -705.096 where: short stacking energy: -332.341 Base-Backbone interact. energy: 3.816 local terms energy: -359.386349 where: bonds (distance) C4'-P energy: -80.608 bonds (distance) P-C4' energy: -80.283 flat angles C4'-P-C4' energy: -75.794 flat angles P-C4'-P energy: -48.150 tors. eta vs tors. theta energy: -74.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -965.215124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.215124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.965124 (E_RNA) where: Base-Base interactions energy: -629.240 where: short stacking energy: -273.739 Base-Backbone interact. energy: -0.551 local terms energy: -368.174252 where: bonds (distance) C4'-P energy: -66.945 bonds (distance) P-C4' energy: -91.484 flat angles C4'-P-C4' energy: -89.375 flat angles P-C4'-P energy: -47.649 tors. eta vs tors. theta energy: -72.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -807.962049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -807.962049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.712049 (E_RNA) where: Base-Base interactions energy: -540.319 where: short stacking energy: -246.749 Base-Backbone interact. energy: 4.853 local terms energy: -305.246044 where: bonds (distance) C4'-P energy: -64.299 bonds (distance) P-C4' energy: -80.201 flat angles C4'-P-C4' energy: -78.541 flat angles P-C4'-P energy: -40.192 tors. eta vs tors. theta energy: -42.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -712.710637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -712.710637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.460637 (E_RNA) where: Base-Base interactions energy: -446.358 where: short stacking energy: -214.797 Base-Backbone interact. energy: -1.065 local terms energy: -298.037809 where: bonds (distance) C4'-P energy: -76.053 bonds (distance) P-C4' energy: -77.131 flat angles C4'-P-C4' energy: -59.524 flat angles P-C4'-P energy: -45.836 tors. eta vs tors. theta energy: -39.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -589.977372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.977372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.727372 (E_RNA) where: Base-Base interactions energy: -351.649 where: short stacking energy: -178.389 Base-Backbone interact. energy: -2.210 local terms energy: -268.868082 where: bonds (distance) C4'-P energy: -59.722 bonds (distance) P-C4' energy: -81.005 flat angles C4'-P-C4' energy: -72.478 flat angles P-C4'-P energy: -30.282 tors. eta vs tors. theta energy: -25.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -385.593447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.593447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.343447 (E_RNA) where: Base-Base interactions energy: -220.656 where: short stacking energy: -133.594 Base-Backbone interact. energy: 0.772 local terms energy: -198.459838 where: bonds (distance) C4'-P energy: -61.424 bonds (distance) P-C4' energy: -63.261 flat angles C4'-P-C4' energy: -61.834 flat angles P-C4'-P energy: -19.249 tors. eta vs tors. theta energy: 7.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -368.523079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.523079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.273079 (E_RNA) where: Base-Base interactions energy: -169.103 where: short stacking energy: -103.361 Base-Backbone interact. energy: 4.194 local terms energy: -236.363869 where: bonds (distance) C4'-P energy: -73.452 bonds (distance) P-C4' energy: -74.073 flat angles C4'-P-C4' energy: -55.638 flat angles P-C4'-P energy: -28.538 tors. eta vs tors. theta energy: -4.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1312.595151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.595151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.345151 (E_RNA) where: Base-Base interactions energy: -924.048 where: short stacking energy: -378.222 Base-Backbone interact. energy: -2.075 local terms energy: -419.222554 where: bonds (distance) C4'-P energy: -84.563 bonds (distance) P-C4' energy: -78.528 flat angles C4'-P-C4' energy: -85.121 flat angles P-C4'-P energy: -64.992 tors. eta vs tors. theta energy: -106.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1226.853147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.853147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.603147 (E_RNA) where: Base-Base interactions energy: -823.131 where: short stacking energy: -390.111 Base-Backbone interact. energy: -1.578 local terms energy: -434.893381 where: bonds (distance) C4'-P energy: -70.745 bonds (distance) P-C4' energy: -94.723 flat angles C4'-P-C4' energy: -93.939 flat angles P-C4'-P energy: -59.172 tors. eta vs tors. theta energy: -116.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1097.401016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.401016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.151016 (E_RNA) where: Base-Base interactions energy: -743.878 where: short stacking energy: -338.716 Base-Backbone interact. energy: 4.281 local terms energy: -390.554530 where: bonds (distance) C4'-P energy: -78.842 bonds (distance) P-C4' energy: -72.911 flat angles C4'-P-C4' energy: -79.854 flat angles P-C4'-P energy: -68.012 tors. eta vs tors. theta energy: -90.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1035.796636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.796636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.546636 (E_RNA) where: Base-Base interactions energy: -702.885 where: short stacking energy: -294.160 Base-Backbone interact. energy: -2.039 local terms energy: -363.623389 where: bonds (distance) C4'-P energy: -77.924 bonds (distance) P-C4' energy: -74.902 flat angles C4'-P-C4' energy: -83.987 flat angles P-C4'-P energy: -55.302 tors. eta vs tors. theta energy: -71.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -952.347456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.347456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.097456 (E_RNA) where: Base-Base interactions energy: -601.081 where: short stacking energy: -272.703 Base-Backbone interact. energy: -2.098 local terms energy: -381.918947 where: bonds (distance) C4'-P energy: -87.516 bonds (distance) P-C4' energy: -80.725 flat angles C4'-P-C4' energy: -91.050 flat angles P-C4'-P energy: -48.036 tors. eta vs tors. theta energy: -74.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -792.034921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.034921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.784921 (E_RNA) where: Base-Base interactions energy: -522.254 where: short stacking energy: -262.927 Base-Backbone interact. energy: -0.011 local terms energy: -302.520445 where: bonds (distance) C4'-P energy: -66.437 bonds (distance) P-C4' energy: -65.482 flat angles C4'-P-C4' energy: -68.257 flat angles P-C4'-P energy: -43.898 tors. eta vs tors. theta energy: -58.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -671.668704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.668704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.418704 (E_RNA) where: Base-Base interactions energy: -399.615 where: short stacking energy: -203.515 Base-Backbone interact. energy: 2.215 local terms energy: -307.019109 where: bonds (distance) C4'-P energy: -66.318 bonds (distance) P-C4' energy: -80.627 flat angles C4'-P-C4' energy: -75.138 flat angles P-C4'-P energy: -45.684 tors. eta vs tors. theta energy: -39.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -631.943373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -631.943373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -664.693373 (E_RNA) where: Base-Base interactions energy: -389.464 where: short stacking energy: -171.040 Base-Backbone interact. energy: -1.626 local terms energy: -273.603263 where: bonds (distance) C4'-P energy: -78.468 bonds (distance) P-C4' energy: -69.026 flat angles C4'-P-C4' energy: -73.240 flat angles P-C4'-P energy: -24.576 tors. eta vs tors. theta energy: -28.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -385.806218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.806218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.556218 (E_RNA) where: Base-Base interactions energy: -214.572 where: short stacking energy: -112.970 Base-Backbone interact. energy: 5.922 local terms energy: -210.231431 where: bonds (distance) C4'-P energy: -70.450 bonds (distance) P-C4' energy: -68.786 flat angles C4'-P-C4' energy: -53.284 flat angles P-C4'-P energy: -30.203 tors. eta vs tors. theta energy: 12.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.325 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -367.252285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.252285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.002285 (E_RNA) where: Base-Base interactions energy: -156.043 where: short stacking energy: -94.679 Base-Backbone interact. energy: 0.796 local terms energy: -244.755218 where: bonds (distance) C4'-P energy: -69.172 bonds (distance) P-C4' energy: -76.682 flat angles C4'-P-C4' energy: -65.146 flat angles P-C4'-P energy: -44.566 tors. eta vs tors. theta energy: 10.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1305.603263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.603263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.353263 (E_RNA) where: Base-Base interactions energy: -922.491 where: short stacking energy: -377.346 Base-Backbone interact. energy: -2.287 local terms energy: -413.575214 where: bonds (distance) C4'-P energy: -74.990 bonds (distance) P-C4' energy: -80.784 flat angles C4'-P-C4' energy: -81.330 flat angles P-C4'-P energy: -62.525 tors. eta vs tors. theta energy: -113.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1240.610630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.610630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.360630 (E_RNA) where: Base-Base interactions energy: -831.286 where: short stacking energy: -365.161 Base-Backbone interact. energy: -4.892 local terms energy: -437.183184 where: bonds (distance) C4'-P energy: -82.882 bonds (distance) P-C4' energy: -83.019 flat angles C4'-P-C4' energy: -96.344 flat angles P-C4'-P energy: -57.513 tors. eta vs tors. theta energy: -117.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1071.868256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.868256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.618256 (E_RNA) where: Base-Base interactions energy: -709.607 where: short stacking energy: -320.749 Base-Backbone interact. energy: -0.102 local terms energy: -394.909015 where: bonds (distance) C4'-P energy: -78.828 bonds (distance) P-C4' energy: -80.397 flat angles C4'-P-C4' energy: -93.364 flat angles P-C4'-P energy: -60.308 tors. eta vs tors. theta energy: -82.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1043.341740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.341740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.091740 (E_RNA) where: Base-Base interactions energy: -707.977 where: short stacking energy: -325.301 Base-Backbone interact. energy: 0.289 local terms energy: -368.403521 where: bonds (distance) C4'-P energy: -81.567 bonds (distance) P-C4' energy: -70.471 flat angles C4'-P-C4' energy: -77.136 flat angles P-C4'-P energy: -55.805 tors. eta vs tors. theta energy: -83.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -990.031192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.031192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.781192 (E_RNA) where: Base-Base interactions energy: -636.195 where: short stacking energy: -310.034 Base-Backbone interact. energy: -1.932 local terms energy: -384.654480 where: bonds (distance) C4'-P energy: -77.491 bonds (distance) P-C4' energy: -90.264 flat angles C4'-P-C4' energy: -80.382 flat angles P-C4'-P energy: -54.586 tors. eta vs tors. theta energy: -81.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -832.610810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.610810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.360810 (E_RNA) where: Base-Base interactions energy: -559.241 where: short stacking energy: -277.577 Base-Backbone interact. energy: -1.185 local terms energy: -304.935259 where: bonds (distance) C4'-P energy: -59.109 bonds (distance) P-C4' energy: -64.384 flat angles C4'-P-C4' energy: -76.061 flat angles P-C4'-P energy: -49.911 tors. eta vs tors. theta energy: -55.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -718.415418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.415418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.165418 (E_RNA) where: Base-Base interactions energy: -463.345 where: short stacking energy: -213.262 Base-Backbone interact. energy: -0.493 local terms energy: -287.327346 where: bonds (distance) C4'-P energy: -60.400 bonds (distance) P-C4' energy: -77.318 flat angles C4'-P-C4' energy: -66.858 flat angles P-C4'-P energy: -44.835 tors. eta vs tors. theta energy: -37.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -573.849377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.849377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.599377 (E_RNA) where: Base-Base interactions energy: -344.032 where: short stacking energy: -163.666 Base-Backbone interact. energy: -2.051 local terms energy: -260.515973 where: bonds (distance) C4'-P energy: -64.652 bonds (distance) P-C4' energy: -70.429 flat angles C4'-P-C4' energy: -66.737 flat angles P-C4'-P energy: -48.837 tors. eta vs tors. theta energy: -9.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -348.542790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.542790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.292790 (E_RNA) where: Base-Base interactions energy: -168.187 where: short stacking energy: -90.541 Base-Backbone interact. energy: -0.778 local terms energy: -212.327832 where: bonds (distance) C4'-P energy: -64.059 bonds (distance) P-C4' energy: -75.078 flat angles C4'-P-C4' energy: -50.143 flat angles P-C4'-P energy: -31.437 tors. eta vs tors. theta energy: 8.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -394.609681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.609681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.359681 (E_RNA) where: Base-Base interactions energy: -194.179 where: short stacking energy: -132.782 Base-Backbone interact. energy: 4.402 local terms energy: -237.583080 where: bonds (distance) C4'-P energy: -76.387 bonds (distance) P-C4' energy: -72.718 flat angles C4'-P-C4' energy: -50.089 flat angles P-C4'-P energy: -29.006 tors. eta vs tors. theta energy: -9.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1313.094687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.094687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.844687 (E_RNA) where: Base-Base interactions energy: -922.602 where: short stacking energy: -396.499 Base-Backbone interact. energy: -1.468 local terms energy: -421.774972 where: bonds (distance) C4'-P energy: -72.182 bonds (distance) P-C4' energy: -78.967 flat angles C4'-P-C4' energy: -93.921 flat angles P-C4'-P energy: -64.593 tors. eta vs tors. theta energy: -112.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1202.689575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1202.689575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1235.439575 (E_RNA) where: Base-Base interactions energy: -825.887 where: short stacking energy: -363.801 Base-Backbone interact. energy: -4.765 local terms energy: -404.788106 where: bonds (distance) C4'-P energy: -70.277 bonds (distance) P-C4' energy: -75.566 flat angles C4'-P-C4' energy: -95.811 flat angles P-C4'-P energy: -50.822 tors. eta vs tors. theta energy: -112.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1051.967376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.967376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.717376 (E_RNA) where: Base-Base interactions energy: -726.606 where: short stacking energy: -325.014 Base-Backbone interact. energy: -0.169 local terms energy: -357.942646 where: bonds (distance) C4'-P energy: -75.201 bonds (distance) P-C4' energy: -52.268 flat angles C4'-P-C4' energy: -99.327 flat angles P-C4'-P energy: -57.860 tors. eta vs tors. theta energy: -73.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1048.587271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.587271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.337271 (E_RNA) where: Base-Base interactions energy: -722.870 where: short stacking energy: -303.225 Base-Backbone interact. energy: -3.293 local terms energy: -355.174553 where: bonds (distance) C4'-P energy: -76.411 bonds (distance) P-C4' energy: -74.688 flat angles C4'-P-C4' energy: -79.005 flat angles P-C4'-P energy: -47.439 tors. eta vs tors. theta energy: -77.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1005.191113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.191113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.941113 (E_RNA) where: Base-Base interactions energy: -661.326 where: short stacking energy: -324.248 Base-Backbone interact. energy: -1.586 local terms energy: -375.028435 where: bonds (distance) C4'-P energy: -76.122 bonds (distance) P-C4' energy: -71.380 flat angles C4'-P-C4' energy: -82.722 flat angles P-C4'-P energy: -60.981 tors. eta vs tors. theta energy: -83.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -813.308030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.308030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -846.058030 (E_RNA) where: Base-Base interactions energy: -518.611 where: short stacking energy: -247.607 Base-Backbone interact. energy: -1.557 local terms energy: -325.890308 where: bonds (distance) C4'-P energy: -73.103 bonds (distance) P-C4' energy: -73.173 flat angles C4'-P-C4' energy: -79.479 flat angles P-C4'-P energy: -38.688 tors. eta vs tors. theta energy: -61.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -702.585151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.585151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -735.335151 (E_RNA) where: Base-Base interactions energy: -453.335 where: short stacking energy: -212.285 Base-Backbone interact. energy: 0.536 local terms energy: -282.536261 where: bonds (distance) C4'-P energy: -59.240 bonds (distance) P-C4' energy: -76.141 flat angles C4'-P-C4' energy: -73.149 flat angles P-C4'-P energy: -33.694 tors. eta vs tors. theta energy: -40.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -627.065764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.065764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.815764 (E_RNA) where: Base-Base interactions energy: -378.859 where: short stacking energy: -209.727 Base-Backbone interact. energy: -1.285 local terms energy: -280.092934 where: bonds (distance) C4'-P energy: -58.712 bonds (distance) P-C4' energy: -76.131 flat angles C4'-P-C4' energy: -64.127 flat angles P-C4'-P energy: -37.038 tors. eta vs tors. theta energy: -44.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.422 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -437.689708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.689708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.439708 (E_RNA) where: Base-Base interactions energy: -228.927 where: short stacking energy: -125.674 Base-Backbone interact. energy: 4.957 local terms energy: -246.469850 where: bonds (distance) C4'-P energy: -60.930 bonds (distance) P-C4' energy: -80.561 flat angles C4'-P-C4' energy: -65.373 flat angles P-C4'-P energy: -35.195 tors. eta vs tors. theta energy: -4.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -348.941868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.941868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.691868 (E_RNA) where: Base-Base interactions energy: -178.950 where: short stacking energy: -124.362 Base-Backbone interact. energy: -0.784 local terms energy: -201.958721 where: bonds (distance) C4'-P energy: -62.833 bonds (distance) P-C4' energy: -75.323 flat angles C4'-P-C4' energy: -53.037 flat angles P-C4'-P energy: -25.426 tors. eta vs tors. theta energy: 14.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1337.366382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1337.366382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.116382 (E_RNA) where: Base-Base interactions energy: -941.628 where: short stacking energy: -393.851 Base-Backbone interact. energy: -1.479 local terms energy: -427.009535 where: bonds (distance) C4'-P energy: -83.197 bonds (distance) P-C4' energy: -78.595 flat angles C4'-P-C4' energy: -93.730 flat angles P-C4'-P energy: -56.673 tors. eta vs tors. theta energy: -114.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1186.477319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.477319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.227319 (E_RNA) where: Base-Base interactions energy: -815.528 where: short stacking energy: -344.318 Base-Backbone interact. energy: -2.053 local terms energy: -401.645889 where: bonds (distance) C4'-P energy: -76.144 bonds (distance) P-C4' energy: -84.733 flat angles C4'-P-C4' energy: -80.774 flat angles P-C4'-P energy: -61.412 tors. eta vs tors. theta energy: -98.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1045.135344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.135344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.885344 (E_RNA) where: Base-Base interactions energy: -702.397 where: short stacking energy: -320.502 Base-Backbone interact. energy: -0.687 local terms energy: -374.801580 where: bonds (distance) C4'-P energy: -87.655 bonds (distance) P-C4' energy: -79.318 flat angles C4'-P-C4' energy: -84.214 flat angles P-C4'-P energy: -40.936 tors. eta vs tors. theta energy: -82.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1059.978471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.978471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1092.728471 (E_RNA) where: Base-Base interactions energy: -701.031 where: short stacking energy: -327.194 Base-Backbone interact. energy: -0.437 local terms energy: -391.261104 where: bonds (distance) C4'-P energy: -70.197 bonds (distance) P-C4' energy: -81.480 flat angles C4'-P-C4' energy: -81.110 flat angles P-C4'-P energy: -61.638 tors. eta vs tors. theta energy: -96.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -963.077428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.077428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.827428 (E_RNA) where: Base-Base interactions energy: -674.488 where: short stacking energy: -282.625 Base-Backbone interact. energy: -0.344 local terms energy: -320.995379 where: bonds (distance) C4'-P energy: -67.349 bonds (distance) P-C4' energy: -66.727 flat angles C4'-P-C4' energy: -67.494 flat angles P-C4'-P energy: -48.790 tors. eta vs tors. theta energy: -70.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -803.477995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.477995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.227995 (E_RNA) where: Base-Base interactions energy: -524.727 where: short stacking energy: -257.542 Base-Backbone interact. energy: -0.828 local terms energy: -311.292361 where: bonds (distance) C4'-P energy: -76.791 bonds (distance) P-C4' energy: -67.990 flat angles C4'-P-C4' energy: -70.237 flat angles P-C4'-P energy: -46.143 tors. eta vs tors. theta energy: -50.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.620 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -743.304106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.304106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.054106 (E_RNA) where: Base-Base interactions energy: -467.903 where: short stacking energy: -234.183 Base-Backbone interact. energy: -2.118 local terms energy: -306.033439 where: bonds (distance) C4'-P energy: -78.379 bonds (distance) P-C4' energy: -72.480 flat angles C4'-P-C4' energy: -66.047 flat angles P-C4'-P energy: -36.411 tors. eta vs tors. theta energy: -52.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -587.872565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.872565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -620.622565 (E_RNA) where: Base-Base interactions energy: -353.412 where: short stacking energy: -179.767 Base-Backbone interact. energy: -0.025 local terms energy: -267.185189 where: bonds (distance) C4'-P energy: -62.553 bonds (distance) P-C4' energy: -64.888 flat angles C4'-P-C4' energy: -57.957 flat angles P-C4'-P energy: -47.410 tors. eta vs tors. theta energy: -34.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -461.419044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.419044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.169044 (E_RNA) where: Base-Base interactions energy: -248.329 where: short stacking energy: -142.142 Base-Backbone interact. energy: -1.201 local terms energy: -244.638958 where: bonds (distance) C4'-P energy: -55.294 bonds (distance) P-C4' energy: -68.834 flat angles C4'-P-C4' energy: -64.721 flat angles P-C4'-P energy: -34.715 tors. eta vs tors. theta energy: -21.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -411.681787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.681787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.431787 (E_RNA) where: Base-Base interactions energy: -196.295 where: short stacking energy: -136.489 Base-Backbone interact. energy: -2.061 local terms energy: -246.076493 where: bonds (distance) C4'-P energy: -59.611 bonds (distance) P-C4' energy: -79.210 flat angles C4'-P-C4' energy: -54.207 flat angles P-C4'-P energy: -39.829 tors. eta vs tors. theta energy: -13.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1335.503699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.503699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.253699 (E_RNA) where: Base-Base interactions energy: -939.612 where: short stacking energy: -383.819 Base-Backbone interact. energy: -1.450 local terms energy: -427.191567 where: bonds (distance) C4'-P energy: -79.187 bonds (distance) P-C4' energy: -75.935 flat angles C4'-P-C4' energy: -98.071 flat angles P-C4'-P energy: -68.197 tors. eta vs tors. theta energy: -105.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1216.984687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.984687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.734687 (E_RNA) where: Base-Base interactions energy: -836.708 where: short stacking energy: -361.795 Base-Backbone interact. energy: -2.795 local terms energy: -410.231819 where: bonds (distance) C4'-P energy: -67.217 bonds (distance) P-C4' energy: -80.539 flat angles C4'-P-C4' energy: -94.524 flat angles P-C4'-P energy: -62.287 tors. eta vs tors. theta energy: -105.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1073.885037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.885037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.635037 (E_RNA) where: Base-Base interactions energy: -715.843 where: short stacking energy: -353.539 Base-Backbone interact. energy: 1.428 local terms energy: -392.220651 where: bonds (distance) C4'-P energy: -81.591 bonds (distance) P-C4' energy: -72.130 flat angles C4'-P-C4' energy: -87.218 flat angles P-C4'-P energy: -53.087 tors. eta vs tors. theta energy: -98.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1010.196148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.196148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.946148 (E_RNA) where: Base-Base interactions energy: -677.491 where: short stacking energy: -297.036 Base-Backbone interact. energy: -1.528 local terms energy: -363.927410 where: bonds (distance) C4'-P energy: -78.892 bonds (distance) P-C4' energy: -77.744 flat angles C4'-P-C4' energy: -80.730 flat angles P-C4'-P energy: -55.749 tors. eta vs tors. theta energy: -70.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -991.032024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.032024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.782024 (E_RNA) where: Base-Base interactions energy: -660.173 where: short stacking energy: -317.901 Base-Backbone interact. energy: -2.124 local terms energy: -361.485522 where: bonds (distance) C4'-P energy: -65.395 bonds (distance) P-C4' energy: -76.906 flat angles C4'-P-C4' energy: -81.854 flat angles P-C4'-P energy: -53.087 tors. eta vs tors. theta energy: -84.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -822.851492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.851492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.601492 (E_RNA) where: Base-Base interactions energy: -538.829 where: short stacking energy: -252.204 Base-Backbone interact. energy: -1.692 local terms energy: -315.080913 where: bonds (distance) C4'-P energy: -73.366 bonds (distance) P-C4' energy: -88.264 flat angles C4'-P-C4' energy: -62.961 flat angles P-C4'-P energy: -42.204 tors. eta vs tors. theta energy: -48.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -710.870776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.870776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.620776 (E_RNA) where: Base-Base interactions energy: -452.056 where: short stacking energy: -209.694 Base-Backbone interact. energy: -0.768 local terms energy: -290.797490 where: bonds (distance) C4'-P energy: -72.310 bonds (distance) P-C4' energy: -73.616 flat angles C4'-P-C4' energy: -70.881 flat angles P-C4'-P energy: -38.832 tors. eta vs tors. theta energy: -35.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -585.260302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.260302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -618.010302 (E_RNA) where: Base-Base interactions energy: -341.679 where: short stacking energy: -200.011 Base-Backbone interact. energy: -1.386 local terms energy: -274.945783 where: bonds (distance) C4'-P energy: -70.052 bonds (distance) P-C4' energy: -85.097 flat angles C4'-P-C4' energy: -75.891 flat angles P-C4'-P energy: -26.214 tors. eta vs tors. theta energy: -17.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -491.378741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.378741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.128741 (E_RNA) where: Base-Base interactions energy: -264.102 where: short stacking energy: -147.500 Base-Backbone interact. energy: -1.987 local terms energy: -258.039888 where: bonds (distance) C4'-P energy: -67.760 bonds (distance) P-C4' energy: -86.488 flat angles C4'-P-C4' energy: -55.489 flat angles P-C4'-P energy: -37.135 tors. eta vs tors. theta energy: -11.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -365.042447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.042447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.792447 (E_RNA) where: Base-Base interactions energy: -187.982 where: short stacking energy: -131.793 Base-Backbone interact. energy: 3.290 local terms energy: -213.101010 where: bonds (distance) C4'-P energy: -47.257 bonds (distance) P-C4' energy: -68.224 flat angles C4'-P-C4' energy: -60.068 flat angles P-C4'-P energy: -29.089 tors. eta vs tors. theta energy: -8.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1320.573894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.573894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.323894 (E_RNA) where: Base-Base interactions energy: -926.507 where: short stacking energy: -392.646 Base-Backbone interact. energy: -0.019 local terms energy: -426.798736 where: bonds (distance) C4'-P energy: -84.386 bonds (distance) P-C4' energy: -85.968 flat angles C4'-P-C4' energy: -89.734 flat angles P-C4'-P energy: -58.563 tors. eta vs tors. theta energy: -108.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1200.763918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.763918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.513918 (E_RNA) where: Base-Base interactions energy: -836.629 where: short stacking energy: -368.701 Base-Backbone interact. energy: -2.060 local terms energy: -394.824695 where: bonds (distance) C4'-P energy: -69.242 bonds (distance) P-C4' energy: -75.869 flat angles C4'-P-C4' energy: -90.975 flat angles P-C4'-P energy: -57.200 tors. eta vs tors. theta energy: -101.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1121.753912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.753912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.503912 (E_RNA) where: Base-Base interactions energy: -750.194 where: short stacking energy: -357.693 Base-Backbone interact. energy: -0.652 local terms energy: -403.657889 where: bonds (distance) C4'-P energy: -76.830 bonds (distance) P-C4' energy: -91.929 flat angles C4'-P-C4' energy: -85.626 flat angles P-C4'-P energy: -53.849 tors. eta vs tors. theta energy: -95.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1003.844148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.844148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.594148 (E_RNA) where: Base-Base interactions energy: -700.807 where: short stacking energy: -301.178 Base-Backbone interact. energy: 1.339 local terms energy: -337.126301 where: bonds (distance) C4'-P energy: -61.180 bonds (distance) P-C4' energy: -73.134 flat angles C4'-P-C4' energy: -79.726 flat angles P-C4'-P energy: -47.761 tors. eta vs tors. theta energy: -75.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -988.212455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.212455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.962455 (E_RNA) where: Base-Base interactions energy: -664.886 where: short stacking energy: -278.799 Base-Backbone interact. energy: 0.808 local terms energy: -356.884743 where: bonds (distance) C4'-P energy: -72.809 bonds (distance) P-C4' energy: -82.234 flat angles C4'-P-C4' energy: -80.023 flat angles P-C4'-P energy: -59.319 tors. eta vs tors. theta energy: -62.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -760.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.147790 (E_RNA) where: Base-Base interactions energy: -496.085 where: short stacking energy: -256.699 Base-Backbone interact. energy: 0.775 local terms energy: -297.838169 where: bonds (distance) C4'-P energy: -68.006 bonds (distance) P-C4' energy: -76.681 flat angles C4'-P-C4' energy: -68.775 flat angles P-C4'-P energy: -36.966 tors. eta vs tors. theta energy: -47.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -761.063654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.063654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.813654 (E_RNA) where: Base-Base interactions energy: -477.242 where: short stacking energy: -226.123 Base-Backbone interact. energy: 2.741 local terms energy: -319.312504 where: bonds (distance) C4'-P energy: -63.864 bonds (distance) P-C4' energy: -81.254 flat angles C4'-P-C4' energy: -71.233 flat angles P-C4'-P energy: -51.823 tors. eta vs tors. theta energy: -51.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -644.332030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.332030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.082030 (E_RNA) where: Base-Base interactions energy: -411.448 where: short stacking energy: -216.540 Base-Backbone interact. energy: 3.130 local terms energy: -272.146261 where: bonds (distance) C4'-P energy: -49.269 bonds (distance) P-C4' energy: -80.564 flat angles C4'-P-C4' energy: -69.514 flat angles P-C4'-P energy: -39.056 tors. eta vs tors. theta energy: -33.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 3.382 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -485.148452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.148452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.898452 (E_RNA) where: Base-Base interactions energy: -277.339 where: short stacking energy: -140.657 Base-Backbone interact. energy: 0.146 local terms energy: -240.704648 where: bonds (distance) C4'-P energy: -49.261 bonds (distance) P-C4' energy: -75.587 flat angles C4'-P-C4' energy: -65.518 flat angles P-C4'-P energy: -45.660 tors. eta vs tors. theta energy: -4.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -359.842299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.842299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.592299 (E_RNA) where: Base-Base interactions energy: -185.347 where: short stacking energy: -104.150 Base-Backbone interact. energy: -1.689 local terms energy: -206.014763 where: bonds (distance) C4'-P energy: -65.112 bonds (distance) P-C4' energy: -62.576 flat angles C4'-P-C4' energy: -60.351 flat angles P-C4'-P energy: -18.728 tors. eta vs tors. theta energy: 0.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.458 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1316.967365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.967365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1349.717365 (E_RNA) where: Base-Base interactions energy: -939.454 where: short stacking energy: -400.684 Base-Backbone interact. energy: 0.627 local terms energy: -410.890624 where: bonds (distance) C4'-P energy: -76.811 bonds (distance) P-C4' energy: -73.381 flat angles C4'-P-C4' energy: -98.057 flat angles P-C4'-P energy: -58.774 tors. eta vs tors. theta energy: -103.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1233.341538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.341538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.091538 (E_RNA) where: Base-Base interactions energy: -845.590 where: short stacking energy: -369.884 Base-Backbone interact. energy: -5.163 local terms energy: -415.339274 where: bonds (distance) C4'-P energy: -70.735 bonds (distance) P-C4' energy: -96.592 flat angles C4'-P-C4' energy: -90.082 flat angles P-C4'-P energy: -54.570 tors. eta vs tors. theta energy: -103.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1119.453726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.453726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.203726 (E_RNA) where: Base-Base interactions energy: -752.681 where: short stacking energy: -346.087 Base-Backbone interact. energy: -0.841 local terms energy: -398.681515 where: bonds (distance) C4'-P energy: -73.621 bonds (distance) P-C4' energy: -87.347 flat angles C4'-P-C4' energy: -88.605 flat angles P-C4'-P energy: -57.163 tors. eta vs tors. theta energy: -91.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1052.896240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.896240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.646240 (E_RNA) where: Base-Base interactions energy: -714.723 where: short stacking energy: -332.620 Base-Backbone interact. energy: 1.105 local terms energy: -372.027478 where: bonds (distance) C4'-P energy: -70.972 bonds (distance) P-C4' energy: -79.540 flat angles C4'-P-C4' energy: -84.393 flat angles P-C4'-P energy: -52.230 tors. eta vs tors. theta energy: -84.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -967.432373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.432373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.182373 (E_RNA) where: Base-Base interactions energy: -648.081 where: short stacking energy: -295.915 Base-Backbone interact. energy: 0.885 local terms energy: -352.986673 where: bonds (distance) C4'-P energy: -60.597 bonds (distance) P-C4' energy: -89.837 flat angles C4'-P-C4' energy: -70.797 flat angles P-C4'-P energy: -49.526 tors. eta vs tors. theta energy: -82.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -749.674677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.674677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.424677 (E_RNA) where: Base-Base interactions energy: -483.021 where: short stacking energy: -266.519 Base-Backbone interact. energy: 6.529 local terms energy: -305.932751 where: bonds (distance) C4'-P energy: -73.475 bonds (distance) P-C4' energy: -73.117 flat angles C4'-P-C4' energy: -70.125 flat angles P-C4'-P energy: -34.707 tors. eta vs tors. theta energy: -54.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -769.043720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.043720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.793720 (E_RNA) where: Base-Base interactions energy: -514.966 where: short stacking energy: -230.786 Base-Backbone interact. energy: 0.814 local terms energy: -287.641824 where: bonds (distance) C4'-P energy: -71.083 bonds (distance) P-C4' energy: -63.938 flat angles C4'-P-C4' energy: -65.271 flat angles P-C4'-P energy: -44.929 tors. eta vs tors. theta energy: -42.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -636.765539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.765539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.515539 (E_RNA) where: Base-Base interactions energy: -371.951 where: short stacking energy: -205.042 Base-Backbone interact. energy: -1.328 local terms energy: -296.236649 where: bonds (distance) C4'-P energy: -62.927 bonds (distance) P-C4' energy: -67.943 flat angles C4'-P-C4' energy: -81.275 flat angles P-C4'-P energy: -52.554 tors. eta vs tors. theta energy: -31.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -447.996492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.996492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.746492 (E_RNA) where: Base-Base interactions energy: -248.939 where: short stacking energy: -155.456 Base-Backbone interact. energy: 0.226 local terms energy: -232.033001 where: bonds (distance) C4'-P energy: -51.093 bonds (distance) P-C4' energy: -73.887 flat angles C4'-P-C4' energy: -60.156 flat angles P-C4'-P energy: -35.847 tors. eta vs tors. theta energy: -11.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -451.255708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.255708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.005708 (E_RNA) where: Base-Base interactions energy: -250.488 where: short stacking energy: -134.772 Base-Backbone interact. energy: 0.471 local terms energy: -233.987998 where: bonds (distance) C4'-P energy: -68.994 bonds (distance) P-C4' energy: -63.792 flat angles C4'-P-C4' energy: -59.695 flat angles P-C4'-P energy: -41.851 tors. eta vs tors. theta energy: 0.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1326.810788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.810788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.560788 (E_RNA) where: Base-Base interactions energy: -940.778 where: short stacking energy: -391.260 Base-Backbone interact. energy: 1.026 local terms energy: -419.808876 where: bonds (distance) C4'-P energy: -70.241 bonds (distance) P-C4' energy: -87.332 flat angles C4'-P-C4' energy: -98.633 flat angles P-C4'-P energy: -58.305 tors. eta vs tors. theta energy: -105.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1208.212134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.212134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.962134 (E_RNA) where: Base-Base interactions energy: -814.967 where: short stacking energy: -352.623 Base-Backbone interact. energy: -3.165 local terms energy: -422.830211 where: bonds (distance) C4'-P energy: -87.018 bonds (distance) P-C4' energy: -82.130 flat angles C4'-P-C4' energy: -91.761 flat angles P-C4'-P energy: -53.490 tors. eta vs tors. theta energy: -108.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1125.709926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.709926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.459926 (E_RNA) where: Base-Base interactions energy: -749.053 where: short stacking energy: -362.997 Base-Backbone interact. energy: 0.087 local terms energy: -409.493750 where: bonds (distance) C4'-P energy: -79.847 bonds (distance) P-C4' energy: -89.001 flat angles C4'-P-C4' energy: -85.461 flat angles P-C4'-P energy: -57.362 tors. eta vs tors. theta energy: -97.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1050.321469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.321469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.071469 (E_RNA) where: Base-Base interactions energy: -723.470 where: short stacking energy: -312.184 Base-Backbone interact. energy: 3.029 local terms energy: -362.630649 where: bonds (distance) C4'-P energy: -71.190 bonds (distance) P-C4' energy: -81.328 flat angles C4'-P-C4' energy: -74.225 flat angles P-C4'-P energy: -55.767 tors. eta vs tors. theta energy: -80.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -975.785904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.785904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.535904 (E_RNA) where: Base-Base interactions energy: -672.696 where: short stacking energy: -311.031 Base-Backbone interact. energy: -3.761 local terms energy: -332.078827 where: bonds (distance) C4'-P energy: -64.184 bonds (distance) P-C4' energy: -70.441 flat angles C4'-P-C4' energy: -79.481 flat angles P-C4'-P energy: -45.204 tors. eta vs tors. theta energy: -72.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -804.802315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.802315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.552315 (E_RNA) where: Base-Base interactions energy: -505.975 where: short stacking energy: -256.195 Base-Backbone interact. energy: -1.004 local terms energy: -330.624979 where: bonds (distance) C4'-P energy: -71.832 bonds (distance) P-C4' energy: -81.109 flat angles C4'-P-C4' energy: -68.329 flat angles P-C4'-P energy: -49.883 tors. eta vs tors. theta energy: -59.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.052 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -736.195633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.195633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.945633 (E_RNA) where: Base-Base interactions energy: -478.845 where: short stacking energy: -221.384 Base-Backbone interact. energy: -0.536 local terms energy: -289.563997 where: bonds (distance) C4'-P energy: -64.473 bonds (distance) P-C4' energy: -75.244 flat angles C4'-P-C4' energy: -61.583 flat angles P-C4'-P energy: -44.236 tors. eta vs tors. theta energy: -44.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -704.196400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.196400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.946400 (E_RNA) where: Base-Base interactions energy: -446.268 where: short stacking energy: -218.850 Base-Backbone interact. energy: -0.966 local terms energy: -289.712420 where: bonds (distance) C4'-P energy: -73.202 bonds (distance) P-C4' energy: -59.397 flat angles C4'-P-C4' energy: -72.043 flat angles P-C4'-P energy: -30.429 tors. eta vs tors. theta energy: -54.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -411.562134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.562134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.312134 (E_RNA) where: Base-Base interactions energy: -198.083 where: short stacking energy: -133.197 Base-Backbone interact. energy: -1.843 local terms energy: -244.385437 where: bonds (distance) C4'-P energy: -64.169 bonds (distance) P-C4' energy: -70.585 flat angles C4'-P-C4' energy: -56.790 flat angles P-C4'-P energy: -46.962 tors. eta vs tors. theta energy: -5.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -467.457269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.457269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.207269 (E_RNA) where: Base-Base interactions energy: -257.041 where: short stacking energy: -133.723 Base-Backbone interact. energy: 1.301 local terms energy: -244.467630 where: bonds (distance) C4'-P energy: -62.491 bonds (distance) P-C4' energy: -63.492 flat angles C4'-P-C4' energy: -66.263 flat angles P-C4'-P energy: -45.686 tors. eta vs tors. theta energy: -6.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1329.856255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.856255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.606255 (E_RNA) where: Base-Base interactions energy: -924.947 where: short stacking energy: -384.253 Base-Backbone interact. energy: -3.661 local terms energy: -433.997910 where: bonds (distance) C4'-P energy: -84.875 bonds (distance) P-C4' energy: -79.701 flat angles C4'-P-C4' energy: -90.369 flat angles P-C4'-P energy: -67.767 tors. eta vs tors. theta energy: -111.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1176.414258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.414258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1209.164258 (E_RNA) where: Base-Base interactions energy: -809.624 where: short stacking energy: -345.609 Base-Backbone interact. energy: -1.700 local terms energy: -397.839641 where: bonds (distance) C4'-P energy: -75.622 bonds (distance) P-C4' energy: -86.082 flat angles C4'-P-C4' energy: -89.158 flat angles P-C4'-P energy: -49.643 tors. eta vs tors. theta energy: -97.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1125.653051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1125.653051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.403051 (E_RNA) where: Base-Base interactions energy: -792.560 where: short stacking energy: -367.833 Base-Backbone interact. energy: -1.792 local terms energy: -365.523644 where: bonds (distance) C4'-P energy: -63.619 bonds (distance) P-C4' energy: -76.925 flat angles C4'-P-C4' energy: -78.564 flat angles P-C4'-P energy: -48.797 tors. eta vs tors. theta energy: -97.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.473 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1040.949415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.949415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.699415 (E_RNA) where: Base-Base interactions energy: -698.849 where: short stacking energy: -303.928 Base-Backbone interact. energy: -2.929 local terms energy: -371.921697 where: bonds (distance) C4'-P energy: -66.874 bonds (distance) P-C4' energy: -71.600 flat angles C4'-P-C4' energy: -83.300 flat angles P-C4'-P energy: -70.798 tors. eta vs tors. theta energy: -79.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -987.402702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.402702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1020.152702 (E_RNA) where: Base-Base interactions energy: -665.568 where: short stacking energy: -302.431 Base-Backbone interact. energy: -2.712 local terms energy: -351.873187 where: bonds (distance) C4'-P energy: -76.893 bonds (distance) P-C4' energy: -84.113 flat angles C4'-P-C4' energy: -67.539 flat angles P-C4'-P energy: -52.613 tors. eta vs tors. theta energy: -70.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -803.014085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.014085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.764085 (E_RNA) where: Base-Base interactions energy: -517.074 where: short stacking energy: -244.697 Base-Backbone interact. energy: -1.687 local terms energy: -317.003225 where: bonds (distance) C4'-P energy: -80.038 bonds (distance) P-C4' energy: -66.741 flat angles C4'-P-C4' energy: -71.775 flat angles P-C4'-P energy: -45.125 tors. eta vs tors. theta energy: -53.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -768.284304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.284304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.034304 (E_RNA) where: Base-Base interactions energy: -476.316 where: short stacking energy: -238.082 Base-Backbone interact. energy: -1.269 local terms energy: -323.449069 where: bonds (distance) C4'-P energy: -72.310 bonds (distance) P-C4' energy: -65.250 flat angles C4'-P-C4' energy: -80.144 flat angles P-C4'-P energy: -51.966 tors. eta vs tors. theta energy: -53.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -669.483989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.483989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.233989 (E_RNA) where: Base-Base interactions energy: -445.950 where: short stacking energy: -184.803 Base-Backbone interact. energy: -1.981 local terms energy: -254.302989 where: bonds (distance) C4'-P energy: -61.158 bonds (distance) P-C4' energy: -69.863 flat angles C4'-P-C4' energy: -72.333 flat angles P-C4'-P energy: -21.717 tors. eta vs tors. theta energy: -29.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -422.522629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.522629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.272629 (E_RNA) where: Base-Base interactions energy: -190.785 where: short stacking energy: -130.138 Base-Backbone interact. energy: 1.773 local terms energy: -266.260930 where: bonds (distance) C4'-P energy: -74.466 bonds (distance) P-C4' energy: -90.527 flat angles C4'-P-C4' energy: -71.261 flat angles P-C4'-P energy: -29.244 tors. eta vs tors. theta energy: -0.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -461.506727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.506727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.256727 (E_RNA) where: Base-Base interactions energy: -232.700 where: short stacking energy: -131.729 Base-Backbone interact. energy: -0.145 local terms energy: -261.412215 where: bonds (distance) C4'-P energy: -80.293 bonds (distance) P-C4' energy: -85.255 flat angles C4'-P-C4' energy: -62.768 flat angles P-C4'-P energy: -29.464 tors. eta vs tors. theta energy: -3.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1311.769389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1311.769389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.519389 (E_RNA) where: Base-Base interactions energy: -906.608 where: short stacking energy: -395.143 Base-Backbone interact. energy: -3.162 local terms energy: -434.749425 where: bonds (distance) C4'-P energy: -73.201 bonds (distance) P-C4' energy: -98.127 flat angles C4'-P-C4' energy: -94.795 flat angles P-C4'-P energy: -66.373 tors. eta vs tors. theta energy: -102.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1187.188647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.188647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.938647 (E_RNA) where: Base-Base interactions energy: -825.135 where: short stacking energy: -357.465 Base-Backbone interact. energy: -0.044 local terms energy: -394.759418 where: bonds (distance) C4'-P energy: -86.467 bonds (distance) P-C4' energy: -74.244 flat angles C4'-P-C4' energy: -75.655 flat angles P-C4'-P energy: -59.805 tors. eta vs tors. theta energy: -98.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1144.312162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.312162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1177.062162 (E_RNA) where: Base-Base interactions energy: -785.259 where: short stacking energy: -381.585 Base-Backbone interact. energy: -1.612 local terms energy: -390.191887 where: bonds (distance) C4'-P energy: -79.294 bonds (distance) P-C4' energy: -75.999 flat angles C4'-P-C4' energy: -90.404 flat angles P-C4'-P energy: -50.219 tors. eta vs tors. theta energy: -94.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1065.237426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.237426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.987426 (E_RNA) where: Base-Base interactions energy: -718.355 where: short stacking energy: -327.871 Base-Backbone interact. energy: -1.261 local terms energy: -378.371641 where: bonds (distance) C4'-P energy: -74.102 bonds (distance) P-C4' energy: -70.902 flat angles C4'-P-C4' energy: -83.391 flat angles P-C4'-P energy: -57.333 tors. eta vs tors. theta energy: -92.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -939.542161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.542161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.292161 (E_RNA) where: Base-Base interactions energy: -616.272 where: short stacking energy: -283.387 Base-Backbone interact. energy: -3.001 local terms energy: -353.019272 where: bonds (distance) C4'-P energy: -76.077 bonds (distance) P-C4' energy: -83.562 flat angles C4'-P-C4' energy: -76.469 flat angles P-C4'-P energy: -46.131 tors. eta vs tors. theta energy: -70.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -822.966310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.966310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.716310 (E_RNA) where: Base-Base interactions energy: -519.840 where: short stacking energy: -254.733 Base-Backbone interact. energy: -1.195 local terms energy: -334.681224 where: bonds (distance) C4'-P energy: -74.904 bonds (distance) P-C4' energy: -72.367 flat angles C4'-P-C4' energy: -82.735 flat angles P-C4'-P energy: -38.665 tors. eta vs tors. theta energy: -66.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -723.388582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -723.388582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.138582 (E_RNA) where: Base-Base interactions energy: -455.964 where: short stacking energy: -211.754 Base-Backbone interact. energy: -1.304 local terms energy: -298.870302 where: bonds (distance) C4'-P energy: -60.661 bonds (distance) P-C4' energy: -81.140 flat angles C4'-P-C4' energy: -61.041 flat angles P-C4'-P energy: -53.865 tors. eta vs tors. theta energy: -42.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -674.511633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.511633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.261633 (E_RNA) where: Base-Base interactions energy: -400.534 where: short stacking energy: -213.381 Base-Backbone interact. energy: 2.022 local terms energy: -308.748864 where: bonds (distance) C4'-P energy: -70.168 bonds (distance) P-C4' energy: -71.331 flat angles C4'-P-C4' energy: -74.262 flat angles P-C4'-P energy: -41.641 tors. eta vs tors. theta energy: -51.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -442.005957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.005957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.755957 (E_RNA) where: Base-Base interactions energy: -239.682 where: short stacking energy: -127.579 Base-Backbone interact. energy: -0.289 local terms energy: -234.784693 where: bonds (distance) C4'-P energy: -58.821 bonds (distance) P-C4' energy: -68.157 flat angles C4'-P-C4' energy: -63.447 flat angles P-C4'-P energy: -39.185 tors. eta vs tors. theta energy: -5.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -440.547576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.547576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.297576 (E_RNA) where: Base-Base interactions energy: -257.141 where: short stacking energy: -129.605 Base-Backbone interact. energy: -0.270 local terms energy: -215.886033 where: bonds (distance) C4'-P energy: -72.153 bonds (distance) P-C4' energy: -69.589 flat angles C4'-P-C4' energy: -53.568 flat angles P-C4'-P energy: -31.453 tors. eta vs tors. theta energy: 10.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1320.478747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.478747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.228747 (E_RNA) where: Base-Base interactions energy: -921.291 where: short stacking energy: -388.735 Base-Backbone interact. energy: -2.378 local terms energy: -429.560201 where: bonds (distance) C4'-P energy: -81.177 bonds (distance) P-C4' energy: -80.136 flat angles C4'-P-C4' energy: -92.869 flat angles P-C4'-P energy: -70.699 tors. eta vs tors. theta energy: -104.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1189.192040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.192040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.942040 (E_RNA) where: Base-Base interactions energy: -800.802 where: short stacking energy: -361.857 Base-Backbone interact. energy: -4.441 local terms energy: -416.698819 where: bonds (distance) C4'-P energy: -73.485 bonds (distance) P-C4' energy: -88.769 flat angles C4'-P-C4' energy: -86.192 flat angles P-C4'-P energy: -59.100 tors. eta vs tors. theta energy: -109.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1152.131319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.131319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.881319 (E_RNA) where: Base-Base interactions energy: -775.104 where: short stacking energy: -368.134 Base-Backbone interact. energy: -0.678 local terms energy: -410.244065 where: bonds (distance) C4'-P energy: -85.541 bonds (distance) P-C4' energy: -77.810 flat angles C4'-P-C4' energy: -81.894 flat angles P-C4'-P energy: -58.979 tors. eta vs tors. theta energy: -106.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.145 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1115.424985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.424985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.174985 (E_RNA) where: Base-Base interactions energy: -762.948 where: short stacking energy: -332.408 Base-Backbone interact. energy: 0.864 local terms energy: -386.090632 where: bonds (distance) C4'-P energy: -72.676 bonds (distance) P-C4' energy: -77.737 flat angles C4'-P-C4' energy: -94.798 flat angles P-C4'-P energy: -52.241 tors. eta vs tors. theta energy: -88.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -928.509306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.509306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.259306 (E_RNA) where: Base-Base interactions energy: -595.047 where: short stacking energy: -273.429 Base-Backbone interact. energy: -0.395 local terms energy: -365.817798 where: bonds (distance) C4'-P energy: -76.109 bonds (distance) P-C4' energy: -88.593 flat angles C4'-P-C4' energy: -84.675 flat angles P-C4'-P energy: -53.572 tors. eta vs tors. theta energy: -62.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -781.867908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.867908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.617908 (E_RNA) where: Base-Base interactions energy: -492.940 where: short stacking energy: -238.897 Base-Backbone interact. energy: 2.104 local terms energy: -323.782145 where: bonds (distance) C4'-P energy: -69.646 bonds (distance) P-C4' energy: -81.775 flat angles C4'-P-C4' energy: -69.898 flat angles P-C4'-P energy: -46.702 tors. eta vs tors. theta energy: -55.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -704.838117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.838117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.588117 (E_RNA) where: Base-Base interactions energy: -449.107 where: short stacking energy: -214.873 Base-Backbone interact. energy: -0.662 local terms energy: -287.819375 where: bonds (distance) C4'-P energy: -65.936 bonds (distance) P-C4' energy: -77.378 flat angles C4'-P-C4' energy: -70.838 flat angles P-C4'-P energy: -34.487 tors. eta vs tors. theta energy: -39.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -664.754537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.754537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.504537 (E_RNA) where: Base-Base interactions energy: -406.397 where: short stacking energy: -186.688 Base-Backbone interact. energy: 1.702 local terms energy: -292.809449 where: bonds (distance) C4'-P energy: -76.547 bonds (distance) P-C4' energy: -71.456 flat angles C4'-P-C4' energy: -68.949 flat angles P-C4'-P energy: -50.665 tors. eta vs tors. theta energy: -25.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -461.715780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.715780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.465780 (E_RNA) where: Base-Base interactions energy: -269.104 where: short stacking energy: -156.666 Base-Backbone interact. energy: -1.056 local terms energy: -224.306270 where: bonds (distance) C4'-P energy: -52.142 bonds (distance) P-C4' energy: -69.929 flat angles C4'-P-C4' energy: -63.645 flat angles P-C4'-P energy: -35.805 tors. eta vs tors. theta energy: -2.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -379.270055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.270055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.020055 (E_RNA) where: Base-Base interactions energy: -184.173 where: short stacking energy: -94.773 Base-Backbone interact. energy: -0.771 local terms energy: -227.075923 where: bonds (distance) C4'-P energy: -58.063 bonds (distance) P-C4' energy: -74.482 flat angles C4'-P-C4' energy: -55.316 flat angles P-C4'-P energy: -38.722 tors. eta vs tors. theta energy: -0.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1324.953893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.953893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.703893 (E_RNA) where: Base-Base interactions energy: -927.333 where: short stacking energy: -391.118 Base-Backbone interact. energy: -1.005 local terms energy: -429.365925 where: bonds (distance) C4'-P energy: -82.588 bonds (distance) P-C4' energy: -84.491 flat angles C4'-P-C4' energy: -97.917 flat angles P-C4'-P energy: -58.509 tors. eta vs tors. theta energy: -105.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1231.748447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.748447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.498447 (E_RNA) where: Base-Base interactions energy: -854.964 where: short stacking energy: -360.629 Base-Backbone interact. energy: -1.830 local terms energy: -407.704917 where: bonds (distance) C4'-P energy: -84.242 bonds (distance) P-C4' energy: -71.470 flat angles C4'-P-C4' energy: -95.785 flat angles P-C4'-P energy: -53.327 tors. eta vs tors. theta energy: -102.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1129.120808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.120808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.870808 (E_RNA) where: Base-Base interactions energy: -778.193 where: short stacking energy: -341.917 Base-Backbone interact. energy: -0.829 local terms energy: -382.848996 where: bonds (distance) C4'-P energy: -77.058 bonds (distance) P-C4' energy: -70.705 flat angles C4'-P-C4' energy: -88.959 flat angles P-C4'-P energy: -54.029 tors. eta vs tors. theta energy: -92.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1087.317896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.317896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.067896 (E_RNA) where: Base-Base interactions energy: -750.531 where: short stacking energy: -336.626 Base-Backbone interact. energy: -1.076 local terms energy: -368.832609 where: bonds (distance) C4'-P energy: -64.133 bonds (distance) P-C4' energy: -78.601 flat angles C4'-P-C4' energy: -88.663 flat angles P-C4'-P energy: -51.187 tors. eta vs tors. theta energy: -86.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.372 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -922.348240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.348240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.098240 (E_RNA) where: Base-Base interactions energy: -612.185 where: short stacking energy: -292.480 Base-Backbone interact. energy: 1.313 local terms energy: -344.226704 where: bonds (distance) C4'-P energy: -68.122 bonds (distance) P-C4' energy: -69.831 flat angles C4'-P-C4' energy: -81.058 flat angles P-C4'-P energy: -57.232 tors. eta vs tors. theta energy: -67.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -797.018398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.018398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.768398 (E_RNA) where: Base-Base interactions energy: -509.714 where: short stacking energy: -237.766 Base-Backbone interact. energy: -1.596 local terms energy: -318.458722 where: bonds (distance) C4'-P energy: -73.001 bonds (distance) P-C4' energy: -82.645 flat angles C4'-P-C4' energy: -83.269 flat angles P-C4'-P energy: -34.242 tors. eta vs tors. theta energy: -45.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -692.958753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.958753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.708753 (E_RNA) where: Base-Base interactions energy: -431.702 where: short stacking energy: -215.654 Base-Backbone interact. energy: 0.157 local terms energy: -294.164071 where: bonds (distance) C4'-P energy: -59.390 bonds (distance) P-C4' energy: -65.906 flat angles C4'-P-C4' energy: -77.790 flat angles P-C4'-P energy: -41.723 tors. eta vs tors. theta energy: -49.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -615.171819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.171819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -647.921819 (E_RNA) where: Base-Base interactions energy: -374.815 where: short stacking energy: -192.054 Base-Backbone interact. energy: -1.201 local terms energy: -271.906081 where: bonds (distance) C4'-P energy: -76.281 bonds (distance) P-C4' energy: -83.055 flat angles C4'-P-C4' energy: -54.938 flat angles P-C4'-P energy: -22.229 tors. eta vs tors. theta energy: -35.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -471.909342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.909342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.659342 (E_RNA) where: Base-Base interactions energy: -282.988 where: short stacking energy: -145.876 Base-Backbone interact. energy: 1.497 local terms energy: -223.167749 where: bonds (distance) C4'-P energy: -67.405 bonds (distance) P-C4' energy: -67.915 flat angles C4'-P-C4' energy: -61.466 flat angles P-C4'-P energy: -23.117 tors. eta vs tors. theta energy: -3.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -418.431181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.431181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.181181 (E_RNA) where: Base-Base interactions energy: -206.123 where: short stacking energy: -131.303 Base-Backbone interact. energy: -0.941 local terms energy: -244.116943 where: bonds (distance) C4'-P energy: -66.806 bonds (distance) P-C4' energy: -66.238 flat angles C4'-P-C4' energy: -65.320 flat angles P-C4'-P energy: -39.167 tors. eta vs tors. theta energy: -6.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1345.866922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.866922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.616922 (E_RNA) where: Base-Base interactions energy: -942.501 where: short stacking energy: -414.019 Base-Backbone interact. energy: -3.044 local terms energy: -433.072126 where: bonds (distance) C4'-P energy: -79.831 bonds (distance) P-C4' energy: -86.385 flat angles C4'-P-C4' energy: -100.201 flat angles P-C4'-P energy: -59.442 tors. eta vs tors. theta energy: -107.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1243.412414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.412414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.162414 (E_RNA) where: Base-Base interactions energy: -861.815 where: short stacking energy: -374.329 Base-Backbone interact. energy: 1.240 local terms energy: -415.587581 where: bonds (distance) C4'-P energy: -79.278 bonds (distance) P-C4' energy: -69.353 flat angles C4'-P-C4' energy: -92.805 flat angles P-C4'-P energy: -62.213 tors. eta vs tors. theta energy: -111.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1147.411319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.411319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.161319 (E_RNA) where: Base-Base interactions energy: -786.027 where: short stacking energy: -352.296 Base-Backbone interact. energy: -1.793 local terms energy: -393.009790 where: bonds (distance) C4'-P energy: -87.327 bonds (distance) P-C4' energy: -81.518 flat angles C4'-P-C4' energy: -74.848 flat angles P-C4'-P energy: -52.918 tors. eta vs tors. theta energy: -96.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.669 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1100.113230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.113230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1132.863230 (E_RNA) where: Base-Base interactions energy: -736.931 where: short stacking energy: -327.543 Base-Backbone interact. energy: 1.049 local terms energy: -396.980854 where: bonds (distance) C4'-P energy: -86.494 bonds (distance) P-C4' energy: -88.027 flat angles C4'-P-C4' energy: -74.365 flat angles P-C4'-P energy: -58.172 tors. eta vs tors. theta energy: -89.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -946.782848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.782848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.532848 (E_RNA) where: Base-Base interactions energy: -627.538 where: short stacking energy: -283.090 Base-Backbone interact. energy: -1.390 local terms energy: -350.604978 where: bonds (distance) C4'-P energy: -80.039 bonds (distance) P-C4' energy: -72.024 flat angles C4'-P-C4' energy: -80.503 flat angles P-C4'-P energy: -50.786 tors. eta vs tors. theta energy: -67.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -908.303181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.303181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.053181 (E_RNA) where: Base-Base interactions energy: -605.432 where: short stacking energy: -274.933 Base-Backbone interact. energy: 0.584 local terms energy: -336.205003 where: bonds (distance) C4'-P energy: -64.679 bonds (distance) P-C4' energy: -80.536 flat angles C4'-P-C4' energy: -76.909 flat angles P-C4'-P energy: -44.392 tors. eta vs tors. theta energy: -69.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -669.689673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.689673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.439673 (E_RNA) where: Base-Base interactions energy: -415.248 where: short stacking energy: -212.103 Base-Backbone interact. energy: 2.275 local terms energy: -289.466915 where: bonds (distance) C4'-P energy: -63.694 bonds (distance) P-C4' energy: -71.263 flat angles C4'-P-C4' energy: -64.488 flat angles P-C4'-P energy: -54.877 tors. eta vs tors. theta energy: -35.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -694.548241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.548241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -727.298241 (E_RNA) where: Base-Base interactions energy: -433.441 where: short stacking energy: -228.207 Base-Backbone interact. energy: -0.714 local terms energy: -293.142566 where: bonds (distance) C4'-P energy: -76.265 bonds (distance) P-C4' energy: -57.829 flat angles C4'-P-C4' energy: -69.897 flat angles P-C4'-P energy: -43.796 tors. eta vs tors. theta energy: -45.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -474.533146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.533146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.283146 (E_RNA) where: Base-Base interactions energy: -273.372 where: short stacking energy: -138.512 Base-Backbone interact. energy: 0.619 local terms energy: -234.529977 where: bonds (distance) C4'-P energy: -67.914 bonds (distance) P-C4' energy: -62.004 flat angles C4'-P-C4' energy: -57.670 flat angles P-C4'-P energy: -35.380 tors. eta vs tors. theta energy: -11.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -393.565379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.565379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.315379 (E_RNA) where: Base-Base interactions energy: -195.798 where: short stacking energy: -120.592 Base-Backbone interact. energy: 2.334 local terms energy: -232.852035 where: bonds (distance) C4'-P energy: -54.246 bonds (distance) P-C4' energy: -77.299 flat angles C4'-P-C4' energy: -56.347 flat angles P-C4'-P energy: -36.694 tors. eta vs tors. theta energy: -8.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1315.510878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.510878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.260878 (E_RNA) where: Base-Base interactions energy: -916.035 where: short stacking energy: -387.811 Base-Backbone interact. energy: -1.777 local terms energy: -430.449719 where: bonds (distance) C4'-P energy: -87.531 bonds (distance) P-C4' energy: -91.374 flat angles C4'-P-C4' energy: -88.659 flat angles P-C4'-P energy: -58.882 tors. eta vs tors. theta energy: -104.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1242.710124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.710124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.460124 (E_RNA) where: Base-Base interactions energy: -850.134 where: short stacking energy: -366.637 Base-Backbone interact. energy: -0.721 local terms energy: -424.605604 where: bonds (distance) C4'-P energy: -85.277 bonds (distance) P-C4' energy: -72.221 flat angles C4'-P-C4' energy: -94.735 flat angles P-C4'-P energy: -61.376 tors. eta vs tors. theta energy: -110.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1119.971707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.971707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.721707 (E_RNA) where: Base-Base interactions energy: -761.414 where: short stacking energy: -347.193 Base-Backbone interact. energy: 0.722 local terms energy: -392.029604 where: bonds (distance) C4'-P energy: -70.430 bonds (distance) P-C4' energy: -85.259 flat angles C4'-P-C4' energy: -87.354 flat angles P-C4'-P energy: -51.287 tors. eta vs tors. theta energy: -97.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1088.626722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.626722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.376722 (E_RNA) where: Base-Base interactions energy: -728.776 where: short stacking energy: -306.162 Base-Backbone interact. energy: -2.215 local terms energy: -391.290833 where: bonds (distance) C4'-P energy: -86.209 bonds (distance) P-C4' energy: -81.716 flat angles C4'-P-C4' energy: -82.365 flat angles P-C4'-P energy: -50.412 tors. eta vs tors. theta energy: -90.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.905 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -951.453818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.453818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.203818 (E_RNA) where: Base-Base interactions energy: -652.292 where: short stacking energy: -262.557 Base-Backbone interact. energy: -2.408 local terms energy: -329.504249 where: bonds (distance) C4'-P energy: -68.707 bonds (distance) P-C4' energy: -79.791 flat angles C4'-P-C4' energy: -69.331 flat angles P-C4'-P energy: -56.090 tors. eta vs tors. theta energy: -55.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -936.566729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -936.566729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.316729 (E_RNA) where: Base-Base interactions energy: -634.348 where: short stacking energy: -305.056 Base-Backbone interact. energy: -2.540 local terms energy: -332.429043 where: bonds (distance) C4'-P energy: -63.988 bonds (distance) P-C4' energy: -61.526 flat angles C4'-P-C4' energy: -84.971 flat angles P-C4'-P energy: -53.231 tors. eta vs tors. theta energy: -68.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -662.430723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -662.430723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.180723 (E_RNA) where: Base-Base interactions energy: -426.848 where: short stacking energy: -209.553 Base-Backbone interact. energy: -1.822 local terms energy: -266.510935 where: bonds (distance) C4'-P energy: -63.479 bonds (distance) P-C4' energy: -68.061 flat angles C4'-P-C4' energy: -69.239 flat angles P-C4'-P energy: -43.541 tors. eta vs tors. theta energy: -22.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -707.099338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.099338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -739.849338 (E_RNA) where: Base-Base interactions energy: -467.251 where: short stacking energy: -207.888 Base-Backbone interact. energy: 1.941 local terms energy: -275.284487 where: bonds (distance) C4'-P energy: -63.427 bonds (distance) P-C4' energy: -87.140 flat angles C4'-P-C4' energy: -66.297 flat angles P-C4'-P energy: -34.500 tors. eta vs tors. theta energy: -23.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.746 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -478.821216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.821216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.571216 (E_RNA) where: Base-Base interactions energy: -274.519 where: short stacking energy: -135.090 Base-Backbone interact. energy: 0.339 local terms energy: -237.391399 where: bonds (distance) C4'-P energy: -82.378 bonds (distance) P-C4' energy: -73.027 flat angles C4'-P-C4' energy: -49.499 flat angles P-C4'-P energy: -30.465 tors. eta vs tors. theta energy: -2.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -388.030427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.030427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.780427 (E_RNA) where: Base-Base interactions energy: -200.283 where: short stacking energy: -108.723 Base-Backbone interact. energy: -0.738 local terms energy: -219.759227 where: bonds (distance) C4'-P energy: -71.909 bonds (distance) P-C4' energy: -60.100 flat angles C4'-P-C4' energy: -56.603 flat angles P-C4'-P energy: -27.267 tors. eta vs tors. theta energy: -3.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1297.702358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.702358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.452358 (E_RNA) where: Base-Base interactions energy: -917.040 where: short stacking energy: -380.683 Base-Backbone interact. energy: -1.178 local terms energy: -412.234600 where: bonds (distance) C4'-P energy: -78.712 bonds (distance) P-C4' energy: -71.254 flat angles C4'-P-C4' energy: -92.329 flat angles P-C4'-P energy: -64.931 tors. eta vs tors. theta energy: -105.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1225.923519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.923519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.673519 (E_RNA) where: Base-Base interactions energy: -837.900 where: short stacking energy: -375.306 Base-Backbone interact. energy: -4.785 local terms energy: -415.988450 where: bonds (distance) C4'-P energy: -85.509 bonds (distance) P-C4' energy: -78.598 flat angles C4'-P-C4' energy: -85.381 flat angles P-C4'-P energy: -56.944 tors. eta vs tors. theta energy: -109.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1089.574795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.574795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.324795 (E_RNA) where: Base-Base interactions energy: -757.900 where: short stacking energy: -331.770 Base-Backbone interact. energy: -0.582 local terms energy: -364.397414 where: bonds (distance) C4'-P energy: -70.243 bonds (distance) P-C4' energy: -63.172 flat angles C4'-P-C4' energy: -88.904 flat angles P-C4'-P energy: -54.493 tors. eta vs tors. theta energy: -87.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.555 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1076.952605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.952605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.702605 (E_RNA) where: Base-Base interactions energy: -748.606 where: short stacking energy: -343.305 Base-Backbone interact. energy: -1.190 local terms energy: -359.906429 where: bonds (distance) C4'-P energy: -69.141 bonds (distance) P-C4' energy: -69.651 flat angles C4'-P-C4' energy: -79.270 flat angles P-C4'-P energy: -49.784 tors. eta vs tors. theta energy: -92.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -945.594073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.594073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.344073 (E_RNA) where: Base-Base interactions energy: -638.884 where: short stacking energy: -301.646 Base-Backbone interact. energy: -0.326 local terms energy: -339.134217 where: bonds (distance) C4'-P energy: -68.742 bonds (distance) P-C4' energy: -70.944 flat angles C4'-P-C4' energy: -76.174 flat angles P-C4'-P energy: -38.466 tors. eta vs tors. theta energy: -84.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -919.694583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.694583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.444583 (E_RNA) where: Base-Base interactions energy: -619.754 where: short stacking energy: -284.175 Base-Backbone interact. energy: -0.709 local terms energy: -331.981600 where: bonds (distance) C4'-P energy: -63.035 bonds (distance) P-C4' energy: -67.910 flat angles C4'-P-C4' energy: -75.512 flat angles P-C4'-P energy: -57.318 tors. eta vs tors. theta energy: -68.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -715.170478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.170478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.920478 (E_RNA) where: Base-Base interactions energy: -436.383 where: short stacking energy: -203.704 Base-Backbone interact. energy: -1.874 local terms energy: -309.663398 where: bonds (distance) C4'-P energy: -74.805 bonds (distance) P-C4' energy: -78.503 flat angles C4'-P-C4' energy: -78.364 flat angles P-C4'-P energy: -44.110 tors. eta vs tors. theta energy: -33.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -629.339902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -629.339902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -662.089902 (E_RNA) where: Base-Base interactions energy: -390.647 where: short stacking energy: -177.443 Base-Backbone interact. energy: -1.341 local terms energy: -270.101847 where: bonds (distance) C4'-P energy: -67.506 bonds (distance) P-C4' energy: -77.644 flat angles C4'-P-C4' energy: -58.408 flat angles P-C4'-P energy: -34.901 tors. eta vs tors. theta energy: -31.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -512.355977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.355977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.105977 (E_RNA) where: Base-Base interactions energy: -309.778 where: short stacking energy: -168.924 Base-Backbone interact. energy: -1.030 local terms energy: -234.297512 where: bonds (distance) C4'-P energy: -69.194 bonds (distance) P-C4' energy: -67.486 flat angles C4'-P-C4' energy: -51.462 flat angles P-C4'-P energy: -35.083 tors. eta vs tors. theta energy: -11.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -334.443618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.443618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.193618 (E_RNA) where: Base-Base interactions energy: -146.546 where: short stacking energy: -104.046 Base-Backbone interact. energy: -4.768 local terms energy: -215.879703 where: bonds (distance) C4'-P energy: -56.377 bonds (distance) P-C4' energy: -50.805 flat angles C4'-P-C4' energy: -64.042 flat angles P-C4'-P energy: -52.811 tors. eta vs tors. theta energy: 8.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1327.419001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1327.419001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.169001 (E_RNA) where: Base-Base interactions energy: -931.772 where: short stacking energy: -397.644 Base-Backbone interact. energy: -1.029 local terms energy: -427.368352 where: bonds (distance) C4'-P energy: -86.762 bonds (distance) P-C4' energy: -79.566 flat angles C4'-P-C4' energy: -97.598 flat angles P-C4'-P energy: -60.640 tors. eta vs tors. theta energy: -102.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1220.463243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.463243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.213243 (E_RNA) where: Base-Base interactions energy: -853.001 where: short stacking energy: -353.538 Base-Backbone interact. energy: 0.552 local terms energy: -400.763853 where: bonds (distance) C4'-P energy: -78.847 bonds (distance) P-C4' energy: -72.475 flat angles C4'-P-C4' energy: -86.857 flat angles P-C4'-P energy: -69.894 tors. eta vs tors. theta energy: -92.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1103.442449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.442449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.192449 (E_RNA) where: Base-Base interactions energy: -745.618 where: short stacking energy: -341.179 Base-Backbone interact. energy: -1.299 local terms energy: -389.275199 where: bonds (distance) C4'-P energy: -82.769 bonds (distance) P-C4' energy: -76.496 flat angles C4'-P-C4' energy: -73.999 flat angles P-C4'-P energy: -66.365 tors. eta vs tors. theta energy: -89.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1073.478860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.478860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.228860 (E_RNA) where: Base-Base interactions energy: -742.235 where: short stacking energy: -326.878 Base-Backbone interact. energy: -2.265 local terms energy: -361.728286 where: bonds (distance) C4'-P energy: -59.441 bonds (distance) P-C4' energy: -77.308 flat angles C4'-P-C4' energy: -78.019 flat angles P-C4'-P energy: -59.050 tors. eta vs tors. theta energy: -87.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -934.200151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.200151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.950151 (E_RNA) where: Base-Base interactions energy: -618.302 where: short stacking energy: -272.414 Base-Backbone interact. energy: -1.826 local terms energy: -346.821805 where: bonds (distance) C4'-P energy: -72.555 bonds (distance) P-C4' energy: -74.243 flat angles C4'-P-C4' energy: -87.163 flat angles P-C4'-P energy: -41.775 tors. eta vs tors. theta energy: -71.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -884.188840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.188840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.938840 (E_RNA) where: Base-Base interactions energy: -603.139 where: short stacking energy: -279.803 Base-Backbone interact. energy: -1.429 local terms energy: -312.370782 where: bonds (distance) C4'-P energy: -70.871 bonds (distance) P-C4' energy: -67.344 flat angles C4'-P-C4' energy: -68.150 flat angles P-C4'-P energy: -42.885 tors. eta vs tors. theta energy: -63.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -709.556812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.556812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.306812 (E_RNA) where: Base-Base interactions energy: -431.575 where: short stacking energy: -228.032 Base-Backbone interact. energy: -0.708 local terms energy: -310.023113 where: bonds (distance) C4'-P energy: -64.982 bonds (distance) P-C4' energy: -64.679 flat angles C4'-P-C4' energy: -73.802 flat angles P-C4'-P energy: -56.793 tors. eta vs tors. theta energy: -49.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -503.975382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.975382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.725382 (E_RNA) where: Base-Base interactions energy: -279.356 where: short stacking energy: -145.595 Base-Backbone interact. energy: -1.759 local terms energy: -255.609938 where: bonds (distance) C4'-P energy: -76.759 bonds (distance) P-C4' energy: -71.978 flat angles C4'-P-C4' energy: -63.786 flat angles P-C4'-P energy: -46.105 tors. eta vs tors. theta energy: 3.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -614.051245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.051245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.801245 (E_RNA) where: Base-Base interactions energy: -368.200 where: short stacking energy: -180.451 Base-Backbone interact. energy: 2.437 local terms energy: -281.038362 where: bonds (distance) C4'-P energy: -70.104 bonds (distance) P-C4' energy: -60.437 flat angles C4'-P-C4' energy: -65.818 flat angles P-C4'-P energy: -39.627 tors. eta vs tors. theta energy: -45.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -286.643150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.643150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.393150 (E_RNA) where: Base-Base interactions energy: -102.285 where: short stacking energy: -91.387 Base-Backbone interact. energy: 0.543 local terms energy: -217.651194 where: bonds (distance) C4'-P energy: -62.652 bonds (distance) P-C4' energy: -65.196 flat angles C4'-P-C4' energy: -57.185 flat angles P-C4'-P energy: -41.308 tors. eta vs tors. theta energy: 8.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1341.245346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.245346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.995346 (E_RNA) where: Base-Base interactions energy: -933.393 where: short stacking energy: -395.801 Base-Backbone interact. energy: -1.262 local terms energy: -439.339918 where: bonds (distance) C4'-P energy: -87.677 bonds (distance) P-C4' energy: -77.392 flat angles C4'-P-C4' energy: -93.826 flat angles P-C4'-P energy: -67.662 tors. eta vs tors. theta energy: -112.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1196.212943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.212943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.962943 (E_RNA) where: Base-Base interactions energy: -824.215 where: short stacking energy: -345.622 Base-Backbone interact. energy: -2.011 local terms energy: -402.736806 where: bonds (distance) C4'-P energy: -79.989 bonds (distance) P-C4' energy: -81.987 flat angles C4'-P-C4' energy: -84.951 flat angles P-C4'-P energy: -58.925 tors. eta vs tors. theta energy: -96.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1153.688150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.688150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.438150 (E_RNA) where: Base-Base interactions energy: -774.853 where: short stacking energy: -369.534 Base-Backbone interact. energy: 4.811 local terms energy: -416.396464 where: bonds (distance) C4'-P energy: -85.838 bonds (distance) P-C4' energy: -91.794 flat angles C4'-P-C4' energy: -86.783 flat angles P-C4'-P energy: -57.919 tors. eta vs tors. theta energy: -94.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1081.420040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.420040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1114.170040 (E_RNA) where: Base-Base interactions energy: -738.017 where: short stacking energy: -337.604 Base-Backbone interact. energy: -1.940 local terms energy: -374.213848 where: bonds (distance) C4'-P energy: -71.010 bonds (distance) P-C4' energy: -79.373 flat angles C4'-P-C4' energy: -81.174 flat angles P-C4'-P energy: -49.408 tors. eta vs tors. theta energy: -93.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -929.956606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.956606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.706606 (E_RNA) where: Base-Base interactions energy: -616.366 where: short stacking energy: -286.144 Base-Backbone interact. energy: -1.402 local terms energy: -344.939052 where: bonds (distance) C4'-P energy: -71.287 bonds (distance) P-C4' energy: -73.051 flat angles C4'-P-C4' energy: -71.458 flat angles P-C4'-P energy: -56.520 tors. eta vs tors. theta energy: -72.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -870.173932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -870.173932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.923932 (E_RNA) where: Base-Base interactions energy: -582.545 where: short stacking energy: -262.876 Base-Backbone interact. energy: -0.961 local terms energy: -319.417829 where: bonds (distance) C4'-P energy: -72.802 bonds (distance) P-C4' energy: -73.100 flat angles C4'-P-C4' energy: -72.125 flat angles P-C4'-P energy: -49.262 tors. eta vs tors. theta energy: -52.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -750.345439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.345439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.095439 (E_RNA) where: Base-Base interactions energy: -460.303 where: short stacking energy: -235.972 Base-Backbone interact. energy: -0.729 local terms energy: -322.063835 where: bonds (distance) C4'-P energy: -71.615 bonds (distance) P-C4' energy: -77.751 flat angles C4'-P-C4' energy: -83.689 flat angles P-C4'-P energy: -49.035 tors. eta vs tors. theta energy: -39.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -565.079790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.079790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.829790 (E_RNA) where: Base-Base interactions energy: -310.675 where: short stacking energy: -151.346 Base-Backbone interact. energy: -2.350 local terms energy: -284.805590 where: bonds (distance) C4'-P energy: -73.391 bonds (distance) P-C4' energy: -78.713 flat angles C4'-P-C4' energy: -75.269 flat angles P-C4'-P energy: -37.077 tors. eta vs tors. theta energy: -20.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -606.123102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.123102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.873102 (E_RNA) where: Base-Base interactions energy: -357.020 where: short stacking energy: -187.514 Base-Backbone interact. energy: -1.583 local terms energy: -280.269442 where: bonds (distance) C4'-P energy: -65.491 bonds (distance) P-C4' energy: -80.804 flat angles C4'-P-C4' energy: -73.239 flat angles P-C4'-P energy: -37.441 tors. eta vs tors. theta energy: -23.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -293.507204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.507204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.257204 (E_RNA) where: Base-Base interactions energy: -105.395 where: short stacking energy: -102.208 Base-Backbone interact. energy: 5.878 local terms energy: -227.890041 where: bonds (distance) C4'-P energy: -61.234 bonds (distance) P-C4' energy: -76.364 flat angles C4'-P-C4' energy: -51.838 flat angles P-C4'-P energy: -33.121 tors. eta vs tors. theta energy: -5.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.150 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1336.143929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.143929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.893929 (E_RNA) where: Base-Base interactions energy: -922.060 where: short stacking energy: -387.988 Base-Backbone interact. energy: -2.777 local terms energy: -444.056929 where: bonds (distance) C4'-P energy: -82.823 bonds (distance) P-C4' energy: -86.316 flat angles C4'-P-C4' energy: -100.300 flat angles P-C4'-P energy: -63.218 tors. eta vs tors. theta energy: -111.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1208.680205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.680205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.430205 (E_RNA) where: Base-Base interactions energy: -826.492 where: short stacking energy: -359.048 Base-Backbone interact. energy: 0.364 local terms energy: -415.301855 where: bonds (distance) C4'-P energy: -91.358 bonds (distance) P-C4' energy: -83.664 flat angles C4'-P-C4' energy: -84.885 flat angles P-C4'-P energy: -57.705 tors. eta vs tors. theta energy: -97.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1162.021392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.021392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.771392 (E_RNA) where: Base-Base interactions energy: -786.150 where: short stacking energy: -347.046 Base-Backbone interact. energy: 1.313 local terms energy: -411.416362 where: bonds (distance) C4'-P energy: -80.473 bonds (distance) P-C4' energy: -82.800 flat angles C4'-P-C4' energy: -85.256 flat angles P-C4'-P energy: -62.549 tors. eta vs tors. theta energy: -100.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.483 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1085.158278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.158278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.908278 (E_RNA) where: Base-Base interactions energy: -724.296 where: short stacking energy: -338.752 Base-Backbone interact. energy: -0.098 local terms energy: -393.514411 where: bonds (distance) C4'-P energy: -73.790 bonds (distance) P-C4' energy: -79.872 flat angles C4'-P-C4' energy: -77.857 flat angles P-C4'-P energy: -59.872 tors. eta vs tors. theta energy: -102.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -980.710486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.710486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.460486 (E_RNA) where: Base-Base interactions energy: -652.107 where: short stacking energy: -320.038 Base-Backbone interact. energy: -0.740 local terms energy: -360.612979 where: bonds (distance) C4'-P energy: -81.446 bonds (distance) P-C4' energy: -70.907 flat angles C4'-P-C4' energy: -84.879 flat angles P-C4'-P energy: -42.702 tors. eta vs tors. theta energy: -80.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -855.290987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.290987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.040987 (E_RNA) where: Base-Base interactions energy: -562.237 where: short stacking energy: -251.324 Base-Backbone interact. energy: -1.605 local terms energy: -324.198842 where: bonds (distance) C4'-P energy: -68.232 bonds (distance) P-C4' energy: -74.673 flat angles C4'-P-C4' energy: -70.908 flat angles P-C4'-P energy: -55.804 tors. eta vs tors. theta energy: -54.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -749.891983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.891983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.641983 (E_RNA) where: Base-Base interactions energy: -469.619 where: short stacking energy: -234.958 Base-Backbone interact. energy: -0.916 local terms energy: -312.541737 where: bonds (distance) C4'-P energy: -75.427 bonds (distance) P-C4' energy: -64.966 flat angles C4'-P-C4' energy: -59.067 flat angles P-C4'-P energy: -53.324 tors. eta vs tors. theta energy: -59.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.435 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -645.895762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.895762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.645762 (E_RNA) where: Base-Base interactions energy: -381.306 where: short stacking energy: -188.815 Base-Backbone interact. energy: -0.089 local terms energy: -297.250637 where: bonds (distance) C4'-P energy: -74.372 bonds (distance) P-C4' energy: -80.774 flat angles C4'-P-C4' energy: -70.400 flat angles P-C4'-P energy: -37.049 tors. eta vs tors. theta energy: -34.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -534.171883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.171883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.921883 (E_RNA) where: Base-Base interactions energy: -308.628 where: short stacking energy: -166.720 Base-Backbone interact. energy: 2.148 local terms energy: -260.442190 where: bonds (distance) C4'-P energy: -57.959 bonds (distance) P-C4' energy: -74.244 flat angles C4'-P-C4' energy: -72.725 flat angles P-C4'-P energy: -34.922 tors. eta vs tors. theta energy: -20.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -299.778911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.778911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.528911 (E_RNA) where: Base-Base interactions energy: -126.800 where: short stacking energy: -109.659 Base-Backbone interact. energy: 1.397 local terms energy: -207.125828 where: bonds (distance) C4'-P energy: -61.440 bonds (distance) P-C4' energy: -69.344 flat angles C4'-P-C4' energy: -45.938 flat angles P-C4'-P energy: -30.667 tors. eta vs tors. theta energy: 0.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1318.356937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1318.356937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.106937 (E_RNA) where: Base-Base interactions energy: -913.259 where: short stacking energy: -372.834 Base-Backbone interact. energy: 1.073 local terms energy: -438.921331 where: bonds (distance) C4'-P energy: -84.973 bonds (distance) P-C4' energy: -84.035 flat angles C4'-P-C4' energy: -106.292 flat angles P-C4'-P energy: -59.736 tors. eta vs tors. theta energy: -103.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1215.516494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.516494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.266494 (E_RNA) where: Base-Base interactions energy: -824.058 where: short stacking energy: -375.126 Base-Backbone interact. energy: -0.863 local terms energy: -423.345753 where: bonds (distance) C4'-P energy: -84.016 bonds (distance) P-C4' energy: -84.319 flat angles C4'-P-C4' energy: -93.014 flat angles P-C4'-P energy: -59.974 tors. eta vs tors. theta energy: -102.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1144.828976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.828976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1177.578976 (E_RNA) where: Base-Base interactions energy: -781.150 where: short stacking energy: -350.023 Base-Backbone interact. energy: -1.427 local terms energy: -395.002850 where: bonds (distance) C4'-P energy: -71.966 bonds (distance) P-C4' energy: -78.249 flat angles C4'-P-C4' energy: -85.816 flat angles P-C4'-P energy: -59.607 tors. eta vs tors. theta energy: -99.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1043.374610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.374610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.124610 (E_RNA) where: Base-Base interactions energy: -711.762 where: short stacking energy: -333.734 Base-Backbone interact. energy: -1.623 local terms energy: -362.739104 where: bonds (distance) C4'-P energy: -63.874 bonds (distance) P-C4' energy: -65.966 flat angles C4'-P-C4' energy: -83.555 flat angles P-C4'-P energy: -58.509 tors. eta vs tors. theta energy: -90.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -970.355942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.355942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.105942 (E_RNA) where: Base-Base interactions energy: -643.124 where: short stacking energy: -295.148 Base-Backbone interact. energy: -0.277 local terms energy: -359.705107 where: bonds (distance) C4'-P energy: -71.201 bonds (distance) P-C4' energy: -78.358 flat angles C4'-P-C4' energy: -86.487 flat angles P-C4'-P energy: -46.251 tors. eta vs tors. theta energy: -77.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -889.479652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.479652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.229652 (E_RNA) where: Base-Base interactions energy: -592.643 where: short stacking energy: -259.693 Base-Backbone interact. energy: -2.767 local terms energy: -326.819333 where: bonds (distance) C4'-P energy: -76.568 bonds (distance) P-C4' energy: -66.826 flat angles C4'-P-C4' energy: -78.867 flat angles P-C4'-P energy: -50.625 tors. eta vs tors. theta energy: -53.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -767.909730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.909730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.659730 (E_RNA) where: Base-Base interactions energy: -479.915 where: short stacking energy: -234.243 Base-Backbone interact. energy: -1.036 local terms energy: -319.708569 where: bonds (distance) C4'-P energy: -71.305 bonds (distance) P-C4' energy: -75.202 flat angles C4'-P-C4' energy: -60.654 flat angles P-C4'-P energy: -53.386 tors. eta vs tors. theta energy: -59.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -618.805814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.805814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.555814 (E_RNA) where: Base-Base interactions energy: -388.188 where: short stacking energy: -186.613 Base-Backbone interact. energy: -1.539 local terms energy: -261.829149 where: bonds (distance) C4'-P energy: -62.805 bonds (distance) P-C4' energy: -73.372 flat angles C4'-P-C4' energy: -64.488 flat angles P-C4'-P energy: -45.661 tors. eta vs tors. theta energy: -15.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -465.003107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.003107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.753107 (E_RNA) where: Base-Base interactions energy: -234.724 where: short stacking energy: -162.703 Base-Backbone interact. energy: -0.651 local terms energy: -262.378718 where: bonds (distance) C4'-P energy: -67.372 bonds (distance) P-C4' energy: -82.076 flat angles C4'-P-C4' energy: -71.091 flat angles P-C4'-P energy: -31.220 tors. eta vs tors. theta energy: -10.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -297.315317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -297.315317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.065317 (E_RNA) where: Base-Base interactions energy: -109.510 where: short stacking energy: -102.651 Base-Backbone interact. energy: -0.930 local terms energy: -219.625866 where: bonds (distance) C4'-P energy: -59.217 bonds (distance) P-C4' energy: -76.743 flat angles C4'-P-C4' energy: -50.371 flat angles P-C4'-P energy: -30.368 tors. eta vs tors. theta energy: -2.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1334.284847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.284847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.034847 (E_RNA) where: Base-Base interactions energy: -937.513 where: short stacking energy: -389.660 Base-Backbone interact. energy: -1.312 local terms energy: -428.209301 where: bonds (distance) C4'-P energy: -84.058 bonds (distance) P-C4' energy: -82.436 flat angles C4'-P-C4' energy: -90.576 flat angles P-C4'-P energy: -65.009 tors. eta vs tors. theta energy: -106.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1236.155390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.155390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.905390 (E_RNA) where: Base-Base interactions energy: -858.501 where: short stacking energy: -351.809 Base-Backbone interact. energy: -1.308 local terms energy: -409.096885 where: bonds (distance) C4'-P energy: -80.543 bonds (distance) P-C4' energy: -69.730 flat angles C4'-P-C4' energy: -87.924 flat angles P-C4'-P energy: -68.393 tors. eta vs tors. theta energy: -102.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1165.350139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.350139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.100139 (E_RNA) where: Base-Base interactions energy: -808.558 where: short stacking energy: -363.531 Base-Backbone interact. energy: -1.435 local terms energy: -388.107248 where: bonds (distance) C4'-P energy: -76.269 bonds (distance) P-C4' energy: -77.530 flat angles C4'-P-C4' energy: -86.905 flat angles P-C4'-P energy: -47.200 tors. eta vs tors. theta energy: -100.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1036.850649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.850649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.600649 (E_RNA) where: Base-Base interactions energy: -676.486 where: short stacking energy: -339.781 Base-Backbone interact. energy: 0.064 local terms energy: -393.179390 where: bonds (distance) C4'-P energy: -76.121 bonds (distance) P-C4' energy: -78.072 flat angles C4'-P-C4' energy: -86.642 flat angles P-C4'-P energy: -58.003 tors. eta vs tors. theta energy: -94.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -942.343129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.343129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.093129 (E_RNA) where: Base-Base interactions energy: -632.688 where: short stacking energy: -284.065 Base-Backbone interact. energy: 1.662 local terms energy: -344.067083 where: bonds (distance) C4'-P energy: -69.965 bonds (distance) P-C4' energy: -82.179 flat angles C4'-P-C4' energy: -69.054 flat angles P-C4'-P energy: -52.172 tors. eta vs tors. theta energy: -70.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -873.058752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.058752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.808752 (E_RNA) where: Base-Base interactions energy: -576.172 where: short stacking energy: -265.727 Base-Backbone interact. energy: 1.191 local terms energy: -330.827770 where: bonds (distance) C4'-P energy: -65.049 bonds (distance) P-C4' energy: -84.253 flat angles C4'-P-C4' energy: -75.053 flat angles P-C4'-P energy: -43.124 tors. eta vs tors. theta energy: -63.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -770.969576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.969576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.719576 (E_RNA) where: Base-Base interactions energy: -499.187 where: short stacking energy: -254.208 Base-Backbone interact. energy: -2.969 local terms energy: -301.563165 where: bonds (distance) C4'-P energy: -64.168 bonds (distance) P-C4' energy: -70.888 flat angles C4'-P-C4' energy: -68.059 flat angles P-C4'-P energy: -52.013 tors. eta vs tors. theta energy: -46.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -608.196544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.196544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -640.946544 (E_RNA) where: Base-Base interactions energy: -389.490 where: short stacking energy: -201.479 Base-Backbone interact. energy: -2.473 local terms energy: -248.983266 where: bonds (distance) C4'-P energy: -58.226 bonds (distance) P-C4' energy: -72.186 flat angles C4'-P-C4' energy: -64.106 flat angles P-C4'-P energy: -26.371 tors. eta vs tors. theta energy: -28.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -486.551471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.551471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.301471 (E_RNA) where: Base-Base interactions energy: -268.879 where: short stacking energy: -146.449 Base-Backbone interact. energy: -1.679 local terms energy: -248.744036 where: bonds (distance) C4'-P energy: -69.603 bonds (distance) P-C4' energy: -58.002 flat angles C4'-P-C4' energy: -77.550 flat angles P-C4'-P energy: -33.204 tors. eta vs tors. theta energy: -10.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -302.855939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.855939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.605939 (E_RNA) where: Base-Base interactions energy: -122.530 where: short stacking energy: -93.178 Base-Backbone interact. energy: -1.393 local terms energy: -211.683231 where: bonds (distance) C4'-P energy: -59.460 bonds (distance) P-C4' energy: -61.885 flat angles C4'-P-C4' energy: -54.418 flat angles P-C4'-P energy: -43.777 tors. eta vs tors. theta energy: 7.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1322.530995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.530995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.280995 (E_RNA) where: Base-Base interactions energy: -937.960 where: short stacking energy: -403.436 Base-Backbone interact. energy: -2.196 local terms energy: -415.125621 where: bonds (distance) C4'-P energy: -75.528 bonds (distance) P-C4' energy: -77.693 flat angles C4'-P-C4' energy: -89.237 flat angles P-C4'-P energy: -64.301 tors. eta vs tors. theta energy: -108.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1243.764472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.764472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.514472 (E_RNA) where: Base-Base interactions energy: -875.505 where: short stacking energy: -379.869 Base-Backbone interact. energy: 1.426 local terms energy: -402.436032 where: bonds (distance) C4'-P energy: -69.470 bonds (distance) P-C4' energy: -84.113 flat angles C4'-P-C4' energy: -85.089 flat angles P-C4'-P energy: -61.739 tors. eta vs tors. theta energy: -102.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1158.735897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.735897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.485897 (E_RNA) where: Base-Base interactions energy: -768.222 where: short stacking energy: -340.599 Base-Backbone interact. energy: -1.382 local terms energy: -421.882489 where: bonds (distance) C4'-P energy: -78.103 bonds (distance) P-C4' energy: -93.664 flat angles C4'-P-C4' energy: -93.344 flat angles P-C4'-P energy: -54.452 tors. eta vs tors. theta energy: -102.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1006.070009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.070009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.820009 (E_RNA) where: Base-Base interactions energy: -651.729 where: short stacking energy: -310.037 Base-Backbone interact. energy: 0.379 local terms energy: -387.470701 where: bonds (distance) C4'-P energy: -73.422 bonds (distance) P-C4' energy: -81.645 flat angles C4'-P-C4' energy: -92.412 flat angles P-C4'-P energy: -56.656 tors. eta vs tors. theta energy: -83.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -958.572670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.572670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.322670 (E_RNA) where: Base-Base interactions energy: -635.198 where: short stacking energy: -315.922 Base-Backbone interact. energy: -2.481 local terms energy: -353.644225 where: bonds (distance) C4'-P energy: -80.120 bonds (distance) P-C4' energy: -71.779 flat angles C4'-P-C4' energy: -70.939 flat angles P-C4'-P energy: -42.252 tors. eta vs tors. theta energy: -88.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -894.107895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.107895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.857895 (E_RNA) where: Base-Base interactions energy: -580.379 where: short stacking energy: -251.898 Base-Backbone interact. energy: -1.894 local terms energy: -344.585272 where: bonds (distance) C4'-P energy: -62.890 bonds (distance) P-C4' energy: -90.642 flat angles C4'-P-C4' energy: -84.407 flat angles P-C4'-P energy: -52.575 tors. eta vs tors. theta energy: -54.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -791.928713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.928713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.678713 (E_RNA) where: Base-Base interactions energy: -519.114 where: short stacking energy: -221.251 Base-Backbone interact. energy: 2.049 local terms energy: -307.612938 where: bonds (distance) C4'-P energy: -64.455 bonds (distance) P-C4' energy: -72.124 flat angles C4'-P-C4' energy: -74.330 flat angles P-C4'-P energy: -44.513 tors. eta vs tors. theta energy: -52.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -613.701055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.701055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.451055 (E_RNA) where: Base-Base interactions energy: -350.895 where: short stacking energy: -176.220 Base-Backbone interact. energy: -0.979 local terms energy: -294.576566 where: bonds (distance) C4'-P energy: -71.572 bonds (distance) P-C4' energy: -64.260 flat angles C4'-P-C4' energy: -77.870 flat angles P-C4'-P energy: -48.615 tors. eta vs tors. theta energy: -32.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -462.649968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.649968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.399968 (E_RNA) where: Base-Base interactions energy: -244.913 where: short stacking energy: -136.271 Base-Backbone interact. energy: -2.274 local terms energy: -248.212284 where: bonds (distance) C4'-P energy: -70.017 bonds (distance) P-C4' energy: -71.521 flat angles C4'-P-C4' energy: -66.277 flat angles P-C4'-P energy: -43.655 tors. eta vs tors. theta energy: 3.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -302.342221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.342221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.092221 (E_RNA) where: Base-Base interactions energy: -116.558 where: short stacking energy: -103.895 Base-Backbone interact. energy: 6.610 local terms energy: -225.144166 where: bonds (distance) C4'-P energy: -72.153 bonds (distance) P-C4' energy: -63.783 flat angles C4'-P-C4' energy: -60.137 flat angles P-C4'-P energy: -49.473 tors. eta vs tors. theta energy: 20.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1330.687640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.687640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.437640 (E_RNA) where: Base-Base interactions energy: -929.490 where: short stacking energy: -403.239 Base-Backbone interact. energy: -3.344 local terms energy: -430.603632 where: bonds (distance) C4'-P energy: -82.090 bonds (distance) P-C4' energy: -86.774 flat angles C4'-P-C4' energy: -93.856 flat angles P-C4'-P energy: -52.715 tors. eta vs tors. theta energy: -115.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1206.950211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.950211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.700211 (E_RNA) where: Base-Base interactions energy: -842.361 where: short stacking energy: -334.410 Base-Backbone interact. energy: -1.103 local terms energy: -396.235990 where: bonds (distance) C4'-P energy: -88.267 bonds (distance) P-C4' energy: -76.391 flat angles C4'-P-C4' energy: -85.933 flat angles P-C4'-P energy: -56.353 tors. eta vs tors. theta energy: -89.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1152.991078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.991078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.741078 (E_RNA) where: Base-Base interactions energy: -776.082 where: short stacking energy: -356.063 Base-Backbone interact. energy: -0.588 local terms energy: -409.071159 where: bonds (distance) C4'-P energy: -81.724 bonds (distance) P-C4' energy: -82.518 flat angles C4'-P-C4' energy: -90.371 flat angles P-C4'-P energy: -47.407 tors. eta vs tors. theta energy: -107.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1001.845390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.845390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.595390 (E_RNA) where: Base-Base interactions energy: -664.190 where: short stacking energy: -306.477 Base-Backbone interact. energy: -0.609 local terms energy: -369.796369 where: bonds (distance) C4'-P energy: -79.505 bonds (distance) P-C4' energy: -70.039 flat angles C4'-P-C4' energy: -81.445 flat angles P-C4'-P energy: -49.173 tors. eta vs tors. theta energy: -89.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -953.961049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.961049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.711049 (E_RNA) where: Base-Base interactions energy: -633.047 where: short stacking energy: -291.895 Base-Backbone interact. energy: -2.058 local terms energy: -351.605826 where: bonds (distance) C4'-P energy: -59.899 bonds (distance) P-C4' energy: -70.235 flat angles C4'-P-C4' energy: -86.850 flat angles P-C4'-P energy: -54.721 tors. eta vs tors. theta energy: -79.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -887.242490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.242490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.992490 (E_RNA) where: Base-Base interactions energy: -610.001 where: short stacking energy: -244.299 Base-Backbone interact. energy: -0.090 local terms energy: -309.901606 where: bonds (distance) C4'-P energy: -55.463 bonds (distance) P-C4' energy: -68.166 flat angles C4'-P-C4' energy: -71.992 flat angles P-C4'-P energy: -54.169 tors. eta vs tors. theta energy: -60.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -773.094605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -773.094605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.844605 (E_RNA) where: Base-Base interactions energy: -521.781 where: short stacking energy: -249.651 Base-Backbone interact. energy: 0.973 local terms energy: -285.037064 where: bonds (distance) C4'-P energy: -69.546 bonds (distance) P-C4' energy: -64.320 flat angles C4'-P-C4' energy: -69.027 flat angles P-C4'-P energy: -30.503 tors. eta vs tors. theta energy: -51.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -620.864680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.864680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.614680 (E_RNA) where: Base-Base interactions energy: -400.343 where: short stacking energy: -194.201 Base-Backbone interact. energy: -1.491 local terms energy: -251.780683 where: bonds (distance) C4'-P energy: -62.810 bonds (distance) P-C4' energy: -64.359 flat angles C4'-P-C4' energy: -54.504 flat angles P-C4'-P energy: -37.284 tors. eta vs tors. theta energy: -32.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -468.846704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.846704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.596704 (E_RNA) where: Base-Base interactions energy: -274.891 where: short stacking energy: -138.355 Base-Backbone interact. energy: 0.385 local terms energy: -227.091139 where: bonds (distance) C4'-P energy: -56.257 bonds (distance) P-C4' energy: -68.298 flat angles C4'-P-C4' energy: -53.685 flat angles P-C4'-P energy: -33.185 tors. eta vs tors. theta energy: -15.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -288.165550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.165550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.915550 (E_RNA) where: Base-Base interactions energy: -107.480 where: short stacking energy: -84.322 Base-Backbone interact. energy: 1.784 local terms energy: -215.219889 where: bonds (distance) C4'-P energy: -57.740 bonds (distance) P-C4' energy: -75.467 flat angles C4'-P-C4' energy: -49.237 flat angles P-C4'-P energy: -42.407 tors. eta vs tors. theta energy: 9.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1309.329352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.329352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.079352 (E_RNA) where: Base-Base interactions energy: -913.768 where: short stacking energy: -386.034 Base-Backbone interact. energy: -1.755 local terms energy: -426.555690 where: bonds (distance) C4'-P energy: -79.816 bonds (distance) P-C4' energy: -87.104 flat angles C4'-P-C4' energy: -93.264 flat angles P-C4'-P energy: -61.092 tors. eta vs tors. theta energy: -105.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1213.896588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.896588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.646588 (E_RNA) where: Base-Base interactions energy: -825.668 where: short stacking energy: -339.806 Base-Backbone interact. energy: -2.868 local terms energy: -418.109757 where: bonds (distance) C4'-P energy: -84.009 bonds (distance) P-C4' energy: -76.895 flat angles C4'-P-C4' energy: -93.228 flat angles P-C4'-P energy: -58.042 tors. eta vs tors. theta energy: -105.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1166.628065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.628065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.378065 (E_RNA) where: Base-Base interactions energy: -796.698 where: short stacking energy: -358.168 Base-Backbone interact. energy: 0.673 local terms energy: -403.353433 where: bonds (distance) C4'-P energy: -82.883 bonds (distance) P-C4' energy: -85.332 flat angles C4'-P-C4' energy: -82.155 flat angles P-C4'-P energy: -49.879 tors. eta vs tors. theta energy: -103.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1034.472136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.472136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.222136 (E_RNA) where: Base-Base interactions energy: -690.288 where: short stacking energy: -316.600 Base-Backbone interact. energy: -2.417 local terms energy: -374.516922 where: bonds (distance) C4'-P energy: -79.330 bonds (distance) P-C4' energy: -71.279 flat angles C4'-P-C4' energy: -92.538 flat angles P-C4'-P energy: -48.640 tors. eta vs tors. theta energy: -82.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -971.142478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.142478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.892478 (E_RNA) where: Base-Base interactions energy: -647.572 where: short stacking energy: -286.112 Base-Backbone interact. energy: 0.209 local terms energy: -356.529943 where: bonds (distance) C4'-P energy: -73.845 bonds (distance) P-C4' energy: -72.521 flat angles C4'-P-C4' energy: -78.814 flat angles P-C4'-P energy: -53.991 tors. eta vs tors. theta energy: -77.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -866.438420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.438420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -899.188420 (E_RNA) where: Base-Base interactions energy: -588.584 where: short stacking energy: -269.310 Base-Backbone interact. energy: -0.583 local terms energy: -310.021478 where: bonds (distance) C4'-P energy: -76.020 bonds (distance) P-C4' energy: -56.678 flat angles C4'-P-C4' energy: -77.553 flat angles P-C4'-P energy: -35.919 tors. eta vs tors. theta energy: -63.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -792.001652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.001652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.751652 (E_RNA) where: Base-Base interactions energy: -505.253 where: short stacking energy: -241.586 Base-Backbone interact. energy: -1.245 local terms energy: -318.253816 where: bonds (distance) C4'-P energy: -68.324 bonds (distance) P-C4' energy: -60.026 flat angles C4'-P-C4' energy: -78.693 flat angles P-C4'-P energy: -49.193 tors. eta vs tors. theta energy: -62.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -597.205110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.205110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.955110 (E_RNA) where: Base-Base interactions energy: -357.871 where: short stacking energy: -185.700 Base-Backbone interact. energy: 4.377 local terms energy: -276.461432 where: bonds (distance) C4'-P energy: -72.937 bonds (distance) P-C4' energy: -75.629 flat angles C4'-P-C4' energy: -73.653 flat angles P-C4'-P energy: -29.711 tors. eta vs tors. theta energy: -24.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -459.810646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.810646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.560646 (E_RNA) where: Base-Base interactions energy: -261.872 where: short stacking energy: -149.083 Base-Backbone interact. energy: -1.528 local terms energy: -229.393996 where: bonds (distance) C4'-P energy: -69.633 bonds (distance) P-C4' energy: -67.840 flat angles C4'-P-C4' energy: -51.057 flat angles P-C4'-P energy: -40.390 tors. eta vs tors. theta energy: -0.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.233 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -279.055450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.055450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.805450 (E_RNA) where: Base-Base interactions energy: -92.639 where: short stacking energy: -80.660 Base-Backbone interact. energy: -1.581 local terms energy: -217.585655 where: bonds (distance) C4'-P energy: -66.293 bonds (distance) P-C4' energy: -75.646 flat angles C4'-P-C4' energy: -68.369 flat angles P-C4'-P energy: -31.521 tors. eta vs tors. theta energy: 24.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1308.749793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.749793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1341.499793 (E_RNA) where: Base-Base interactions energy: -919.468 where: short stacking energy: -386.161 Base-Backbone interact. energy: -2.564 local terms energy: -419.468401 where: bonds (distance) C4'-P energy: -79.620 bonds (distance) P-C4' energy: -84.082 flat angles C4'-P-C4' energy: -89.429 flat angles P-C4'-P energy: -50.656 tors. eta vs tors. theta energy: -115.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1223.128202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.128202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.878202 (E_RNA) where: Base-Base interactions energy: -850.750 where: short stacking energy: -359.334 Base-Backbone interact. energy: 1.995 local terms energy: -407.122284 where: bonds (distance) C4'-P energy: -80.190 bonds (distance) P-C4' energy: -86.435 flat angles C4'-P-C4' energy: -86.432 flat angles P-C4'-P energy: -51.028 tors. eta vs tors. theta energy: -103.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1175.877167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.877167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.627167 (E_RNA) where: Base-Base interactions energy: -806.774 where: short stacking energy: -365.108 Base-Backbone interact. energy: 4.822 local terms energy: -406.674971 where: bonds (distance) C4'-P energy: -70.238 bonds (distance) P-C4' energy: -81.781 flat angles C4'-P-C4' energy: -98.322 flat angles P-C4'-P energy: -55.483 tors. eta vs tors. theta energy: -100.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1044.011307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.011307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.761307 (E_RNA) where: Base-Base interactions energy: -711.139 where: short stacking energy: -324.880 Base-Backbone interact. energy: -1.085 local terms energy: -364.536640 where: bonds (distance) C4'-P energy: -85.081 bonds (distance) P-C4' energy: -77.693 flat angles C4'-P-C4' energy: -74.937 flat angles P-C4'-P energy: -41.496 tors. eta vs tors. theta energy: -85.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1014.955587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.955587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.705587 (E_RNA) where: Base-Base interactions energy: -672.866 where: short stacking energy: -327.987 Base-Backbone interact. energy: -2.006 local terms energy: -372.832991 where: bonds (distance) C4'-P energy: -77.894 bonds (distance) P-C4' energy: -86.851 flat angles C4'-P-C4' energy: -78.964 flat angles P-C4'-P energy: -37.079 tors. eta vs tors. theta energy: -92.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -880.139072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.139072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.889072 (E_RNA) where: Base-Base interactions energy: -584.815 where: short stacking energy: -266.641 Base-Backbone interact. energy: 2.586 local terms energy: -330.660350 where: bonds (distance) C4'-P energy: -73.861 bonds (distance) P-C4' energy: -74.546 flat angles C4'-P-C4' energy: -75.279 flat angles P-C4'-P energy: -52.586 tors. eta vs tors. theta energy: -54.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -784.673963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.673963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.423963 (E_RNA) where: Base-Base interactions energy: -492.138 where: short stacking energy: -222.821 Base-Backbone interact. energy: -1.381 local terms energy: -323.905467 where: bonds (distance) C4'-P energy: -65.325 bonds (distance) P-C4' energy: -74.084 flat angles C4'-P-C4' energy: -84.737 flat angles P-C4'-P energy: -43.549 tors. eta vs tors. theta energy: -56.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -588.710119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.710119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.460119 (E_RNA) where: Base-Base interactions energy: -324.915 where: short stacking energy: -159.496 Base-Backbone interact. energy: 0.890 local terms energy: -297.435302 where: bonds (distance) C4'-P energy: -62.621 bonds (distance) P-C4' energy: -86.614 flat angles C4'-P-C4' energy: -70.009 flat angles P-C4'-P energy: -60.951 tors. eta vs tors. theta energy: -17.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -366.699820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.699820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.449820 (E_RNA) where: Base-Base interactions energy: -172.331 where: short stacking energy: -103.246 Base-Backbone interact. energy: 3.345 local terms energy: -230.463380 where: bonds (distance) C4'-P energy: -64.828 bonds (distance) P-C4' energy: -76.818 flat angles C4'-P-C4' energy: -60.281 flat angles P-C4'-P energy: -37.253 tors. eta vs tors. theta energy: 8.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -313.198310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.198310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.948310 (E_RNA) where: Base-Base interactions energy: -134.579 where: short stacking energy: -123.524 Base-Backbone interact. energy: -0.559 local terms energy: -210.810866 where: bonds (distance) C4'-P energy: -58.241 bonds (distance) P-C4' energy: -60.896 flat angles C4'-P-C4' energy: -43.996 flat angles P-C4'-P energy: -50.539 tors. eta vs tors. theta energy: 2.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1298.780582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.780582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.530582 (E_RNA) where: Base-Base interactions energy: -921.263 where: short stacking energy: -375.899 Base-Backbone interact. energy: -4.441 local terms energy: -405.826281 where: bonds (distance) C4'-P energy: -79.140 bonds (distance) P-C4' energy: -83.106 flat angles C4'-P-C4' energy: -86.156 flat angles P-C4'-P energy: -60.834 tors. eta vs tors. theta energy: -96.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1211.525375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.525375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.275375 (E_RNA) where: Base-Base interactions energy: -841.742 where: short stacking energy: -374.546 Base-Backbone interact. energy: -0.634 local terms energy: -401.899507 where: bonds (distance) C4'-P energy: -65.975 bonds (distance) P-C4' energy: -80.009 flat angles C4'-P-C4' energy: -89.706 flat angles P-C4'-P energy: -63.907 tors. eta vs tors. theta energy: -102.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1157.817502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.817502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.567502 (E_RNA) where: Base-Base interactions energy: -787.124 where: short stacking energy: -341.380 Base-Backbone interact. energy: -2.463 local terms energy: -400.980243 where: bonds (distance) C4'-P energy: -81.341 bonds (distance) P-C4' energy: -79.456 flat angles C4'-P-C4' energy: -82.239 flat angles P-C4'-P energy: -65.035 tors. eta vs tors. theta energy: -92.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1033.530050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.530050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.280050 (E_RNA) where: Base-Base interactions energy: -690.534 where: short stacking energy: -309.078 Base-Backbone interact. energy: -1.546 local terms energy: -374.199728 where: bonds (distance) C4'-P energy: -74.538 bonds (distance) P-C4' energy: -69.021 flat angles C4'-P-C4' energy: -93.234 flat angles P-C4'-P energy: -58.207 tors. eta vs tors. theta energy: -79.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -981.749329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.749329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.499329 (E_RNA) where: Base-Base interactions energy: -653.910 where: short stacking energy: -280.195 Base-Backbone interact. energy: 0.368 local terms energy: -360.957180 where: bonds (distance) C4'-P energy: -75.785 bonds (distance) P-C4' energy: -79.740 flat angles C4'-P-C4' energy: -67.824 flat angles P-C4'-P energy: -63.660 tors. eta vs tors. theta energy: -73.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -914.232104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.232104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.982104 (E_RNA) where: Base-Base interactions energy: -607.175 where: short stacking energy: -276.560 Base-Backbone interact. energy: 2.042 local terms energy: -341.849240 where: bonds (distance) C4'-P energy: -75.053 bonds (distance) P-C4' energy: -72.874 flat angles C4'-P-C4' energy: -70.572 flat angles P-C4'-P energy: -49.876 tors. eta vs tors. theta energy: -73.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -772.856296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.856296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -805.606296 (E_RNA) where: Base-Base interactions energy: -489.787 where: short stacking energy: -253.004 Base-Backbone interact. energy: 0.125 local terms energy: -315.944511 where: bonds (distance) C4'-P energy: -71.905 bonds (distance) P-C4' energy: -79.441 flat angles C4'-P-C4' energy: -70.572 flat angles P-C4'-P energy: -43.772 tors. eta vs tors. theta energy: -50.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -612.910646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.910646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.660646 (E_RNA) where: Base-Base interactions energy: -382.998 where: short stacking energy: -180.741 Base-Backbone interact. energy: -2.303 local terms energy: -260.360263 where: bonds (distance) C4'-P energy: -73.202 bonds (distance) P-C4' energy: -67.188 flat angles C4'-P-C4' energy: -70.429 flat angles P-C4'-P energy: -39.655 tors. eta vs tors. theta energy: -9.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -334.453799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.453799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.203799 (E_RNA) where: Base-Base interactions energy: -140.756 where: short stacking energy: -70.652 Base-Backbone interact. energy: -1.704 local terms energy: -224.813302 where: bonds (distance) C4'-P energy: -56.836 bonds (distance) P-C4' energy: -77.420 flat angles C4'-P-C4' energy: -54.660 flat angles P-C4'-P energy: -56.690 tors. eta vs tors. theta energy: 20.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.069 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -322.426826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -322.426826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.176826 (E_RNA) where: Base-Base interactions energy: -135.337 where: short stacking energy: -111.509 Base-Backbone interact. energy: 5.148 local terms energy: -224.987379 where: bonds (distance) C4'-P energy: -65.455 bonds (distance) P-C4' energy: -72.754 flat angles C4'-P-C4' energy: -58.423 flat angles P-C4'-P energy: -28.687 tors. eta vs tors. theta energy: 0.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1315.566865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.566865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.316865 (E_RNA) where: Base-Base interactions energy: -924.119 where: short stacking energy: -385.237 Base-Backbone interact. energy: -1.760 local terms energy: -422.438538 where: bonds (distance) C4'-P energy: -71.479 bonds (distance) P-C4' energy: -88.844 flat angles C4'-P-C4' energy: -100.206 flat angles P-C4'-P energy: -56.598 tors. eta vs tors. theta energy: -105.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1196.425329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.425329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.175329 (E_RNA) where: Base-Base interactions energy: -810.304 where: short stacking energy: -370.118 Base-Backbone interact. energy: -1.736 local terms energy: -417.135125 where: bonds (distance) C4'-P energy: -78.913 bonds (distance) P-C4' energy: -88.318 flat angles C4'-P-C4' energy: -88.520 flat angles P-C4'-P energy: -50.485 tors. eta vs tors. theta energy: -110.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1201.427242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.427242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.177242 (E_RNA) where: Base-Base interactions energy: -835.947 where: short stacking energy: -333.842 Base-Backbone interact. energy: -3.431 local terms energy: -394.799164 where: bonds (distance) C4'-P energy: -73.780 bonds (distance) P-C4' energy: -80.325 flat angles C4'-P-C4' energy: -91.565 flat angles P-C4'-P energy: -55.403 tors. eta vs tors. theta energy: -93.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1064.158575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.158575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.908575 (E_RNA) where: Base-Base interactions energy: -706.276 where: short stacking energy: -313.664 Base-Backbone interact. energy: -1.584 local terms energy: -389.048783 where: bonds (distance) C4'-P energy: -81.211 bonds (distance) P-C4' energy: -86.802 flat angles C4'-P-C4' energy: -83.958 flat angles P-C4'-P energy: -52.217 tors. eta vs tors. theta energy: -84.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -980.049907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.049907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.799907 (E_RNA) where: Base-Base interactions energy: -684.179 where: short stacking energy: -308.894 Base-Backbone interact. energy: -2.004 local terms energy: -326.616992 where: bonds (distance) C4'-P energy: -63.035 bonds (distance) P-C4' energy: -72.819 flat angles C4'-P-C4' energy: -80.493 flat angles P-C4'-P energy: -46.739 tors. eta vs tors. theta energy: -63.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -889.411625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.411625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.161625 (E_RNA) where: Base-Base interactions energy: -576.584 where: short stacking energy: -257.569 Base-Backbone interact. energy: -0.336 local terms energy: -345.241447 where: bonds (distance) C4'-P energy: -73.065 bonds (distance) P-C4' energy: -70.059 flat angles C4'-P-C4' energy: -79.743 flat angles P-C4'-P energy: -56.233 tors. eta vs tors. theta energy: -66.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -771.820059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.820059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.570059 (E_RNA) where: Base-Base interactions energy: -486.995 where: short stacking energy: -243.572 Base-Backbone interact. energy: -1.172 local terms energy: -316.403292 where: bonds (distance) C4'-P energy: -64.786 bonds (distance) P-C4' energy: -70.775 flat angles C4'-P-C4' energy: -73.376 flat angles P-C4'-P energy: -52.723 tors. eta vs tors. theta energy: -54.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -609.031373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.031373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -641.781373 (E_RNA) where: Base-Base interactions energy: -363.927 where: short stacking energy: -176.420 Base-Backbone interact. energy: -3.005 local terms energy: -274.849141 where: bonds (distance) C4'-P energy: -73.375 bonds (distance) P-C4' energy: -77.227 flat angles C4'-P-C4' energy: -65.905 flat angles P-C4'-P energy: -33.613 tors. eta vs tors. theta energy: -24.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -397.762083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.762083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.512083 (E_RNA) where: Base-Base interactions energy: -176.930 where: short stacking energy: -118.540 Base-Backbone interact. energy: -2.474 local terms energy: -251.107745 where: bonds (distance) C4'-P energy: -67.560 bonds (distance) P-C4' energy: -65.101 flat angles C4'-P-C4' energy: -70.206 flat angles P-C4'-P energy: -48.886 tors. eta vs tors. theta energy: 0.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -326.551840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.551840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.301840 (E_RNA) where: Base-Base interactions energy: -139.464 where: short stacking energy: -105.643 Base-Backbone interact. energy: 0.947 local terms energy: -220.784386 where: bonds (distance) C4'-P energy: -70.258 bonds (distance) P-C4' energy: -62.226 flat angles C4'-P-C4' energy: -68.267 flat angles P-C4'-P energy: -31.298 tors. eta vs tors. theta energy: 11.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1302.532367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.532367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.282367 (E_RNA) where: Base-Base interactions energy: -906.646 where: short stacking energy: -396.403 Base-Backbone interact. energy: -0.984 local terms energy: -427.651685 where: bonds (distance) C4'-P energy: -75.768 bonds (distance) P-C4' energy: -80.260 flat angles C4'-P-C4' energy: -96.903 flat angles P-C4'-P energy: -68.357 tors. eta vs tors. theta energy: -106.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1199.003840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.003840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.753840 (E_RNA) where: Base-Base interactions energy: -797.612 where: short stacking energy: -378.436 Base-Backbone interact. energy: 0.430 local terms energy: -434.571409 where: bonds (distance) C4'-P energy: -86.908 bonds (distance) P-C4' energy: -90.792 flat angles C4'-P-C4' energy: -89.291 flat angles P-C4'-P energy: -60.774 tors. eta vs tors. theta energy: -106.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1177.454110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.454110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.204110 (E_RNA) where: Base-Base interactions energy: -815.853 where: short stacking energy: -336.311 Base-Backbone interact. energy: -2.072 local terms energy: -392.279395 where: bonds (distance) C4'-P energy: -70.568 bonds (distance) P-C4' energy: -83.546 flat angles C4'-P-C4' energy: -91.059 flat angles P-C4'-P energy: -47.843 tors. eta vs tors. theta energy: -99.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1089.072549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.072549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.822549 (E_RNA) where: Base-Base interactions energy: -742.661 where: short stacking energy: -348.321 Base-Backbone interact. energy: -0.329 local terms energy: -378.832762 where: bonds (distance) C4'-P energy: -74.401 bonds (distance) P-C4' energy: -76.897 flat angles C4'-P-C4' energy: -80.575 flat angles P-C4'-P energy: -58.112 tors. eta vs tors. theta energy: -88.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -977.688900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.688900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.438900 (E_RNA) where: Base-Base interactions energy: -657.916 where: short stacking energy: -300.769 Base-Backbone interact. energy: -1.226 local terms energy: -351.296892 where: bonds (distance) C4'-P energy: -76.636 bonds (distance) P-C4' energy: -81.072 flat angles C4'-P-C4' energy: -67.794 flat angles P-C4'-P energy: -48.417 tors. eta vs tors. theta energy: -77.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -942.963429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.963429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.713429 (E_RNA) where: Base-Base interactions energy: -627.929 where: short stacking energy: -298.570 Base-Backbone interact. energy: 0.027 local terms energy: -347.810565 where: bonds (distance) C4'-P energy: -68.328 bonds (distance) P-C4' energy: -77.627 flat angles C4'-P-C4' energy: -76.212 flat angles P-C4'-P energy: -55.096 tors. eta vs tors. theta energy: -70.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -747.300096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.300096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.050096 (E_RNA) where: Base-Base interactions energy: -464.469 where: short stacking energy: -225.355 Base-Backbone interact. energy: -1.016 local terms energy: -314.688959 where: bonds (distance) C4'-P energy: -61.580 bonds (distance) P-C4' energy: -79.869 flat angles C4'-P-C4' energy: -81.077 flat angles P-C4'-P energy: -47.512 tors. eta vs tors. theta energy: -44.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.124 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -653.561666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.561666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.311666 (E_RNA) where: Base-Base interactions energy: -404.090 where: short stacking energy: -192.568 Base-Backbone interact. energy: -1.823 local terms energy: -280.399357 where: bonds (distance) C4'-P energy: -73.314 bonds (distance) P-C4' energy: -73.030 flat angles C4'-P-C4' energy: -63.519 flat angles P-C4'-P energy: -43.146 tors. eta vs tors. theta energy: -27.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -414.961581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.961581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.711581 (E_RNA) where: Base-Base interactions energy: -206.728 where: short stacking energy: -154.253 Base-Backbone interact. energy: -1.119 local terms energy: -239.864511 where: bonds (distance) C4'-P energy: -60.665 bonds (distance) P-C4' energy: -69.178 flat angles C4'-P-C4' energy: -59.833 flat angles P-C4'-P energy: -44.400 tors. eta vs tors. theta energy: -5.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -305.723743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.723743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.473743 (E_RNA) where: Base-Base interactions energy: -152.058 where: short stacking energy: -114.053 Base-Backbone interact. energy: -0.895 local terms energy: -185.520554 where: bonds (distance) C4'-P energy: -41.984 bonds (distance) P-C4' energy: -75.041 flat angles C4'-P-C4' energy: -47.765 flat angles P-C4'-P energy: -35.237 tors. eta vs tors. theta energy: 14.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1300.239453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.239453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.989453 (E_RNA) where: Base-Base interactions energy: -912.890 where: short stacking energy: -397.788 Base-Backbone interact. energy: -2.048 local terms energy: -418.050765 where: bonds (distance) C4'-P energy: -83.277 bonds (distance) P-C4' energy: -78.436 flat angles C4'-P-C4' energy: -84.288 flat angles P-C4'-P energy: -59.630 tors. eta vs tors. theta energy: -112.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1192.057727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.057727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.807727 (E_RNA) where: Base-Base interactions energy: -786.998 where: short stacking energy: -359.620 Base-Backbone interact. energy: -1.364 local terms energy: -436.445234 where: bonds (distance) C4'-P energy: -86.949 bonds (distance) P-C4' energy: -90.894 flat angles C4'-P-C4' energy: -95.699 flat angles P-C4'-P energy: -69.513 tors. eta vs tors. theta energy: -93.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1181.772016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.772016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.522016 (E_RNA) where: Base-Base interactions energy: -806.700 where: short stacking energy: -347.722 Base-Backbone interact. energy: -0.003 local terms energy: -407.819023 where: bonds (distance) C4'-P energy: -74.368 bonds (distance) P-C4' energy: -83.125 flat angles C4'-P-C4' energy: -93.086 flat angles P-C4'-P energy: -54.097 tors. eta vs tors. theta energy: -103.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1063.624339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.624339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.374339 (E_RNA) where: Base-Base interactions energy: -732.556 where: short stacking energy: -330.519 Base-Backbone interact. energy: -1.885 local terms energy: -361.932573 where: bonds (distance) C4'-P energy: -68.873 bonds (distance) P-C4' energy: -69.699 flat angles C4'-P-C4' energy: -89.932 flat angles P-C4'-P energy: -51.866 tors. eta vs tors. theta energy: -81.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -966.882305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.882305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.632305 (E_RNA) where: Base-Base interactions energy: -644.620 where: short stacking energy: -285.573 Base-Backbone interact. energy: -0.997 local terms energy: -354.014929 where: bonds (distance) C4'-P energy: -69.058 bonds (distance) P-C4' energy: -75.875 flat angles C4'-P-C4' energy: -76.218 flat angles P-C4'-P energy: -50.225 tors. eta vs tors. theta energy: -82.639 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -902.455077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.455077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.205077 (E_RNA) where: Base-Base interactions energy: -632.917 where: short stacking energy: -289.813 Base-Backbone interact. energy: -0.830 local terms energy: -301.458255 where: bonds (distance) C4'-P energy: -62.839 bonds (distance) P-C4' energy: -73.525 flat angles C4'-P-C4' energy: -61.344 flat angles P-C4'-P energy: -41.655 tors. eta vs tors. theta energy: -62.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -714.447763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.447763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.197763 (E_RNA) where: Base-Base interactions energy: -450.181 where: short stacking energy: -208.670 Base-Backbone interact. energy: 2.110 local terms energy: -299.127022 where: bonds (distance) C4'-P energy: -72.729 bonds (distance) P-C4' energy: -74.688 flat angles C4'-P-C4' energy: -71.814 flat angles P-C4'-P energy: -41.187 tors. eta vs tors. theta energy: -38.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -628.688045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -628.688045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.438045 (E_RNA) where: Base-Base interactions energy: -362.540 where: short stacking energy: -185.966 Base-Backbone interact. energy: -0.023 local terms energy: -298.874893 where: bonds (distance) C4'-P energy: -63.383 bonds (distance) P-C4' energy: -77.916 flat angles C4'-P-C4' energy: -64.880 flat angles P-C4'-P energy: -54.286 tors. eta vs tors. theta energy: -38.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -365.281470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.281470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.031470 (E_RNA) where: Base-Base interactions energy: -169.890 where: short stacking energy: -99.810 Base-Backbone interact. energy: 0.624 local terms energy: -228.766223 where: bonds (distance) C4'-P energy: -62.857 bonds (distance) P-C4' energy: -68.022 flat angles C4'-P-C4' energy: -63.083 flat angles P-C4'-P energy: -34.340 tors. eta vs tors. theta energy: -0.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -340.193732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.193732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.943732 (E_RNA) where: Base-Base interactions energy: -132.385 where: short stacking energy: -119.050 Base-Backbone interact. energy: 0.064 local terms energy: -240.622911 where: bonds (distance) C4'-P energy: -66.424 bonds (distance) P-C4' energy: -75.308 flat angles C4'-P-C4' energy: -47.818 flat angles P-C4'-P energy: -41.437 tors. eta vs tors. theta energy: -9.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1321.553003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.553003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.303003 (E_RNA) where: Base-Base interactions energy: -927.708 where: short stacking energy: -390.760 Base-Backbone interact. energy: -0.412 local terms energy: -426.182283 where: bonds (distance) C4'-P energy: -70.305 bonds (distance) P-C4' energy: -91.734 flat angles C4'-P-C4' energy: -88.665 flat angles P-C4'-P energy: -66.180 tors. eta vs tors. theta energy: -109.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1184.513270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.513270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.263270 (E_RNA) where: Base-Base interactions energy: -810.033 where: short stacking energy: -360.294 Base-Backbone interact. energy: -0.547 local terms energy: -406.683582 where: bonds (distance) C4'-P energy: -80.667 bonds (distance) P-C4' energy: -89.271 flat angles C4'-P-C4' energy: -91.376 flat angles P-C4'-P energy: -55.976 tors. eta vs tors. theta energy: -89.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1160.535929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.535929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.285929 (E_RNA) where: Base-Base interactions energy: -788.288 where: short stacking energy: -360.723 Base-Backbone interact. energy: -1.915 local terms energy: -403.082275 where: bonds (distance) C4'-P energy: -66.695 bonds (distance) P-C4' energy: -82.448 flat angles C4'-P-C4' energy: -92.927 flat angles P-C4'-P energy: -48.902 tors. eta vs tors. theta energy: -112.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1034.751886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.751886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.501886 (E_RNA) where: Base-Base interactions energy: -713.487 where: short stacking energy: -322.429 Base-Backbone interact. energy: -0.890 local terms energy: -353.124854 where: bonds (distance) C4'-P energy: -67.242 bonds (distance) P-C4' energy: -82.976 flat angles C4'-P-C4' energy: -81.858 flat angles P-C4'-P energy: -45.656 tors. eta vs tors. theta energy: -75.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -963.919441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.919441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.669441 (E_RNA) where: Base-Base interactions energy: -630.439 where: short stacking energy: -301.378 Base-Backbone interact. energy: -1.804 local terms energy: -364.426148 where: bonds (distance) C4'-P energy: -69.181 bonds (distance) P-C4' energy: -74.060 flat angles C4'-P-C4' energy: -89.380 flat angles P-C4'-P energy: -54.321 tors. eta vs tors. theta energy: -77.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -904.354117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.354117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.104117 (E_RNA) where: Base-Base interactions energy: -609.624 where: short stacking energy: -290.278 Base-Backbone interact. energy: 9.779 local terms energy: -337.259832 where: bonds (distance) C4'-P energy: -78.681 bonds (distance) P-C4' energy: -63.200 flat angles C4'-P-C4' energy: -78.064 flat angles P-C4'-P energy: -56.831 tors. eta vs tors. theta energy: -60.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -775.676112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.676112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.426112 (E_RNA) where: Base-Base interactions energy: -506.696 where: short stacking energy: -236.643 Base-Backbone interact. energy: 2.832 local terms energy: -304.561536 where: bonds (distance) C4'-P energy: -79.855 bonds (distance) P-C4' energy: -66.051 flat angles C4'-P-C4' energy: -73.591 flat angles P-C4'-P energy: -38.068 tors. eta vs tors. theta energy: -46.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -648.906136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.906136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.656136 (E_RNA) where: Base-Base interactions energy: -402.389 where: short stacking energy: -189.800 Base-Backbone interact. energy: -1.189 local terms energy: -278.078006 where: bonds (distance) C4'-P energy: -49.560 bonds (distance) P-C4' energy: -75.185 flat angles C4'-P-C4' energy: -77.494 flat angles P-C4'-P energy: -53.811 tors. eta vs tors. theta energy: -22.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -404.456831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.456831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.206831 (E_RNA) where: Base-Base interactions energy: -192.618 where: short stacking energy: -146.995 Base-Backbone interact. energy: -1.532 local terms energy: -243.056887 where: bonds (distance) C4'-P energy: -63.240 bonds (distance) P-C4' energy: -70.547 flat angles C4'-P-C4' energy: -69.840 flat angles P-C4'-P energy: -36.899 tors. eta vs tors. theta energy: -2.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -313.196866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.196866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.946866 (E_RNA) where: Base-Base interactions energy: -111.979 where: short stacking energy: -94.571 Base-Backbone interact. energy: 0.215 local terms energy: -234.182606 where: bonds (distance) C4'-P energy: -73.168 bonds (distance) P-C4' energy: -60.759 flat angles C4'-P-C4' energy: -64.539 flat angles P-C4'-P energy: -35.533 tors. eta vs tors. theta energy: -0.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1319.569567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.569567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.319567 (E_RNA) where: Base-Base interactions energy: -923.058 where: short stacking energy: -385.889 Base-Backbone interact. energy: -2.050 local terms energy: -427.211833 where: bonds (distance) C4'-P energy: -74.349 bonds (distance) P-C4' energy: -90.907 flat angles C4'-P-C4' energy: -94.175 flat angles P-C4'-P energy: -59.332 tors. eta vs tors. theta energy: -108.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1210.755101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.755101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.505101 (E_RNA) where: Base-Base interactions energy: -843.262 where: short stacking energy: -353.905 Base-Backbone interact. energy: -2.166 local terms energy: -398.077340 where: bonds (distance) C4'-P energy: -66.148 bonds (distance) P-C4' energy: -77.879 flat angles C4'-P-C4' energy: -86.070 flat angles P-C4'-P energy: -69.518 tors. eta vs tors. theta energy: -98.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1177.392739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.392739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.142739 (E_RNA) where: Base-Base interactions energy: -810.068 where: short stacking energy: -364.312 Base-Backbone interact. energy: 2.225 local terms energy: -402.299595 where: bonds (distance) C4'-P energy: -62.911 bonds (distance) P-C4' energy: -79.222 flat angles C4'-P-C4' energy: -96.345 flat angles P-C4'-P energy: -53.590 tors. eta vs tors. theta energy: -110.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1071.775757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.775757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.525757 (E_RNA) where: Base-Base interactions energy: -701.239 where: short stacking energy: -324.947 Base-Backbone interact. energy: -0.478 local terms energy: -402.809292 where: bonds (distance) C4'-P energy: -69.232 bonds (distance) P-C4' energy: -84.669 flat angles C4'-P-C4' energy: -92.299 flat angles P-C4'-P energy: -66.972 tors. eta vs tors. theta energy: -89.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -974.840322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.840322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.590322 (E_RNA) where: Base-Base interactions energy: -662.005 where: short stacking energy: -317.722 Base-Backbone interact. energy: 3.458 local terms energy: -349.043659 where: bonds (distance) C4'-P energy: -80.778 bonds (distance) P-C4' energy: -54.970 flat angles C4'-P-C4' energy: -85.092 flat angles P-C4'-P energy: -37.241 tors. eta vs tors. theta energy: -90.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -924.306541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -924.306541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.056541 (E_RNA) where: Base-Base interactions energy: -626.486 where: short stacking energy: -267.289 Base-Backbone interact. energy: 1.369 local terms energy: -331.939995 where: bonds (distance) C4'-P energy: -73.327 bonds (distance) P-C4' energy: -80.048 flat angles C4'-P-C4' energy: -74.369 flat angles P-C4'-P energy: -42.245 tors. eta vs tors. theta energy: -61.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -713.801380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.801380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.551380 (E_RNA) where: Base-Base interactions energy: -439.833 where: short stacking energy: -198.809 Base-Backbone interact. energy: 0.056 local terms energy: -306.774627 where: bonds (distance) C4'-P energy: -57.388 bonds (distance) P-C4' energy: -79.655 flat angles C4'-P-C4' energy: -66.423 flat angles P-C4'-P energy: -56.299 tors. eta vs tors. theta energy: -47.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -661.604066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.604066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.354066 (E_RNA) where: Base-Base interactions energy: -440.997 where: short stacking energy: -197.062 Base-Backbone interact. energy: 0.646 local terms energy: -254.003366 where: bonds (distance) C4'-P energy: -61.014 bonds (distance) P-C4' energy: -67.909 flat angles C4'-P-C4' energy: -68.819 flat angles P-C4'-P energy: -28.763 tors. eta vs tors. theta energy: -27.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -421.213193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.213193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.963193 (E_RNA) where: Base-Base interactions energy: -217.962 where: short stacking energy: -143.565 Base-Backbone interact. energy: 2.577 local terms energy: -239.347042 where: bonds (distance) C4'-P energy: -71.980 bonds (distance) P-C4' energy: -58.541 flat angles C4'-P-C4' energy: -56.953 flat angles P-C4'-P energy: -49.409 tors. eta vs tors. theta energy: -2.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.769 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -306.438309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.438309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.188309 (E_RNA) where: Base-Base interactions energy: -107.667 where: short stacking energy: -70.358 Base-Backbone interact. energy: -0.063 local terms energy: -231.458582 where: bonds (distance) C4'-P energy: -53.762 bonds (distance) P-C4' energy: -83.432 flat angles C4'-P-C4' energy: -71.741 flat angles P-C4'-P energy: -35.856 tors. eta vs tors. theta energy: 13.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1331.079375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.079375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.829375 (E_RNA) where: Base-Base interactions energy: -923.581 where: short stacking energy: -381.831 Base-Backbone interact. energy: -2.266 local terms energy: -437.982053 where: bonds (distance) C4'-P energy: -83.421 bonds (distance) P-C4' energy: -86.517 flat angles C4'-P-C4' energy: -91.354 flat angles P-C4'-P energy: -71.129 tors. eta vs tors. theta energy: -105.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1190.023265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.023265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.773265 (E_RNA) where: Base-Base interactions energy: -829.151 where: short stacking energy: -363.155 Base-Backbone interact. energy: -2.476 local terms energy: -391.145619 where: bonds (distance) C4'-P energy: -66.952 bonds (distance) P-C4' energy: -82.469 flat angles C4'-P-C4' energy: -84.841 flat angles P-C4'-P energy: -63.365 tors. eta vs tors. theta energy: -93.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1204.806341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.806341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.556341 (E_RNA) where: Base-Base interactions energy: -850.992 where: short stacking energy: -369.800 Base-Backbone interact. energy: -1.594 local terms energy: -384.970089 where: bonds (distance) C4'-P energy: -72.677 bonds (distance) P-C4' energy: -91.933 flat angles C4'-P-C4' energy: -80.497 flat angles P-C4'-P energy: -42.044 tors. eta vs tors. theta energy: -97.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1041.490902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.490902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.240902 (E_RNA) where: Base-Base interactions energy: -691.199 where: short stacking energy: -315.138 Base-Backbone interact. energy: 0.571 local terms energy: -383.612926 where: bonds (distance) C4'-P energy: -77.755 bonds (distance) P-C4' energy: -86.351 flat angles C4'-P-C4' energy: -79.045 flat angles P-C4'-P energy: -51.846 tors. eta vs tors. theta energy: -88.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -972.682911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.682911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.432911 (E_RNA) where: Base-Base interactions energy: -669.719 where: short stacking energy: -305.304 Base-Backbone interact. energy: -1.479 local terms energy: -334.235281 where: bonds (distance) C4'-P energy: -59.287 bonds (distance) P-C4' energy: -73.529 flat angles C4'-P-C4' energy: -80.924 flat angles P-C4'-P energy: -49.630 tors. eta vs tors. theta energy: -70.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -860.457030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.457030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.207030 (E_RNA) where: Base-Base interactions energy: -573.616 where: short stacking energy: -249.725 Base-Backbone interact. energy: -1.589 local terms energy: -318.002190 where: bonds (distance) C4'-P energy: -66.587 bonds (distance) P-C4' energy: -75.447 flat angles C4'-P-C4' energy: -81.259 flat angles P-C4'-P energy: -46.934 tors. eta vs tors. theta energy: -47.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -717.227618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.227618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.977618 (E_RNA) where: Base-Base interactions energy: -449.094 where: short stacking energy: -224.339 Base-Backbone interact. energy: -1.141 local terms energy: -299.741995 where: bonds (distance) C4'-P energy: -62.497 bonds (distance) P-C4' energy: -68.194 flat angles C4'-P-C4' energy: -79.398 flat angles P-C4'-P energy: -53.023 tors. eta vs tors. theta energy: -36.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -705.570680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.570680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.320680 (E_RNA) where: Base-Base interactions energy: -449.836 where: short stacking energy: -226.261 Base-Backbone interact. energy: -0.693 local terms energy: -287.791670 where: bonds (distance) C4'-P energy: -75.038 bonds (distance) P-C4' energy: -67.585 flat angles C4'-P-C4' energy: -65.357 flat angles P-C4'-P energy: -42.350 tors. eta vs tors. theta energy: -37.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -343.244077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.244077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.994077 (E_RNA) where: Base-Base interactions energy: -164.626 where: short stacking energy: -116.716 Base-Backbone interact. energy: -0.186 local terms energy: -211.181624 where: bonds (distance) C4'-P energy: -74.085 bonds (distance) P-C4' energy: -68.149 flat angles C4'-P-C4' energy: -43.257 flat angles P-C4'-P energy: -31.123 tors. eta vs tors. theta energy: 5.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -312.517440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.517440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.267440 (E_RNA) where: Base-Base interactions energy: -124.758 where: short stacking energy: -91.839 Base-Backbone interact. energy: -0.570 local terms energy: -219.940366 where: bonds (distance) C4'-P energy: -71.107 bonds (distance) P-C4' energy: -65.584 flat angles C4'-P-C4' energy: -52.112 flat angles P-C4'-P energy: -44.010 tors. eta vs tors. theta energy: 12.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1331.080759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.080759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.830759 (E_RNA) where: Base-Base interactions energy: -938.646 where: short stacking energy: -395.550 Base-Backbone interact. energy: -2.602 local terms energy: -422.582555 where: bonds (distance) C4'-P energy: -81.146 bonds (distance) P-C4' energy: -84.726 flat angles C4'-P-C4' energy: -87.640 flat angles P-C4'-P energy: -57.831 tors. eta vs tors. theta energy: -111.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1251.153042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.153042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.903042 (E_RNA) where: Base-Base interactions energy: -846.109 where: short stacking energy: -371.625 Base-Backbone interact. energy: -2.901 local terms energy: -434.966213 where: bonds (distance) C4'-P energy: -82.316 bonds (distance) P-C4' energy: -89.976 flat angles C4'-P-C4' energy: -90.449 flat angles P-C4'-P energy: -63.524 tors. eta vs tors. theta energy: -108.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.073 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1181.203640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.203640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.953640 (E_RNA) where: Base-Base interactions energy: -799.479 where: short stacking energy: -337.507 Base-Backbone interact. energy: -2.234 local terms energy: -412.240592 where: bonds (distance) C4'-P energy: -77.155 bonds (distance) P-C4' energy: -89.413 flat angles C4'-P-C4' energy: -78.145 flat angles P-C4'-P energy: -69.210 tors. eta vs tors. theta energy: -98.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1078.167864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.167864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.917864 (E_RNA) where: Base-Base interactions energy: -730.251 where: short stacking energy: -347.432 Base-Backbone interact. energy: -0.421 local terms energy: -380.245751 where: bonds (distance) C4'-P energy: -76.397 bonds (distance) P-C4' energy: -72.766 flat angles C4'-P-C4' energy: -81.793 flat angles P-C4'-P energy: -63.286 tors. eta vs tors. theta energy: -86.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -922.473734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.473734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.223734 (E_RNA) where: Base-Base interactions energy: -622.041 where: short stacking energy: -277.506 Base-Backbone interact. energy: -2.883 local terms energy: -330.299911 where: bonds (distance) C4'-P energy: -70.703 bonds (distance) P-C4' energy: -78.937 flat angles C4'-P-C4' energy: -69.743 flat angles P-C4'-P energy: -49.989 tors. eta vs tors. theta energy: -60.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -834.508134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.508134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.258134 (E_RNA) where: Base-Base interactions energy: -551.105 where: short stacking energy: -244.465 Base-Backbone interact. energy: -0.288 local terms energy: -315.865593 where: bonds (distance) C4'-P energy: -65.645 bonds (distance) P-C4' energy: -74.196 flat angles C4'-P-C4' energy: -77.020 flat angles P-C4'-P energy: -52.345 tors. eta vs tors. theta energy: -46.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -710.612538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.612538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.362538 (E_RNA) where: Base-Base interactions energy: -456.253 where: short stacking energy: -219.837 Base-Backbone interact. energy: -0.228 local terms energy: -286.882320 where: bonds (distance) C4'-P energy: -68.403 bonds (distance) P-C4' energy: -59.580 flat angles C4'-P-C4' energy: -74.388 flat angles P-C4'-P energy: -53.102 tors. eta vs tors. theta energy: -31.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -755.564803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.564803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.314803 (E_RNA) where: Base-Base interactions energy: -469.051 where: short stacking energy: -218.069 Base-Backbone interact. energy: -0.665 local terms energy: -318.599098 where: bonds (distance) C4'-P energy: -75.278 bonds (distance) P-C4' energy: -72.776 flat angles C4'-P-C4' energy: -78.846 flat angles P-C4'-P energy: -54.823 tors. eta vs tors. theta energy: -36.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -398.444773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.444773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.194773 (E_RNA) where: Base-Base interactions energy: -203.960 where: short stacking energy: -123.176 Base-Backbone interact. energy: 1.427 local terms energy: -228.662415 where: bonds (distance) C4'-P energy: -65.696 bonds (distance) P-C4' energy: -71.793 flat angles C4'-P-C4' energy: -60.122 flat angles P-C4'-P energy: -22.142 tors. eta vs tors. theta energy: -8.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -317.454532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.454532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.204532 (E_RNA) where: Base-Base interactions energy: -139.683 where: short stacking energy: -105.849 Base-Backbone interact. energy: 0.214 local terms energy: -210.735587 where: bonds (distance) C4'-P energy: -59.637 bonds (distance) P-C4' energy: -73.107 flat angles C4'-P-C4' energy: -71.083 flat angles P-C4'-P energy: -15.481 tors. eta vs tors. theta energy: 8.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1329.120885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.120885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.870885 (E_RNA) where: Base-Base interactions energy: -922.103 where: short stacking energy: -388.567 Base-Backbone interact. energy: -1.844 local terms energy: -437.923774 where: bonds (distance) C4'-P energy: -86.933 bonds (distance) P-C4' energy: -86.311 flat angles C4'-P-C4' energy: -95.252 flat angles P-C4'-P energy: -59.937 tors. eta vs tors. theta energy: -109.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1225.083893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.083893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.833893 (E_RNA) where: Base-Base interactions energy: -823.196 where: short stacking energy: -345.396 Base-Backbone interact. energy: -2.270 local terms energy: -432.368400 where: bonds (distance) C4'-P energy: -84.250 bonds (distance) P-C4' energy: -79.497 flat angles C4'-P-C4' energy: -90.233 flat angles P-C4'-P energy: -75.249 tors. eta vs tors. theta energy: -103.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1164.628693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.628693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.378693 (E_RNA) where: Base-Base interactions energy: -799.836 where: short stacking energy: -333.768 Base-Backbone interact. energy: -1.066 local terms energy: -396.477261 where: bonds (distance) C4'-P energy: -81.126 bonds (distance) P-C4' energy: -80.560 flat angles C4'-P-C4' energy: -93.170 flat angles P-C4'-P energy: -44.342 tors. eta vs tors. theta energy: -97.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1064.016438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.016438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.766438 (E_RNA) where: Base-Base interactions energy: -719.802 where: short stacking energy: -334.083 Base-Backbone interact. energy: -0.756 local terms energy: -376.208241 where: bonds (distance) C4'-P energy: -72.908 bonds (distance) P-C4' energy: -74.742 flat angles C4'-P-C4' energy: -89.257 flat angles P-C4'-P energy: -56.186 tors. eta vs tors. theta energy: -83.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -884.971505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.971505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.721505 (E_RNA) where: Base-Base interactions energy: -589.349 where: short stacking energy: -273.779 Base-Backbone interact. energy: 0.421 local terms energy: -328.793268 where: bonds (distance) C4'-P energy: -74.917 bonds (distance) P-C4' energy: -78.900 flat angles C4'-P-C4' energy: -79.069 flat angles P-C4'-P energy: -36.935 tors. eta vs tors. theta energy: -58.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -857.104958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.104958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.854958 (E_RNA) where: Base-Base interactions energy: -538.498 where: short stacking energy: -262.657 Base-Backbone interact. energy: -0.777 local terms energy: -350.580244 where: bonds (distance) C4'-P energy: -73.987 bonds (distance) P-C4' energy: -79.530 flat angles C4'-P-C4' energy: -86.758 flat angles P-C4'-P energy: -49.608 tors. eta vs tors. theta energy: -60.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -762.700150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.700150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.450150 (E_RNA) where: Base-Base interactions energy: -483.175 where: short stacking energy: -236.619 Base-Backbone interact. energy: -1.387 local terms energy: -310.887365 where: bonds (distance) C4'-P energy: -62.202 bonds (distance) P-C4' energy: -74.460 flat angles C4'-P-C4' energy: -73.398 flat angles P-C4'-P energy: -48.275 tors. eta vs tors. theta energy: -52.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -618.001266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -618.001266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.751266 (E_RNA) where: Base-Base interactions energy: -394.276 where: short stacking energy: -187.142 Base-Backbone interact. energy: 1.975 local terms energy: -258.450674 where: bonds (distance) C4'-P energy: -64.977 bonds (distance) P-C4' energy: -76.680 flat angles C4'-P-C4' energy: -52.581 flat angles P-C4'-P energy: -51.138 tors. eta vs tors. theta energy: -13.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -412.730104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.730104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.480104 (E_RNA) where: Base-Base interactions energy: -208.785 where: short stacking energy: -119.525 Base-Backbone interact. energy: 0.792 local terms energy: -237.486711 where: bonds (distance) C4'-P energy: -58.686 bonds (distance) P-C4' energy: -75.798 flat angles C4'-P-C4' energy: -65.988 flat angles P-C4'-P energy: -35.103 tors. eta vs tors. theta energy: -1.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -285.654589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.654589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.404589 (E_RNA) where: Base-Base interactions energy: -115.376 where: short stacking energy: -82.564 Base-Backbone interact. energy: -3.228 local terms energy: -199.800988 where: bonds (distance) C4'-P energy: -63.315 bonds (distance) P-C4' energy: -62.020 flat angles C4'-P-C4' energy: -52.284 flat angles P-C4'-P energy: -31.123 tors. eta vs tors. theta energy: 8.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1328.639130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.639130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.389130 (E_RNA) where: Base-Base interactions energy: -942.553 where: short stacking energy: -381.926 Base-Backbone interact. energy: -0.924 local terms energy: -417.912356 where: bonds (distance) C4'-P energy: -84.468 bonds (distance) P-C4' energy: -82.111 flat angles C4'-P-C4' energy: -83.463 flat angles P-C4'-P energy: -62.284 tors. eta vs tors. theta energy: -105.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1247.105313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.105313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1279.855313 (E_RNA) where: Base-Base interactions energy: -845.803 where: short stacking energy: -380.882 Base-Backbone interact. energy: -1.983 local terms energy: -432.069494 where: bonds (distance) C4'-P energy: -90.932 bonds (distance) P-C4' energy: -84.471 flat angles C4'-P-C4' energy: -91.834 flat angles P-C4'-P energy: -56.990 tors. eta vs tors. theta energy: -107.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1152.916435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.916435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.666435 (E_RNA) where: Base-Base interactions energy: -787.826 where: short stacking energy: -341.302 Base-Backbone interact. energy: -1.562 local terms energy: -396.278657 where: bonds (distance) C4'-P energy: -84.195 bonds (distance) P-C4' energy: -80.796 flat angles C4'-P-C4' energy: -85.485 flat angles P-C4'-P energy: -59.298 tors. eta vs tors. theta energy: -86.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1098.039384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.039384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.789384 (E_RNA) where: Base-Base interactions energy: -750.901 where: short stacking energy: -354.569 Base-Backbone interact. energy: -4.093 local terms energy: -375.795236 where: bonds (distance) C4'-P energy: -77.328 bonds (distance) P-C4' energy: -69.082 flat angles C4'-P-C4' energy: -90.573 flat angles P-C4'-P energy: -43.307 tors. eta vs tors. theta energy: -95.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -901.087540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.087540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.837540 (E_RNA) where: Base-Base interactions energy: -576.543 where: short stacking energy: -247.206 Base-Backbone interact. energy: -3.353 local terms energy: -353.942194 where: bonds (distance) C4'-P energy: -77.693 bonds (distance) P-C4' energy: -86.513 flat angles C4'-P-C4' energy: -78.850 flat angles P-C4'-P energy: -50.469 tors. eta vs tors. theta energy: -60.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -816.950539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.950539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.700539 (E_RNA) where: Base-Base interactions energy: -504.260 where: short stacking energy: -257.560 Base-Backbone interact. energy: -0.265 local terms energy: -345.175506 where: bonds (distance) C4'-P energy: -75.089 bonds (distance) P-C4' energy: -70.686 flat angles C4'-P-C4' energy: -76.586 flat angles P-C4'-P energy: -56.074 tors. eta vs tors. theta energy: -66.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -770.613171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.613171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.363171 (E_RNA) where: Base-Base interactions energy: -488.660 where: short stacking energy: -217.693 Base-Backbone interact. energy: 0.076 local terms energy: -314.778961 where: bonds (distance) C4'-P energy: -75.740 bonds (distance) P-C4' energy: -75.264 flat angles C4'-P-C4' energy: -79.005 flat angles P-C4'-P energy: -40.294 tors. eta vs tors. theta energy: -44.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -563.668196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.668196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.418196 (E_RNA) where: Base-Base interactions energy: -349.442 where: short stacking energy: -175.619 Base-Backbone interact. energy: 3.093 local terms energy: -250.070008 where: bonds (distance) C4'-P energy: -57.813 bonds (distance) P-C4' energy: -78.758 flat angles C4'-P-C4' energy: -65.038 flat angles P-C4'-P energy: -36.441 tors. eta vs tors. theta energy: -12.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -406.756910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.756910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.506910 (E_RNA) where: Base-Base interactions energy: -209.339 where: short stacking energy: -129.903 Base-Backbone interact. energy: -1.029 local terms energy: -229.138340 where: bonds (distance) C4'-P energy: -66.353 bonds (distance) P-C4' energy: -70.974 flat angles C4'-P-C4' energy: -61.077 flat angles P-C4'-P energy: -31.151 tors. eta vs tors. theta energy: 0.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -307.081316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.081316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.831316 (E_RNA) where: Base-Base interactions energy: -116.133 where: short stacking energy: -94.756 Base-Backbone interact. energy: -0.135 local terms energy: -223.563630 where: bonds (distance) C4'-P energy: -69.808 bonds (distance) P-C4' energy: -74.590 flat angles C4'-P-C4' energy: -51.397 flat angles P-C4'-P energy: -34.706 tors. eta vs tors. theta energy: 6.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1329.988967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.988967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.738967 (E_RNA) where: Base-Base interactions energy: -947.381 where: short stacking energy: -393.733 Base-Backbone interact. energy: -1.735 local terms energy: -413.623563 where: bonds (distance) C4'-P energy: -70.049 bonds (distance) P-C4' energy: -67.405 flat angles C4'-P-C4' energy: -97.260 flat angles P-C4'-P energy: -72.322 tors. eta vs tors. theta energy: -106.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1234.953586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.953586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.703586 (E_RNA) where: Base-Base interactions energy: -851.765 where: short stacking energy: -360.788 Base-Backbone interact. energy: -2.245 local terms energy: -413.693548 where: bonds (distance) C4'-P energy: -81.050 bonds (distance) P-C4' energy: -84.573 flat angles C4'-P-C4' energy: -89.772 flat angles P-C4'-P energy: -54.231 tors. eta vs tors. theta energy: -104.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1163.792563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.792563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.542563 (E_RNA) where: Base-Base interactions energy: -809.169 where: short stacking energy: -344.892 Base-Backbone interact. energy: -2.903 local terms energy: -384.470795 where: bonds (distance) C4'-P energy: -78.956 bonds (distance) P-C4' energy: -76.975 flat angles C4'-P-C4' energy: -92.003 flat angles P-C4'-P energy: -41.399 tors. eta vs tors. theta energy: -95.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1108.464597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.464597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.214597 (E_RNA) where: Base-Base interactions energy: -748.365 where: short stacking energy: -342.542 Base-Backbone interact. energy: -2.088 local terms energy: -390.761614 where: bonds (distance) C4'-P energy: -81.352 bonds (distance) P-C4' energy: -73.886 flat angles C4'-P-C4' energy: -87.286 flat angles P-C4'-P energy: -56.816 tors. eta vs tors. theta energy: -91.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -923.112518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.112518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.862518 (E_RNA) where: Base-Base interactions energy: -610.077 where: short stacking energy: -283.188 Base-Backbone interact. energy: -0.825 local terms energy: -344.960773 where: bonds (distance) C4'-P energy: -81.113 bonds (distance) P-C4' energy: -63.151 flat angles C4'-P-C4' energy: -78.597 flat angles P-C4'-P energy: -49.180 tors. eta vs tors. theta energy: -72.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -860.516804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.516804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.266804 (E_RNA) where: Base-Base interactions energy: -566.794 where: short stacking energy: -255.335 Base-Backbone interact. energy: 1.593 local terms energy: -328.065529 where: bonds (distance) C4'-P energy: -73.173 bonds (distance) P-C4' energy: -72.058 flat angles C4'-P-C4' energy: -62.153 flat angles P-C4'-P energy: -44.342 tors. eta vs tors. theta energy: -76.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -730.875715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.875715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.625715 (E_RNA) where: Base-Base interactions energy: -462.338 where: short stacking energy: -224.027 Base-Backbone interact. energy: 2.204 local terms energy: -303.491459 where: bonds (distance) C4'-P energy: -71.827 bonds (distance) P-C4' energy: -64.414 flat angles C4'-P-C4' energy: -70.843 flat angles P-C4'-P energy: -51.525 tors. eta vs tors. theta energy: -44.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -594.246057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.246057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.996057 (E_RNA) where: Base-Base interactions energy: -348.167 where: short stacking energy: -182.696 Base-Backbone interact. energy: -0.456 local terms energy: -278.373295 where: bonds (distance) C4'-P energy: -64.058 bonds (distance) P-C4' energy: -85.849 flat angles C4'-P-C4' energy: -62.580 flat angles P-C4'-P energy: -36.634 tors. eta vs tors. theta energy: -29.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -445.962193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.962193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.712193 (E_RNA) where: Base-Base interactions energy: -265.896 where: short stacking energy: -125.725 Base-Backbone interact. energy: -2.538 local terms energy: -210.278350 where: bonds (distance) C4'-P energy: -70.141 bonds (distance) P-C4' energy: -55.809 flat angles C4'-P-C4' energy: -62.229 flat angles P-C4'-P energy: -36.344 tors. eta vs tors. theta energy: 14.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -282.215016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.215016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -314.965016 (E_RNA) where: Base-Base interactions energy: -123.656 where: short stacking energy: -110.457 Base-Backbone interact. energy: -3.619 local terms energy: -187.690146 where: bonds (distance) C4'-P energy: -48.093 bonds (distance) P-C4' energy: -61.658 flat angles C4'-P-C4' energy: -48.029 flat angles P-C4'-P energy: -37.543 tors. eta vs tors. theta energy: 7.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1330.906212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.906212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.656212 (E_RNA) where: Base-Base interactions energy: -943.904 where: short stacking energy: -383.429 Base-Backbone interact. energy: -4.465 local terms energy: -415.287533 where: bonds (distance) C4'-P energy: -72.698 bonds (distance) P-C4' energy: -88.733 flat angles C4'-P-C4' energy: -87.821 flat angles P-C4'-P energy: -58.119 tors. eta vs tors. theta energy: -107.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1238.718960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.718960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.468960 (E_RNA) where: Base-Base interactions energy: -854.596 where: short stacking energy: -363.179 Base-Backbone interact. energy: -1.410 local terms energy: -415.462829 where: bonds (distance) C4'-P energy: -77.254 bonds (distance) P-C4' energy: -87.120 flat angles C4'-P-C4' energy: -85.580 flat angles P-C4'-P energy: -66.216 tors. eta vs tors. theta energy: -99.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1198.891959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.891959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.641959 (E_RNA) where: Base-Base interactions energy: -823.129 where: short stacking energy: -353.566 Base-Backbone interact. energy: -1.999 local terms energy: -406.514024 where: bonds (distance) C4'-P energy: -78.247 bonds (distance) P-C4' energy: -80.475 flat angles C4'-P-C4' energy: -94.615 flat angles P-C4'-P energy: -48.268 tors. eta vs tors. theta energy: -104.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1094.863367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.863367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.613367 (E_RNA) where: Base-Base interactions energy: -734.284 where: short stacking energy: -336.078 Base-Backbone interact. energy: -2.109 local terms energy: -391.220643 where: bonds (distance) C4'-P energy: -79.018 bonds (distance) P-C4' energy: -74.059 flat angles C4'-P-C4' energy: -74.264 flat angles P-C4'-P energy: -65.831 tors. eta vs tors. theta energy: -98.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -959.313959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.313959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.063959 (E_RNA) where: Base-Base interactions energy: -630.429 where: short stacking energy: -278.231 Base-Backbone interact. energy: -2.669 local terms energy: -358.965966 where: bonds (distance) C4'-P energy: -68.632 bonds (distance) P-C4' energy: -93.181 flat angles C4'-P-C4' energy: -76.132 flat angles P-C4'-P energy: -54.551 tors. eta vs tors. theta energy: -66.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -926.178094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.178094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.928094 (E_RNA) where: Base-Base interactions energy: -610.440 where: short stacking energy: -284.689 Base-Backbone interact. energy: 2.046 local terms energy: -350.533842 where: bonds (distance) C4'-P energy: -72.319 bonds (distance) P-C4' energy: -66.411 flat angles C4'-P-C4' energy: -81.472 flat angles P-C4'-P energy: -59.243 tors. eta vs tors. theta energy: -71.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -744.392469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.392469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.142469 (E_RNA) where: Base-Base interactions energy: -462.068 where: short stacking energy: -232.015 Base-Backbone interact. energy: -1.972 local terms energy: -313.102834 where: bonds (distance) C4'-P energy: -75.078 bonds (distance) P-C4' energy: -74.487 flat angles C4'-P-C4' energy: -79.751 flat angles P-C4'-P energy: -52.354 tors. eta vs tors. theta energy: -31.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -621.274924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.274924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.024924 (E_RNA) where: Base-Base interactions energy: -379.014 where: short stacking energy: -208.398 Base-Backbone interact. energy: -1.347 local terms energy: -273.664128 where: bonds (distance) C4'-P energy: -63.466 bonds (distance) P-C4' energy: -53.711 flat angles C4'-P-C4' energy: -78.702 flat angles P-C4'-P energy: -43.562 tors. eta vs tors. theta energy: -34.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -441.337984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.337984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.087984 (E_RNA) where: Base-Base interactions energy: -217.592 where: short stacking energy: -128.454 Base-Backbone interact. energy: -1.497 local terms energy: -254.998540 where: bonds (distance) C4'-P energy: -66.133 bonds (distance) P-C4' energy: -87.345 flat angles C4'-P-C4' energy: -56.100 flat angles P-C4'-P energy: -36.973 tors. eta vs tors. theta energy: -8.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -310.554207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.554207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.304207 (E_RNA) where: Base-Base interactions energy: -126.771 where: short stacking energy: -102.275 Base-Backbone interact. energy: 9.250 local terms energy: -225.783126 where: bonds (distance) C4'-P energy: -66.243 bonds (distance) P-C4' energy: -61.900 flat angles C4'-P-C4' energy: -67.066 flat angles P-C4'-P energy: -35.727 tors. eta vs tors. theta energy: 5.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1334.117616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.117616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.867616 (E_RNA) where: Base-Base interactions energy: -949.831 where: short stacking energy: -398.076 Base-Backbone interact. energy: -0.514 local terms energy: -416.523100 where: bonds (distance) C4'-P energy: -78.586 bonds (distance) P-C4' energy: -84.400 flat angles C4'-P-C4' energy: -82.115 flat angles P-C4'-P energy: -62.398 tors. eta vs tors. theta energy: -109.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1244.586775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.586775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.336775 (E_RNA) where: Base-Base interactions energy: -865.129 where: short stacking energy: -357.654 Base-Backbone interact. energy: -2.361 local terms energy: -409.847341 where: bonds (distance) C4'-P energy: -72.817 bonds (distance) P-C4' energy: -91.145 flat angles C4'-P-C4' energy: -87.950 flat angles P-C4'-P energy: -60.280 tors. eta vs tors. theta energy: -97.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1201.133623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.133623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.883623 (E_RNA) where: Base-Base interactions energy: -825.085 where: short stacking energy: -370.284 Base-Backbone interact. energy: -2.401 local terms energy: -406.397766 where: bonds (distance) C4'-P energy: -77.930 bonds (distance) P-C4' energy: -83.737 flat angles C4'-P-C4' energy: -84.797 flat angles P-C4'-P energy: -56.538 tors. eta vs tors. theta energy: -103.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1097.319554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.319554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.069554 (E_RNA) where: Base-Base interactions energy: -721.615 where: short stacking energy: -335.232 Base-Backbone interact. energy: -1.053 local terms energy: -407.401905 where: bonds (distance) C4'-P energy: -84.547 bonds (distance) P-C4' energy: -81.937 flat angles C4'-P-C4' energy: -97.073 flat angles P-C4'-P energy: -52.072 tors. eta vs tors. theta energy: -91.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -971.253469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.253469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.003469 (E_RNA) where: Base-Base interactions energy: -649.481 where: short stacking energy: -289.710 Base-Backbone interact. energy: -0.210 local terms energy: -354.312305 where: bonds (distance) C4'-P energy: -69.510 bonds (distance) P-C4' energy: -77.876 flat angles C4'-P-C4' energy: -88.346 flat angles P-C4'-P energy: -45.954 tors. eta vs tors. theta energy: -72.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -912.625385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.625385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.375385 (E_RNA) where: Base-Base interactions energy: -606.769 where: short stacking energy: -279.425 Base-Backbone interact. energy: -3.667 local terms energy: -334.939705 where: bonds (distance) C4'-P energy: -76.082 bonds (distance) P-C4' energy: -72.543 flat angles C4'-P-C4' energy: -74.419 flat angles P-C4'-P energy: -50.708 tors. eta vs tors. theta energy: -61.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -664.936443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.936443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.686443 (E_RNA) where: Base-Base interactions energy: -411.930 where: short stacking energy: -208.671 Base-Backbone interact. energy: -1.431 local terms energy: -284.325573 where: bonds (distance) C4'-P energy: -72.620 bonds (distance) P-C4' energy: -67.752 flat angles C4'-P-C4' energy: -65.578 flat angles P-C4'-P energy: -48.637 tors. eta vs tors. theta energy: -29.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -620.724386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -620.724386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.474386 (E_RNA) where: Base-Base interactions energy: -372.125 where: short stacking energy: -203.044 Base-Backbone interact. energy: 0.464 local terms energy: -281.813246 where: bonds (distance) C4'-P energy: -71.815 bonds (distance) P-C4' energy: -69.420 flat angles C4'-P-C4' energy: -70.527 flat angles P-C4'-P energy: -37.300 tors. eta vs tors. theta energy: -32.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -390.947435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.947435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.697435 (E_RNA) where: Base-Base interactions energy: -187.810 where: short stacking energy: -97.103 Base-Backbone interact. energy: -2.405 local terms energy: -233.482335 where: bonds (distance) C4'-P energy: -78.091 bonds (distance) P-C4' energy: -67.659 flat angles C4'-P-C4' energy: -53.658 flat angles P-C4'-P energy: -46.813 tors. eta vs tors. theta energy: 12.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -303.032203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.032203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.782203 (E_RNA) where: Base-Base interactions energy: -106.840 where: short stacking energy: -94.937 Base-Backbone interact. energy: 0.373 local terms energy: -229.314943 where: bonds (distance) C4'-P energy: -66.981 bonds (distance) P-C4' energy: -71.452 flat angles C4'-P-C4' energy: -81.733 flat angles P-C4'-P energy: -31.553 tors. eta vs tors. theta energy: 22.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1319.618532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.618532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.368532 (E_RNA) where: Base-Base interactions energy: -936.458 where: short stacking energy: -393.323 Base-Backbone interact. energy: -1.241 local terms energy: -414.668922 where: bonds (distance) C4'-P energy: -78.647 bonds (distance) P-C4' energy: -81.538 flat angles C4'-P-C4' energy: -91.484 flat angles P-C4'-P energy: -55.614 tors. eta vs tors. theta energy: -107.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1270.813675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.813675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.563675 (E_RNA) where: Base-Base interactions energy: -890.975 where: short stacking energy: -354.060 Base-Backbone interact. energy: -3.155 local terms energy: -409.433970 where: bonds (distance) C4'-P energy: -75.594 bonds (distance) P-C4' energy: -80.050 flat angles C4'-P-C4' energy: -89.573 flat angles P-C4'-P energy: -67.541 tors. eta vs tors. theta energy: -96.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1230.433778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.433778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.183778 (E_RNA) where: Base-Base interactions energy: -837.037 where: short stacking energy: -361.959 Base-Backbone interact. energy: -2.342 local terms energy: -423.804696 where: bonds (distance) C4'-P energy: -80.785 bonds (distance) P-C4' energy: -87.244 flat angles C4'-P-C4' energy: -92.225 flat angles P-C4'-P energy: -61.653 tors. eta vs tors. theta energy: -101.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1095.189456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.189456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.939456 (E_RNA) where: Base-Base interactions energy: -724.495 where: short stacking energy: -342.994 Base-Backbone interact. energy: -0.281 local terms energy: -403.163975 where: bonds (distance) C4'-P energy: -73.627 bonds (distance) P-C4' energy: -79.359 flat angles C4'-P-C4' energy: -90.387 flat angles P-C4'-P energy: -54.887 tors. eta vs tors. theta energy: -104.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -994.986636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.986636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.736636 (E_RNA) where: Base-Base interactions energy: -673.789 where: short stacking energy: -316.460 Base-Backbone interact. energy: -0.694 local terms energy: -353.253428 where: bonds (distance) C4'-P energy: -71.531 bonds (distance) P-C4' energy: -67.658 flat angles C4'-P-C4' energy: -77.741 flat angles P-C4'-P energy: -59.212 tors. eta vs tors. theta energy: -77.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -925.460919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.460919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.210919 (E_RNA) where: Base-Base interactions energy: -627.064 where: short stacking energy: -273.399 Base-Backbone interact. energy: -1.825 local terms energy: -329.321604 where: bonds (distance) C4'-P energy: -63.746 bonds (distance) P-C4' energy: -72.668 flat angles C4'-P-C4' energy: -74.232 flat angles P-C4'-P energy: -51.210 tors. eta vs tors. theta energy: -67.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -683.644492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -683.644492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.394492 (E_RNA) where: Base-Base interactions energy: -411.839 where: short stacking energy: -218.103 Base-Backbone interact. energy: -0.862 local terms energy: -303.693982 where: bonds (distance) C4'-P energy: -68.883 bonds (distance) P-C4' energy: -72.983 flat angles C4'-P-C4' energy: -73.038 flat angles P-C4'-P energy: -54.747 tors. eta vs tors. theta energy: -34.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -614.181715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -614.181715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.931715 (E_RNA) where: Base-Base interactions energy: -359.258 where: short stacking energy: -180.357 Base-Backbone interact. energy: -3.083 local terms energy: -284.590103 where: bonds (distance) C4'-P energy: -73.343 bonds (distance) P-C4' energy: -66.839 flat angles C4'-P-C4' energy: -77.417 flat angles P-C4'-P energy: -48.990 tors. eta vs tors. theta energy: -18.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -422.386642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.386642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.136642 (E_RNA) where: Base-Base interactions energy: -237.476 where: short stacking energy: -126.428 Base-Backbone interact. energy: 8.794 local terms energy: -226.454270 where: bonds (distance) C4'-P energy: -69.118 bonds (distance) P-C4' energy: -67.848 flat angles C4'-P-C4' energy: -54.211 flat angles P-C4'-P energy: -38.225 tors. eta vs tors. theta energy: 2.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -301.182073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.182073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.932073 (E_RNA) where: Base-Base interactions energy: -108.209 where: short stacking energy: -92.631 Base-Backbone interact. energy: 1.559 local terms energy: -227.282160 where: bonds (distance) C4'-P energy: -66.876 bonds (distance) P-C4' energy: -71.346 flat angles C4'-P-C4' energy: -61.106 flat angles P-C4'-P energy: -40.592 tors. eta vs tors. theta energy: 12.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1321.498161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.498161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.248161 (E_RNA) where: Base-Base interactions energy: -920.945 where: short stacking energy: -390.824 Base-Backbone interact. energy: -2.063 local terms energy: -431.240577 where: bonds (distance) C4'-P energy: -79.715 bonds (distance) P-C4' energy: -83.113 flat angles C4'-P-C4' energy: -92.972 flat angles P-C4'-P energy: -65.110 tors. eta vs tors. theta energy: -110.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1254.347877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.347877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.097877 (E_RNA) where: Base-Base interactions energy: -876.193 where: short stacking energy: -361.090 Base-Backbone interact. energy: 1.420 local terms energy: -412.325232 where: bonds (distance) C4'-P energy: -82.489 bonds (distance) P-C4' energy: -85.466 flat angles C4'-P-C4' energy: -84.106 flat angles P-C4'-P energy: -64.236 tors. eta vs tors. theta energy: -96.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1205.103974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1205.103974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.853974 (E_RNA) where: Base-Base interactions energy: -838.102 where: short stacking energy: -355.094 Base-Backbone interact. energy: -0.891 local terms energy: -398.861088 where: bonds (distance) C4'-P energy: -69.871 bonds (distance) P-C4' energy: -81.768 flat angles C4'-P-C4' energy: -83.844 flat angles P-C4'-P energy: -55.574 tors. eta vs tors. theta energy: -107.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1082.087034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.087034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1114.837034 (E_RNA) where: Base-Base interactions energy: -725.012 where: short stacking energy: -337.636 Base-Backbone interact. energy: -0.210 local terms energy: -389.614997 where: bonds (distance) C4'-P energy: -66.073 bonds (distance) P-C4' energy: -93.216 flat angles C4'-P-C4' energy: -77.544 flat angles P-C4'-P energy: -51.726 tors. eta vs tors. theta energy: -101.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1007.387257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.387257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.137257 (E_RNA) where: Base-Base interactions energy: -681.943 where: short stacking energy: -303.819 Base-Backbone interact. energy: -3.251 local terms energy: -354.943089 where: bonds (distance) C4'-P energy: -69.318 bonds (distance) P-C4' energy: -78.062 flat angles C4'-P-C4' energy: -86.434 flat angles P-C4'-P energy: -46.746 tors. eta vs tors. theta energy: -74.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -881.888740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.888740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.638740 (E_RNA) where: Base-Base interactions energy: -599.750 where: short stacking energy: -278.887 Base-Backbone interact. energy: -0.243 local terms energy: -314.645400 where: bonds (distance) C4'-P energy: -56.530 bonds (distance) P-C4' energy: -64.392 flat angles C4'-P-C4' energy: -74.619 flat angles P-C4'-P energy: -48.132 tors. eta vs tors. theta energy: -70.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -657.085991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.085991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.835991 (E_RNA) where: Base-Base interactions energy: -402.297 where: short stacking energy: -217.466 Base-Backbone interact. energy: -0.824 local terms energy: -286.714969 where: bonds (distance) C4'-P energy: -58.435 bonds (distance) P-C4' energy: -88.797 flat angles C4'-P-C4' energy: -71.603 flat angles P-C4'-P energy: -27.488 tors. eta vs tors. theta energy: -40.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -597.180345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.180345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.930345 (E_RNA) where: Base-Base interactions energy: -362.303 where: short stacking energy: -168.264 Base-Backbone interact. energy: -1.626 local terms energy: -266.001789 where: bonds (distance) C4'-P energy: -79.462 bonds (distance) P-C4' energy: -70.457 flat angles C4'-P-C4' energy: -52.311 flat angles P-C4'-P energy: -39.604 tors. eta vs tors. theta energy: -24.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -476.363088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.363088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.113088 (E_RNA) where: Base-Base interactions energy: -236.406 where: short stacking energy: -123.481 Base-Backbone interact. energy: -0.584 local terms energy: -272.123125 where: bonds (distance) C4'-P energy: -73.913 bonds (distance) P-C4' energy: -70.989 flat angles C4'-P-C4' energy: -68.266 flat angles P-C4'-P energy: -49.810 tors. eta vs tors. theta energy: -9.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -324.988734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.988734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.738734 (E_RNA) where: Base-Base interactions energy: -137.548 where: short stacking energy: -103.152 Base-Backbone interact. energy: -0.572 local terms energy: -219.619261 where: bonds (distance) C4'-P energy: -64.851 bonds (distance) P-C4' energy: -78.771 flat angles C4'-P-C4' energy: -42.255 flat angles P-C4'-P energy: -42.715 tors. eta vs tors. theta energy: 8.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1317.063298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.063298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1349.813298 (E_RNA) where: Base-Base interactions energy: -918.012 where: short stacking energy: -384.373 Base-Backbone interact. energy: -1.700 local terms energy: -430.101361 where: bonds (distance) C4'-P energy: -89.178 bonds (distance) P-C4' energy: -87.410 flat angles C4'-P-C4' energy: -82.812 flat angles P-C4'-P energy: -66.036 tors. eta vs tors. theta energy: -104.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1259.138480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.138480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1291.888480 (E_RNA) where: Base-Base interactions energy: -875.701 where: short stacking energy: -376.314 Base-Backbone interact. energy: -3.832 local terms energy: -412.355546 where: bonds (distance) C4'-P energy: -80.429 bonds (distance) P-C4' energy: -80.431 flat angles C4'-P-C4' energy: -92.148 flat angles P-C4'-P energy: -56.913 tors. eta vs tors. theta energy: -102.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1227.662470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.662470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1260.412470 (E_RNA) where: Base-Base interactions energy: -875.035 where: short stacking energy: -358.611 Base-Backbone interact. energy: -0.689 local terms energy: -384.688138 where: bonds (distance) C4'-P energy: -71.192 bonds (distance) P-C4' energy: -81.336 flat angles C4'-P-C4' energy: -92.196 flat angles P-C4'-P energy: -47.872 tors. eta vs tors. theta energy: -92.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1021.713744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.713744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.463744 (E_RNA) where: Base-Base interactions energy: -683.074 where: short stacking energy: -323.233 Base-Backbone interact. energy: -0.718 local terms energy: -370.671895 where: bonds (distance) C4'-P energy: -76.021 bonds (distance) P-C4' energy: -87.234 flat angles C4'-P-C4' energy: -78.638 flat angles P-C4'-P energy: -43.449 tors. eta vs tors. theta energy: -85.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1017.456250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.456250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.206250 (E_RNA) where: Base-Base interactions energy: -685.308 where: short stacking energy: -334.842 Base-Backbone interact. energy: -0.477 local terms energy: -364.421458 where: bonds (distance) C4'-P energy: -64.592 bonds (distance) P-C4' energy: -75.486 flat angles C4'-P-C4' energy: -84.195 flat angles P-C4'-P energy: -50.133 tors. eta vs tors. theta energy: -90.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -949.177280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.177280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.927280 (E_RNA) where: Base-Base interactions energy: -623.341 where: short stacking energy: -283.661 Base-Backbone interact. energy: -0.649 local terms energy: -357.937420 where: bonds (distance) C4'-P energy: -73.912 bonds (distance) P-C4' energy: -77.041 flat angles C4'-P-C4' energy: -72.129 flat angles P-C4'-P energy: -58.462 tors. eta vs tors. theta energy: -76.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -664.314819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.314819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.064819 (E_RNA) where: Base-Base interactions energy: -415.943 where: short stacking energy: -207.146 Base-Backbone interact. energy: 0.438 local terms energy: -281.559460 where: bonds (distance) C4'-P energy: -48.024 bonds (distance) P-C4' energy: -76.654 flat angles C4'-P-C4' energy: -69.504 flat angles P-C4'-P energy: -52.318 tors. eta vs tors. theta energy: -35.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -583.602946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.602946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.352946 (E_RNA) where: Base-Base interactions energy: -362.360 where: short stacking energy: -176.098 Base-Backbone interact. energy: 1.275 local terms energy: -255.268114 where: bonds (distance) C4'-P energy: -66.230 bonds (distance) P-C4' energy: -72.983 flat angles C4'-P-C4' energy: -64.968 flat angles P-C4'-P energy: -36.637 tors. eta vs tors. theta energy: -14.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -449.932994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.932994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.682994 (E_RNA) where: Base-Base interactions energy: -256.799 where: short stacking energy: -139.484 Base-Backbone interact. energy: -2.407 local terms energy: -225.309435 where: bonds (distance) C4'-P energy: -65.506 bonds (distance) P-C4' energy: -68.262 flat angles C4'-P-C4' energy: -54.570 flat angles P-C4'-P energy: -40.759 tors. eta vs tors. theta energy: 3.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.832 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -288.295651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.295651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.045651 (E_RNA) where: Base-Base interactions energy: -109.498 where: short stacking energy: -89.852 Base-Backbone interact. energy: -0.768 local terms energy: -210.779922 where: bonds (distance) C4'-P energy: -58.293 bonds (distance) P-C4' energy: -63.084 flat angles C4'-P-C4' energy: -65.954 flat angles P-C4'-P energy: -32.529 tors. eta vs tors. theta energy: 9.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1323.661790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.661790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.411790 (E_RNA) where: Base-Base interactions energy: -924.657 where: short stacking energy: -375.192 Base-Backbone interact. energy: -0.206 local terms energy: -431.548019 where: bonds (distance) C4'-P energy: -78.865 bonds (distance) P-C4' energy: -95.049 flat angles C4'-P-C4' energy: -90.283 flat angles P-C4'-P energy: -65.378 tors. eta vs tors. theta energy: -101.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1250.644170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.644170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.394170 (E_RNA) where: Base-Base interactions energy: -874.005 where: short stacking energy: -378.215 Base-Backbone interact. energy: -2.890 local terms energy: -406.498281 where: bonds (distance) C4'-P energy: -68.597 bonds (distance) P-C4' energy: -82.669 flat angles C4'-P-C4' energy: -82.904 flat angles P-C4'-P energy: -62.767 tors. eta vs tors. theta energy: -109.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1230.991212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.991212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.741212 (E_RNA) where: Base-Base interactions energy: -863.224 where: short stacking energy: -339.470 Base-Backbone interact. energy: -4.321 local terms energy: -396.196682 where: bonds (distance) C4'-P energy: -69.898 bonds (distance) P-C4' energy: -92.967 flat angles C4'-P-C4' energy: -91.645 flat angles P-C4'-P energy: -48.459 tors. eta vs tors. theta energy: -93.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1023.196775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.196775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.946775 (E_RNA) where: Base-Base interactions energy: -689.158 where: short stacking energy: -304.227 Base-Backbone interact. energy: 1.257 local terms energy: -368.045547 where: bonds (distance) C4'-P energy: -71.725 bonds (distance) P-C4' energy: -76.195 flat angles C4'-P-C4' energy: -88.223 flat angles P-C4'-P energy: -58.497 tors. eta vs tors. theta energy: -73.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1018.164372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.164372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.914372 (E_RNA) where: Base-Base interactions energy: -694.136 where: short stacking energy: -307.275 Base-Backbone interact. energy: -3.212 local terms energy: -353.566183 where: bonds (distance) C4'-P energy: -77.692 bonds (distance) P-C4' energy: -68.793 flat angles C4'-P-C4' energy: -74.809 flat angles P-C4'-P energy: -52.746 tors. eta vs tors. theta energy: -79.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -887.560924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.560924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.310924 (E_RNA) where: Base-Base interactions energy: -574.106 where: short stacking energy: -275.195 Base-Backbone interact. energy: -0.127 local terms energy: -346.077881 where: bonds (distance) C4'-P energy: -69.129 bonds (distance) P-C4' energy: -76.206 flat angles C4'-P-C4' energy: -72.488 flat angles P-C4'-P energy: -54.370 tors. eta vs tors. theta energy: -73.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -653.006027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.006027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.756027 (E_RNA) where: Base-Base interactions energy: -392.902 where: short stacking energy: -193.960 Base-Backbone interact. energy: -0.363 local terms energy: -292.490821 where: bonds (distance) C4'-P energy: -67.360 bonds (distance) P-C4' energy: -83.155 flat angles C4'-P-C4' energy: -76.213 flat angles P-C4'-P energy: -52.905 tors. eta vs tors. theta energy: -12.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -551.181709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.181709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.931709 (E_RNA) where: Base-Base interactions energy: -325.950 where: short stacking energy: -166.834 Base-Backbone interact. energy: -1.511 local terms energy: -256.470864 where: bonds (distance) C4'-P energy: -68.862 bonds (distance) P-C4' energy: -68.047 flat angles C4'-P-C4' energy: -70.896 flat angles P-C4'-P energy: -45.857 tors. eta vs tors. theta energy: -2.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -511.581708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.581708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.331708 (E_RNA) where: Base-Base interactions energy: -292.679 where: short stacking energy: -152.961 Base-Backbone interact. energy: -2.076 local terms energy: -249.576607 where: bonds (distance) C4'-P energy: -64.360 bonds (distance) P-C4' energy: -74.560 flat angles C4'-P-C4' energy: -64.140 flat angles P-C4'-P energy: -42.789 tors. eta vs tors. theta energy: -3.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -302.034653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.034653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.784653 (E_RNA) where: Base-Base interactions energy: -119.302 where: short stacking energy: -95.723 Base-Backbone interact. energy: -3.255 local terms energy: -212.227473 where: bonds (distance) C4'-P energy: -56.112 bonds (distance) P-C4' energy: -82.573 flat angles C4'-P-C4' energy: -52.347 flat angles P-C4'-P energy: -31.430 tors. eta vs tors. theta energy: 10.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1330.440696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.440696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.190696 (E_RNA) where: Base-Base interactions energy: -910.707 where: short stacking energy: -375.500 Base-Backbone interact. energy: -2.282 local terms energy: -450.201546 where: bonds (distance) C4'-P energy: -82.043 bonds (distance) P-C4' energy: -91.790 flat angles C4'-P-C4' energy: -99.108 flat angles P-C4'-P energy: -71.035 tors. eta vs tors. theta energy: -106.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1246.187078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.187078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.937078 (E_RNA) where: Base-Base interactions energy: -872.687 where: short stacking energy: -361.518 Base-Backbone interact. energy: -2.198 local terms energy: -404.051936 where: bonds (distance) C4'-P energy: -81.448 bonds (distance) P-C4' energy: -84.462 flat angles C4'-P-C4' energy: -81.752 flat angles P-C4'-P energy: -57.139 tors. eta vs tors. theta energy: -99.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1187.588174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.588174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.338174 (E_RNA) where: Base-Base interactions energy: -834.415 where: short stacking energy: -344.674 Base-Backbone interact. energy: -2.817 local terms energy: -383.106148 where: bonds (distance) C4'-P energy: -75.266 bonds (distance) P-C4' energy: -70.416 flat angles C4'-P-C4' energy: -80.242 flat angles P-C4'-P energy: -61.493 tors. eta vs tors. theta energy: -95.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -999.723296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.723296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.473296 (E_RNA) where: Base-Base interactions energy: -669.382 where: short stacking energy: -308.947 Base-Backbone interact. energy: -1.891 local terms energy: -361.200153 where: bonds (distance) C4'-P energy: -75.656 bonds (distance) P-C4' energy: -80.773 flat angles C4'-P-C4' energy: -80.216 flat angles P-C4'-P energy: -51.427 tors. eta vs tors. theta energy: -73.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -991.024361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.024361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.774361 (E_RNA) where: Base-Base interactions energy: -676.103 where: short stacking energy: -287.108 Base-Backbone interact. energy: 2.941 local terms energy: -350.612334 where: bonds (distance) C4'-P energy: -65.744 bonds (distance) P-C4' energy: -88.278 flat angles C4'-P-C4' energy: -74.859 flat angles P-C4'-P energy: -50.010 tors. eta vs tors. theta energy: -71.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -890.301464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -890.301464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.051464 (E_RNA) where: Base-Base interactions energy: -595.407 where: short stacking energy: -257.034 Base-Backbone interact. energy: -1.963 local terms energy: -325.681222 where: bonds (distance) C4'-P energy: -72.466 bonds (distance) P-C4' energy: -70.699 flat angles C4'-P-C4' energy: -72.193 flat angles P-C4'-P energy: -55.420 tors. eta vs tors. theta energy: -54.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -594.989959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.989959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -627.739959 (E_RNA) where: Base-Base interactions energy: -345.934 where: short stacking energy: -190.549 Base-Backbone interact. energy: -1.774 local terms energy: -280.031106 where: bonds (distance) C4'-P energy: -68.715 bonds (distance) P-C4' energy: -74.530 flat angles C4'-P-C4' energy: -56.414 flat angles P-C4'-P energy: -47.064 tors. eta vs tors. theta energy: -33.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -593.376522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.376522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.126522 (E_RNA) where: Base-Base interactions energy: -344.248 where: short stacking energy: -161.559 Base-Backbone interact. energy: -2.060 local terms energy: -279.818493 where: bonds (distance) C4'-P energy: -78.736 bonds (distance) P-C4' energy: -79.985 flat angles C4'-P-C4' energy: -66.266 flat angles P-C4'-P energy: -38.605 tors. eta vs tors. theta energy: -16.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -562.773299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.773299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.523299 (E_RNA) where: Base-Base interactions energy: -342.577 where: short stacking energy: -182.252 Base-Backbone interact. energy: -0.137 local terms energy: -252.809544 where: bonds (distance) C4'-P energy: -55.265 bonds (distance) P-C4' energy: -61.141 flat angles C4'-P-C4' energy: -66.929 flat angles P-C4'-P energy: -42.866 tors. eta vs tors. theta energy: -26.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -313.462226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -313.462226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.212226 (E_RNA) where: Base-Base interactions energy: -130.327 where: short stacking energy: -83.641 Base-Backbone interact. energy: -0.621 local terms energy: -215.264590 where: bonds (distance) C4'-P energy: -68.531 bonds (distance) P-C4' energy: -83.247 flat angles C4'-P-C4' energy: -40.321 flat angles P-C4'-P energy: -31.597 tors. eta vs tors. theta energy: 8.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1343.722565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.722565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.472565 (E_RNA) where: Base-Base interactions energy: -940.079 where: short stacking energy: -404.500 Base-Backbone interact. energy: -1.689 local terms energy: -434.704735 where: bonds (distance) C4'-P energy: -68.707 bonds (distance) P-C4' energy: -83.488 flat angles C4'-P-C4' energy: -99.190 flat angles P-C4'-P energy: -66.471 tors. eta vs tors. theta energy: -116.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1238.148278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.148278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.898278 (E_RNA) where: Base-Base interactions energy: -873.631 where: short stacking energy: -364.457 Base-Backbone interact. energy: -2.591 local terms energy: -394.676472 where: bonds (distance) C4'-P energy: -78.513 bonds (distance) P-C4' energy: -78.500 flat angles C4'-P-C4' energy: -95.908 flat angles P-C4'-P energy: -49.228 tors. eta vs tors. theta energy: -92.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1198.451420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.451420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.201420 (E_RNA) where: Base-Base interactions energy: -835.573 where: short stacking energy: -359.044 Base-Backbone interact. energy: -1.714 local terms energy: -393.914276 where: bonds (distance) C4'-P energy: -70.472 bonds (distance) P-C4' energy: -83.591 flat angles C4'-P-C4' energy: -84.663 flat angles P-C4'-P energy: -52.735 tors. eta vs tors. theta energy: -102.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1035.816481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.816481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.566481 (E_RNA) where: Base-Base interactions energy: -711.105 where: short stacking energy: -321.170 Base-Backbone interact. energy: -1.445 local terms energy: -356.016331 where: bonds (distance) C4'-P energy: -68.056 bonds (distance) P-C4' energy: -82.343 flat angles C4'-P-C4' energy: -80.099 flat angles P-C4'-P energy: -41.886 tors. eta vs tors. theta energy: -83.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -995.458564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.458564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.208564 (E_RNA) where: Base-Base interactions energy: -674.535 where: short stacking energy: -296.831 Base-Backbone interact. energy: -3.778 local terms energy: -349.895603 where: bonds (distance) C4'-P energy: -69.200 bonds (distance) P-C4' energy: -70.403 flat angles C4'-P-C4' energy: -88.511 flat angles P-C4'-P energy: -52.872 tors. eta vs tors. theta energy: -68.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -952.151662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.151662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.901662 (E_RNA) where: Base-Base interactions energy: -628.768 where: short stacking energy: -258.138 Base-Backbone interact. energy: -0.503 local terms energy: -355.630729 where: bonds (distance) C4'-P energy: -80.155 bonds (distance) P-C4' energy: -77.056 flat angles C4'-P-C4' energy: -83.710 flat angles P-C4'-P energy: -43.076 tors. eta vs tors. theta energy: -71.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -646.801212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.801212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.551212 (E_RNA) where: Base-Base interactions energy: -390.458 where: short stacking energy: -205.811 Base-Backbone interact. energy: -3.576 local terms energy: -285.517483 where: bonds (distance) C4'-P energy: -65.401 bonds (distance) P-C4' energy: -76.276 flat angles C4'-P-C4' energy: -72.860 flat angles P-C4'-P energy: -36.573 tors. eta vs tors. theta energy: -34.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -561.132675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.132675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.882675 (E_RNA) where: Base-Base interactions energy: -319.142 where: short stacking energy: -173.857 Base-Backbone interact. energy: -0.263 local terms energy: -274.477389 where: bonds (distance) C4'-P energy: -56.350 bonds (distance) P-C4' energy: -75.081 flat angles C4'-P-C4' energy: -71.051 flat angles P-C4'-P energy: -38.592 tors. eta vs tors. theta energy: -33.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -521.398635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.398635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -554.148635 (E_RNA) where: Base-Base interactions energy: -300.020 where: short stacking energy: -151.548 Base-Backbone interact. energy: -2.630 local terms energy: -251.499457 where: bonds (distance) C4'-P energy: -72.588 bonds (distance) P-C4' energy: -62.847 flat angles C4'-P-C4' energy: -55.394 flat angles P-C4'-P energy: -46.981 tors. eta vs tors. theta energy: -13.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -305.002211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.002211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.752211 (E_RNA) where: Base-Base interactions energy: -134.551 where: short stacking energy: -100.133 Base-Backbone interact. energy: -2.719 local terms energy: -200.482295 where: bonds (distance) C4'-P energy: -51.835 bonds (distance) P-C4' energy: -72.694 flat angles C4'-P-C4' energy: -47.477 flat angles P-C4'-P energy: -35.788 tors. eta vs tors. theta energy: 7.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1342.143808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.143808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.893808 (E_RNA) where: Base-Base interactions energy: -936.022 where: short stacking energy: -384.796 Base-Backbone interact. energy: 1.037 local terms energy: -439.909185 where: bonds (distance) C4'-P energy: -81.096 bonds (distance) P-C4' energy: -88.059 flat angles C4'-P-C4' energy: -90.503 flat angles P-C4'-P energy: -71.112 tors. eta vs tors. theta energy: -109.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1234.861159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.861159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.611159 (E_RNA) where: Base-Base interactions energy: -848.991 where: short stacking energy: -367.249 Base-Backbone interact. energy: -1.720 local terms energy: -416.900344 where: bonds (distance) C4'-P energy: -81.753 bonds (distance) P-C4' energy: -82.369 flat angles C4'-P-C4' energy: -93.365 flat angles P-C4'-P energy: -55.362 tors. eta vs tors. theta energy: -104.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1180.685804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.685804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.435804 (E_RNA) where: Base-Base interactions energy: -825.031 where: short stacking energy: -354.647 Base-Backbone interact. energy: -5.238 local terms energy: -383.166781 where: bonds (distance) C4'-P energy: -76.845 bonds (distance) P-C4' energy: -80.081 flat angles C4'-P-C4' energy: -77.105 flat angles P-C4'-P energy: -56.605 tors. eta vs tors. theta energy: -92.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1039.557236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.557236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.307236 (E_RNA) where: Base-Base interactions energy: -700.829 where: short stacking energy: -297.240 Base-Backbone interact. energy: -3.198 local terms energy: -368.280383 where: bonds (distance) C4'-P energy: -76.953 bonds (distance) P-C4' energy: -84.664 flat angles C4'-P-C4' energy: -76.469 flat angles P-C4'-P energy: -55.141 tors. eta vs tors. theta energy: -75.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -996.763804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.763804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.513804 (E_RNA) where: Base-Base interactions energy: -686.805 where: short stacking energy: -297.387 Base-Backbone interact. energy: -0.269 local terms energy: -342.440021 where: bonds (distance) C4'-P energy: -75.279 bonds (distance) P-C4' energy: -71.748 flat angles C4'-P-C4' energy: -85.594 flat angles P-C4'-P energy: -28.155 tors. eta vs tors. theta energy: -81.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -911.068083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.068083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.818083 (E_RNA) where: Base-Base interactions energy: -603.072 where: short stacking energy: -291.044 Base-Backbone interact. energy: 2.078 local terms energy: -342.824528 where: bonds (distance) C4'-P energy: -65.115 bonds (distance) P-C4' energy: -76.053 flat angles C4'-P-C4' energy: -85.547 flat angles P-C4'-P energy: -47.737 tors. eta vs tors. theta energy: -68.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -670.879531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.879531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.629531 (E_RNA) where: Base-Base interactions energy: -408.624 where: short stacking energy: -223.622 Base-Backbone interact. energy: 0.475 local terms energy: -295.480494 where: bonds (distance) C4'-P energy: -71.164 bonds (distance) P-C4' energy: -77.677 flat angles C4'-P-C4' energy: -68.432 flat angles P-C4'-P energy: -39.090 tors. eta vs tors. theta energy: -39.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -549.670633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.670633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.420633 (E_RNA) where: Base-Base interactions energy: -312.374 where: short stacking energy: -175.842 Base-Backbone interact. energy: -1.607 local terms energy: -268.439534 where: bonds (distance) C4'-P energy: -61.173 bonds (distance) P-C4' energy: -77.778 flat angles C4'-P-C4' energy: -68.652 flat angles P-C4'-P energy: -44.000 tors. eta vs tors. theta energy: -16.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -558.130043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.130043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.880043 (E_RNA) where: Base-Base interactions energy: -326.319 where: short stacking energy: -172.759 Base-Backbone interact. energy: -2.629 local terms energy: -262.097501 where: bonds (distance) C4'-P energy: -65.979 bonds (distance) P-C4' energy: -67.566 flat angles C4'-P-C4' energy: -70.632 flat angles P-C4'-P energy: -30.683 tors. eta vs tors. theta energy: -27.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.166 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -294.300589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.300589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.050589 (E_RNA) where: Base-Base interactions energy: -138.989 where: short stacking energy: -101.806 Base-Backbone interact. energy: 4.090 local terms energy: -192.150771 where: bonds (distance) C4'-P energy: -68.738 bonds (distance) P-C4' energy: -59.907 flat angles C4'-P-C4' energy: -49.091 flat angles P-C4'-P energy: -28.066 tors. eta vs tors. theta energy: 13.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1350.994367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.994367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.744367 (E_RNA) where: Base-Base interactions energy: -932.146 where: short stacking energy: -412.641 Base-Backbone interact. energy: -3.164 local terms energy: -448.434450 where: bonds (distance) C4'-P energy: -91.248 bonds (distance) P-C4' energy: -85.753 flat angles C4'-P-C4' energy: -91.002 flat angles P-C4'-P energy: -55.990 tors. eta vs tors. theta energy: -124.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1235.721625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.721625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.471625 (E_RNA) where: Base-Base interactions energy: -862.945 where: short stacking energy: -361.630 Base-Backbone interact. energy: -2.530 local terms energy: -402.997116 where: bonds (distance) C4'-P energy: -86.173 bonds (distance) P-C4' energy: -86.110 flat angles C4'-P-C4' energy: -88.176 flat angles P-C4'-P energy: -45.437 tors. eta vs tors. theta energy: -97.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1187.021096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.021096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.771096 (E_RNA) where: Base-Base interactions energy: -816.452 where: short stacking energy: -341.095 Base-Backbone interact. energy: -4.095 local terms energy: -399.223711 where: bonds (distance) C4'-P energy: -74.394 bonds (distance) P-C4' energy: -83.913 flat angles C4'-P-C4' energy: -91.494 flat angles P-C4'-P energy: -59.590 tors. eta vs tors. theta energy: -89.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1064.090785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.090785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.840785 (E_RNA) where: Base-Base interactions energy: -707.467 where: short stacking energy: -309.243 Base-Backbone interact. energy: -0.063 local terms energy: -389.356156 where: bonds (distance) C4'-P energy: -73.625 bonds (distance) P-C4' energy: -76.228 flat angles C4'-P-C4' energy: -88.012 flat angles P-C4'-P energy: -59.290 tors. eta vs tors. theta energy: -92.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.046 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -995.352379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.352379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1028.102379 (E_RNA) where: Base-Base interactions energy: -659.526 where: short stacking energy: -272.895 Base-Backbone interact. energy: -2.955 local terms energy: -365.621568 where: bonds (distance) C4'-P energy: -80.258 bonds (distance) P-C4' energy: -85.832 flat angles C4'-P-C4' energy: -76.989 flat angles P-C4'-P energy: -60.437 tors. eta vs tors. theta energy: -62.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -926.506087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.506087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.256087 (E_RNA) where: Base-Base interactions energy: -620.937 where: short stacking energy: -292.054 Base-Backbone interact. energy: -1.703 local terms energy: -336.615993 where: bonds (distance) C4'-P energy: -74.091 bonds (distance) P-C4' energy: -66.701 flat angles C4'-P-C4' energy: -76.151 flat angles P-C4'-P energy: -41.896 tors. eta vs tors. theta energy: -77.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -727.312514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -727.312514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.062514 (E_RNA) where: Base-Base interactions energy: -437.855 where: short stacking energy: -232.332 Base-Backbone interact. energy: 0.021 local terms energy: -322.229006 where: bonds (distance) C4'-P energy: -74.632 bonds (distance) P-C4' energy: -80.768 flat angles C4'-P-C4' energy: -70.833 flat angles P-C4'-P energy: -40.607 tors. eta vs tors. theta energy: -55.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -548.089912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -548.089912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.839912 (E_RNA) where: Base-Base interactions energy: -291.061 where: short stacking energy: -150.778 Base-Backbone interact. energy: -2.667 local terms energy: -287.111798 where: bonds (distance) C4'-P energy: -69.559 bonds (distance) P-C4' energy: -69.103 flat angles C4'-P-C4' energy: -74.385 flat angles P-C4'-P energy: -52.694 tors. eta vs tors. theta energy: -21.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -517.189063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.189063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.939063 (E_RNA) where: Base-Base interactions energy: -298.980 where: short stacking energy: -150.223 Base-Backbone interact. energy: 0.801 local terms energy: -251.760729 where: bonds (distance) C4'-P energy: -64.262 bonds (distance) P-C4' energy: -69.442 flat angles C4'-P-C4' energy: -62.582 flat angles P-C4'-P energy: -41.638 tors. eta vs tors. theta energy: -13.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -316.117660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.117660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.867660 (E_RNA) where: Base-Base interactions energy: -126.769 where: short stacking energy: -120.728 Base-Backbone interact. energy: -1.408 local terms energy: -220.691061 where: bonds (distance) C4'-P energy: -64.307 bonds (distance) P-C4' energy: -51.822 flat angles C4'-P-C4' energy: -70.481 flat angles P-C4'-P energy: -35.079 tors. eta vs tors. theta energy: 0.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1372.264238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.264238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.014238 (E_RNA) where: Base-Base interactions energy: -978.620 where: short stacking energy: -383.068 Base-Backbone interact. energy: 0.468 local terms energy: -426.862551 where: bonds (distance) C4'-P energy: -86.871 bonds (distance) P-C4' energy: -81.257 flat angles C4'-P-C4' energy: -87.453 flat angles P-C4'-P energy: -60.373 tors. eta vs tors. theta energy: -110.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1212.349692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.349692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.099692 (E_RNA) where: Base-Base interactions energy: -832.037 where: short stacking energy: -355.300 Base-Backbone interact. energy: -0.809 local terms energy: -412.254182 where: bonds (distance) C4'-P energy: -78.633 bonds (distance) P-C4' energy: -74.429 flat angles C4'-P-C4' energy: -93.458 flat angles P-C4'-P energy: -58.645 tors. eta vs tors. theta energy: -107.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1193.129656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.129656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.879656 (E_RNA) where: Base-Base interactions energy: -813.980 where: short stacking energy: -350.374 Base-Backbone interact. energy: -2.052 local terms energy: -409.847041 where: bonds (distance) C4'-P energy: -84.321 bonds (distance) P-C4' energy: -86.375 flat angles C4'-P-C4' energy: -94.316 flat angles P-C4'-P energy: -52.099 tors. eta vs tors. theta energy: -92.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1094.632749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.632749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.382749 (E_RNA) where: Base-Base interactions energy: -752.643 where: short stacking energy: -314.775 Base-Backbone interact. energy: -3.687 local terms energy: -371.052885 where: bonds (distance) C4'-P energy: -77.517 bonds (distance) P-C4' energy: -75.746 flat angles C4'-P-C4' energy: -87.216 flat angles P-C4'-P energy: -46.210 tors. eta vs tors. theta energy: -84.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -985.037385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.037385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.787385 (E_RNA) where: Base-Base interactions energy: -663.361 where: short stacking energy: -272.795 Base-Backbone interact. energy: 0.357 local terms energy: -354.783333 where: bonds (distance) C4'-P energy: -77.832 bonds (distance) P-C4' energy: -73.825 flat angles C4'-P-C4' energy: -82.498 flat angles P-C4'-P energy: -49.890 tors. eta vs tors. theta energy: -70.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -907.718748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.718748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.468748 (E_RNA) where: Base-Base interactions energy: -617.514 where: short stacking energy: -263.586 Base-Backbone interact. energy: -1.988 local terms energy: -320.967102 where: bonds (distance) C4'-P energy: -67.832 bonds (distance) P-C4' energy: -69.141 flat angles C4'-P-C4' energy: -81.266 flat angles P-C4'-P energy: -53.934 tors. eta vs tors. theta energy: -48.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -692.760713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.760713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.510713 (E_RNA) where: Base-Base interactions energy: -407.371 where: short stacking energy: -199.148 Base-Backbone interact. energy: 1.763 local terms energy: -319.902543 where: bonds (distance) C4'-P energy: -78.528 bonds (distance) P-C4' energy: -82.003 flat angles C4'-P-C4' energy: -77.730 flat angles P-C4'-P energy: -41.093 tors. eta vs tors. theta energy: -40.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -569.919706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.919706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.669706 (E_RNA) where: Base-Base interactions energy: -336.293 where: short stacking energy: -168.613 Base-Backbone interact. energy: -2.044 local terms energy: -264.586665 where: bonds (distance) C4'-P energy: -64.689 bonds (distance) P-C4' energy: -67.603 flat angles C4'-P-C4' energy: -73.964 flat angles P-C4'-P energy: -50.273 tors. eta vs tors. theta energy: -8.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.255 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -511.258578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.258578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.008578 (E_RNA) where: Base-Base interactions energy: -271.472 where: short stacking energy: -144.465 Base-Backbone interact. energy: 1.445 local terms energy: -273.981617 where: bonds (distance) C4'-P energy: -74.261 bonds (distance) P-C4' energy: -81.214 flat angles C4'-P-C4' energy: -71.137 flat angles P-C4'-P energy: -40.627 tors. eta vs tors. theta energy: -6.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -290.606481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.606481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.356481 (E_RNA) where: Base-Base interactions energy: -107.483 where: short stacking energy: -104.082 Base-Backbone interact. energy: -0.813 local terms energy: -215.060917 where: bonds (distance) C4'-P energy: -81.218 bonds (distance) P-C4' energy: -76.074 flat angles C4'-P-C4' energy: -38.065 flat angles P-C4'-P energy: -29.631 tors. eta vs tors. theta energy: 9.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1335.686251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.686251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.436251 (E_RNA) where: Base-Base interactions energy: -939.070 where: short stacking energy: -370.321 Base-Backbone interact. energy: -0.754 local terms energy: -428.612258 where: bonds (distance) C4'-P energy: -77.259 bonds (distance) P-C4' energy: -88.323 flat angles C4'-P-C4' energy: -87.479 flat angles P-C4'-P energy: -69.446 tors. eta vs tors. theta energy: -106.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1225.480523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.480523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.230523 (E_RNA) where: Base-Base interactions energy: -857.474 where: short stacking energy: -384.785 Base-Backbone interact. energy: -0.589 local terms energy: -400.167940 where: bonds (distance) C4'-P energy: -76.225 bonds (distance) P-C4' energy: -84.506 flat angles C4'-P-C4' energy: -83.324 flat angles P-C4'-P energy: -48.334 tors. eta vs tors. theta energy: -107.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1206.553695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.553695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.303695 (E_RNA) where: Base-Base interactions energy: -847.077 where: short stacking energy: -366.115 Base-Backbone interact. energy: -1.061 local terms energy: -391.165636 where: bonds (distance) C4'-P energy: -74.162 bonds (distance) P-C4' energy: -78.830 flat angles C4'-P-C4' energy: -90.109 flat angles P-C4'-P energy: -50.791 tors. eta vs tors. theta energy: -97.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1076.148428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.148428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.898428 (E_RNA) where: Base-Base interactions energy: -750.303 where: short stacking energy: -317.304 Base-Backbone interact. energy: -1.062 local terms energy: -357.533697 where: bonds (distance) C4'-P energy: -78.141 bonds (distance) P-C4' energy: -82.766 flat angles C4'-P-C4' energy: -74.239 flat angles P-C4'-P energy: -50.923 tors. eta vs tors. theta energy: -71.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -980.172242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.172242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.922242 (E_RNA) where: Base-Base interactions energy: -676.295 where: short stacking energy: -293.682 Base-Backbone interact. energy: -3.621 local terms energy: -333.006015 where: bonds (distance) C4'-P energy: -81.605 bonds (distance) P-C4' energy: -76.223 flat angles C4'-P-C4' energy: -75.965 flat angles P-C4'-P energy: -35.802 tors. eta vs tors. theta energy: -63.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -903.169824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -903.169824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.919824 (E_RNA) where: Base-Base interactions energy: -606.792 where: short stacking energy: -269.352 Base-Backbone interact. energy: 0.229 local terms energy: -329.356769 where: bonds (distance) C4'-P energy: -72.198 bonds (distance) P-C4' energy: -82.407 flat angles C4'-P-C4' energy: -79.770 flat angles P-C4'-P energy: -35.607 tors. eta vs tors. theta energy: -59.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -709.554212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.554212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -742.304212 (E_RNA) where: Base-Base interactions energy: -454.519 where: short stacking energy: -217.469 Base-Backbone interact. energy: 4.896 local terms energy: -292.681232 where: bonds (distance) C4'-P energy: -58.405 bonds (distance) P-C4' energy: -77.798 flat angles C4'-P-C4' energy: -84.835 flat angles P-C4'-P energy: -31.825 tors. eta vs tors. theta energy: -39.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -559.732676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.732676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.482676 (E_RNA) where: Base-Base interactions energy: -338.782 where: short stacking energy: -150.876 Base-Backbone interact. energy: -0.821 local terms energy: -252.879511 where: bonds (distance) C4'-P energy: -65.664 bonds (distance) P-C4' energy: -71.759 flat angles C4'-P-C4' energy: -70.587 flat angles P-C4'-P energy: -28.017 tors. eta vs tors. theta energy: -16.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -438.381045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.381045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.131045 (E_RNA) where: Base-Base interactions energy: -228.410 where: short stacking energy: -120.085 Base-Backbone interact. energy: -0.783 local terms energy: -241.938393 where: bonds (distance) C4'-P energy: -65.852 bonds (distance) P-C4' energy: -79.368 flat angles C4'-P-C4' energy: -67.111 flat angles P-C4'-P energy: -30.608 tors. eta vs tors. theta energy: 1.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -347.701249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.701249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.451249 (E_RNA) where: Base-Base interactions energy: -166.513 where: short stacking energy: -105.866 Base-Backbone interact. energy: 2.317 local terms energy: -216.255689 where: bonds (distance) C4'-P energy: -74.244 bonds (distance) P-C4' energy: -67.079 flat angles C4'-P-C4' energy: -48.988 flat angles P-C4'-P energy: -40.608 tors. eta vs tors. theta energy: 14.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1342.454153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.454153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.204153 (E_RNA) where: Base-Base interactions energy: -954.770 where: short stacking energy: -387.101 Base-Backbone interact. energy: 2.367 local terms energy: -422.801104 where: bonds (distance) C4'-P energy: -66.879 bonds (distance) P-C4' energy: -84.814 flat angles C4'-P-C4' energy: -90.613 flat angles P-C4'-P energy: -62.930 tors. eta vs tors. theta energy: -117.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1255.145056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.145056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.895056 (E_RNA) where: Base-Base interactions energy: -896.260 where: short stacking energy: -372.935 Base-Backbone interact. energy: -0.423 local terms energy: -391.212017 where: bonds (distance) C4'-P energy: -80.397 bonds (distance) P-C4' energy: -66.857 flat angles C4'-P-C4' energy: -92.729 flat angles P-C4'-P energy: -56.512 tors. eta vs tors. theta energy: -94.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1152.106539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.106539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.856539 (E_RNA) where: Base-Base interactions energy: -796.986 where: short stacking energy: -329.227 Base-Backbone interact. energy: -1.764 local terms energy: -386.106551 where: bonds (distance) C4'-P energy: -79.236 bonds (distance) P-C4' energy: -82.007 flat angles C4'-P-C4' energy: -85.033 flat angles P-C4'-P energy: -56.964 tors. eta vs tors. theta energy: -82.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1061.014227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.014227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.764227 (E_RNA) where: Base-Base interactions energy: -716.248 where: short stacking energy: -305.651 Base-Backbone interact. energy: -1.340 local terms energy: -376.176007 where: bonds (distance) C4'-P energy: -81.715 bonds (distance) P-C4' energy: -84.874 flat angles C4'-P-C4' energy: -77.953 flat angles P-C4'-P energy: -60.608 tors. eta vs tors. theta energy: -71.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -971.252272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.252272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.002272 (E_RNA) where: Base-Base interactions energy: -671.561 where: short stacking energy: -287.269 Base-Backbone interact. energy: 1.383 local terms energy: -333.824321 where: bonds (distance) C4'-P energy: -60.064 bonds (distance) P-C4' energy: -81.739 flat angles C4'-P-C4' energy: -76.627 flat angles P-C4'-P energy: -50.504 tors. eta vs tors. theta energy: -64.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -914.882238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.882238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.632238 (E_RNA) where: Base-Base interactions energy: -603.541 where: short stacking energy: -273.331 Base-Backbone interact. energy: -1.300 local terms energy: -342.791120 where: bonds (distance) C4'-P energy: -66.100 bonds (distance) P-C4' energy: -74.888 flat angles C4'-P-C4' energy: -88.415 flat angles P-C4'-P energy: -37.921 tors. eta vs tors. theta energy: -75.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -692.820339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.820339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.570339 (E_RNA) where: Base-Base interactions energy: -442.896 where: short stacking energy: -217.279 Base-Backbone interact. energy: -0.205 local terms energy: -282.469643 where: bonds (distance) C4'-P energy: -74.570 bonds (distance) P-C4' energy: -68.090 flat angles C4'-P-C4' energy: -65.481 flat angles P-C4'-P energy: -35.194 tors. eta vs tors. theta energy: -39.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -531.036184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.036184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.786184 (E_RNA) where: Base-Base interactions energy: -316.091 where: short stacking energy: -150.239 Base-Backbone interact. energy: -1.034 local terms energy: -246.660910 where: bonds (distance) C4'-P energy: -66.984 bonds (distance) P-C4' energy: -64.459 flat angles C4'-P-C4' energy: -65.242 flat angles P-C4'-P energy: -38.841 tors. eta vs tors. theta energy: -11.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -443.686821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.686821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.436821 (E_RNA) where: Base-Base interactions energy: -228.617 where: short stacking energy: -131.649 Base-Backbone interact. energy: 3.869 local terms energy: -251.688590 where: bonds (distance) C4'-P energy: -63.691 bonds (distance) P-C4' energy: -73.016 flat angles C4'-P-C4' energy: -75.018 flat angles P-C4'-P energy: -40.737 tors. eta vs tors. theta energy: 0.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -323.700248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -323.700248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.450248 (E_RNA) where: Base-Base interactions energy: -143.183 where: short stacking energy: -90.010 Base-Backbone interact. energy: 6.594 local terms energy: -219.860824 where: bonds (distance) C4'-P energy: -57.398 bonds (distance) P-C4' energy: -75.617 flat angles C4'-P-C4' energy: -65.675 flat angles P-C4'-P energy: -39.549 tors. eta vs tors. theta energy: 18.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1341.650797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.650797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.400797 (E_RNA) where: Base-Base interactions energy: -931.361 where: short stacking energy: -397.018 Base-Backbone interact. energy: -0.239 local terms energy: -442.800510 where: bonds (distance) C4'-P energy: -80.093 bonds (distance) P-C4' energy: -89.943 flat angles C4'-P-C4' energy: -96.757 flat angles P-C4'-P energy: -59.573 tors. eta vs tors. theta energy: -116.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1271.552140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.552140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1304.302140 (E_RNA) where: Base-Base interactions energy: -891.704 where: short stacking energy: -370.274 Base-Backbone interact. energy: -2.022 local terms energy: -410.575980 where: bonds (distance) C4'-P energy: -88.426 bonds (distance) P-C4' energy: -73.464 flat angles C4'-P-C4' energy: -90.889 flat angles P-C4'-P energy: -59.345 tors. eta vs tors. theta energy: -98.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1159.255917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.255917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.005917 (E_RNA) where: Base-Base interactions energy: -799.308 where: short stacking energy: -359.197 Base-Backbone interact. energy: -0.872 local terms energy: -391.826548 where: bonds (distance) C4'-P energy: -78.611 bonds (distance) P-C4' energy: -73.783 flat angles C4'-P-C4' energy: -80.441 flat angles P-C4'-P energy: -61.946 tors. eta vs tors. theta energy: -97.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1066.159743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.159743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.909743 (E_RNA) where: Base-Base interactions energy: -702.242 where: short stacking energy: -332.804 Base-Backbone interact. energy: 2.547 local terms energy: -399.214988 where: bonds (distance) C4'-P energy: -79.261 bonds (distance) P-C4' energy: -90.935 flat angles C4'-P-C4' energy: -86.453 flat angles P-C4'-P energy: -51.618 tors. eta vs tors. theta energy: -90.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -966.399934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.399934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.149934 (E_RNA) where: Base-Base interactions energy: -659.552 where: short stacking energy: -264.564 Base-Backbone interact. energy: -0.309 local terms energy: -339.288143 where: bonds (distance) C4'-P energy: -63.422 bonds (distance) P-C4' energy: -82.899 flat angles C4'-P-C4' energy: -77.633 flat angles P-C4'-P energy: -58.560 tors. eta vs tors. theta energy: -56.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -917.176441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.176441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.926441 (E_RNA) where: Base-Base interactions energy: -618.858 where: short stacking energy: -291.860 Base-Backbone interact. energy: 8.954 local terms energy: -340.023395 where: bonds (distance) C4'-P energy: -70.412 bonds (distance) P-C4' energy: -75.561 flat angles C4'-P-C4' energy: -78.690 flat angles P-C4'-P energy: -28.434 tors. eta vs tors. theta energy: -86.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -680.390125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.390125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.140125 (E_RNA) where: Base-Base interactions energy: -437.500 where: short stacking energy: -220.457 Base-Backbone interact. energy: -0.246 local terms energy: -275.394143 where: bonds (distance) C4'-P energy: -61.654 bonds (distance) P-C4' energy: -76.837 flat angles C4'-P-C4' energy: -56.212 flat angles P-C4'-P energy: -45.481 tors. eta vs tors. theta energy: -35.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -623.649287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.649287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.399287 (E_RNA) where: Base-Base interactions energy: -386.086 where: short stacking energy: -194.486 Base-Backbone interact. energy: 0.188 local terms energy: -270.500892 where: bonds (distance) C4'-P energy: -58.919 bonds (distance) P-C4' energy: -77.170 flat angles C4'-P-C4' energy: -58.496 flat angles P-C4'-P energy: -41.083 tors. eta vs tors. theta energy: -34.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -310.079781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.079781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.829781 (E_RNA) where: Base-Base interactions energy: -128.688 where: short stacking energy: -91.810 Base-Backbone interact. energy: 6.395 local terms energy: -220.536648 where: bonds (distance) C4'-P energy: -63.478 bonds (distance) P-C4' energy: -77.006 flat angles C4'-P-C4' energy: -61.043 flat angles P-C4'-P energy: -39.896 tors. eta vs tors. theta energy: 20.886 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -403.287490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.287490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.037490 (E_RNA) where: Base-Base interactions energy: -211.326 where: short stacking energy: -127.475 Base-Backbone interact. energy: 0.737 local terms energy: -225.448081 where: bonds (distance) C4'-P energy: -60.971 bonds (distance) P-C4' energy: -56.783 flat angles C4'-P-C4' energy: -55.806 flat angles P-C4'-P energy: -38.583 tors. eta vs tors. theta energy: -13.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1338.779672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.779672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.529672 (E_RNA) where: Base-Base interactions energy: -944.162 where: short stacking energy: -386.691 Base-Backbone interact. energy: -2.086 local terms energy: -425.282080 where: bonds (distance) C4'-P energy: -75.970 bonds (distance) P-C4' energy: -83.781 flat angles C4'-P-C4' energy: -84.289 flat angles P-C4'-P energy: -66.197 tors. eta vs tors. theta energy: -115.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1255.562784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.562784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.312784 (E_RNA) where: Base-Base interactions energy: -872.373 where: short stacking energy: -374.797 Base-Backbone interact. energy: -1.430 local terms energy: -414.509930 where: bonds (distance) C4'-P energy: -71.055 bonds (distance) P-C4' energy: -82.937 flat angles C4'-P-C4' energy: -97.662 flat angles P-C4'-P energy: -62.242 tors. eta vs tors. theta energy: -100.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1165.606105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.606105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.356105 (E_RNA) where: Base-Base interactions energy: -806.672 where: short stacking energy: -344.485 Base-Backbone interact. energy: -2.110 local terms energy: -389.765512 where: bonds (distance) C4'-P energy: -78.120 bonds (distance) P-C4' energy: -78.232 flat angles C4'-P-C4' energy: -89.153 flat angles P-C4'-P energy: -50.741 tors. eta vs tors. theta energy: -93.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.192 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1047.779686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.779686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.529686 (E_RNA) where: Base-Base interactions energy: -714.088 where: short stacking energy: -304.080 Base-Backbone interact. energy: 0.742 local terms energy: -367.183966 where: bonds (distance) C4'-P energy: -68.067 bonds (distance) P-C4' energy: -82.594 flat angles C4'-P-C4' energy: -89.819 flat angles P-C4'-P energy: -44.325 tors. eta vs tors. theta energy: -82.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -995.023497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.023497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.773497 (E_RNA) where: Base-Base interactions energy: -669.751 where: short stacking energy: -282.547 Base-Backbone interact. energy: -1.730 local terms energy: -356.292701 where: bonds (distance) C4'-P energy: -74.146 bonds (distance) P-C4' energy: -81.316 flat angles C4'-P-C4' energy: -71.217 flat angles P-C4'-P energy: -53.017 tors. eta vs tors. theta energy: -76.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -960.788505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.788505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.538505 (E_RNA) where: Base-Base interactions energy: -635.355 where: short stacking energy: -302.118 Base-Backbone interact. energy: -1.517 local terms energy: -356.666880 where: bonds (distance) C4'-P energy: -78.310 bonds (distance) P-C4' energy: -66.778 flat angles C4'-P-C4' energy: -73.455 flat angles P-C4'-P energy: -55.599 tors. eta vs tors. theta energy: -82.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -761.733100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.733100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.483100 (E_RNA) where: Base-Base interactions energy: -475.490 where: short stacking energy: -231.807 Base-Backbone interact. energy: -0.895 local terms energy: -318.098352 where: bonds (distance) C4'-P energy: -67.108 bonds (distance) P-C4' energy: -85.116 flat angles C4'-P-C4' energy: -72.050 flat angles P-C4'-P energy: -38.874 tors. eta vs tors. theta energy: -54.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -556.373149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.373149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.123149 (E_RNA) where: Base-Base interactions energy: -357.178 where: short stacking energy: -175.351 Base-Backbone interact. energy: 3.024 local terms energy: -234.969688 where: bonds (distance) C4'-P energy: -67.024 bonds (distance) P-C4' energy: -61.195 flat angles C4'-P-C4' energy: -60.584 flat angles P-C4'-P energy: -41.157 tors. eta vs tors. theta energy: -5.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -328.608037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.608037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.358037 (E_RNA) where: Base-Base interactions energy: -131.756 where: short stacking energy: -105.571 Base-Backbone interact. energy: -0.707 local terms energy: -228.896025 where: bonds (distance) C4'-P energy: -74.088 bonds (distance) P-C4' energy: -68.125 flat angles C4'-P-C4' energy: -58.750 flat angles P-C4'-P energy: -28.302 tors. eta vs tors. theta energy: 0.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -425.718113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.718113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.468113 (E_RNA) where: Base-Base interactions energy: -238.889 where: short stacking energy: -129.423 Base-Backbone interact. energy: -2.186 local terms energy: -217.393787 where: bonds (distance) C4'-P energy: -66.038 bonds (distance) P-C4' energy: -66.454 flat angles C4'-P-C4' energy: -56.758 flat angles P-C4'-P energy: -29.452 tors. eta vs tors. theta energy: 1.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1330.524436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.524436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.274436 (E_RNA) where: Base-Base interactions energy: -932.720 where: short stacking energy: -389.210 Base-Backbone interact. energy: -2.028 local terms energy: -428.527262 where: bonds (distance) C4'-P energy: -89.046 bonds (distance) P-C4' energy: -80.609 flat angles C4'-P-C4' energy: -90.824 flat angles P-C4'-P energy: -55.254 tors. eta vs tors. theta energy: -112.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1248.243921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.243921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.993921 (E_RNA) where: Base-Base interactions energy: -878.245 where: short stacking energy: -354.313 Base-Backbone interact. energy: 1.628 local terms energy: -404.377379 where: bonds (distance) C4'-P energy: -72.837 bonds (distance) P-C4' energy: -93.567 flat angles C4'-P-C4' energy: -92.992 flat angles P-C4'-P energy: -54.865 tors. eta vs tors. theta energy: -90.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1151.038123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.038123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1183.788123 (E_RNA) where: Base-Base interactions energy: -789.777 where: short stacking energy: -356.383 Base-Backbone interact. energy: 1.148 local terms energy: -395.158285 where: bonds (distance) C4'-P energy: -76.303 bonds (distance) P-C4' energy: -80.994 flat angles C4'-P-C4' energy: -86.899 flat angles P-C4'-P energy: -55.610 tors. eta vs tors. theta energy: -95.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1049.818772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.818772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1082.568772 (E_RNA) where: Base-Base interactions energy: -719.157 where: short stacking energy: -327.327 Base-Backbone interact. energy: -2.787 local terms energy: -360.624454 where: bonds (distance) C4'-P energy: -63.507 bonds (distance) P-C4' energy: -71.898 flat angles C4'-P-C4' energy: -79.131 flat angles P-C4'-P energy: -53.410 tors. eta vs tors. theta energy: -92.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -983.832454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.832454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.582454 (E_RNA) where: Base-Base interactions energy: -657.016 where: short stacking energy: -274.375 Base-Backbone interact. energy: -2.028 local terms energy: -357.538637 where: bonds (distance) C4'-P energy: -89.575 bonds (distance) P-C4' energy: -76.010 flat angles C4'-P-C4' energy: -82.458 flat angles P-C4'-P energy: -44.701 tors. eta vs tors. theta energy: -64.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -957.712582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.712582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.462582 (E_RNA) where: Base-Base interactions energy: -635.632 where: short stacking energy: -290.609 Base-Backbone interact. energy: -1.901 local terms energy: -352.929537 where: bonds (distance) C4'-P energy: -66.829 bonds (distance) P-C4' energy: -84.204 flat angles C4'-P-C4' energy: -83.141 flat angles P-C4'-P energy: -42.686 tors. eta vs tors. theta energy: -76.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -785.580289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.580289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.330289 (E_RNA) where: Base-Base interactions energy: -481.230 where: short stacking energy: -233.010 Base-Backbone interact. energy: -0.923 local terms energy: -336.177633 where: bonds (distance) C4'-P energy: -68.048 bonds (distance) P-C4' energy: -61.561 flat angles C4'-P-C4' energy: -86.249 flat angles P-C4'-P energy: -61.016 tors. eta vs tors. theta energy: -59.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -579.292273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.292273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.042273 (E_RNA) where: Base-Base interactions energy: -343.980 where: short stacking energy: -180.494 Base-Backbone interact. energy: -2.170 local terms energy: -265.892495 where: bonds (distance) C4'-P energy: -55.252 bonds (distance) P-C4' energy: -72.356 flat angles C4'-P-C4' energy: -63.636 flat angles P-C4'-P energy: -58.875 tors. eta vs tors. theta energy: -15.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -499.364082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.364082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.114082 (E_RNA) where: Base-Base interactions energy: -324.560 where: short stacking energy: -157.170 Base-Backbone interact. energy: -1.217 local terms energy: -206.336767 where: bonds (distance) C4'-P energy: -67.332 bonds (distance) P-C4' energy: -60.563 flat angles C4'-P-C4' energy: -52.501 flat angles P-C4'-P energy: -31.306 tors. eta vs tors. theta energy: 5.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -296.478936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.478936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.228936 (E_RNA) where: Base-Base interactions energy: -115.922 where: short stacking energy: -77.925 Base-Backbone interact. energy: 0.560 local terms energy: -213.866373 where: bonds (distance) C4'-P energy: -57.008 bonds (distance) P-C4' energy: -78.645 flat angles C4'-P-C4' energy: -63.439 flat angles P-C4'-P energy: -33.867 tors. eta vs tors. theta energy: 19.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1374.924599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.924599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.674599 (E_RNA) where: Base-Base interactions energy: -966.646 where: short stacking energy: -388.321 Base-Backbone interact. energy: -2.290 local terms energy: -438.738221 where: bonds (distance) C4'-P energy: -86.915 bonds (distance) P-C4' energy: -85.344 flat angles C4'-P-C4' energy: -95.649 flat angles P-C4'-P energy: -64.611 tors. eta vs tors. theta energy: -106.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1221.367218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.367218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.117218 (E_RNA) where: Base-Base interactions energy: -855.986 where: short stacking energy: -359.608 Base-Backbone interact. energy: -1.198 local terms energy: -396.933433 where: bonds (distance) C4'-P energy: -82.438 bonds (distance) P-C4' energy: -73.827 flat angles C4'-P-C4' energy: -84.395 flat angles P-C4'-P energy: -55.428 tors. eta vs tors. theta energy: -100.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1182.679933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.679933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.429933 (E_RNA) where: Base-Base interactions energy: -807.384 where: short stacking energy: -361.090 Base-Backbone interact. energy: -1.497 local terms energy: -406.548242 where: bonds (distance) C4'-P energy: -75.401 bonds (distance) P-C4' energy: -85.637 flat angles C4'-P-C4' energy: -87.254 flat angles P-C4'-P energy: -45.367 tors. eta vs tors. theta energy: -112.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1058.322057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.322057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.072057 (E_RNA) where: Base-Base interactions energy: -717.403 where: short stacking energy: -332.032 Base-Backbone interact. energy: -1.545 local terms energy: -372.124413 where: bonds (distance) C4'-P energy: -66.398 bonds (distance) P-C4' energy: -72.416 flat angles C4'-P-C4' energy: -85.251 flat angles P-C4'-P energy: -60.777 tors. eta vs tors. theta energy: -87.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -985.683940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.683940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.433940 (E_RNA) where: Base-Base interactions energy: -689.085 where: short stacking energy: -291.020 Base-Backbone interact. energy: 1.373 local terms energy: -331.215958 where: bonds (distance) C4'-P energy: -69.565 bonds (distance) P-C4' energy: -77.098 flat angles C4'-P-C4' energy: -71.625 flat angles P-C4'-P energy: -53.004 tors. eta vs tors. theta energy: -59.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.494 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -942.163137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.163137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.913137 (E_RNA) where: Base-Base interactions energy: -614.864 where: short stacking energy: -281.563 Base-Backbone interact. energy: -1.027 local terms energy: -359.022253 where: bonds (distance) C4'-P energy: -62.706 bonds (distance) P-C4' energy: -74.125 flat angles C4'-P-C4' energy: -83.721 flat angles P-C4'-P energy: -60.337 tors. eta vs tors. theta energy: -78.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -769.125717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.125717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -801.875717 (E_RNA) where: Base-Base interactions energy: -479.091 where: short stacking energy: -232.462 Base-Backbone interact. energy: -1.466 local terms energy: -321.318887 where: bonds (distance) C4'-P energy: -71.673 bonds (distance) P-C4' energy: -85.612 flat angles C4'-P-C4' energy: -67.866 flat angles P-C4'-P energy: -44.329 tors. eta vs tors. theta energy: -51.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -630.293690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.293690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.043690 (E_RNA) where: Base-Base interactions energy: -369.518 where: short stacking energy: -185.491 Base-Backbone interact. energy: 0.291 local terms energy: -293.816135 where: bonds (distance) C4'-P energy: -70.519 bonds (distance) P-C4' energy: -76.062 flat angles C4'-P-C4' energy: -72.088 flat angles P-C4'-P energy: -41.944 tors. eta vs tors. theta energy: -33.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -498.304942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.304942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.054942 (E_RNA) where: Base-Base interactions energy: -308.000 where: short stacking energy: -158.178 Base-Backbone interact. energy: 4.381 local terms energy: -227.435038 where: bonds (distance) C4'-P energy: -53.789 bonds (distance) P-C4' energy: -78.866 flat angles C4'-P-C4' energy: -54.606 flat angles P-C4'-P energy: -38.918 tors. eta vs tors. theta energy: -1.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -345.198224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.198224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.948224 (E_RNA) where: Base-Base interactions energy: -161.613 where: short stacking energy: -108.733 Base-Backbone interact. energy: -0.384 local terms energy: -215.951691 where: bonds (distance) C4'-P energy: -63.295 bonds (distance) P-C4' energy: -68.546 flat angles C4'-P-C4' energy: -72.686 flat angles P-C4'-P energy: -30.468 tors. eta vs tors. theta energy: 19.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1371.423051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.423051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.173051 (E_RNA) where: Base-Base interactions energy: -956.565 where: short stacking energy: -389.541 Base-Backbone interact. energy: -0.028 local terms energy: -447.580219 where: bonds (distance) C4'-P energy: -81.424 bonds (distance) P-C4' energy: -85.745 flat angles C4'-P-C4' energy: -91.226 flat angles P-C4'-P energy: -70.921 tors. eta vs tors. theta energy: -118.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1243.663760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.663760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.413760 (E_RNA) where: Base-Base interactions energy: -868.067 where: short stacking energy: -363.107 Base-Backbone interact. energy: 3.683 local terms energy: -412.030191 where: bonds (distance) C4'-P energy: -83.585 bonds (distance) P-C4' energy: -80.326 flat angles C4'-P-C4' energy: -93.610 flat angles P-C4'-P energy: -61.514 tors. eta vs tors. theta energy: -92.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1192.011074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.011074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.761074 (E_RNA) where: Base-Base interactions energy: -817.087 where: short stacking energy: -364.937 Base-Backbone interact. energy: -1.842 local terms energy: -405.832007 where: bonds (distance) C4'-P energy: -79.665 bonds (distance) P-C4' energy: -83.471 flat angles C4'-P-C4' energy: -86.498 flat angles P-C4'-P energy: -53.306 tors. eta vs tors. theta energy: -102.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1115.462952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.462952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.212952 (E_RNA) where: Base-Base interactions energy: -759.299 where: short stacking energy: -330.976 Base-Backbone interact. energy: 3.080 local terms energy: -391.994550 where: bonds (distance) C4'-P energy: -80.196 bonds (distance) P-C4' energy: -81.757 flat angles C4'-P-C4' energy: -79.216 flat angles P-C4'-P energy: -56.879 tors. eta vs tors. theta energy: -93.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -933.023683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.023683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.773683 (E_RNA) where: Base-Base interactions energy: -632.722 where: short stacking energy: -284.793 Base-Backbone interact. energy: -1.212 local terms energy: -331.840058 where: bonds (distance) C4'-P energy: -68.838 bonds (distance) P-C4' energy: -72.014 flat angles C4'-P-C4' energy: -73.814 flat angles P-C4'-P energy: -40.307 tors. eta vs tors. theta energy: -76.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -946.844304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.844304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.594304 (E_RNA) where: Base-Base interactions energy: -657.059 where: short stacking energy: -281.137 Base-Backbone interact. energy: -3.160 local terms energy: -319.375325 where: bonds (distance) C4'-P energy: -53.327 bonds (distance) P-C4' energy: -79.648 flat angles C4'-P-C4' energy: -72.502 flat angles P-C4'-P energy: -41.141 tors. eta vs tors. theta energy: -72.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -790.605830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.605830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.355830 (E_RNA) where: Base-Base interactions energy: -500.028 where: short stacking energy: -245.272 Base-Backbone interact. energy: -0.863 local terms energy: -322.464854 where: bonds (distance) C4'-P energy: -59.492 bonds (distance) P-C4' energy: -70.830 flat angles C4'-P-C4' energy: -74.571 flat angles P-C4'-P energy: -57.049 tors. eta vs tors. theta energy: -60.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -648.004736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.004736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.754736 (E_RNA) where: Base-Base interactions energy: -389.999 where: short stacking energy: -186.145 Base-Backbone interact. energy: 1.569 local terms energy: -292.325056 where: bonds (distance) C4'-P energy: -72.019 bonds (distance) P-C4' energy: -63.601 flat angles C4'-P-C4' energy: -73.985 flat angles P-C4'-P energy: -49.394 tors. eta vs tors. theta energy: -33.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -526.423726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.423726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.173726 (E_RNA) where: Base-Base interactions energy: -298.951 where: short stacking energy: -182.861 Base-Backbone interact. energy: 0.055 local terms energy: -260.277837 where: bonds (distance) C4'-P energy: -60.861 bonds (distance) P-C4' energy: -73.241 flat angles C4'-P-C4' energy: -66.669 flat angles P-C4'-P energy: -35.160 tors. eta vs tors. theta energy: -24.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -372.930050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.930050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.680050 (E_RNA) where: Base-Base interactions energy: -152.086 where: short stacking energy: -115.646 Base-Backbone interact. energy: -2.044 local terms energy: -251.550118 where: bonds (distance) C4'-P energy: -74.426 bonds (distance) P-C4' energy: -74.112 flat angles C4'-P-C4' energy: -58.506 flat angles P-C4'-P energy: -51.516 tors. eta vs tors. theta energy: 7.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1363.089200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.089200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.839200 (E_RNA) where: Base-Base interactions energy: -959.417 where: short stacking energy: -402.434 Base-Backbone interact. energy: -2.449 local terms energy: -433.973868 where: bonds (distance) C4'-P energy: -75.215 bonds (distance) P-C4' energy: -84.937 flat angles C4'-P-C4' energy: -91.782 flat angles P-C4'-P energy: -66.299 tors. eta vs tors. theta energy: -115.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1225.163832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.163832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.913832 (E_RNA) where: Base-Base interactions energy: -866.928 where: short stacking energy: -376.437 Base-Backbone interact. energy: -1.160 local terms energy: -389.825853 where: bonds (distance) C4'-P energy: -76.675 bonds (distance) P-C4' energy: -81.010 flat angles C4'-P-C4' energy: -84.206 flat angles P-C4'-P energy: -52.234 tors. eta vs tors. theta energy: -95.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1215.404288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.404288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.154288 (E_RNA) where: Base-Base interactions energy: -833.504 where: short stacking energy: -376.024 Base-Backbone interact. energy: -2.368 local terms energy: -412.282060 where: bonds (distance) C4'-P energy: -75.303 bonds (distance) P-C4' energy: -85.434 flat angles C4'-P-C4' energy: -86.677 flat angles P-C4'-P energy: -57.635 tors. eta vs tors. theta energy: -107.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1106.258035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.258035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.008035 (E_RNA) where: Base-Base interactions energy: -756.537 where: short stacking energy: -338.819 Base-Backbone interact. energy: -0.142 local terms energy: -382.329108 where: bonds (distance) C4'-P energy: -79.651 bonds (distance) P-C4' energy: -79.771 flat angles C4'-P-C4' energy: -76.879 flat angles P-C4'-P energy: -55.286 tors. eta vs tors. theta energy: -90.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -965.763182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.763182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.513182 (E_RNA) where: Base-Base interactions energy: -669.302 where: short stacking energy: -274.046 Base-Backbone interact. energy: -2.213 local terms energy: -326.998377 where: bonds (distance) C4'-P energy: -61.527 bonds (distance) P-C4' energy: -83.474 flat angles C4'-P-C4' energy: -63.591 flat angles P-C4'-P energy: -55.631 tors. eta vs tors. theta energy: -62.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -954.522190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.522190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.272190 (E_RNA) where: Base-Base interactions energy: -635.145 where: short stacking energy: -284.147 Base-Backbone interact. energy: -0.801 local terms energy: -351.326703 where: bonds (distance) C4'-P energy: -59.596 bonds (distance) P-C4' energy: -72.827 flat angles C4'-P-C4' energy: -72.838 flat angles P-C4'-P energy: -64.150 tors. eta vs tors. theta energy: -81.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -722.942250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.942250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.692250 (E_RNA) where: Base-Base interactions energy: -453.384 where: short stacking energy: -208.384 Base-Backbone interact. energy: 0.178 local terms energy: -302.485987 where: bonds (distance) C4'-P energy: -65.136 bonds (distance) P-C4' energy: -73.719 flat angles C4'-P-C4' energy: -81.337 flat angles P-C4'-P energy: -39.432 tors. eta vs tors. theta energy: -42.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -633.286802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.286802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.036802 (E_RNA) where: Base-Base interactions energy: -406.150 where: short stacking energy: -182.803 Base-Backbone interact. energy: 1.867 local terms energy: -261.754198 where: bonds (distance) C4'-P energy: -63.821 bonds (distance) P-C4' energy: -50.889 flat angles C4'-P-C4' energy: -79.793 flat angles P-C4'-P energy: -38.462 tors. eta vs tors. theta energy: -28.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -494.080367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.080367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.830367 (E_RNA) where: Base-Base interactions energy: -269.232 where: short stacking energy: -142.648 Base-Backbone interact. energy: -1.685 local terms energy: -255.913544 where: bonds (distance) C4'-P energy: -71.423 bonds (distance) P-C4' energy: -71.512 flat angles C4'-P-C4' energy: -61.835 flat angles P-C4'-P energy: -36.426 tors. eta vs tors. theta energy: -14.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -312.805615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.805615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.555615 (E_RNA) where: Base-Base interactions energy: -120.838 where: short stacking energy: -73.148 Base-Backbone interact. energy: -2.280 local terms energy: -222.437176 where: bonds (distance) C4'-P energy: -61.376 bonds (distance) P-C4' energy: -74.771 flat angles C4'-P-C4' energy: -46.032 flat angles P-C4'-P energy: -46.881 tors. eta vs tors. theta energy: 6.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1360.017377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.017377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.767377 (E_RNA) where: Base-Base interactions energy: -942.455 where: short stacking energy: -383.185 Base-Backbone interact. energy: -3.885 local terms energy: -446.427717 where: bonds (distance) C4'-P energy: -84.462 bonds (distance) P-C4' energy: -74.641 flat angles C4'-P-C4' energy: -92.352 flat angles P-C4'-P energy: -75.026 tors. eta vs tors. theta energy: -119.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1241.072935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.072935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.822935 (E_RNA) where: Base-Base interactions energy: -868.651 where: short stacking energy: -362.725 Base-Backbone interact. energy: 0.483 local terms energy: -405.655453 where: bonds (distance) C4'-P energy: -73.029 bonds (distance) P-C4' energy: -80.498 flat angles C4'-P-C4' energy: -92.150 flat angles P-C4'-P energy: -63.449 tors. eta vs tors. theta energy: -96.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1214.485424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.485424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.235424 (E_RNA) where: Base-Base interactions energy: -829.578 where: short stacking energy: -375.630 Base-Backbone interact. energy: -3.019 local terms energy: -414.639059 where: bonds (distance) C4'-P energy: -85.393 bonds (distance) P-C4' energy: -62.495 flat angles C4'-P-C4' energy: -91.414 flat angles P-C4'-P energy: -58.257 tors. eta vs tors. theta energy: -117.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1074.371286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.371286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.121286 (E_RNA) where: Base-Base interactions energy: -718.277 where: short stacking energy: -299.584 Base-Backbone interact. energy: -4.062 local terms energy: -384.782636 where: bonds (distance) C4'-P energy: -77.443 bonds (distance) P-C4' energy: -81.182 flat angles C4'-P-C4' energy: -94.701 flat angles P-C4'-P energy: -50.576 tors. eta vs tors. theta energy: -80.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -941.754754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.754754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.504754 (E_RNA) where: Base-Base interactions energy: -640.740 where: short stacking energy: -275.311 Base-Backbone interact. energy: 1.250 local terms energy: -335.014795 where: bonds (distance) C4'-P energy: -68.674 bonds (distance) P-C4' energy: -83.822 flat angles C4'-P-C4' energy: -79.476 flat angles P-C4'-P energy: -50.832 tors. eta vs tors. theta energy: -52.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -904.640037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.640037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.390037 (E_RNA) where: Base-Base interactions energy: -612.258 where: short stacking energy: -253.243 Base-Backbone interact. energy: -2.308 local terms energy: -322.824503 where: bonds (distance) C4'-P energy: -72.443 bonds (distance) P-C4' energy: -71.364 flat angles C4'-P-C4' energy: -69.804 flat angles P-C4'-P energy: -51.666 tors. eta vs tors. theta energy: -57.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -704.317709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.317709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -737.067709 (E_RNA) where: Base-Base interactions energy: -449.529 where: short stacking energy: -212.710 Base-Backbone interact. energy: 3.344 local terms energy: -290.882629 where: bonds (distance) C4'-P energy: -53.649 bonds (distance) P-C4' energy: -79.864 flat angles C4'-P-C4' energy: -76.033 flat angles P-C4'-P energy: -45.902 tors. eta vs tors. theta energy: -35.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -635.102214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.102214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -667.852214 (E_RNA) where: Base-Base interactions energy: -390.193 where: short stacking energy: -192.647 Base-Backbone interact. energy: 2.397 local terms energy: -280.056285 where: bonds (distance) C4'-P energy: -60.084 bonds (distance) P-C4' energy: -73.946 flat angles C4'-P-C4' energy: -67.886 flat angles P-C4'-P energy: -46.259 tors. eta vs tors. theta energy: -31.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -413.765914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.765914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.515914 (E_RNA) where: Base-Base interactions energy: -233.753 where: short stacking energy: -108.866 Base-Backbone interact. energy: 2.185 local terms energy: -214.947753 where: bonds (distance) C4'-P energy: -70.649 bonds (distance) P-C4' energy: -65.986 flat angles C4'-P-C4' energy: -49.388 flat angles P-C4'-P energy: -29.259 tors. eta vs tors. theta energy: 0.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -286.291238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.291238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.041238 (E_RNA) where: Base-Base interactions energy: -118.359 where: short stacking energy: -94.558 Base-Backbone interact. energy: 0.236 local terms energy: -200.918342 where: bonds (distance) C4'-P energy: -64.966 bonds (distance) P-C4' energy: -61.653 flat angles C4'-P-C4' energy: -43.636 flat angles P-C4'-P energy: -35.331 tors. eta vs tors. theta energy: 4.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1328.853726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.853726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.603726 (E_RNA) where: Base-Base interactions energy: -938.613 where: short stacking energy: -383.362 Base-Backbone interact. energy: 1.921 local terms energy: -424.911255 where: bonds (distance) C4'-P energy: -67.587 bonds (distance) P-C4' energy: -90.358 flat angles C4'-P-C4' energy: -87.410 flat angles P-C4'-P energy: -62.132 tors. eta vs tors. theta energy: -117.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1229.765174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.765174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.515174 (E_RNA) where: Base-Base interactions energy: -849.907 where: short stacking energy: -371.055 Base-Backbone interact. energy: -0.213 local terms energy: -412.395009 where: bonds (distance) C4'-P energy: -79.392 bonds (distance) P-C4' energy: -83.257 flat angles C4'-P-C4' energy: -92.438 flat angles P-C4'-P energy: -59.878 tors. eta vs tors. theta energy: -97.430 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1190.345505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.345505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.095505 (E_RNA) where: Base-Base interactions energy: -835.185 where: short stacking energy: -370.983 Base-Backbone interact. energy: -1.453 local terms energy: -386.457989 where: bonds (distance) C4'-P energy: -59.422 bonds (distance) P-C4' energy: -72.784 flat angles C4'-P-C4' energy: -83.670 flat angles P-C4'-P energy: -69.722 tors. eta vs tors. theta energy: -100.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1077.854449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.854449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.604449 (E_RNA) where: Base-Base interactions energy: -745.583 where: short stacking energy: -334.094 Base-Backbone interact. energy: -0.299 local terms energy: -364.722855 where: bonds (distance) C4'-P energy: -69.505 bonds (distance) P-C4' energy: -78.600 flat angles C4'-P-C4' energy: -79.157 flat angles P-C4'-P energy: -55.496 tors. eta vs tors. theta energy: -81.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -947.350702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.350702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.100702 (E_RNA) where: Base-Base interactions energy: -636.438 where: short stacking energy: -279.081 Base-Backbone interact. energy: -2.101 local terms energy: -341.561576 where: bonds (distance) C4'-P energy: -77.100 bonds (distance) P-C4' energy: -76.734 flat angles C4'-P-C4' energy: -81.178 flat angles P-C4'-P energy: -42.588 tors. eta vs tors. theta energy: -63.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -951.549528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.549528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.299528 (E_RNA) where: Base-Base interactions energy: -629.506 where: short stacking energy: -292.090 Base-Backbone interact. energy: -2.401 local terms energy: -352.391815 where: bonds (distance) C4'-P energy: -69.813 bonds (distance) P-C4' energy: -79.752 flat angles C4'-P-C4' energy: -74.875 flat angles P-C4'-P energy: -55.089 tors. eta vs tors. theta energy: -72.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -744.306325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.306325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.056325 (E_RNA) where: Base-Base interactions energy: -457.278 where: short stacking energy: -226.306 Base-Backbone interact. energy: 1.346 local terms energy: -321.124434 where: bonds (distance) C4'-P energy: -57.624 bonds (distance) P-C4' energy: -64.592 flat angles C4'-P-C4' energy: -76.898 flat angles P-C4'-P energy: -66.053 tors. eta vs tors. theta energy: -55.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -596.483591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.483591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -629.233591 (E_RNA) where: Base-Base interactions energy: -349.812 where: short stacking energy: -181.230 Base-Backbone interact. energy: -0.874 local terms energy: -278.547608 where: bonds (distance) C4'-P energy: -71.527 bonds (distance) P-C4' energy: -71.803 flat angles C4'-P-C4' energy: -69.968 flat angles P-C4'-P energy: -43.229 tors. eta vs tors. theta energy: -22.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -392.455811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.455811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.205811 (E_RNA) where: Base-Base interactions energy: -201.176 where: short stacking energy: -110.605 Base-Backbone interact. energy: 4.257 local terms energy: -228.287055 where: bonds (distance) C4'-P energy: -71.788 bonds (distance) P-C4' energy: -60.589 flat angles C4'-P-C4' energy: -63.389 flat angles P-C4'-P energy: -38.057 tors. eta vs tors. theta energy: 5.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -305.141406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.141406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.891406 (E_RNA) where: Base-Base interactions energy: -133.459 where: short stacking energy: -93.551 Base-Backbone interact. energy: 3.354 local terms energy: -207.785597 where: bonds (distance) C4'-P energy: -67.420 bonds (distance) P-C4' energy: -67.718 flat angles C4'-P-C4' energy: -41.101 flat angles P-C4'-P energy: -47.855 tors. eta vs tors. theta energy: 16.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1336.544175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.544175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.294175 (E_RNA) where: Base-Base interactions energy: -936.027 where: short stacking energy: -410.069 Base-Backbone interact. energy: -0.782 local terms energy: -432.485237 where: bonds (distance) C4'-P energy: -89.862 bonds (distance) P-C4' energy: -84.189 flat angles C4'-P-C4' energy: -86.109 flat angles P-C4'-P energy: -56.179 tors. eta vs tors. theta energy: -116.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1199.661317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.661317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.411317 (E_RNA) where: Base-Base interactions energy: -820.676 where: short stacking energy: -359.747 Base-Backbone interact. energy: 1.197 local terms energy: -412.932461 where: bonds (distance) C4'-P energy: -83.798 bonds (distance) P-C4' energy: -85.363 flat angles C4'-P-C4' energy: -87.199 flat angles P-C4'-P energy: -62.350 tors. eta vs tors. theta energy: -94.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1208.413903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.413903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.163903 (E_RNA) where: Base-Base interactions energy: -830.548 where: short stacking energy: -371.545 Base-Backbone interact. energy: -2.595 local terms energy: -408.021263 where: bonds (distance) C4'-P energy: -81.585 bonds (distance) P-C4' energy: -83.403 flat angles C4'-P-C4' energy: -84.882 flat angles P-C4'-P energy: -50.634 tors. eta vs tors. theta energy: -107.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1070.242491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.242491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.992491 (E_RNA) where: Base-Base interactions energy: -725.793 where: short stacking energy: -303.448 Base-Backbone interact. energy: -1.455 local terms energy: -375.744373 where: bonds (distance) C4'-P energy: -69.314 bonds (distance) P-C4' energy: -80.354 flat angles C4'-P-C4' energy: -85.420 flat angles P-C4'-P energy: -61.032 tors. eta vs tors. theta energy: -79.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -963.890739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.890739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.640739 (E_RNA) where: Base-Base interactions energy: -654.062 where: short stacking energy: -281.993 Base-Backbone interact. energy: -0.263 local terms energy: -342.314990 where: bonds (distance) C4'-P energy: -74.657 bonds (distance) P-C4' energy: -76.017 flat angles C4'-P-C4' energy: -84.305 flat angles P-C4'-P energy: -43.328 tors. eta vs tors. theta energy: -64.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -916.739082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.739082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.489082 (E_RNA) where: Base-Base interactions energy: -611.437 where: short stacking energy: -286.069 Base-Backbone interact. energy: -2.132 local terms energy: -335.920110 where: bonds (distance) C4'-P energy: -67.036 bonds (distance) P-C4' energy: -78.052 flat angles C4'-P-C4' energy: -72.954 flat angles P-C4'-P energy: -54.430 tors. eta vs tors. theta energy: -63.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -674.698342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.698342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.448342 (E_RNA) where: Base-Base interactions energy: -415.800 where: short stacking energy: -207.617 Base-Backbone interact. energy: -0.998 local terms energy: -290.650636 where: bonds (distance) C4'-P energy: -58.129 bonds (distance) P-C4' energy: -75.601 flat angles C4'-P-C4' energy: -65.952 flat angles P-C4'-P energy: -51.773 tors. eta vs tors. theta energy: -39.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -551.870294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.870294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.620294 (E_RNA) where: Base-Base interactions energy: -297.379 where: short stacking energy: -158.179 Base-Backbone interact. energy: 2.897 local terms energy: -290.138191 where: bonds (distance) C4'-P energy: -90.721 bonds (distance) P-C4' energy: -76.947 flat angles C4'-P-C4' energy: -63.677 flat angles P-C4'-P energy: -47.835 tors. eta vs tors. theta energy: -10.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -374.456108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.456108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.206108 (E_RNA) where: Base-Base interactions energy: -202.766 where: short stacking energy: -127.030 Base-Backbone interact. energy: 0.427 local terms energy: -204.867025 where: bonds (distance) C4'-P energy: -63.331 bonds (distance) P-C4' energy: -59.895 flat angles C4'-P-C4' energy: -44.180 flat angles P-C4'-P energy: -35.594 tors. eta vs tors. theta energy: -1.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -341.184608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.184608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.934608 (E_RNA) where: Base-Base interactions energy: -161.820 where: short stacking energy: -88.899 Base-Backbone interact. energy: 2.358 local terms energy: -214.471970 where: bonds (distance) C4'-P energy: -71.266 bonds (distance) P-C4' energy: -76.964 flat angles C4'-P-C4' energy: -63.029 flat angles P-C4'-P energy: -18.829 tors. eta vs tors. theta energy: 15.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1362.344120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.344120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.094120 (E_RNA) where: Base-Base interactions energy: -960.278 where: short stacking energy: -395.471 Base-Backbone interact. energy: -4.379 local terms energy: -430.437435 where: bonds (distance) C4'-P energy: -76.990 bonds (distance) P-C4' energy: -89.992 flat angles C4'-P-C4' energy: -94.202 flat angles P-C4'-P energy: -56.181 tors. eta vs tors. theta energy: -113.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1257.130555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.130555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.880555 (E_RNA) where: Base-Base interactions energy: -872.655 where: short stacking energy: -406.717 Base-Backbone interact. energy: -0.208 local terms energy: -417.018306 where: bonds (distance) C4'-P energy: -68.839 bonds (distance) P-C4' energy: -84.137 flat angles C4'-P-C4' energy: -94.956 flat angles P-C4'-P energy: -55.065 tors. eta vs tors. theta energy: -114.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1176.528326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.528326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1209.278326 (E_RNA) where: Base-Base interactions energy: -798.728 where: short stacking energy: -333.096 Base-Backbone interact. energy: -2.193 local terms energy: -408.357318 where: bonds (distance) C4'-P energy: -89.944 bonds (distance) P-C4' energy: -80.974 flat angles C4'-P-C4' energy: -89.303 flat angles P-C4'-P energy: -61.861 tors. eta vs tors. theta energy: -86.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1084.317025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.317025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.067025 (E_RNA) where: Base-Base interactions energy: -742.735 where: short stacking energy: -311.942 Base-Backbone interact. energy: 1.278 local terms energy: -375.610064 where: bonds (distance) C4'-P energy: -74.884 bonds (distance) P-C4' energy: -82.676 flat angles C4'-P-C4' energy: -88.029 flat angles P-C4'-P energy: -51.539 tors. eta vs tors. theta energy: -78.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -988.784410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.784410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.534410 (E_RNA) where: Base-Base interactions energy: -678.094 where: short stacking energy: -284.952 Base-Backbone interact. energy: 0.815 local terms energy: -344.255070 where: bonds (distance) C4'-P energy: -69.476 bonds (distance) P-C4' energy: -70.155 flat angles C4'-P-C4' energy: -75.986 flat angles P-C4'-P energy: -55.443 tors. eta vs tors. theta energy: -73.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -957.329371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.329371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.079371 (E_RNA) where: Base-Base interactions energy: -650.996 where: short stacking energy: -271.128 Base-Backbone interact. energy: -2.022 local terms energy: -337.062219 where: bonds (distance) C4'-P energy: -66.581 bonds (distance) P-C4' energy: -77.250 flat angles C4'-P-C4' energy: -85.086 flat angles P-C4'-P energy: -38.737 tors. eta vs tors. theta energy: -69.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -646.601777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -646.601777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.351777 (E_RNA) where: Base-Base interactions energy: -402.428 where: short stacking energy: -219.578 Base-Backbone interact. energy: -1.193 local terms energy: -275.850048 where: bonds (distance) C4'-P energy: -62.781 bonds (distance) P-C4' energy: -68.892 flat angles C4'-P-C4' energy: -78.507 flat angles P-C4'-P energy: -29.893 tors. eta vs tors. theta energy: -35.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.119 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -537.636952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -537.636952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.386952 (E_RNA) where: Base-Base interactions energy: -295.402 where: short stacking energy: -145.180 Base-Backbone interact. energy: 0.937 local terms energy: -275.921972 where: bonds (distance) C4'-P energy: -71.249 bonds (distance) P-C4' energy: -78.678 flat angles C4'-P-C4' energy: -75.142 flat angles P-C4'-P energy: -40.228 tors. eta vs tors. theta energy: -10.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -415.960941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.960941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.710941 (E_RNA) where: Base-Base interactions energy: -207.736 where: short stacking energy: -109.124 Base-Backbone interact. energy: 1.133 local terms energy: -242.108434 where: bonds (distance) C4'-P energy: -76.086 bonds (distance) P-C4' energy: -84.373 flat angles C4'-P-C4' energy: -61.946 flat angles P-C4'-P energy: -31.001 tors. eta vs tors. theta energy: 11.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -325.341986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.341986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.091986 (E_RNA) where: Base-Base interactions energy: -143.735 where: short stacking energy: -103.054 Base-Backbone interact. energy: 0.114 local terms energy: -215.766467 where: bonds (distance) C4'-P energy: -74.820 bonds (distance) P-C4' energy: -74.089 flat angles C4'-P-C4' energy: -57.523 flat angles P-C4'-P energy: -23.543 tors. eta vs tors. theta energy: 14.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.295 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1370.819220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.819220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1403.569220 (E_RNA) where: Base-Base interactions energy: -964.791 where: short stacking energy: -406.816 Base-Backbone interact. energy: -2.764 local terms energy: -436.014102 where: bonds (distance) C4'-P energy: -78.727 bonds (distance) P-C4' energy: -79.969 flat angles C4'-P-C4' energy: -94.459 flat angles P-C4'-P energy: -62.096 tors. eta vs tors. theta energy: -120.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1255.083559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.083559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.833559 (E_RNA) where: Base-Base interactions energy: -890.358 where: short stacking energy: -400.579 Base-Backbone interact. energy: 3.903 local terms energy: -401.378578 where: bonds (distance) C4'-P energy: -78.276 bonds (distance) P-C4' energy: -74.564 flat angles C4'-P-C4' energy: -91.528 flat angles P-C4'-P energy: -48.659 tors. eta vs tors. theta energy: -108.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1194.030756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.030756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.780756 (E_RNA) where: Base-Base interactions energy: -837.835 where: short stacking energy: -348.349 Base-Backbone interact. energy: -3.479 local terms energy: -385.466275 where: bonds (distance) C4'-P energy: -74.243 bonds (distance) P-C4' energy: -74.260 flat angles C4'-P-C4' energy: -74.454 flat angles P-C4'-P energy: -67.733 tors. eta vs tors. theta energy: -94.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1068.023278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.023278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.773278 (E_RNA) where: Base-Base interactions energy: -730.724 where: short stacking energy: -304.743 Base-Backbone interact. energy: -2.520 local terms energy: -367.529235 where: bonds (distance) C4'-P energy: -75.391 bonds (distance) P-C4' energy: -93.694 flat angles C4'-P-C4' energy: -76.704 flat angles P-C4'-P energy: -45.009 tors. eta vs tors. theta energy: -76.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -977.815395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.815395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.565395 (E_RNA) where: Base-Base interactions energy: -671.886 where: short stacking energy: -294.499 Base-Backbone interact. energy: -0.341 local terms energy: -338.338824 where: bonds (distance) C4'-P energy: -63.369 bonds (distance) P-C4' energy: -72.961 flat angles C4'-P-C4' energy: -75.041 flat angles P-C4'-P energy: -48.002 tors. eta vs tors. theta energy: -78.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -944.840944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.840944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.590944 (E_RNA) where: Base-Base interactions energy: -618.514 where: short stacking energy: -271.346 Base-Backbone interact. energy: -1.096 local terms energy: -357.980185 where: bonds (distance) C4'-P energy: -75.596 bonds (distance) P-C4' energy: -76.012 flat angles C4'-P-C4' energy: -84.954 flat angles P-C4'-P energy: -45.208 tors. eta vs tors. theta energy: -76.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -675.224986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.224986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.974986 (E_RNA) where: Base-Base interactions energy: -399.726 where: short stacking energy: -210.857 Base-Backbone interact. energy: 1.036 local terms energy: -309.285700 where: bonds (distance) C4'-P energy: -61.982 bonds (distance) P-C4' energy: -82.784 flat angles C4'-P-C4' energy: -69.536 flat angles P-C4'-P energy: -56.260 tors. eta vs tors. theta energy: -38.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -565.863971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.863971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.613971 (E_RNA) where: Base-Base interactions energy: -304.054 where: short stacking energy: -144.595 Base-Backbone interact. energy: -0.116 local terms energy: -294.444285 where: bonds (distance) C4'-P energy: -72.932 bonds (distance) P-C4' energy: -87.496 flat angles C4'-P-C4' energy: -69.187 flat angles P-C4'-P energy: -33.509 tors. eta vs tors. theta energy: -31.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -394.851835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.851835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.601835 (E_RNA) where: Base-Base interactions energy: -178.955 where: short stacking energy: -115.766 Base-Backbone interact. energy: -1.675 local terms energy: -246.971436 where: bonds (distance) C4'-P energy: -71.359 bonds (distance) P-C4' energy: -71.260 flat angles C4'-P-C4' energy: -63.817 flat angles P-C4'-P energy: -49.218 tors. eta vs tors. theta energy: 8.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -325.395815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.395815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.145815 (E_RNA) where: Base-Base interactions energy: -136.317 where: short stacking energy: -108.589 Base-Backbone interact. energy: -0.227 local terms energy: -221.602381 where: bonds (distance) C4'-P energy: -62.355 bonds (distance) P-C4' energy: -76.414 flat angles C4'-P-C4' energy: -52.527 flat angles P-C4'-P energy: -40.820 tors. eta vs tors. theta energy: 10.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1354.188678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.188678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.938678 (E_RNA) where: Base-Base interactions energy: -946.291 where: short stacking energy: -394.938 Base-Backbone interact. energy: -2.353 local terms energy: -438.295343 where: bonds (distance) C4'-P energy: -86.983 bonds (distance) P-C4' energy: -91.412 flat angles C4'-P-C4' energy: -84.455 flat angles P-C4'-P energy: -63.045 tors. eta vs tors. theta energy: -112.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1255.430996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.430996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.180996 (E_RNA) where: Base-Base interactions energy: -863.978 where: short stacking energy: -392.172 Base-Backbone interact. energy: -1.263 local terms energy: -422.939957 where: bonds (distance) C4'-P energy: -81.749 bonds (distance) P-C4' energy: -86.872 flat angles C4'-P-C4' energy: -81.369 flat angles P-C4'-P energy: -61.286 tors. eta vs tors. theta energy: -111.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1181.830593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.830593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.580593 (E_RNA) where: Base-Base interactions energy: -815.128 where: short stacking energy: -361.675 Base-Backbone interact. energy: -3.100 local terms energy: -396.352630 where: bonds (distance) C4'-P energy: -85.873 bonds (distance) P-C4' energy: -75.343 flat angles C4'-P-C4' energy: -82.930 flat angles P-C4'-P energy: -51.032 tors. eta vs tors. theta energy: -101.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -1069.738811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.738811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.488811 (E_RNA) where: Base-Base interactions energy: -734.540 where: short stacking energy: -294.228 Base-Backbone interact. energy: -2.159 local terms energy: -365.882440 where: bonds (distance) C4'-P energy: -66.667 bonds (distance) P-C4' energy: -77.329 flat angles C4'-P-C4' energy: -79.221 flat angles P-C4'-P energy: -61.337 tors. eta vs tors. theta energy: -81.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.092 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -979.950182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.950182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.700182 (E_RNA) where: Base-Base interactions energy: -671.351 where: short stacking energy: -311.612 Base-Backbone interact. energy: 0.051 local terms energy: -341.399316 where: bonds (distance) C4'-P energy: -71.481 bonds (distance) P-C4' energy: -84.336 flat angles C4'-P-C4' energy: -77.499 flat angles P-C4'-P energy: -39.397 tors. eta vs tors. theta energy: -68.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -981.385725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -981.385725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.135725 (E_RNA) where: Base-Base interactions energy: -673.304 where: short stacking energy: -295.886 Base-Backbone interact. energy: -1.743 local terms energy: -339.088560 where: bonds (distance) C4'-P energy: -66.515 bonds (distance) P-C4' energy: -79.494 flat angles C4'-P-C4' energy: -63.914 flat angles P-C4'-P energy: -52.166 tors. eta vs tors. theta energy: -76.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -645.016599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.016599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.766599 (E_RNA) where: Base-Base interactions energy: -412.053 where: short stacking energy: -212.466 Base-Backbone interact. energy: -1.238 local terms energy: -264.475645 where: bonds (distance) C4'-P energy: -44.024 bonds (distance) P-C4' energy: -86.984 flat angles C4'-P-C4' energy: -64.949 flat angles P-C4'-P energy: -35.045 tors. eta vs tors. theta energy: -33.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -571.451372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.451372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.201372 (E_RNA) where: Base-Base interactions energy: -334.615 where: short stacking energy: -166.114 Base-Backbone interact. energy: 1.934 local terms energy: -271.519984 where: bonds (distance) C4'-P energy: -63.649 bonds (distance) P-C4' energy: -70.299 flat angles C4'-P-C4' energy: -80.860 flat angles P-C4'-P energy: -43.285 tors. eta vs tors. theta energy: -13.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -412.271220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.271220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.021220 (E_RNA) where: Base-Base interactions energy: -204.247 where: short stacking energy: -124.208 Base-Backbone interact. energy: -0.692 local terms energy: -240.082361 where: bonds (distance) C4'-P energy: -68.670 bonds (distance) P-C4' energy: -73.381 flat angles C4'-P-C4' energy: -53.381 flat angles P-C4'-P energy: -35.738 tors. eta vs tors. theta energy: -8.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -292.625193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.625193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.375193 (E_RNA) where: Base-Base interactions energy: -118.961 where: short stacking energy: -102.044 Base-Backbone interact. energy: 1.425 local terms energy: -207.839408 where: bonds (distance) C4'-P energy: -57.244 bonds (distance) P-C4' energy: -72.017 flat angles C4'-P-C4' energy: -48.868 flat angles P-C4'-P energy: -36.196 tors. eta vs tors. theta energy: 6.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1342.976761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.976761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.726761 (E_RNA) where: Base-Base interactions energy: -944.873 where: short stacking energy: -396.513 Base-Backbone interact. energy: 1.138 local terms energy: -431.991848 where: bonds (distance) C4'-P energy: -79.274 bonds (distance) P-C4' energy: -91.891 flat angles C4'-P-C4' energy: -89.198 flat angles P-C4'-P energy: -59.169 tors. eta vs tors. theta energy: -112.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1266.951619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.951619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.701619 (E_RNA) where: Base-Base interactions energy: -886.628 where: short stacking energy: -403.423 Base-Backbone interact. energy: -0.829 local terms energy: -412.244372 where: bonds (distance) C4'-P energy: -74.499 bonds (distance) P-C4' energy: -77.133 flat angles C4'-P-C4' energy: -94.678 flat angles P-C4'-P energy: -56.955 tors. eta vs tors. theta energy: -108.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1128.990121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.990121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.740121 (E_RNA) where: Base-Base interactions energy: -782.396 where: short stacking energy: -331.779 Base-Backbone interact. energy: 0.056 local terms energy: -379.399681 where: bonds (distance) C4'-P energy: -76.706 bonds (distance) P-C4' energy: -77.932 flat angles C4'-P-C4' energy: -81.456 flat angles P-C4'-P energy: -55.965 tors. eta vs tors. theta energy: -87.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -1159.513011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.513011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.263011 (E_RNA) where: Base-Base interactions energy: -804.423 where: short stacking energy: -361.258 Base-Backbone interact. energy: 0.798 local terms energy: -388.637643 where: bonds (distance) C4'-P energy: -76.161 bonds (distance) P-C4' energy: -76.483 flat angles C4'-P-C4' energy: -81.299 flat angles P-C4'-P energy: -46.879 tors. eta vs tors. theta energy: -107.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -1077.303193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.303193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.053193 (E_RNA) where: Base-Base interactions energy: -748.251 where: short stacking energy: -339.081 Base-Backbone interact. energy: -3.007 local terms energy: -358.795032 where: bonds (distance) C4'-P energy: -73.246 bonds (distance) P-C4' energy: -81.122 flat angles C4'-P-C4' energy: -75.986 flat angles P-C4'-P energy: -36.635 tors. eta vs tors. theta energy: -91.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -907.048247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.048247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.798247 (E_RNA) where: Base-Base interactions energy: -619.869 where: short stacking energy: -259.372 Base-Backbone interact. energy: -1.166 local terms energy: -318.762659 where: bonds (distance) C4'-P energy: -74.885 bonds (distance) P-C4' energy: -67.630 flat angles C4'-P-C4' energy: -77.378 flat angles P-C4'-P energy: -43.790 tors. eta vs tors. theta energy: -55.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -636.748982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.748982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.498982 (E_RNA) where: Base-Base interactions energy: -380.739 where: short stacking energy: -203.458 Base-Backbone interact. energy: -1.212 local terms energy: -287.547183 where: bonds (distance) C4'-P energy: -55.059 bonds (distance) P-C4' energy: -74.651 flat angles C4'-P-C4' energy: -79.295 flat angles P-C4'-P energy: -47.361 tors. eta vs tors. theta energy: -31.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -613.664486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.664486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.414486 (E_RNA) where: Base-Base interactions energy: -397.947 where: short stacking energy: -191.038 Base-Backbone interact. energy: 0.028 local terms energy: -248.494851 where: bonds (distance) C4'-P energy: -64.570 bonds (distance) P-C4' energy: -68.331 flat angles C4'-P-C4' energy: -57.137 flat angles P-C4'-P energy: -30.026 tors. eta vs tors. theta energy: -28.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -424.159286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.159286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.909286 (E_RNA) where: Base-Base interactions energy: -229.703 where: short stacking energy: -124.465 Base-Backbone interact. energy: 3.464 local terms energy: -230.670543 where: bonds (distance) C4'-P energy: -60.036 bonds (distance) P-C4' energy: -81.882 flat angles C4'-P-C4' energy: -68.535 flat angles P-C4'-P energy: -32.194 tors. eta vs tors. theta energy: 11.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -292.424606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.424606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.174606 (E_RNA) where: Base-Base interactions energy: -114.001 where: short stacking energy: -105.555 Base-Backbone interact. energy: 1.906 local terms energy: -213.079807 where: bonds (distance) C4'-P energy: -69.219 bonds (distance) P-C4' energy: -57.203 flat angles C4'-P-C4' energy: -53.903 flat angles P-C4'-P energy: -34.466 tors. eta vs tors. theta energy: 1.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1365.072135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.072135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.822135 (E_RNA) where: Base-Base interactions energy: -943.015 where: short stacking energy: -411.169 Base-Backbone interact. energy: -0.936 local terms energy: -453.870587 where: bonds (distance) C4'-P energy: -87.869 bonds (distance) P-C4' energy: -90.944 flat angles C4'-P-C4' energy: -97.767 flat angles P-C4'-P energy: -60.605 tors. eta vs tors. theta energy: -116.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1251.130265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.130265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.880265 (E_RNA) where: Base-Base interactions energy: -864.974 where: short stacking energy: -371.390 Base-Backbone interact. energy: -4.569 local terms energy: -414.337237 where: bonds (distance) C4'-P energy: -83.144 bonds (distance) P-C4' energy: -92.652 flat angles C4'-P-C4' energy: -90.639 flat angles P-C4'-P energy: -44.962 tors. eta vs tors. theta energy: -102.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1162.606948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.606948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.356948 (E_RNA) where: Base-Base interactions energy: -805.130 where: short stacking energy: -367.638 Base-Backbone interact. energy: -0.823 local terms energy: -389.403694 where: bonds (distance) C4'-P energy: -78.851 bonds (distance) P-C4' energy: -66.967 flat angles C4'-P-C4' energy: -83.825 flat angles P-C4'-P energy: -63.819 tors. eta vs tors. theta energy: -95.942 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1142.752968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.752968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.502968 (E_RNA) where: Base-Base interactions energy: -796.932 where: short stacking energy: -331.818 Base-Backbone interact. energy: -0.808 local terms energy: -377.762659 where: bonds (distance) C4'-P energy: -72.099 bonds (distance) P-C4' energy: -71.358 flat angles C4'-P-C4' energy: -93.689 flat angles P-C4'-P energy: -48.570 tors. eta vs tors. theta energy: -92.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -1043.479186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.479186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.229186 (E_RNA) where: Base-Base interactions energy: -710.528 where: short stacking energy: -325.145 Base-Backbone interact. energy: -2.495 local terms energy: -363.206220 where: bonds (distance) C4'-P energy: -66.777 bonds (distance) P-C4' energy: -76.238 flat angles C4'-P-C4' energy: -90.096 flat angles P-C4'-P energy: -47.241 tors. eta vs tors. theta energy: -82.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -897.835354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.835354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.585354 (E_RNA) where: Base-Base interactions energy: -599.984 where: short stacking energy: -270.526 Base-Backbone interact. energy: -1.138 local terms energy: -329.463593 where: bonds (distance) C4'-P energy: -77.878 bonds (distance) P-C4' energy: -67.973 flat angles C4'-P-C4' energy: -86.033 flat angles P-C4'-P energy: -41.950 tors. eta vs tors. theta energy: -55.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -650.618037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.618037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -683.368037 (E_RNA) where: Base-Base interactions energy: -386.692 where: short stacking energy: -194.385 Base-Backbone interact. energy: 1.241 local terms energy: -297.916814 where: bonds (distance) C4'-P energy: -77.127 bonds (distance) P-C4' energy: -69.111 flat angles C4'-P-C4' energy: -75.784 flat angles P-C4'-P energy: -47.449 tors. eta vs tors. theta energy: -28.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -584.661655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.661655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -617.411655 (E_RNA) where: Base-Base interactions energy: -364.356 where: short stacking energy: -166.620 Base-Backbone interact. energy: -2.835 local terms energy: -250.220825 where: bonds (distance) C4'-P energy: -67.314 bonds (distance) P-C4' energy: -54.367 flat angles C4'-P-C4' energy: -55.384 flat angles P-C4'-P energy: -54.631 tors. eta vs tors. theta energy: -18.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -383.168284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.168284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.918284 (E_RNA) where: Base-Base interactions energy: -204.596 where: short stacking energy: -114.375 Base-Backbone interact. energy: 1.050 local terms energy: -212.371590 where: bonds (distance) C4'-P energy: -74.345 bonds (distance) P-C4' energy: -71.010 flat angles C4'-P-C4' energy: -50.996 flat angles P-C4'-P energy: -23.413 tors. eta vs tors. theta energy: 7.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -308.188762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.188762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.938762 (E_RNA) where: Base-Base interactions energy: -127.509 where: short stacking energy: -90.133 Base-Backbone interact. energy: 3.517 local terms energy: -216.946374 where: bonds (distance) C4'-P energy: -76.975 bonds (distance) P-C4' energy: -67.671 flat angles C4'-P-C4' energy: -50.863 flat angles P-C4'-P energy: -35.739 tors. eta vs tors. theta energy: 14.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -1336.796855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.796855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.546855 (E_RNA) where: Base-Base interactions energy: -928.366 where: short stacking energy: -395.950 Base-Backbone interact. energy: -0.218 local terms energy: -440.962813 where: bonds (distance) C4'-P energy: -69.252 bonds (distance) P-C4' energy: -87.307 flat angles C4'-P-C4' energy: -95.600 flat angles P-C4'-P energy: -66.224 tors. eta vs tors. theta energy: -122.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -1236.905988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.905988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.655988 (E_RNA) where: Base-Base interactions energy: -858.974 where: short stacking energy: -389.772 Base-Backbone interact. energy: 0.780 local terms energy: -411.462150 where: bonds (distance) C4'-P energy: -68.237 bonds (distance) P-C4' energy: -79.622 flat angles C4'-P-C4' energy: -91.136 flat angles P-C4'-P energy: -65.368 tors. eta vs tors. theta energy: -107.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -1142.383176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1142.383176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.133176 (E_RNA) where: Base-Base interactions energy: -781.228 where: short stacking energy: -351.687 Base-Backbone interact. energy: -0.844 local terms energy: -393.061351 where: bonds (distance) C4'-P energy: -75.354 bonds (distance) P-C4' energy: -83.086 flat angles C4'-P-C4' energy: -85.894 flat angles P-C4'-P energy: -56.394 tors. eta vs tors. theta energy: -92.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -1134.391425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.391425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.141425 (E_RNA) where: Base-Base interactions energy: -774.963 where: short stacking energy: -344.518 Base-Backbone interact. energy: -2.881 local terms energy: -389.297200 where: bonds (distance) C4'-P energy: -79.712 bonds (distance) P-C4' energy: -81.564 flat angles C4'-P-C4' energy: -84.084 flat angles P-C4'-P energy: -56.080 tors. eta vs tors. theta energy: -87.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -1053.390109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.390109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.140109 (E_RNA) where: Base-Base interactions energy: -720.518 where: short stacking energy: -329.623 Base-Backbone interact. energy: -1.962 local terms energy: -363.659135 where: bonds (distance) C4'-P energy: -70.735 bonds (distance) P-C4' energy: -62.716 flat angles C4'-P-C4' energy: -86.379 flat angles P-C4'-P energy: -56.798 tors. eta vs tors. theta energy: -87.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -884.406048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.406048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.156048 (E_RNA) where: Base-Base interactions energy: -594.565 where: short stacking energy: -299.920 Base-Backbone interact. energy: 0.770 local terms energy: -323.361129 where: bonds (distance) C4'-P energy: -73.111 bonds (distance) P-C4' energy: -72.397 flat angles C4'-P-C4' energy: -71.450 flat angles P-C4'-P energy: -42.728 tors. eta vs tors. theta energy: -63.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -656.667395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -656.667395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.417395 (E_RNA) where: Base-Base interactions energy: -401.560 where: short stacking energy: -214.674 Base-Backbone interact. energy: 3.252 local terms energy: -291.108954 where: bonds (distance) C4'-P energy: -73.119 bonds (distance) P-C4' energy: -72.059 flat angles C4'-P-C4' energy: -61.614 flat angles P-C4'-P energy: -41.190 tors. eta vs tors. theta energy: -43.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -591.684771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.684771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.434771 (E_RNA) where: Base-Base interactions energy: -367.166 where: short stacking energy: -190.749 Base-Backbone interact. energy: 1.062 local terms energy: -258.330777 where: bonds (distance) C4'-P energy: -66.762 bonds (distance) P-C4' energy: -81.114 flat angles C4'-P-C4' energy: -54.899 flat angles P-C4'-P energy: -31.874 tors. eta vs tors. theta energy: -23.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -340.374785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.374785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.124785 (E_RNA) where: Base-Base interactions energy: -138.857 where: short stacking energy: -110.105 Base-Backbone interact. energy: 3.832 local terms energy: -238.099216 where: bonds (distance) C4'-P energy: -59.461 bonds (distance) P-C4' energy: -75.656 flat angles C4'-P-C4' energy: -66.807 flat angles P-C4'-P energy: -35.364 tors. eta vs tors. theta energy: -0.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -288.676706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.676706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.426706 (E_RNA) where: Base-Base interactions energy: -109.983 where: short stacking energy: -96.663 Base-Backbone interact. energy: -1.998 local terms energy: -209.445316 where: bonds (distance) C4'-P energy: -73.348 bonds (distance) P-C4' energy: -73.731 flat angles C4'-P-C4' energy: -32.327 flat angles P-C4'-P energy: -31.408 tors. eta vs tors. theta energy: 1.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -1338.426507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.426507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.176507 (E_RNA) where: Base-Base interactions energy: -945.009 where: short stacking energy: -396.160 Base-Backbone interact. energy: -2.672 local terms energy: -423.495863 where: bonds (distance) C4'-P energy: -69.103 bonds (distance) P-C4' energy: -81.104 flat angles C4'-P-C4' energy: -92.771 flat angles P-C4'-P energy: -65.267 tors. eta vs tors. theta energy: -115.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -1229.945182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.945182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.695182 (E_RNA) where: Base-Base interactions energy: -846.455 where: short stacking energy: -372.452 Base-Backbone interact. energy: -1.718 local terms energy: -414.522618 where: bonds (distance) C4'-P energy: -74.679 bonds (distance) P-C4' energy: -85.687 flat angles C4'-P-C4' energy: -92.294 flat angles P-C4'-P energy: -60.917 tors. eta vs tors. theta energy: -100.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -1158.397387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.397387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.147387 (E_RNA) where: Base-Base interactions energy: -795.313 where: short stacking energy: -348.919 Base-Backbone interact. energy: 0.157 local terms energy: -395.990815 where: bonds (distance) C4'-P energy: -70.712 bonds (distance) P-C4' energy: -75.163 flat angles C4'-P-C4' energy: -96.810 flat angles P-C4'-P energy: -48.455 tors. eta vs tors. theta energy: -104.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -1130.671286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1130.671286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.421286 (E_RNA) where: Base-Base interactions energy: -782.857 where: short stacking energy: -362.674 Base-Backbone interact. energy: -3.809 local terms energy: -376.755570 where: bonds (distance) C4'-P energy: -60.962 bonds (distance) P-C4' energy: -91.187 flat angles C4'-P-C4' energy: -80.982 flat angles P-C4'-P energy: -47.163 tors. eta vs tors. theta energy: -96.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -1059.039329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.039329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.789329 (E_RNA) where: Base-Base interactions energy: -724.314 where: short stacking energy: -311.715 Base-Backbone interact. energy: 0.375 local terms energy: -367.849820 where: bonds (distance) C4'-P energy: -75.642 bonds (distance) P-C4' energy: -73.130 flat angles C4'-P-C4' energy: -83.528 flat angles P-C4'-P energy: -57.877 tors. eta vs tors. theta energy: -77.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -931.172984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.172984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.922984 (E_RNA) where: Base-Base interactions energy: -631.025 where: short stacking energy: -277.049 Base-Backbone interact. energy: -2.104 local terms energy: -330.793471 where: bonds (distance) C4'-P energy: -67.814 bonds (distance) P-C4' energy: -67.512 flat angles C4'-P-C4' energy: -79.987 flat angles P-C4'-P energy: -43.125 tors. eta vs tors. theta energy: -72.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -673.814417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.814417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -706.564417 (E_RNA) where: Base-Base interactions energy: -401.167 where: short stacking energy: -206.821 Base-Backbone interact. energy: -0.541 local terms energy: -304.856543 where: bonds (distance) C4'-P energy: -59.403 bonds (distance) P-C4' energy: -81.285 flat angles C4'-P-C4' energy: -75.212 flat angles P-C4'-P energy: -44.524 tors. eta vs tors. theta energy: -44.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -575.837408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.837408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.587408 (E_RNA) where: Base-Base interactions energy: -355.658 where: short stacking energy: -185.932 Base-Backbone interact. energy: -1.747 local terms energy: -251.181938 where: bonds (distance) C4'-P energy: -56.226 bonds (distance) P-C4' energy: -68.238 flat angles C4'-P-C4' energy: -73.692 flat angles P-C4'-P energy: -33.654 tors. eta vs tors. theta energy: -19.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -324.289774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.289774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.039774 (E_RNA) where: Base-Base interactions energy: -129.378 where: short stacking energy: -97.161 Base-Backbone interact. energy: 2.820 local terms energy: -230.481584 where: bonds (distance) C4'-P energy: -67.837 bonds (distance) P-C4' energy: -69.447 flat angles C4'-P-C4' energy: -58.184 flat angles P-C4'-P energy: -41.244 tors. eta vs tors. theta energy: 6.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -306.944465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.944465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.694465 (E_RNA) where: Base-Base interactions energy: -110.757 where: short stacking energy: -96.748 Base-Backbone interact. energy: 0.361 local terms energy: -229.297750 where: bonds (distance) C4'-P energy: -68.695 bonds (distance) P-C4' energy: -65.748 flat angles C4'-P-C4' energy: -70.458 flat angles P-C4'-P energy: -36.048 tors. eta vs tors. theta energy: 11.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 104 Temperature: 0.900000 Total energy: -1346.502733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.502733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.252733 (E_RNA) where: Base-Base interactions energy: -955.988 where: short stacking energy: -399.516 Base-Backbone interact. energy: -3.207 local terms energy: -420.056958 where: bonds (distance) C4'-P energy: -78.776 bonds (distance) P-C4' energy: -81.096 flat angles C4'-P-C4' energy: -89.350 flat angles P-C4'-P energy: -65.068 tors. eta vs tors. theta energy: -105.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 104 Temperature: 0.950000 Total energy: -1244.504876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.504876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.254876 (E_RNA) where: Base-Base interactions energy: -851.918 where: short stacking energy: -400.293 Base-Backbone interact. energy: -1.185 local terms energy: -425.521505 where: bonds (distance) C4'-P energy: -79.359 bonds (distance) P-C4' energy: -80.764 flat angles C4'-P-C4' energy: -88.752 flat angles P-C4'-P energy: -59.452 tors. eta vs tors. theta energy: -117.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.370 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 104 Temperature: 1.000000 Total energy: -1136.144535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.144535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.894535 (E_RNA) where: Base-Base interactions energy: -772.974 where: short stacking energy: -352.303 Base-Backbone interact. energy: -1.054 local terms energy: -394.866429 where: bonds (distance) C4'-P energy: -79.543 bonds (distance) P-C4' energy: -71.028 flat angles C4'-P-C4' energy: -92.183 flat angles P-C4'-P energy: -55.312 tors. eta vs tors. theta energy: -96.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 104 Temperature: 1.050000 Total energy: -1104.311829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.311829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.061829 (E_RNA) where: Base-Base interactions energy: -753.306 where: short stacking energy: -332.932 Base-Backbone interact. energy: -1.859 local terms energy: -381.897505 where: bonds (distance) C4'-P energy: -66.792 bonds (distance) P-C4' energy: -82.638 flat angles C4'-P-C4' energy: -81.644 flat angles P-C4'-P energy: -62.245 tors. eta vs tors. theta energy: -88.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 104 Temperature: 1.100000 Total energy: -1057.233815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.233815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.983815 (E_RNA) where: Base-Base interactions energy: -712.224 where: short stacking energy: -310.933 Base-Backbone interact. energy: -0.061 local terms energy: -377.699413 where: bonds (distance) C4'-P energy: -84.803 bonds (distance) P-C4' energy: -78.586 flat angles C4'-P-C4' energy: -81.169 flat angles P-C4'-P energy: -43.068 tors. eta vs tors. theta energy: -90.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 104 Temperature: 1.150000 Total energy: -866.122544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.122544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.872544 (E_RNA) where: Base-Base interactions energy: -574.545 where: short stacking energy: -256.487 Base-Backbone interact. energy: -1.705 local terms energy: -322.622746 where: bonds (distance) C4'-P energy: -70.271 bonds (distance) P-C4' energy: -79.427 flat angles C4'-P-C4' energy: -76.261 flat angles P-C4'-P energy: -40.242 tors. eta vs tors. theta energy: -56.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 104 Temperature: 1.200000 Total energy: -647.908168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -647.908168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.658168 (E_RNA) where: Base-Base interactions energy: -412.225 where: short stacking energy: -209.670 Base-Backbone interact. energy: -1.082 local terms energy: -267.351602 where: bonds (distance) C4'-P energy: -63.534 bonds (distance) P-C4' energy: -70.132 flat angles C4'-P-C4' energy: -60.833 flat angles P-C4'-P energy: -45.257 tors. eta vs tors. theta energy: -27.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 104 Temperature: 1.250000 Total energy: -624.536451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.536451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -657.286451 (E_RNA) where: Base-Base interactions energy: -368.495 where: short stacking energy: -208.860 Base-Backbone interact. energy: -1.617 local terms energy: -287.174772 where: bonds (distance) C4'-P energy: -81.664 bonds (distance) P-C4' energy: -60.243 flat angles C4'-P-C4' energy: -73.807 flat angles P-C4'-P energy: -29.361 tors. eta vs tors. theta energy: -42.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 104 Temperature: 1.300000 Total energy: -351.885014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.885014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.635014 (E_RNA) where: Base-Base interactions energy: -135.884 where: short stacking energy: -90.925 Base-Backbone interact. energy: -1.250 local terms energy: -247.500686 where: bonds (distance) C4'-P energy: -75.076 bonds (distance) P-C4' energy: -88.638 flat angles C4'-P-C4' energy: -60.209 flat angles P-C4'-P energy: -46.819 tors. eta vs tors. theta energy: 23.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 104 Temperature: 1.350000 Total energy: -279.411477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.411477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.161477 (E_RNA) where: Base-Base interactions energy: -112.686 where: short stacking energy: -81.058 Base-Backbone interact. energy: 4.429 local terms energy: -203.904281 where: bonds (distance) C4'-P energy: -77.357 bonds (distance) P-C4' energy: -70.275 flat angles C4'-P-C4' energy: -57.510 flat angles P-C4'-P energy: -28.830 tors. eta vs tors. theta energy: 30.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 105 Temperature: 0.900000 Total energy: -1353.117795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.117795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.867795 (E_RNA) where: Base-Base interactions energy: -927.896 where: short stacking energy: -426.421 Base-Backbone interact. energy: -2.411 local terms energy: -455.560491 where: bonds (distance) C4'-P energy: -79.279 bonds (distance) P-C4' energy: -77.702 flat angles C4'-P-C4' energy: -93.867 flat angles P-C4'-P energy: -77.853 tors. eta vs tors. theta energy: -126.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 105 Temperature: 0.950000 Total energy: -1235.114350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.114350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.864350 (E_RNA) where: Base-Base interactions energy: -840.097 where: short stacking energy: -373.878 Base-Backbone interact. energy: -2.445 local terms energy: -425.400497 where: bonds (distance) C4'-P energy: -80.140 bonds (distance) P-C4' energy: -80.566 flat angles C4'-P-C4' energy: -89.744 flat angles P-C4'-P energy: -65.618 tors. eta vs tors. theta energy: -109.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.078 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 105 Temperature: 1.000000 Total energy: -1151.460113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.460113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.210113 (E_RNA) where: Base-Base interactions energy: -776.785 where: short stacking energy: -344.783 Base-Backbone interact. energy: -1.463 local terms energy: -405.962505 where: bonds (distance) C4'-P energy: -82.513 bonds (distance) P-C4' energy: -77.852 flat angles C4'-P-C4' energy: -85.890 flat angles P-C4'-P energy: -62.911 tors. eta vs tors. theta energy: -96.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 105 Temperature: 1.050000 Total energy: -1078.991141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.991141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1111.741141 (E_RNA) where: Base-Base interactions energy: -743.459 where: short stacking energy: -331.488 Base-Backbone interact. energy: -3.850 local terms energy: -364.432228 where: bonds (distance) C4'-P energy: -69.596 bonds (distance) P-C4' energy: -87.540 flat angles C4'-P-C4' energy: -74.474 flat angles P-C4'-P energy: -40.323 tors. eta vs tors. theta energy: -92.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 105 Temperature: 1.100000 Total energy: -1051.833028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.833028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.583028 (E_RNA) where: Base-Base interactions energy: -716.639 where: short stacking energy: -303.272 Base-Backbone interact. energy: -1.973 local terms energy: -365.970307 where: bonds (distance) C4'-P energy: -65.246 bonds (distance) P-C4' energy: -82.995 flat angles C4'-P-C4' energy: -80.380 flat angles P-C4'-P energy: -57.015 tors. eta vs tors. theta energy: -80.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 105 Temperature: 1.150000 Total energy: -896.735474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.735474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -929.485474 (E_RNA) where: Base-Base interactions energy: -589.511 where: short stacking energy: -278.973 Base-Backbone interact. energy: -1.524 local terms energy: -338.451034 where: bonds (distance) C4'-P energy: -65.592 bonds (distance) P-C4' energy: -81.943 flat angles C4'-P-C4' energy: -72.289 flat angles P-C4'-P energy: -54.790 tors. eta vs tors. theta energy: -63.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 105 Temperature: 1.200000 Total energy: -613.398165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.398165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -646.148165 (E_RNA) where: Base-Base interactions energy: -354.262 where: short stacking energy: -190.561 Base-Backbone interact. energy: -0.536 local terms energy: -291.350298 where: bonds (distance) C4'-P energy: -66.808 bonds (distance) P-C4' energy: -68.805 flat angles C4'-P-C4' energy: -73.758 flat angles P-C4'-P energy: -47.371 tors. eta vs tors. theta energy: -34.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 105 Temperature: 1.250000 Total energy: -674.366134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.366134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.116134 (E_RNA) where: Base-Base interactions energy: -413.925 where: short stacking energy: -213.810 Base-Backbone interact. energy: -1.935 local terms energy: -291.256229 where: bonds (distance) C4'-P energy: -61.504 bonds (distance) P-C4' energy: -71.372 flat angles C4'-P-C4' energy: -71.631 flat angles P-C4'-P energy: -53.086 tors. eta vs tors. theta energy: -33.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 105 Temperature: 1.300000 Total energy: -337.669652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.669652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.419652 (E_RNA) where: Base-Base interactions energy: -136.667 where: short stacking energy: -101.363 Base-Backbone interact. energy: 0.695 local terms energy: -234.448290 where: bonds (distance) C4'-P energy: -64.984 bonds (distance) P-C4' energy: -83.544 flat angles C4'-P-C4' energy: -61.289 flat angles P-C4'-P energy: -31.467 tors. eta vs tors. theta energy: 6.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 105 Temperature: 1.350000 Total energy: -288.880602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.880602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.630602 (E_RNA) where: Base-Base interactions energy: -128.528 where: short stacking energy: -98.038 Base-Backbone interact. energy: 1.278 local terms energy: -194.380623 where: bonds (distance) C4'-P energy: -54.937 bonds (distance) P-C4' energy: -70.792 flat angles C4'-P-C4' energy: -63.627 flat angles P-C4'-P energy: -13.099 tors. eta vs tors. theta energy: 8.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 106 Temperature: 0.900000 Total energy: -1348.017737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.017737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.767737 (E_RNA) where: Base-Base interactions energy: -937.083 where: short stacking energy: -405.395 Base-Backbone interact. energy: 0.775 local terms energy: -444.459084 where: bonds (distance) C4'-P energy: -87.823 bonds (distance) P-C4' energy: -74.566 flat angles C4'-P-C4' energy: -99.436 flat angles P-C4'-P energy: -63.342 tors. eta vs tors. theta energy: -119.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 106 Temperature: 0.950000 Total energy: -1230.974662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.974662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.724662 (E_RNA) where: Base-Base interactions energy: -850.361 where: short stacking energy: -369.976 Base-Backbone interact. energy: -2.775 local terms energy: -410.588397 where: bonds (distance) C4'-P energy: -81.336 bonds (distance) P-C4' energy: -84.987 flat angles C4'-P-C4' energy: -89.443 flat angles P-C4'-P energy: -56.044 tors. eta vs tors. theta energy: -98.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 106 Temperature: 1.000000 Total energy: -1136.296468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.296468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.046468 (E_RNA) where: Base-Base interactions energy: -788.373 where: short stacking energy: -321.114 Base-Backbone interact. energy: -4.893 local terms energy: -375.780301 where: bonds (distance) C4'-P energy: -82.648 bonds (distance) P-C4' energy: -80.294 flat angles C4'-P-C4' energy: -78.446 flat angles P-C4'-P energy: -50.734 tors. eta vs tors. theta energy: -83.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 106 Temperature: 1.050000 Total energy: -1077.659279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1077.659279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.409279 (E_RNA) where: Base-Base interactions energy: -735.955 where: short stacking energy: -326.567 Base-Backbone interact. energy: -2.515 local terms energy: -371.939148 where: bonds (distance) C4'-P energy: -72.714 bonds (distance) P-C4' energy: -72.341 flat angles C4'-P-C4' energy: -83.090 flat angles P-C4'-P energy: -60.928 tors. eta vs tors. theta energy: -82.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 106 Temperature: 1.100000 Total energy: -1046.740159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.740159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.490159 (E_RNA) where: Base-Base interactions energy: -725.264 where: short stacking energy: -300.114 Base-Backbone interact. energy: 0.978 local terms energy: -355.204078 where: bonds (distance) C4'-P energy: -75.645 bonds (distance) P-C4' energy: -79.942 flat angles C4'-P-C4' energy: -76.168 flat angles P-C4'-P energy: -53.553 tors. eta vs tors. theta energy: -69.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 106 Temperature: 1.150000 Total energy: -885.968403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -885.968403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.718403 (E_RNA) where: Base-Base interactions energy: -614.649 where: short stacking energy: -243.155 Base-Backbone interact. energy: 1.447 local terms energy: -305.516024 where: bonds (distance) C4'-P energy: -70.159 bonds (distance) P-C4' energy: -69.838 flat angles C4'-P-C4' energy: -74.387 flat angles P-C4'-P energy: -44.280 tors. eta vs tors. theta energy: -46.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 106 Temperature: 1.200000 Total energy: -698.353583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.353583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.103583 (E_RNA) where: Base-Base interactions energy: -433.182 where: short stacking energy: -234.529 Base-Backbone interact. energy: -1.005 local terms energy: -296.916507 where: bonds (distance) C4'-P energy: -74.077 bonds (distance) P-C4' energy: -63.711 flat angles C4'-P-C4' energy: -75.793 flat angles P-C4'-P energy: -42.379 tors. eta vs tors. theta energy: -40.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 106 Temperature: 1.250000 Total energy: -561.452474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.452474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.202474 (E_RNA) where: Base-Base interactions energy: -348.037 where: short stacking energy: -174.862 Base-Backbone interact. energy: -0.601 local terms energy: -245.565033 where: bonds (distance) C4'-P energy: -69.946 bonds (distance) P-C4' energy: -50.167 flat angles C4'-P-C4' energy: -66.261 flat angles P-C4'-P energy: -35.063 tors. eta vs tors. theta energy: -24.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 106 Temperature: 1.300000 Total energy: -383.442438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.442438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.192438 (E_RNA) where: Base-Base interactions energy: -177.165 where: short stacking energy: -96.464 Base-Backbone interact. energy: -2.703 local terms energy: -236.324050 where: bonds (distance) C4'-P energy: -69.721 bonds (distance) P-C4' energy: -77.499 flat angles C4'-P-C4' energy: -71.058 flat angles P-C4'-P energy: -32.174 tors. eta vs tors. theta energy: 14.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 106 Temperature: 1.350000 Total energy: -296.596003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.596003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.346003 (E_RNA) where: Base-Base interactions energy: -119.846 where: short stacking energy: -110.589 Base-Backbone interact. energy: 1.458 local terms energy: -210.958692 where: bonds (distance) C4'-P energy: -51.791 bonds (distance) P-C4' energy: -69.823 flat angles C4'-P-C4' energy: -69.302 flat angles P-C4'-P energy: -23.164 tors. eta vs tors. theta energy: 3.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 107 Temperature: 0.900000 Total energy: -1349.794391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.794391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.544391 (E_RNA) where: Base-Base interactions energy: -933.503 where: short stacking energy: -423.998 Base-Backbone interact. energy: -0.159 local terms energy: -448.882793 where: bonds (distance) C4'-P energy: -79.061 bonds (distance) P-C4' energy: -86.737 flat angles C4'-P-C4' energy: -90.586 flat angles P-C4'-P energy: -67.022 tors. eta vs tors. theta energy: -125.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 107 Temperature: 0.950000 Total energy: -1222.121386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.121386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.871386 (E_RNA) where: Base-Base interactions energy: -842.084 where: short stacking energy: -364.841 Base-Backbone interact. energy: -1.517 local terms energy: -411.270599 where: bonds (distance) C4'-P energy: -83.151 bonds (distance) P-C4' energy: -75.053 flat angles C4'-P-C4' energy: -91.728 flat angles P-C4'-P energy: -60.274 tors. eta vs tors. theta energy: -101.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 107 Temperature: 1.000000 Total energy: -1122.892123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.892123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.642123 (E_RNA) where: Base-Base interactions energy: -768.010 where: short stacking energy: -322.198 Base-Backbone interact. energy: -2.770 local terms energy: -384.861977 where: bonds (distance) C4'-P energy: -71.406 bonds (distance) P-C4' energy: -73.952 flat angles C4'-P-C4' energy: -93.671 flat angles P-C4'-P energy: -62.653 tors. eta vs tors. theta energy: -83.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 107 Temperature: 1.050000 Total energy: -1149.878307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.878307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.628307 (E_RNA) where: Base-Base interactions energy: -793.020 where: short stacking energy: -351.891 Base-Backbone interact. energy: -2.574 local terms energy: -387.034234 where: bonds (distance) C4'-P energy: -72.143 bonds (distance) P-C4' energy: -86.914 flat angles C4'-P-C4' energy: -80.626 flat angles P-C4'-P energy: -53.748 tors. eta vs tors. theta energy: -93.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 107 Temperature: 1.100000 Total energy: -1015.380981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.380981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.130981 (E_RNA) where: Base-Base interactions energy: -694.200 where: short stacking energy: -300.111 Base-Backbone interact. energy: 1.855 local terms energy: -355.785540 where: bonds (distance) C4'-P energy: -68.190 bonds (distance) P-C4' energy: -76.769 flat angles C4'-P-C4' energy: -82.498 flat angles P-C4'-P energy: -49.197 tors. eta vs tors. theta energy: -79.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 107 Temperature: 1.150000 Total energy: -908.097370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.097370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.847370 (E_RNA) where: Base-Base interactions energy: -596.044 where: short stacking energy: -271.449 Base-Backbone interact. energy: -0.595 local terms energy: -344.208204 where: bonds (distance) C4'-P energy: -77.188 bonds (distance) P-C4' energy: -85.482 flat angles C4'-P-C4' energy: -71.188 flat angles P-C4'-P energy: -49.017 tors. eta vs tors. theta energy: -61.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 107 Temperature: 1.200000 Total energy: -715.802610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.802610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.552610 (E_RNA) where: Base-Base interactions energy: -462.771 where: short stacking energy: -220.124 Base-Backbone interact. energy: 1.205 local terms energy: -286.986193 where: bonds (distance) C4'-P energy: -52.449 bonds (distance) P-C4' energy: -69.482 flat angles C4'-P-C4' energy: -73.657 flat angles P-C4'-P energy: -37.542 tors. eta vs tors. theta energy: -53.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 107 Temperature: 1.250000 Total energy: -568.579606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.579606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.329606 (E_RNA) where: Base-Base interactions energy: -361.409 where: short stacking energy: -146.357 Base-Backbone interact. energy: 4.294 local terms energy: -244.214325 where: bonds (distance) C4'-P energy: -68.768 bonds (distance) P-C4' energy: -75.893 flat angles C4'-P-C4' energy: -65.790 flat angles P-C4'-P energy: -21.652 tors. eta vs tors. theta energy: -12.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 107 Temperature: 1.300000 Total energy: -366.338946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.338946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.088946 (E_RNA) where: Base-Base interactions energy: -176.045 where: short stacking energy: -112.248 Base-Backbone interact. energy: 0.457 local terms energy: -223.501673 where: bonds (distance) C4'-P energy: -61.154 bonds (distance) P-C4' energy: -67.954 flat angles C4'-P-C4' energy: -61.286 flat angles P-C4'-P energy: -31.151 tors. eta vs tors. theta energy: -1.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 107 Temperature: 1.350000 Total energy: -280.097591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.097591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.847591 (E_RNA) where: Base-Base interactions energy: -121.352 where: short stacking energy: -105.586 Base-Backbone interact. energy: 0.059 local terms energy: -191.554654 where: bonds (distance) C4'-P energy: -60.165 bonds (distance) P-C4' energy: -68.516 flat angles C4'-P-C4' energy: -61.137 flat angles P-C4'-P energy: -3.225 tors. eta vs tors. theta energy: 1.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 108 Temperature: 0.900000 Total energy: -1337.027693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1337.027693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.777693 (E_RNA) where: Base-Base interactions energy: -919.076 where: short stacking energy: -391.466 Base-Backbone interact. energy: -2.415 local terms energy: -448.287316 where: bonds (distance) C4'-P energy: -85.636 bonds (distance) P-C4' energy: -88.343 flat angles C4'-P-C4' energy: -94.308 flat angles P-C4'-P energy: -60.025 tors. eta vs tors. theta energy: -119.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 108 Temperature: 0.950000 Total energy: -1229.750919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.750919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.500919 (E_RNA) where: Base-Base interactions energy: -840.785 where: short stacking energy: -376.259 Base-Backbone interact. energy: 0.170 local terms energy: -421.885307 where: bonds (distance) C4'-P energy: -75.141 bonds (distance) P-C4' energy: -74.957 flat angles C4'-P-C4' energy: -95.541 flat angles P-C4'-P energy: -60.171 tors. eta vs tors. theta energy: -116.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 108 Temperature: 1.000000 Total energy: -1206.117685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.117685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.867685 (E_RNA) where: Base-Base interactions energy: -824.331 where: short stacking energy: -360.660 Base-Backbone interact. energy: -1.434 local terms energy: -413.102271 where: bonds (distance) C4'-P energy: -78.211 bonds (distance) P-C4' energy: -87.625 flat angles C4'-P-C4' energy: -86.856 flat angles P-C4'-P energy: -62.287 tors. eta vs tors. theta energy: -98.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 108 Temperature: 1.050000 Total energy: -1059.849793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.849793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1092.599793 (E_RNA) where: Base-Base interactions energy: -715.593 where: short stacking energy: -317.006 Base-Backbone interact. energy: -2.445 local terms energy: -374.562318 where: bonds (distance) C4'-P energy: -72.074 bonds (distance) P-C4' energy: -90.609 flat angles C4'-P-C4' energy: -79.845 flat angles P-C4'-P energy: -53.271 tors. eta vs tors. theta energy: -78.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 108 Temperature: 1.100000 Total energy: -1044.977473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.977473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1077.727473 (E_RNA) where: Base-Base interactions energy: -708.947 where: short stacking energy: -312.805 Base-Backbone interact. energy: -3.353 local terms energy: -365.427699 where: bonds (distance) C4'-P energy: -72.820 bonds (distance) P-C4' energy: -79.305 flat angles C4'-P-C4' energy: -77.388 flat angles P-C4'-P energy: -52.868 tors. eta vs tors. theta energy: -83.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 108 Temperature: 1.150000 Total energy: -904.372743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.372743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.122743 (E_RNA) where: Base-Base interactions energy: -598.043 where: short stacking energy: -310.014 Base-Backbone interact. energy: 3.806 local terms energy: -342.885684 where: bonds (distance) C4'-P energy: -55.453 bonds (distance) P-C4' energy: -79.542 flat angles C4'-P-C4' energy: -72.864 flat angles P-C4'-P energy: -49.668 tors. eta vs tors. theta energy: -85.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 108 Temperature: 1.200000 Total energy: -725.205857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.205857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.955857 (E_RNA) where: Base-Base interactions energy: -482.787 where: short stacking energy: -216.077 Base-Backbone interact. energy: 1.971 local terms energy: -277.140434 where: bonds (distance) C4'-P energy: -68.726 bonds (distance) P-C4' energy: -74.909 flat angles C4'-P-C4' energy: -63.033 flat angles P-C4'-P energy: -41.540 tors. eta vs tors. theta energy: -28.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 108 Temperature: 1.250000 Total energy: -623.442009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.442009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.192009 (E_RNA) where: Base-Base interactions energy: -365.489 where: short stacking energy: -181.470 Base-Backbone interact. energy: -1.501 local terms energy: -290.912709 where: bonds (distance) C4'-P energy: -76.459 bonds (distance) P-C4' energy: -73.211 flat angles C4'-P-C4' energy: -70.957 flat angles P-C4'-P energy: -43.605 tors. eta vs tors. theta energy: -26.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.711 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 108 Temperature: 1.300000 Total energy: -423.833391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.833391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.583391 (E_RNA) where: Base-Base interactions energy: -182.961 where: short stacking energy: -152.121 Base-Backbone interact. energy: -0.995 local terms energy: -272.626787 where: bonds (distance) C4'-P energy: -78.696 bonds (distance) P-C4' energy: -61.867 flat angles C4'-P-C4' energy: -60.065 flat angles P-C4'-P energy: -41.570 tors. eta vs tors. theta energy: -30.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 108 Temperature: 1.350000 Total energy: -293.836759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.836759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.586759 (E_RNA) where: Base-Base interactions energy: -122.003 where: short stacking energy: -92.166 Base-Backbone interact. energy: -0.302 local terms energy: -204.282194 where: bonds (distance) C4'-P energy: -67.297 bonds (distance) P-C4' energy: -72.126 flat angles C4'-P-C4' energy: -51.234 flat angles P-C4'-P energy: -26.909 tors. eta vs tors. theta energy: 13.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 109 Temperature: 0.900000 Total energy: -1329.021196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.021196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.771196 (E_RNA) where: Base-Base interactions energy: -916.942 where: short stacking energy: -391.355 Base-Backbone interact. energy: -3.087 local terms energy: -441.742558 where: bonds (distance) C4'-P energy: -78.076 bonds (distance) P-C4' energy: -83.373 flat angles C4'-P-C4' energy: -99.374 flat angles P-C4'-P energy: -60.438 tors. eta vs tors. theta energy: -120.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 109 Temperature: 0.950000 Total energy: -1257.192984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.192984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.942984 (E_RNA) where: Base-Base interactions energy: -861.279 where: short stacking energy: -379.884 Base-Backbone interact. energy: -0.451 local terms energy: -428.213089 where: bonds (distance) C4'-P energy: -86.550 bonds (distance) P-C4' energy: -91.813 flat angles C4'-P-C4' energy: -95.425 flat angles P-C4'-P energy: -51.108 tors. eta vs tors. theta energy: -103.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 109 Temperature: 1.000000 Total energy: -1223.042821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.042821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.792821 (E_RNA) where: Base-Base interactions energy: -844.778 where: short stacking energy: -388.061 Base-Backbone interact. energy: -3.187 local terms energy: -407.828574 where: bonds (distance) C4'-P energy: -70.534 bonds (distance) P-C4' energy: -80.077 flat angles C4'-P-C4' energy: -90.188 flat angles P-C4'-P energy: -57.957 tors. eta vs tors. theta energy: -109.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 109 Temperature: 1.050000 Total energy: -1117.555405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.555405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.305405 (E_RNA) where: Base-Base interactions energy: -740.585 where: short stacking energy: -338.848 Base-Backbone interact. energy: -0.955 local terms energy: -408.764799 where: bonds (distance) C4'-P energy: -80.187 bonds (distance) P-C4' energy: -84.821 flat angles C4'-P-C4' energy: -95.150 flat angles P-C4'-P energy: -60.889 tors. eta vs tors. theta energy: -87.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 109 Temperature: 1.100000 Total energy: -1003.535821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.535821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.285821 (E_RNA) where: Base-Base interactions energy: -681.532 where: short stacking energy: -303.825 Base-Backbone interact. energy: 5.030 local terms energy: -359.783679 where: bonds (distance) C4'-P energy: -70.253 bonds (distance) P-C4' energy: -71.594 flat angles C4'-P-C4' energy: -86.892 flat angles P-C4'-P energy: -52.907 tors. eta vs tors. theta energy: -78.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 109 Temperature: 1.150000 Total energy: -951.829350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.829350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.579350 (E_RNA) where: Base-Base interactions energy: -652.138 where: short stacking energy: -279.936 Base-Backbone interact. energy: -1.320 local terms energy: -331.122033 where: bonds (distance) C4'-P energy: -69.957 bonds (distance) P-C4' energy: -76.615 flat angles C4'-P-C4' energy: -79.794 flat angles P-C4'-P energy: -45.434 tors. eta vs tors. theta energy: -59.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 109 Temperature: 1.200000 Total energy: -739.177261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -739.177261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.927261 (E_RNA) where: Base-Base interactions energy: -449.778 where: short stacking energy: -229.028 Base-Backbone interact. energy: -1.922 local terms energy: -320.227770 where: bonds (distance) C4'-P energy: -62.563 bonds (distance) P-C4' energy: -89.806 flat angles C4'-P-C4' energy: -80.117 flat angles P-C4'-P energy: -42.293 tors. eta vs tors. theta energy: -45.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 109 Temperature: 1.250000 Total energy: -621.988642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.988642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.738642 (E_RNA) where: Base-Base interactions energy: -396.624 where: short stacking energy: -184.403 Base-Backbone interact. energy: 2.304 local terms energy: -260.418691 where: bonds (distance) C4'-P energy: -69.601 bonds (distance) P-C4' energy: -67.002 flat angles C4'-P-C4' energy: -62.590 flat angles P-C4'-P energy: -41.223 tors. eta vs tors. theta energy: -20.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 109 Temperature: 1.300000 Total energy: -342.292249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.292249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.042249 (E_RNA) where: Base-Base interactions energy: -122.824 where: short stacking energy: -106.853 Base-Backbone interact. energy: 1.644 local terms energy: -253.862112 where: bonds (distance) C4'-P energy: -71.094 bonds (distance) P-C4' energy: -79.902 flat angles C4'-P-C4' energy: -59.109 flat angles P-C4'-P energy: -41.259 tors. eta vs tors. theta energy: -2.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 109 Temperature: 1.350000 Total energy: -294.695229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.695229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.445229 (E_RNA) where: Base-Base interactions energy: -121.471 where: short stacking energy: -102.220 Base-Backbone interact. energy: -1.111 local terms energy: -204.862674 where: bonds (distance) C4'-P energy: -70.050 bonds (distance) P-C4' energy: -66.487 flat angles C4'-P-C4' energy: -55.073 flat angles P-C4'-P energy: -33.890 tors. eta vs tors. theta energy: 20.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 110 Temperature: 0.900000 Total energy: -1343.620851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.620851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.370851 (E_RNA) where: Base-Base interactions energy: -916.498 where: short stacking energy: -425.585 Base-Backbone interact. energy: -6.121 local terms energy: -453.752325 where: bonds (distance) C4'-P energy: -82.428 bonds (distance) P-C4' energy: -90.547 flat angles C4'-P-C4' energy: -97.976 flat angles P-C4'-P energy: -62.972 tors. eta vs tors. theta energy: -119.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 110 Temperature: 0.950000 Total energy: -1257.086488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.086488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.836488 (E_RNA) where: Base-Base interactions energy: -874.327 where: short stacking energy: -391.953 Base-Backbone interact. energy: -0.601 local terms energy: -414.909188 where: bonds (distance) C4'-P energy: -80.656 bonds (distance) P-C4' energy: -75.358 flat angles C4'-P-C4' energy: -89.193 flat angles P-C4'-P energy: -55.755 tors. eta vs tors. theta energy: -113.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 110 Temperature: 1.000000 Total energy: -1231.441959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.441959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.191959 (E_RNA) where: Base-Base interactions energy: -847.771 where: short stacking energy: -403.524 Base-Backbone interact. energy: -1.300 local terms energy: -415.120860 where: bonds (distance) C4'-P energy: -75.066 bonds (distance) P-C4' energy: -75.513 flat angles C4'-P-C4' energy: -90.025 flat angles P-C4'-P energy: -64.075 tors. eta vs tors. theta energy: -110.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 110 Temperature: 1.050000 Total energy: -1120.142767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.142767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.892767 (E_RNA) where: Base-Base interactions energy: -771.203 where: short stacking energy: -339.927 Base-Backbone interact. energy: -2.706 local terms energy: -378.983243 where: bonds (distance) C4'-P energy: -73.048 bonds (distance) P-C4' energy: -75.399 flat angles C4'-P-C4' energy: -70.199 flat angles P-C4'-P energy: -66.470 tors. eta vs tors. theta energy: -93.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 110 Temperature: 1.100000 Total energy: -977.214542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.214542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.964542 (E_RNA) where: Base-Base interactions energy: -659.462 where: short stacking energy: -299.514 Base-Backbone interact. energy: -0.099 local terms energy: -350.403309 where: bonds (distance) C4'-P energy: -71.228 bonds (distance) P-C4' energy: -77.780 flat angles C4'-P-C4' energy: -84.064 flat angles P-C4'-P energy: -44.598 tors. eta vs tors. theta energy: -72.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 110 Temperature: 1.150000 Total energy: -916.016155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.016155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.766155 (E_RNA) where: Base-Base interactions energy: -606.068 where: short stacking energy: -250.227 Base-Backbone interact. energy: -1.517 local terms energy: -341.181127 where: bonds (distance) C4'-P energy: -84.297 bonds (distance) P-C4' energy: -85.179 flat angles C4'-P-C4' energy: -79.392 flat angles P-C4'-P energy: -40.032 tors. eta vs tors. theta energy: -52.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 110 Temperature: 1.200000 Total energy: -763.903767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.903767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.653767 (E_RNA) where: Base-Base interactions energy: -484.280 where: short stacking energy: -229.153 Base-Backbone interact. energy: 2.056 local terms energy: -314.430373 where: bonds (distance) C4'-P energy: -64.304 bonds (distance) P-C4' energy: -77.437 flat angles C4'-P-C4' energy: -75.534 flat angles P-C4'-P energy: -52.013 tors. eta vs tors. theta energy: -45.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 110 Temperature: 1.250000 Total energy: -666.115526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.115526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.865526 (E_RNA) where: Base-Base interactions energy: -433.856 where: short stacking energy: -202.201 Base-Backbone interact. energy: -2.588 local terms energy: -262.421297 where: bonds (distance) C4'-P energy: -64.578 bonds (distance) P-C4' energy: -68.835 flat angles C4'-P-C4' energy: -59.225 flat angles P-C4'-P energy: -37.508 tors. eta vs tors. theta energy: -32.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 110 Temperature: 1.300000 Total energy: -315.810130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.810130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.560130 (E_RNA) where: Base-Base interactions energy: -103.579 where: short stacking energy: -81.821 Base-Backbone interact. energy: 1.212 local terms energy: -246.192716 where: bonds (distance) C4'-P energy: -65.823 bonds (distance) P-C4' energy: -92.978 flat angles C4'-P-C4' energy: -64.871 flat angles P-C4'-P energy: -49.335 tors. eta vs tors. theta energy: 26.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 110 Temperature: 1.350000 Total energy: -295.590100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.590100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.340100 (E_RNA) where: Base-Base interactions energy: -120.038 where: short stacking energy: -86.035 Base-Backbone interact. energy: -0.356 local terms energy: -209.102231 where: bonds (distance) C4'-P energy: -71.149 bonds (distance) P-C4' energy: -53.741 flat angles C4'-P-C4' energy: -63.193 flat angles P-C4'-P energy: -34.359 tors. eta vs tors. theta energy: 13.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.156 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 111 Temperature: 0.900000 Total energy: -1328.415525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.415525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.165525 (E_RNA) where: Base-Base interactions energy: -918.117 where: short stacking energy: -378.948 Base-Backbone interact. energy: -3.150 local terms energy: -439.898944 where: bonds (distance) C4'-P energy: -80.904 bonds (distance) P-C4' energy: -83.907 flat angles C4'-P-C4' energy: -96.477 flat angles P-C4'-P energy: -62.924 tors. eta vs tors. theta energy: -115.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 111 Temperature: 0.950000 Total energy: -1273.015639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.015639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.765639 (E_RNA) where: Base-Base interactions energy: -905.714 where: short stacking energy: -382.142 Base-Backbone interact. energy: -0.428 local terms energy: -399.623594 where: bonds (distance) C4'-P energy: -85.130 bonds (distance) P-C4' energy: -75.352 flat angles C4'-P-C4' energy: -81.524 flat angles P-C4'-P energy: -45.680 tors. eta vs tors. theta energy: -111.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 111 Temperature: 1.000000 Total energy: -1178.808844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.808844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.558844 (E_RNA) where: Base-Base interactions energy: -803.597 where: short stacking energy: -360.403 Base-Backbone interact. energy: 0.135 local terms energy: -408.097041 where: bonds (distance) C4'-P energy: -80.172 bonds (distance) P-C4' energy: -77.077 flat angles C4'-P-C4' energy: -85.394 flat angles P-C4'-P energy: -59.407 tors. eta vs tors. theta energy: -106.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 111 Temperature: 1.050000 Total energy: -1140.547888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.547888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.297888 (E_RNA) where: Base-Base interactions energy: -765.419 where: short stacking energy: -340.319 Base-Backbone interact. energy: -2.433 local terms energy: -405.446130 where: bonds (distance) C4'-P energy: -84.475 bonds (distance) P-C4' energy: -76.329 flat angles C4'-P-C4' energy: -80.285 flat angles P-C4'-P energy: -69.262 tors. eta vs tors. theta energy: -95.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 111 Temperature: 1.100000 Total energy: -994.657115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.657115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.407115 (E_RNA) where: Base-Base interactions energy: -665.549 where: short stacking energy: -307.308 Base-Backbone interact. energy: -1.811 local terms energy: -360.047534 where: bonds (distance) C4'-P energy: -65.285 bonds (distance) P-C4' energy: -74.809 flat angles C4'-P-C4' energy: -83.593 flat angles P-C4'-P energy: -51.450 tors. eta vs tors. theta energy: -84.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 111 Temperature: 1.150000 Total energy: -958.064491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.064491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.814491 (E_RNA) where: Base-Base interactions energy: -642.721 where: short stacking energy: -289.532 Base-Backbone interact. energy: -0.457 local terms energy: -348.257378 where: bonds (distance) C4'-P energy: -64.266 bonds (distance) P-C4' energy: -81.435 flat angles C4'-P-C4' energy: -69.133 flat angles P-C4'-P energy: -56.107 tors. eta vs tors. theta energy: -77.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.621 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 111 Temperature: 1.200000 Total energy: -777.071613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.071613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -809.821613 (E_RNA) where: Base-Base interactions energy: -506.790 where: short stacking energy: -245.977 Base-Backbone interact. energy: 6.608 local terms energy: -309.639099 where: bonds (distance) C4'-P energy: -64.958 bonds (distance) P-C4' energy: -67.921 flat angles C4'-P-C4' energy: -64.986 flat angles P-C4'-P energy: -52.547 tors. eta vs tors. theta energy: -59.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 111 Temperature: 1.250000 Total energy: -649.575211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.575211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.325211 (E_RNA) where: Base-Base interactions energy: -410.878 where: short stacking energy: -196.592 Base-Backbone interact. energy: -0.961 local terms energy: -270.486164 where: bonds (distance) C4'-P energy: -57.768 bonds (distance) P-C4' energy: -79.731 flat angles C4'-P-C4' energy: -70.529 flat angles P-C4'-P energy: -44.650 tors. eta vs tors. theta energy: -17.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 111 Temperature: 1.300000 Total energy: -447.299131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.299131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.049131 (E_RNA) where: Base-Base interactions energy: -219.198 where: short stacking energy: -125.879 Base-Backbone interact. energy: -0.674 local terms energy: -260.177119 where: bonds (distance) C4'-P energy: -66.581 bonds (distance) P-C4' energy: -80.641 flat angles C4'-P-C4' energy: -66.458 flat angles P-C4'-P energy: -37.912 tors. eta vs tors. theta energy: -8.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 111 Temperature: 1.350000 Total energy: -309.953794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.953794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.703794 (E_RNA) where: Base-Base interactions energy: -134.520 where: short stacking energy: -107.544 Base-Backbone interact. energy: -1.747 local terms energy: -206.436614 where: bonds (distance) C4'-P energy: -62.041 bonds (distance) P-C4' energy: -66.634 flat angles C4'-P-C4' energy: -57.720 flat angles P-C4'-P energy: -28.963 tors. eta vs tors. theta energy: 8.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 112 Temperature: 0.900000 Total energy: -1312.650619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.650619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.400619 (E_RNA) where: Base-Base interactions energy: -914.662 where: short stacking energy: -393.166 Base-Backbone interact. energy: -3.275 local terms energy: -427.464244 where: bonds (distance) C4'-P energy: -84.438 bonds (distance) P-C4' energy: -86.141 flat angles C4'-P-C4' energy: -92.161 flat angles P-C4'-P energy: -58.612 tors. eta vs tors. theta energy: -106.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 112 Temperature: 0.950000 Total energy: -1319.780105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.780105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.530105 (E_RNA) where: Base-Base interactions energy: -938.052 where: short stacking energy: -395.712 Base-Backbone interact. energy: 0.043 local terms energy: -414.520593 where: bonds (distance) C4'-P energy: -68.486 bonds (distance) P-C4' energy: -88.065 flat angles C4'-P-C4' energy: -72.758 flat angles P-C4'-P energy: -66.114 tors. eta vs tors. theta energy: -119.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 112 Temperature: 1.000000 Total energy: -1181.565346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.565346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.315346 (E_RNA) where: Base-Base interactions energy: -824.400 where: short stacking energy: -363.153 Base-Backbone interact. energy: -2.574 local terms energy: -387.341923 where: bonds (distance) C4'-P energy: -75.695 bonds (distance) P-C4' energy: -81.395 flat angles C4'-P-C4' energy: -78.476 flat angles P-C4'-P energy: -55.447 tors. eta vs tors. theta energy: -96.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 112 Temperature: 1.050000 Total energy: -1146.785660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1146.785660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.535660 (E_RNA) where: Base-Base interactions energy: -781.171 where: short stacking energy: -335.323 Base-Backbone interact. energy: -1.217 local terms energy: -397.147274 where: bonds (distance) C4'-P energy: -69.760 bonds (distance) P-C4' energy: -82.098 flat angles C4'-P-C4' energy: -84.574 flat angles P-C4'-P energy: -63.016 tors. eta vs tors. theta energy: -97.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 112 Temperature: 1.100000 Total energy: -1024.909431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.909431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.659431 (E_RNA) where: Base-Base interactions energy: -695.678 where: short stacking energy: -307.865 Base-Backbone interact. energy: -1.241 local terms energy: -360.739965 where: bonds (distance) C4'-P energy: -73.826 bonds (distance) P-C4' energy: -72.912 flat angles C4'-P-C4' energy: -76.019 flat angles P-C4'-P energy: -56.199 tors. eta vs tors. theta energy: -81.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 112 Temperature: 1.150000 Total energy: -1005.617399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.617399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.367399 (E_RNA) where: Base-Base interactions energy: -688.934 where: short stacking energy: -308.413 Base-Backbone interact. energy: -0.438 local terms energy: -348.995329 where: bonds (distance) C4'-P energy: -67.294 bonds (distance) P-C4' energy: -64.414 flat angles C4'-P-C4' energy: -88.754 flat angles P-C4'-P energy: -55.550 tors. eta vs tors. theta energy: -72.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 112 Temperature: 1.200000 Total energy: -728.690779 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.690779 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.440779 (E_RNA) where: Base-Base interactions energy: -468.379 where: short stacking energy: -225.835 Base-Backbone interact. energy: -1.544 local terms energy: -291.518090 where: bonds (distance) C4'-P energy: -64.132 bonds (distance) P-C4' energy: -69.090 flat angles C4'-P-C4' energy: -70.751 flat angles P-C4'-P energy: -48.619 tors. eta vs tors. theta energy: -38.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 112 Temperature: 1.250000 Total energy: -657.254051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.254051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.004051 (E_RNA) where: Base-Base interactions energy: -420.443 where: short stacking energy: -194.664 Base-Backbone interact. energy: -3.451 local terms energy: -266.109384 where: bonds (distance) C4'-P energy: -69.485 bonds (distance) P-C4' energy: -75.785 flat angles C4'-P-C4' energy: -64.328 flat angles P-C4'-P energy: -33.534 tors. eta vs tors. theta energy: -22.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 112 Temperature: 1.300000 Total energy: -383.620878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.620878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.370878 (E_RNA) where: Base-Base interactions energy: -194.194 where: short stacking energy: -135.757 Base-Backbone interact. energy: -0.032 local terms energy: -222.144744 where: bonds (distance) C4'-P energy: -66.890 bonds (distance) P-C4' energy: -80.488 flat angles C4'-P-C4' energy: -66.294 flat angles P-C4'-P energy: -12.282 tors. eta vs tors. theta energy: 3.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 112 Temperature: 1.350000 Total energy: -302.191864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.191864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.941864 (E_RNA) where: Base-Base interactions energy: -125.351 where: short stacking energy: -109.038 Base-Backbone interact. energy: 1.278 local terms energy: -210.868870 where: bonds (distance) C4'-P energy: -61.657 bonds (distance) P-C4' energy: -73.792 flat angles C4'-P-C4' energy: -51.947 flat angles P-C4'-P energy: -22.000 tors. eta vs tors. theta energy: -1.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 113 Temperature: 0.900000 Total energy: -1305.244021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.244021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.994021 (E_RNA) where: Base-Base interactions energy: -903.397 where: short stacking energy: -385.765 Base-Backbone interact. energy: -2.253 local terms energy: -432.344526 where: bonds (distance) C4'-P energy: -86.148 bonds (distance) P-C4' energy: -74.350 flat angles C4'-P-C4' energy: -89.424 flat angles P-C4'-P energy: -62.413 tors. eta vs tors. theta energy: -120.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 113 Temperature: 0.950000 Total energy: -1308.127001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.127001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.877001 (E_RNA) where: Base-Base interactions energy: -903.560 where: short stacking energy: -394.701 Base-Backbone interact. energy: -2.614 local terms energy: -434.703040 where: bonds (distance) C4'-P energy: -80.728 bonds (distance) P-C4' energy: -85.952 flat angles C4'-P-C4' energy: -95.343 flat angles P-C4'-P energy: -60.811 tors. eta vs tors. theta energy: -111.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 113 Temperature: 1.000000 Total energy: -1186.953175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.953175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.703175 (E_RNA) where: Base-Base interactions energy: -816.657 where: short stacking energy: -373.816 Base-Backbone interact. energy: -1.924 local terms energy: -401.121232 where: bonds (distance) C4'-P energy: -75.159 bonds (distance) P-C4' energy: -76.963 flat angles C4'-P-C4' energy: -81.983 flat angles P-C4'-P energy: -56.153 tors. eta vs tors. theta energy: -110.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 113 Temperature: 1.050000 Total energy: -1118.675974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.675974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1151.425974 (E_RNA) where: Base-Base interactions energy: -769.303 where: short stacking energy: -318.262 Base-Backbone interact. energy: -3.443 local terms energy: -378.680084 where: bonds (distance) C4'-P energy: -72.644 bonds (distance) P-C4' energy: -74.668 flat angles C4'-P-C4' energy: -89.035 flat angles P-C4'-P energy: -53.664 tors. eta vs tors. theta energy: -88.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 113 Temperature: 1.100000 Total energy: -1025.300852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.300852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.050852 (E_RNA) where: Base-Base interactions energy: -697.249 where: short stacking energy: -313.304 Base-Backbone interact. energy: -1.316 local terms energy: -359.486500 where: bonds (distance) C4'-P energy: -73.555 bonds (distance) P-C4' energy: -86.701 flat angles C4'-P-C4' energy: -81.227 flat angles P-C4'-P energy: -45.244 tors. eta vs tors. theta energy: -72.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 113 Temperature: 1.150000 Total energy: -959.157914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.157914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.907914 (E_RNA) where: Base-Base interactions energy: -657.264 where: short stacking energy: -294.285 Base-Backbone interact. energy: 3.415 local terms energy: -338.058501 where: bonds (distance) C4'-P energy: -56.131 bonds (distance) P-C4' energy: -83.420 flat angles C4'-P-C4' energy: -67.421 flat angles P-C4'-P energy: -56.543 tors. eta vs tors. theta energy: -74.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 113 Temperature: 1.200000 Total energy: -770.722824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.722824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.472824 (E_RNA) where: Base-Base interactions energy: -473.898 where: short stacking energy: -250.420 Base-Backbone interact. energy: -0.601 local terms energy: -328.973802 where: bonds (distance) C4'-P energy: -65.249 bonds (distance) P-C4' energy: -83.531 flat angles C4'-P-C4' energy: -61.381 flat angles P-C4'-P energy: -48.674 tors. eta vs tors. theta energy: -70.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 113 Temperature: 1.250000 Total energy: -665.313465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -665.313465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.063465 (E_RNA) where: Base-Base interactions energy: -442.826 where: short stacking energy: -184.411 Base-Backbone interact. energy: 3.613 local terms energy: -258.850265 where: bonds (distance) C4'-P energy: -55.913 bonds (distance) P-C4' energy: -77.698 flat angles C4'-P-C4' energy: -82.101 flat angles P-C4'-P energy: -23.982 tors. eta vs tors. theta energy: -19.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 113 Temperature: 1.300000 Total energy: -463.926768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.926768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.676768 (E_RNA) where: Base-Base interactions energy: -264.338 where: short stacking energy: -159.334 Base-Backbone interact. energy: 1.485 local terms energy: -233.823998 where: bonds (distance) C4'-P energy: -62.584 bonds (distance) P-C4' energy: -60.751 flat angles C4'-P-C4' energy: -66.088 flat angles P-C4'-P energy: -35.206 tors. eta vs tors. theta energy: -9.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 113 Temperature: 1.350000 Total energy: -321.274582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.274582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.024582 (E_RNA) where: Base-Base interactions energy: -151.270 where: short stacking energy: -97.432 Base-Backbone interact. energy: -0.077 local terms energy: -202.677666 where: bonds (distance) C4'-P energy: -51.519 bonds (distance) P-C4' energy: -76.536 flat angles C4'-P-C4' energy: -56.827 flat angles P-C4'-P energy: -38.411 tors. eta vs tors. theta energy: 20.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 114 Temperature: 0.900000 Total energy: -1306.723008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.723008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.473008 (E_RNA) where: Base-Base interactions energy: -916.243 where: short stacking energy: -394.282 Base-Backbone interact. energy: -1.144 local terms energy: -422.085285 where: bonds (distance) C4'-P energy: -83.178 bonds (distance) P-C4' energy: -80.812 flat angles C4'-P-C4' energy: -88.179 flat angles P-C4'-P energy: -61.145 tors. eta vs tors. theta energy: -108.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 114 Temperature: 0.950000 Total energy: -1261.081852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1261.081852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.831852 (E_RNA) where: Base-Base interactions energy: -865.780 where: short stacking energy: -364.850 Base-Backbone interact. energy: 1.623 local terms energy: -429.674765 where: bonds (distance) C4'-P energy: -71.966 bonds (distance) P-C4' energy: -89.070 flat angles C4'-P-C4' energy: -91.261 flat angles P-C4'-P energy: -66.964 tors. eta vs tors. theta energy: -110.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 114 Temperature: 1.000000 Total energy: -1198.144805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.144805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.894805 (E_RNA) where: Base-Base interactions energy: -812.637 where: short stacking energy: -368.096 Base-Backbone interact. energy: -2.781 local terms energy: -415.476611 where: bonds (distance) C4'-P energy: -79.325 bonds (distance) P-C4' energy: -78.958 flat angles C4'-P-C4' energy: -92.147 flat angles P-C4'-P energy: -55.290 tors. eta vs tors. theta energy: -109.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 114 Temperature: 1.050000 Total energy: -1117.681012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.681012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.431012 (E_RNA) where: Base-Base interactions energy: -751.168 where: short stacking energy: -312.156 Base-Backbone interact. energy: -0.831 local terms energy: -398.432005 where: bonds (distance) C4'-P energy: -76.508 bonds (distance) P-C4' energy: -85.396 flat angles C4'-P-C4' energy: -92.530 flat angles P-C4'-P energy: -55.146 tors. eta vs tors. theta energy: -88.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 114 Temperature: 1.100000 Total energy: -1058.371114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.371114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.121114 (E_RNA) where: Base-Base interactions energy: -711.743 where: short stacking energy: -321.842 Base-Backbone interact. energy: -1.492 local terms energy: -377.886085 where: bonds (distance) C4'-P energy: -79.714 bonds (distance) P-C4' energy: -75.210 flat angles C4'-P-C4' energy: -79.829 flat angles P-C4'-P energy: -56.185 tors. eta vs tors. theta energy: -86.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 114 Temperature: 1.150000 Total energy: -1042.597453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.597453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1075.347453 (E_RNA) where: Base-Base interactions energy: -717.460 where: short stacking energy: -320.369 Base-Backbone interact. energy: -1.510 local terms energy: -356.377582 where: bonds (distance) C4'-P energy: -68.023 bonds (distance) P-C4' energy: -73.997 flat angles C4'-P-C4' energy: -85.192 flat angles P-C4'-P energy: -46.004 tors. eta vs tors. theta energy: -83.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 114 Temperature: 1.200000 Total energy: -755.299882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.299882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.049882 (E_RNA) where: Base-Base interactions energy: -479.170 where: short stacking energy: -226.715 Base-Backbone interact. energy: -1.712 local terms energy: -307.168320 where: bonds (distance) C4'-P energy: -70.606 bonds (distance) P-C4' energy: -70.824 flat angles C4'-P-C4' energy: -69.022 flat angles P-C4'-P energy: -54.714 tors. eta vs tors. theta energy: -42.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 114 Temperature: 1.250000 Total energy: -644.139868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.139868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -676.889868 (E_RNA) where: Base-Base interactions energy: -406.447 where: short stacking energy: -197.383 Base-Backbone interact. energy: -1.372 local terms energy: -269.071546 where: bonds (distance) C4'-P energy: -64.226 bonds (distance) P-C4' energy: -61.252 flat angles C4'-P-C4' energy: -76.699 flat angles P-C4'-P energy: -47.407 tors. eta vs tors. theta energy: -19.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 114 Temperature: 1.300000 Total energy: -359.935851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.935851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.685851 (E_RNA) where: Base-Base interactions energy: -170.780 where: short stacking energy: -122.052 Base-Backbone interact. energy: 6.359 local terms energy: -228.265140 where: bonds (distance) C4'-P energy: -68.113 bonds (distance) P-C4' energy: -68.655 flat angles C4'-P-C4' energy: -61.086 flat angles P-C4'-P energy: -32.060 tors. eta vs tors. theta energy: 1.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 114 Temperature: 1.350000 Total energy: -399.890924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.890924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.640924 (E_RNA) where: Base-Base interactions energy: -220.162 where: short stacking energy: -94.574 Base-Backbone interact. energy: -1.455 local terms energy: -211.023960 where: bonds (distance) C4'-P energy: -57.998 bonds (distance) P-C4' energy: -82.586 flat angles C4'-P-C4' energy: -44.399 flat angles P-C4'-P energy: -43.198 tors. eta vs tors. theta energy: 17.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 115 Temperature: 0.900000 Total energy: -1293.288144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.288144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.038144 (E_RNA) where: Base-Base interactions energy: -915.203 where: short stacking energy: -388.356 Base-Backbone interact. energy: -4.071 local terms energy: -406.764830 where: bonds (distance) C4'-P energy: -75.648 bonds (distance) P-C4' energy: -89.184 flat angles C4'-P-C4' energy: -86.539 flat angles P-C4'-P energy: -48.424 tors. eta vs tors. theta energy: -106.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 115 Temperature: 0.950000 Total energy: -1283.166480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.166480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.916480 (E_RNA) where: Base-Base interactions energy: -896.110 where: short stacking energy: -372.390 Base-Backbone interact. energy: -3.354 local terms energy: -416.452683 where: bonds (distance) C4'-P energy: -80.527 bonds (distance) P-C4' energy: -82.452 flat angles C4'-P-C4' energy: -94.707 flat angles P-C4'-P energy: -56.520 tors. eta vs tors. theta energy: -102.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 115 Temperature: 1.000000 Total energy: -1191.254225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.254225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.004225 (E_RNA) where: Base-Base interactions energy: -820.863 where: short stacking energy: -361.901 Base-Backbone interact. energy: -2.406 local terms energy: -400.734718 where: bonds (distance) C4'-P energy: -77.607 bonds (distance) P-C4' energy: -84.688 flat angles C4'-P-C4' energy: -84.438 flat angles P-C4'-P energy: -57.323 tors. eta vs tors. theta energy: -96.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 115 Temperature: 1.050000 Total energy: -1119.383417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.383417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.133417 (E_RNA) where: Base-Base interactions energy: -787.885 where: short stacking energy: -339.078 Base-Backbone interact. energy: -0.629 local terms energy: -363.619265 where: bonds (distance) C4'-P energy: -74.581 bonds (distance) P-C4' energy: -74.510 flat angles C4'-P-C4' energy: -85.549 flat angles P-C4'-P energy: -49.186 tors. eta vs tors. theta energy: -79.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 115 Temperature: 1.100000 Total energy: -1058.691652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.691652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.441652 (E_RNA) where: Base-Base interactions energy: -708.069 where: short stacking energy: -332.993 Base-Backbone interact. energy: -0.010 local terms energy: -383.362882 where: bonds (distance) C4'-P energy: -73.324 bonds (distance) P-C4' energy: -74.389 flat angles C4'-P-C4' energy: -94.350 flat angles P-C4'-P energy: -54.317 tors. eta vs tors. theta energy: -86.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 115 Temperature: 1.150000 Total energy: -941.074417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.074417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.824417 (E_RNA) where: Base-Base interactions energy: -663.916 where: short stacking energy: -280.730 Base-Backbone interact. energy: -0.837 local terms energy: -309.071367 where: bonds (distance) C4'-P energy: -66.313 bonds (distance) P-C4' energy: -68.229 flat angles C4'-P-C4' energy: -76.586 flat angles P-C4'-P energy: -50.352 tors. eta vs tors. theta energy: -47.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 115 Temperature: 1.200000 Total energy: -766.605152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.605152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.355152 (E_RNA) where: Base-Base interactions energy: -488.687 where: short stacking energy: -234.641 Base-Backbone interact. energy: -0.812 local terms energy: -312.206471 where: bonds (distance) C4'-P energy: -79.202 bonds (distance) P-C4' energy: -71.385 flat angles C4'-P-C4' energy: -73.729 flat angles P-C4'-P energy: -45.227 tors. eta vs tors. theta energy: -42.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.350 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 115 Temperature: 1.250000 Total energy: -649.138638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.138638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.888638 (E_RNA) where: Base-Base interactions energy: -400.857 where: short stacking energy: -193.636 Base-Backbone interact. energy: -0.945 local terms energy: -280.086317 where: bonds (distance) C4'-P energy: -53.572 bonds (distance) P-C4' energy: -72.191 flat angles C4'-P-C4' energy: -58.366 flat angles P-C4'-P energy: -58.012 tors. eta vs tors. theta energy: -37.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 115 Temperature: 1.300000 Total energy: -376.414227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.414227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.164227 (E_RNA) where: Base-Base interactions energy: -158.813 where: short stacking energy: -107.675 Base-Backbone interact. energy: 0.454 local terms energy: -250.806008 where: bonds (distance) C4'-P energy: -67.392 bonds (distance) P-C4' energy: -70.674 flat angles C4'-P-C4' energy: -65.997 flat angles P-C4'-P energy: -37.635 tors. eta vs tors. theta energy: -9.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 115 Temperature: 1.350000 Total energy: -416.864571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.864571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.614571 (E_RNA) where: Base-Base interactions energy: -225.875 where: short stacking energy: -126.669 Base-Backbone interact. energy: -0.896 local terms energy: -222.843895 where: bonds (distance) C4'-P energy: -64.682 bonds (distance) P-C4' energy: -64.728 flat angles C4'-P-C4' energy: -78.176 flat angles P-C4'-P energy: -15.450 tors. eta vs tors. theta energy: 0.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 116 Temperature: 0.900000 Total energy: -1325.830901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.830901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.580901 (E_RNA) where: Base-Base interactions energy: -926.696 where: short stacking energy: -395.036 Base-Backbone interact. energy: -3.689 local terms energy: -428.196473 where: bonds (distance) C4'-P energy: -79.198 bonds (distance) P-C4' energy: -75.204 flat angles C4'-P-C4' energy: -99.394 flat angles P-C4'-P energy: -71.325 tors. eta vs tors. theta energy: -103.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 116 Temperature: 0.950000 Total energy: -1292.456513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.456513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.206513 (E_RNA) where: Base-Base interactions energy: -898.683 where: short stacking energy: -396.746 Base-Backbone interact. energy: 1.555 local terms energy: -428.078199 where: bonds (distance) C4'-P energy: -72.724 bonds (distance) P-C4' energy: -87.691 flat angles C4'-P-C4' energy: -97.476 flat angles P-C4'-P energy: -60.759 tors. eta vs tors. theta energy: -109.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 116 Temperature: 1.000000 Total energy: -1192.976563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.976563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.726563 (E_RNA) where: Base-Base interactions energy: -840.070 where: short stacking energy: -361.561 Base-Backbone interact. energy: -1.830 local terms energy: -383.826492 where: bonds (distance) C4'-P energy: -78.254 bonds (distance) P-C4' energy: -68.330 flat angles C4'-P-C4' energy: -84.493 flat angles P-C4'-P energy: -57.898 tors. eta vs tors. theta energy: -94.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 116 Temperature: 1.050000 Total energy: -1091.976277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.976277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.726277 (E_RNA) where: Base-Base interactions energy: -742.513 where: short stacking energy: -318.823 Base-Backbone interact. energy: -2.791 local terms energy: -379.422060 where: bonds (distance) C4'-P energy: -76.320 bonds (distance) P-C4' energy: -85.027 flat angles C4'-P-C4' energy: -81.390 flat angles P-C4'-P energy: -53.799 tors. eta vs tors. theta energy: -82.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 116 Temperature: 1.100000 Total energy: -1059.545247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.545247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1092.295247 (E_RNA) where: Base-Base interactions energy: -745.850 where: short stacking energy: -315.801 Base-Backbone interact. energy: -0.870 local terms energy: -345.575153 where: bonds (distance) C4'-P energy: -69.931 bonds (distance) P-C4' energy: -76.921 flat angles C4'-P-C4' energy: -76.222 flat angles P-C4'-P energy: -44.585 tors. eta vs tors. theta energy: -77.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 116 Temperature: 1.150000 Total energy: -920.851397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.851397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.601397 (E_RNA) where: Base-Base interactions energy: -618.201 where: short stacking energy: -291.117 Base-Backbone interact. energy: -0.067 local terms energy: -335.333879 where: bonds (distance) C4'-P energy: -80.960 bonds (distance) P-C4' energy: -69.517 flat angles C4'-P-C4' energy: -67.129 flat angles P-C4'-P energy: -47.266 tors. eta vs tors. theta energy: -70.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 116 Temperature: 1.200000 Total energy: -803.362017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.362017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.112017 (E_RNA) where: Base-Base interactions energy: -540.979 where: short stacking energy: -232.087 Base-Backbone interact. energy: 2.623 local terms energy: -298.832229 where: bonds (distance) C4'-P energy: -72.244 bonds (distance) P-C4' energy: -61.192 flat angles C4'-P-C4' energy: -67.416 flat angles P-C4'-P energy: -39.095 tors. eta vs tors. theta energy: -58.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.077 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 116 Temperature: 1.250000 Total energy: -642.077739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.077739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.827739 (E_RNA) where: Base-Base interactions energy: -378.012 where: short stacking energy: -194.394 Base-Backbone interact. energy: -1.949 local terms energy: -294.866133 where: bonds (distance) C4'-P energy: -71.503 bonds (distance) P-C4' energy: -75.664 flat angles C4'-P-C4' energy: -72.226 flat angles P-C4'-P energy: -42.765 tors. eta vs tors. theta energy: -32.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 116 Temperature: 1.300000 Total energy: -460.507053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.507053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.257053 (E_RNA) where: Base-Base interactions energy: -256.627 where: short stacking energy: -155.264 Base-Backbone interact. energy: -0.874 local terms energy: -235.755793 where: bonds (distance) C4'-P energy: -74.594 bonds (distance) P-C4' energy: -57.160 flat angles C4'-P-C4' energy: -52.726 flat angles P-C4'-P energy: -39.294 tors. eta vs tors. theta energy: -11.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 116 Temperature: 1.350000 Total energy: -391.288275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.288275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.038275 (E_RNA) where: Base-Base interactions energy: -181.055 where: short stacking energy: -125.092 Base-Backbone interact. energy: -0.210 local terms energy: -243.888936 where: bonds (distance) C4'-P energy: -60.588 bonds (distance) P-C4' energy: -73.573 flat angles C4'-P-C4' energy: -61.949 flat angles P-C4'-P energy: -43.014 tors. eta vs tors. theta energy: -4.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.116 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 117 Temperature: 0.900000 Total energy: -1323.101450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.101450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.851450 (E_RNA) where: Base-Base interactions energy: -933.073 where: short stacking energy: -381.943 Base-Backbone interact. energy: -0.423 local terms energy: -422.354896 where: bonds (distance) C4'-P energy: -77.441 bonds (distance) P-C4' energy: -84.576 flat angles C4'-P-C4' energy: -80.504 flat angles P-C4'-P energy: -65.570 tors. eta vs tors. theta energy: -114.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 117 Temperature: 0.950000 Total energy: -1277.221671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.221671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.971671 (E_RNA) where: Base-Base interactions energy: -893.746 where: short stacking energy: -376.324 Base-Backbone interact. energy: -2.515 local terms energy: -413.711286 where: bonds (distance) C4'-P energy: -75.565 bonds (distance) P-C4' energy: -80.533 flat angles C4'-P-C4' energy: -89.424 flat angles P-C4'-P energy: -66.819 tors. eta vs tors. theta energy: -101.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 117 Temperature: 1.000000 Total energy: -1194.123216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.123216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.873216 (E_RNA) where: Base-Base interactions energy: -826.137 where: short stacking energy: -360.760 Base-Backbone interact. energy: -1.723 local terms energy: -399.013456 where: bonds (distance) C4'-P energy: -74.533 bonds (distance) P-C4' energy: -73.397 flat angles C4'-P-C4' energy: -91.752 flat angles P-C4'-P energy: -58.583 tors. eta vs tors. theta energy: -100.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 117 Temperature: 1.050000 Total energy: -1104.148151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.148151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.898151 (E_RNA) where: Base-Base interactions energy: -772.578 where: short stacking energy: -331.300 Base-Backbone interact. energy: -0.428 local terms energy: -363.892018 where: bonds (distance) C4'-P energy: -78.153 bonds (distance) P-C4' energy: -68.859 flat angles C4'-P-C4' energy: -80.419 flat angles P-C4'-P energy: -44.561 tors. eta vs tors. theta energy: -91.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 117 Temperature: 1.100000 Total energy: -1063.925301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.925301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.675301 (E_RNA) where: Base-Base interactions energy: -727.700 where: short stacking energy: -325.551 Base-Backbone interact. energy: -3.256 local terms energy: -365.719645 where: bonds (distance) C4'-P energy: -71.713 bonds (distance) P-C4' energy: -82.241 flat angles C4'-P-C4' energy: -84.573 flat angles P-C4'-P energy: -49.511 tors. eta vs tors. theta energy: -77.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 117 Temperature: 1.150000 Total energy: -942.438664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.438664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.188664 (E_RNA) where: Base-Base interactions energy: -646.129 where: short stacking energy: -284.981 Base-Backbone interact. energy: -0.610 local terms energy: -328.450497 where: bonds (distance) C4'-P energy: -48.528 bonds (distance) P-C4' energy: -86.516 flat angles C4'-P-C4' energy: -75.820 flat angles P-C4'-P energy: -56.626 tors. eta vs tors. theta energy: -60.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 117 Temperature: 1.200000 Total energy: -806.081010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.081010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.831010 (E_RNA) where: Base-Base interactions energy: -550.870 where: short stacking energy: -239.178 Base-Backbone interact. energy: -1.017 local terms energy: -286.943828 where: bonds (distance) C4'-P energy: -61.486 bonds (distance) P-C4' energy: -68.714 flat angles C4'-P-C4' energy: -70.843 flat angles P-C4'-P energy: -42.511 tors. eta vs tors. theta energy: -43.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 117 Temperature: 1.250000 Total energy: -664.268851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -664.268851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -697.018851 (E_RNA) where: Base-Base interactions energy: -410.720 where: short stacking energy: -197.157 Base-Backbone interact. energy: -1.128 local terms energy: -285.170043 where: bonds (distance) C4'-P energy: -65.075 bonds (distance) P-C4' energy: -67.764 flat angles C4'-P-C4' energy: -70.133 flat angles P-C4'-P energy: -43.492 tors. eta vs tors. theta energy: -38.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 117 Temperature: 1.300000 Total energy: -492.321022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.321022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.071022 (E_RNA) where: Base-Base interactions energy: -264.608 where: short stacking energy: -156.188 Base-Backbone interact. energy: -0.156 local terms energy: -260.306973 where: bonds (distance) C4'-P energy: -63.070 bonds (distance) P-C4' energy: -79.365 flat angles C4'-P-C4' energy: -61.501 flat angles P-C4'-P energy: -39.587 tors. eta vs tors. theta energy: -16.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 117 Temperature: 1.350000 Total energy: -300.612433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.612433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.362433 (E_RNA) where: Base-Base interactions energy: -127.378 where: short stacking energy: -107.675 Base-Backbone interact. energy: 1.986 local terms energy: -207.970598 where: bonds (distance) C4'-P energy: -59.281 bonds (distance) P-C4' energy: -68.219 flat angles C4'-P-C4' energy: -70.888 flat angles P-C4'-P energy: -24.948 tors. eta vs tors. theta energy: 15.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 118 Temperature: 0.900000 Total energy: -1323.925852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.925852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.675852 (E_RNA) where: Base-Base interactions energy: -931.619 where: short stacking energy: -385.939 Base-Backbone interact. energy: -3.525 local terms energy: -421.531768 where: bonds (distance) C4'-P energy: -79.923 bonds (distance) P-C4' energy: -87.007 flat angles C4'-P-C4' energy: -78.501 flat angles P-C4'-P energy: -61.087 tors. eta vs tors. theta energy: -115.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 118 Temperature: 0.950000 Total energy: -1287.440292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.440292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1320.190292 (E_RNA) where: Base-Base interactions energy: -893.372 where: short stacking energy: -385.300 Base-Backbone interact. energy: 1.931 local terms energy: -428.749516 where: bonds (distance) C4'-P energy: -85.490 bonds (distance) P-C4' energy: -84.020 flat angles C4'-P-C4' energy: -86.003 flat angles P-C4'-P energy: -64.525 tors. eta vs tors. theta energy: -108.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 118 Temperature: 1.000000 Total energy: -1160.694814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.694814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.444814 (E_RNA) where: Base-Base interactions energy: -817.375 where: short stacking energy: -357.308 Base-Backbone interact. energy: -2.132 local terms energy: -373.937949 where: bonds (distance) C4'-P energy: -70.877 bonds (distance) P-C4' energy: -82.605 flat angles C4'-P-C4' energy: -84.050 flat angles P-C4'-P energy: -56.979 tors. eta vs tors. theta energy: -79.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 118 Temperature: 1.050000 Total energy: -1105.198995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.198995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1137.948995 (E_RNA) where: Base-Base interactions energy: -757.247 where: short stacking energy: -320.854 Base-Backbone interact. energy: -0.707 local terms energy: -379.994713 where: bonds (distance) C4'-P energy: -74.913 bonds (distance) P-C4' energy: -83.421 flat angles C4'-P-C4' energy: -69.313 flat angles P-C4'-P energy: -66.471 tors. eta vs tors. theta energy: -85.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 118 Temperature: 1.100000 Total energy: -1057.868669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.868669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.618669 (E_RNA) where: Base-Base interactions energy: -709.355 where: short stacking energy: -297.452 Base-Backbone interact. energy: -1.942 local terms energy: -379.320985 where: bonds (distance) C4'-P energy: -82.425 bonds (distance) P-C4' energy: -79.200 flat angles C4'-P-C4' energy: -87.677 flat angles P-C4'-P energy: -51.510 tors. eta vs tors. theta energy: -78.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 118 Temperature: 1.150000 Total energy: -919.492768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.492768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.242768 (E_RNA) where: Base-Base interactions energy: -618.354 where: short stacking energy: -279.132 Base-Backbone interact. energy: -1.799 local terms energy: -332.089725 where: bonds (distance) C4'-P energy: -64.118 bonds (distance) P-C4' energy: -70.780 flat angles C4'-P-C4' energy: -76.759 flat angles P-C4'-P energy: -60.275 tors. eta vs tors. theta energy: -60.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 118 Temperature: 1.200000 Total energy: -825.363511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.363511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.113511 (E_RNA) where: Base-Base interactions energy: -536.904 where: short stacking energy: -267.056 Base-Backbone interact. energy: -0.911 local terms energy: -320.298595 where: bonds (distance) C4'-P energy: -71.361 bonds (distance) P-C4' energy: -77.650 flat angles C4'-P-C4' energy: -73.765 flat angles P-C4'-P energy: -40.610 tors. eta vs tors. theta energy: -56.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 118 Temperature: 1.250000 Total energy: -674.353613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.353613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.103613 (E_RNA) where: Base-Base interactions energy: -424.291 where: short stacking energy: -210.897 Base-Backbone interact. energy: -0.246 local terms energy: -282.909994 where: bonds (distance) C4'-P energy: -50.201 bonds (distance) P-C4' energy: -77.454 flat angles C4'-P-C4' energy: -74.438 flat angles P-C4'-P energy: -40.502 tors. eta vs tors. theta energy: -40.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.344 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 118 Temperature: 1.300000 Total energy: -391.733511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.733511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.483511 (E_RNA) where: Base-Base interactions energy: -179.245 where: short stacking energy: -125.893 Base-Backbone interact. energy: 1.102 local terms energy: -246.339837 where: bonds (distance) C4'-P energy: -66.315 bonds (distance) P-C4' energy: -70.909 flat angles C4'-P-C4' energy: -57.259 flat angles P-C4'-P energy: -45.087 tors. eta vs tors. theta energy: -6.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 118 Temperature: 1.350000 Total energy: -296.791017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.791017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.541017 (E_RNA) where: Base-Base interactions energy: -109.247 where: short stacking energy: -80.824 Base-Backbone interact. energy: 0.430 local terms energy: -220.724634 where: bonds (distance) C4'-P energy: -69.331 bonds (distance) P-C4' energy: -65.601 flat angles C4'-P-C4' energy: -54.671 flat angles P-C4'-P energy: -30.616 tors. eta vs tors. theta energy: -0.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 119 Temperature: 0.900000 Total energy: -1331.157176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.157176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.907176 (E_RNA) where: Base-Base interactions energy: -943.762 where: short stacking energy: -395.677 Base-Backbone interact. energy: -0.481 local terms energy: -419.664316 where: bonds (distance) C4'-P energy: -83.500 bonds (distance) P-C4' energy: -80.298 flat angles C4'-P-C4' energy: -91.795 flat angles P-C4'-P energy: -54.232 tors. eta vs tors. theta energy: -109.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 119 Temperature: 0.950000 Total energy: -1282.661757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.661757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.411757 (E_RNA) where: Base-Base interactions energy: -901.486 where: short stacking energy: -390.267 Base-Backbone interact. energy: 1.044 local terms energy: -414.968932 where: bonds (distance) C4'-P energy: -80.970 bonds (distance) P-C4' energy: -74.267 flat angles C4'-P-C4' energy: -95.694 flat angles P-C4'-P energy: -58.287 tors. eta vs tors. theta energy: -105.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 119 Temperature: 1.000000 Total energy: -1169.106325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.106325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1201.856325 (E_RNA) where: Base-Base interactions energy: -816.380 where: short stacking energy: -350.857 Base-Backbone interact. energy: -2.058 local terms energy: -383.419000 where: bonds (distance) C4'-P energy: -76.519 bonds (distance) P-C4' energy: -77.047 flat angles C4'-P-C4' energy: -91.270 flat angles P-C4'-P energy: -53.051 tors. eta vs tors. theta energy: -85.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 119 Temperature: 1.050000 Total energy: -1093.538795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.538795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.288795 (E_RNA) where: Base-Base interactions energy: -749.298 where: short stacking energy: -325.361 Base-Backbone interact. energy: -0.104 local terms energy: -376.886365 where: bonds (distance) C4'-P energy: -79.197 bonds (distance) P-C4' energy: -75.925 flat angles C4'-P-C4' energy: -85.943 flat angles P-C4'-P energy: -42.471 tors. eta vs tors. theta energy: -93.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 119 Temperature: 1.100000 Total energy: -1048.386930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.386930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.136930 (E_RNA) where: Base-Base interactions energy: -708.979 where: short stacking energy: -299.393 Base-Backbone interact. energy: 0.182 local terms energy: -372.339665 where: bonds (distance) C4'-P energy: -78.247 bonds (distance) P-C4' energy: -85.257 flat angles C4'-P-C4' energy: -78.772 flat angles P-C4'-P energy: -51.014 tors. eta vs tors. theta energy: -79.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 119 Temperature: 1.150000 Total energy: -927.360502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.360502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.110502 (E_RNA) where: Base-Base interactions energy: -627.070 where: short stacking energy: -289.675 Base-Backbone interact. energy: 1.329 local terms energy: -334.370140 where: bonds (distance) C4'-P energy: -55.294 bonds (distance) P-C4' energy: -69.751 flat angles C4'-P-C4' energy: -85.347 flat angles P-C4'-P energy: -59.939 tors. eta vs tors. theta energy: -64.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 119 Temperature: 1.200000 Total energy: -794.234553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.234553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.984553 (E_RNA) where: Base-Base interactions energy: -512.232 where: short stacking energy: -242.817 Base-Backbone interact. energy: -1.049 local terms energy: -313.702839 where: bonds (distance) C4'-P energy: -70.022 bonds (distance) P-C4' energy: -83.920 flat angles C4'-P-C4' energy: -61.298 flat angles P-C4'-P energy: -47.706 tors. eta vs tors. theta energy: -50.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 119 Temperature: 1.250000 Total energy: -673.030199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.030199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.780199 (E_RNA) where: Base-Base interactions energy: -432.382 where: short stacking energy: -217.966 Base-Backbone interact. energy: -1.508 local terms energy: -273.300780 where: bonds (distance) C4'-P energy: -64.676 bonds (distance) P-C4' energy: -61.791 flat angles C4'-P-C4' energy: -70.085 flat angles P-C4'-P energy: -40.835 tors. eta vs tors. theta energy: -35.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.410 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 119 Temperature: 1.300000 Total energy: -392.150625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.150625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.900625 (E_RNA) where: Base-Base interactions energy: -175.034 where: short stacking energy: -125.843 Base-Backbone interact. energy: -0.664 local terms energy: -249.203010 where: bonds (distance) C4'-P energy: -71.040 bonds (distance) P-C4' energy: -74.480 flat angles C4'-P-C4' energy: -67.026 flat angles P-C4'-P energy: -29.876 tors. eta vs tors. theta energy: -6.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 119 Temperature: 1.350000 Total energy: -315.262906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.262906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.012906 (E_RNA) where: Base-Base interactions energy: -132.739 where: short stacking energy: -95.384 Base-Backbone interact. energy: 2.573 local terms energy: -217.846436 where: bonds (distance) C4'-P energy: -52.613 bonds (distance) P-C4' energy: -77.956 flat angles C4'-P-C4' energy: -55.430 flat angles P-C4'-P energy: -35.873 tors. eta vs tors. theta energy: 4.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 120 Temperature: 0.900000 Total energy: -1305.992622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.992622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.742622 (E_RNA) where: Base-Base interactions energy: -912.124 where: short stacking energy: -383.505 Base-Backbone interact. energy: -2.486 local terms energy: -424.132476 where: bonds (distance) C4'-P energy: -84.630 bonds (distance) P-C4' energy: -91.054 flat angles C4'-P-C4' energy: -90.290 flat angles P-C4'-P energy: -58.125 tors. eta vs tors. theta energy: -100.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 120 Temperature: 0.950000 Total energy: -1259.727914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.727914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.477914 (E_RNA) where: Base-Base interactions energy: -892.683 where: short stacking energy: -385.379 Base-Backbone interact. energy: -0.204 local terms energy: -399.591769 where: bonds (distance) C4'-P energy: -75.780 bonds (distance) P-C4' energy: -73.353 flat angles C4'-P-C4' energy: -96.244 flat angles P-C4'-P energy: -47.410 tors. eta vs tors. theta energy: -106.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 120 Temperature: 1.000000 Total energy: -1134.183894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.183894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.933894 (E_RNA) where: Base-Base interactions energy: -780.025 where: short stacking energy: -337.918 Base-Backbone interact. energy: -0.581 local terms energy: -386.327414 where: bonds (distance) C4'-P energy: -84.886 bonds (distance) P-C4' energy: -84.980 flat angles C4'-P-C4' energy: -83.746 flat angles P-C4'-P energy: -47.417 tors. eta vs tors. theta energy: -85.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 120 Temperature: 1.050000 Total energy: -1147.175393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.175393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.925393 (E_RNA) where: Base-Base interactions energy: -781.168 where: short stacking energy: -332.888 Base-Backbone interact. energy: 1.187 local terms energy: -399.944386 where: bonds (distance) C4'-P energy: -81.707 bonds (distance) P-C4' energy: -87.270 flat angles C4'-P-C4' energy: -83.131 flat angles P-C4'-P energy: -63.301 tors. eta vs tors. theta energy: -84.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 120 Temperature: 1.100000 Total energy: -1046.525674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.525674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.275674 (E_RNA) where: Base-Base interactions energy: -731.247 where: short stacking energy: -299.350 Base-Backbone interact. energy: -2.766 local terms energy: -345.263093 where: bonds (distance) C4'-P energy: -72.813 bonds (distance) P-C4' energy: -72.038 flat angles C4'-P-C4' energy: -77.267 flat angles P-C4'-P energy: -49.130 tors. eta vs tors. theta energy: -74.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 120 Temperature: 1.150000 Total energy: -951.068140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.068140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.818140 (E_RNA) where: Base-Base interactions energy: -657.442 where: short stacking energy: -303.175 Base-Backbone interact. energy: 0.632 local terms energy: -327.007584 where: bonds (distance) C4'-P energy: -73.220 bonds (distance) P-C4' energy: -61.258 flat angles C4'-P-C4' energy: -72.085 flat angles P-C4'-P energy: -54.875 tors. eta vs tors. theta energy: -65.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 120 Temperature: 1.200000 Total energy: -786.913670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.913670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.663670 (E_RNA) where: Base-Base interactions energy: -513.371 where: short stacking energy: -241.471 Base-Backbone interact. energy: -0.457 local terms energy: -305.835539 where: bonds (distance) C4'-P energy: -70.546 bonds (distance) P-C4' energy: -66.229 flat angles C4'-P-C4' energy: -68.641 flat angles P-C4'-P energy: -46.668 tors. eta vs tors. theta energy: -53.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 120 Temperature: 1.250000 Total energy: -661.522113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.522113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.272113 (E_RNA) where: Base-Base interactions energy: -399.385 where: short stacking energy: -188.554 Base-Backbone interact. energy: 0.380 local terms energy: -295.267688 where: bonds (distance) C4'-P energy: -71.483 bonds (distance) P-C4' energy: -80.647 flat angles C4'-P-C4' energy: -56.695 flat angles P-C4'-P energy: -55.260 tors. eta vs tors. theta energy: -31.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 120 Temperature: 1.300000 Total energy: -365.130670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.130670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.880670 (E_RNA) where: Base-Base interactions energy: -168.014 where: short stacking energy: -112.284 Base-Backbone interact. energy: -1.105 local terms energy: -228.761672 where: bonds (distance) C4'-P energy: -62.524 bonds (distance) P-C4' energy: -67.358 flat angles C4'-P-C4' energy: -53.149 flat angles P-C4'-P energy: -50.233 tors. eta vs tors. theta energy: 4.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 120 Temperature: 1.350000 Total energy: -357.867649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.867649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.617649 (E_RNA) where: Base-Base interactions energy: -181.385 where: short stacking energy: -115.852 Base-Backbone interact. energy: -1.032 local terms energy: -208.200181 where: bonds (distance) C4'-P energy: -70.774 bonds (distance) P-C4' energy: -57.785 flat angles C4'-P-C4' energy: -55.368 flat angles P-C4'-P energy: -48.263 tors. eta vs tors. theta energy: 23.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 121 Temperature: 0.900000 Total energy: -1338.248565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.248565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.998565 (E_RNA) where: Base-Base interactions energy: -935.415 where: short stacking energy: -412.712 Base-Backbone interact. energy: -1.624 local terms energy: -433.959255 where: bonds (distance) C4'-P energy: -79.982 bonds (distance) P-C4' energy: -92.506 flat angles C4'-P-C4' energy: -93.376 flat angles P-C4'-P energy: -51.886 tors. eta vs tors. theta energy: -116.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 121 Temperature: 0.950000 Total energy: -1292.785991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.785991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.535991 (E_RNA) where: Base-Base interactions energy: -893.610 where: short stacking energy: -396.121 Base-Backbone interact. energy: -3.984 local terms energy: -427.941146 where: bonds (distance) C4'-P energy: -86.502 bonds (distance) P-C4' energy: -81.081 flat angles C4'-P-C4' energy: -90.727 flat angles P-C4'-P energy: -57.082 tors. eta vs tors. theta energy: -112.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 121 Temperature: 1.000000 Total energy: -1117.763818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.763818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.513818 (E_RNA) where: Base-Base interactions energy: -758.113 where: short stacking energy: -314.417 Base-Backbone interact. energy: -1.451 local terms energy: -390.949548 where: bonds (distance) C4'-P energy: -72.096 bonds (distance) P-C4' energy: -88.666 flat angles C4'-P-C4' energy: -84.539 flat angles P-C4'-P energy: -54.132 tors. eta vs tors. theta energy: -91.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 121 Temperature: 1.050000 Total energy: -1159.277457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.277457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.027457 (E_RNA) where: Base-Base interactions energy: -818.390 where: short stacking energy: -339.685 Base-Backbone interact. energy: -1.026 local terms energy: -372.611626 where: bonds (distance) C4'-P energy: -67.467 bonds (distance) P-C4' energy: -80.121 flat angles C4'-P-C4' energy: -83.623 flat angles P-C4'-P energy: -48.149 tors. eta vs tors. theta energy: -93.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 121 Temperature: 1.100000 Total energy: -1075.326356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1075.326356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.076356 (E_RNA) where: Base-Base interactions energy: -736.130 where: short stacking energy: -329.908 Base-Backbone interact. energy: -1.838 local terms energy: -370.108932 where: bonds (distance) C4'-P energy: -74.928 bonds (distance) P-C4' energy: -63.585 flat angles C4'-P-C4' energy: -83.960 flat angles P-C4'-P energy: -51.260 tors. eta vs tors. theta energy: -96.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 121 Temperature: 1.150000 Total energy: -961.054075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.054075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.804075 (E_RNA) where: Base-Base interactions energy: -657.145 where: short stacking energy: -284.741 Base-Backbone interact. energy: -1.414 local terms energy: -335.245388 where: bonds (distance) C4'-P energy: -68.074 bonds (distance) P-C4' energy: -72.686 flat angles C4'-P-C4' energy: -75.556 flat angles P-C4'-P energy: -49.136 tors. eta vs tors. theta energy: -69.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 121 Temperature: 1.200000 Total energy: -816.782708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.782708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.532708 (E_RNA) where: Base-Base interactions energy: -553.970 where: short stacking energy: -268.346 Base-Backbone interact. energy: -3.013 local terms energy: -292.549509 where: bonds (distance) C4'-P energy: -56.197 bonds (distance) P-C4' energy: -77.287 flat angles C4'-P-C4' energy: -65.357 flat angles P-C4'-P energy: -41.667 tors. eta vs tors. theta energy: -52.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 121 Temperature: 1.250000 Total energy: -644.465011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.465011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.215011 (E_RNA) where: Base-Base interactions energy: -400.176 where: short stacking energy: -195.751 Base-Backbone interact. energy: 1.244 local terms energy: -278.283496 where: bonds (distance) C4'-P energy: -62.914 bonds (distance) P-C4' energy: -72.753 flat angles C4'-P-C4' energy: -62.668 flat angles P-C4'-P energy: -56.271 tors. eta vs tors. theta energy: -23.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 121 Temperature: 1.300000 Total energy: -348.412407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.412407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.162407 (E_RNA) where: Base-Base interactions energy: -151.791 where: short stacking energy: -105.113 Base-Backbone interact. energy: -1.496 local terms energy: -227.874864 where: bonds (distance) C4'-P energy: -55.245 bonds (distance) P-C4' energy: -64.768 flat angles C4'-P-C4' energy: -65.457 flat angles P-C4'-P energy: -41.441 tors. eta vs tors. theta energy: -0.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 121 Temperature: 1.350000 Total energy: -385.019033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.019033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.769033 (E_RNA) where: Base-Base interactions energy: -199.349 where: short stacking energy: -111.929 Base-Backbone interact. energy: -0.419 local terms energy: -218.000674 where: bonds (distance) C4'-P energy: -56.652 bonds (distance) P-C4' energy: -78.039 flat angles C4'-P-C4' energy: -53.035 flat angles P-C4'-P energy: -36.179 tors. eta vs tors. theta energy: 5.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 122 Temperature: 0.900000 Total energy: -1321.761040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.761040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.511040 (E_RNA) where: Base-Base interactions energy: -917.925 where: short stacking energy: -392.379 Base-Backbone interact. energy: -0.609 local terms energy: -435.977753 where: bonds (distance) C4'-P energy: -83.491 bonds (distance) P-C4' energy: -78.839 flat angles C4'-P-C4' energy: -92.609 flat angles P-C4'-P energy: -62.197 tors. eta vs tors. theta energy: -118.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 122 Temperature: 0.950000 Total energy: -1262.765872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.765872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.515872 (E_RNA) where: Base-Base interactions energy: -864.455 where: short stacking energy: -381.018 Base-Backbone interact. energy: -1.874 local terms energy: -429.186657 where: bonds (distance) C4'-P energy: -80.658 bonds (distance) P-C4' energy: -84.104 flat angles C4'-P-C4' energy: -88.996 flat angles P-C4'-P energy: -66.697 tors. eta vs tors. theta energy: -108.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 122 Temperature: 1.000000 Total energy: -1147.919057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.919057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.669057 (E_RNA) where: Base-Base interactions energy: -793.437 where: short stacking energy: -316.539 Base-Backbone interact. energy: -1.799 local terms energy: -385.432744 where: bonds (distance) C4'-P energy: -77.950 bonds (distance) P-C4' energy: -84.829 flat angles C4'-P-C4' energy: -84.624 flat angles P-C4'-P energy: -55.300 tors. eta vs tors. theta energy: -82.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 122 Temperature: 1.050000 Total energy: -1141.381222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.381222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.131222 (E_RNA) where: Base-Base interactions energy: -793.640 where: short stacking energy: -333.880 Base-Backbone interact. energy: -2.772 local terms energy: -377.718850 where: bonds (distance) C4'-P energy: -75.567 bonds (distance) P-C4' energy: -71.880 flat angles C4'-P-C4' energy: -85.535 flat angles P-C4'-P energy: -57.167 tors. eta vs tors. theta energy: -87.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 122 Temperature: 1.100000 Total energy: -1021.959127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.959127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.709127 (E_RNA) where: Base-Base interactions energy: -684.939 where: short stacking energy: -294.819 Base-Backbone interact. energy: -1.392 local terms energy: -368.378321 where: bonds (distance) C4'-P energy: -80.312 bonds (distance) P-C4' energy: -80.800 flat angles C4'-P-C4' energy: -77.478 flat angles P-C4'-P energy: -56.004 tors. eta vs tors. theta energy: -73.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 122 Temperature: 1.150000 Total energy: -921.943891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.943891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.693891 (E_RNA) where: Base-Base interactions energy: -623.631 where: short stacking energy: -286.469 Base-Backbone interact. energy: -0.772 local terms energy: -330.290528 where: bonds (distance) C4'-P energy: -63.654 bonds (distance) P-C4' energy: -68.004 flat angles C4'-P-C4' energy: -79.844 flat angles P-C4'-P energy: -53.847 tors. eta vs tors. theta energy: -64.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 122 Temperature: 1.200000 Total energy: -783.523820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.523820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.273820 (E_RNA) where: Base-Base interactions energy: -490.223 where: short stacking energy: -220.943 Base-Backbone interact. energy: 0.481 local terms energy: -326.531564 where: bonds (distance) C4'-P energy: -81.278 bonds (distance) P-C4' energy: -85.497 flat angles C4'-P-C4' energy: -55.330 flat angles P-C4'-P energy: -46.695 tors. eta vs tors. theta energy: -57.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 122 Temperature: 1.250000 Total energy: -666.437808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.437808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.187808 (E_RNA) where: Base-Base interactions energy: -415.202 where: short stacking energy: -195.776 Base-Backbone interact. energy: -2.396 local terms energy: -281.589660 where: bonds (distance) C4'-P energy: -67.708 bonds (distance) P-C4' energy: -70.970 flat angles C4'-P-C4' energy: -68.281 flat angles P-C4'-P energy: -39.271 tors. eta vs tors. theta energy: -35.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 122 Temperature: 1.300000 Total energy: -386.252156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.252156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.002156 (E_RNA) where: Base-Base interactions energy: -200.298 where: short stacking energy: -122.734 Base-Backbone interact. energy: -0.772 local terms energy: -217.931825 where: bonds (distance) C4'-P energy: -52.303 bonds (distance) P-C4' energy: -79.456 flat angles C4'-P-C4' energy: -52.601 flat angles P-C4'-P energy: -29.752 tors. eta vs tors. theta energy: -3.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 122 Temperature: 1.350000 Total energy: -333.378648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.378648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.128648 (E_RNA) where: Base-Base interactions energy: -130.029 where: short stacking energy: -104.882 Base-Backbone interact. energy: -1.305 local terms energy: -234.794744 where: bonds (distance) C4'-P energy: -63.698 bonds (distance) P-C4' energy: -76.991 flat angles C4'-P-C4' energy: -59.539 flat angles P-C4'-P energy: -42.664 tors. eta vs tors. theta energy: 8.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 123 Temperature: 0.900000 Total energy: -1301.860341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.860341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.610341 (E_RNA) where: Base-Base interactions energy: -906.971 where: short stacking energy: -390.319 Base-Backbone interact. energy: 1.368 local terms energy: -429.007805 where: bonds (distance) C4'-P energy: -86.558 bonds (distance) P-C4' energy: -82.067 flat angles C4'-P-C4' energy: -90.774 flat angles P-C4'-P energy: -58.971 tors. eta vs tors. theta energy: -110.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 123 Temperature: 0.950000 Total energy: -1265.323960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.323960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.073960 (E_RNA) where: Base-Base interactions energy: -885.885 where: short stacking energy: -385.053 Base-Backbone interact. energy: -0.585 local terms energy: -411.603803 where: bonds (distance) C4'-P energy: -80.794 bonds (distance) P-C4' energy: -73.416 flat angles C4'-P-C4' energy: -91.126 flat angles P-C4'-P energy: -56.685 tors. eta vs tors. theta energy: -109.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 123 Temperature: 1.000000 Total energy: -1165.715026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.715026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.465026 (E_RNA) where: Base-Base interactions energy: -806.304 where: short stacking energy: -342.306 Base-Backbone interact. energy: -1.573 local terms energy: -390.588217 where: bonds (distance) C4'-P energy: -72.620 bonds (distance) P-C4' energy: -93.913 flat angles C4'-P-C4' energy: -88.121 flat angles P-C4'-P energy: -47.907 tors. eta vs tors. theta energy: -88.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 123 Temperature: 1.050000 Total energy: -1134.924329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.924329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.674329 (E_RNA) where: Base-Base interactions energy: -780.858 where: short stacking energy: -339.974 Base-Backbone interact. energy: -2.923 local terms energy: -383.893447 where: bonds (distance) C4'-P energy: -78.498 bonds (distance) P-C4' energy: -87.082 flat angles C4'-P-C4' energy: -79.136 flat angles P-C4'-P energy: -55.658 tors. eta vs tors. theta energy: -83.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 123 Temperature: 1.100000 Total energy: -1018.706301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.706301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.456301 (E_RNA) where: Base-Base interactions energy: -709.925 where: short stacking energy: -289.095 Base-Backbone interact. energy: 1.062 local terms energy: -342.593781 where: bonds (distance) C4'-P energy: -60.513 bonds (distance) P-C4' energy: -72.884 flat angles C4'-P-C4' energy: -80.195 flat angles P-C4'-P energy: -55.180 tors. eta vs tors. theta energy: -73.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 123 Temperature: 1.150000 Total energy: -951.893504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.893504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.643504 (E_RNA) where: Base-Base interactions energy: -642.127 where: short stacking energy: -299.097 Base-Backbone interact. energy: -1.320 local terms energy: -341.196864 where: bonds (distance) C4'-P energy: -67.189 bonds (distance) P-C4' energy: -77.616 flat angles C4'-P-C4' energy: -74.193 flat angles P-C4'-P energy: -44.021 tors. eta vs tors. theta energy: -78.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 123 Temperature: 1.200000 Total energy: -770.075229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.075229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.825229 (E_RNA) where: Base-Base interactions energy: -503.915 where: short stacking energy: -241.348 Base-Backbone interact. energy: -0.616 local terms energy: -298.294258 where: bonds (distance) C4'-P energy: -58.738 bonds (distance) P-C4' energy: -65.373 flat angles C4'-P-C4' energy: -67.664 flat angles P-C4'-P energy: -50.986 tors. eta vs tors. theta energy: -55.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 123 Temperature: 1.250000 Total energy: -649.840330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.840330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.590330 (E_RNA) where: Base-Base interactions energy: -405.390 where: short stacking energy: -203.767 Base-Backbone interact. energy: 0.325 local terms energy: -277.524815 where: bonds (distance) C4'-P energy: -68.820 bonds (distance) P-C4' energy: -69.011 flat angles C4'-P-C4' energy: -71.398 flat angles P-C4'-P energy: -39.704 tors. eta vs tors. theta energy: -28.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 123 Temperature: 1.300000 Total energy: -408.911354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.911354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.661354 (E_RNA) where: Base-Base interactions energy: -192.969 where: short stacking energy: -119.715 Base-Backbone interact. energy: -0.166 local terms energy: -248.526770 where: bonds (distance) C4'-P energy: -82.315 bonds (distance) P-C4' energy: -75.236 flat angles C4'-P-C4' energy: -47.639 flat angles P-C4'-P energy: -36.080 tors. eta vs tors. theta energy: -7.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 123 Temperature: 1.350000 Total energy: -308.820175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.820175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.570175 (E_RNA) where: Base-Base interactions energy: -148.269 where: short stacking energy: -110.457 Base-Backbone interact. energy: 15.693 local terms energy: -208.994103 where: bonds (distance) C4'-P energy: -70.415 bonds (distance) P-C4' energy: -61.869 flat angles C4'-P-C4' energy: -59.738 flat angles P-C4'-P energy: -34.840 tors. eta vs tors. theta energy: 17.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 124 Temperature: 0.900000 Total energy: -1304.368080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.368080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1337.118080 (E_RNA) where: Base-Base interactions energy: -927.251 where: short stacking energy: -384.364 Base-Backbone interact. energy: -2.862 local terms energy: -407.004874 where: bonds (distance) C4'-P energy: -82.652 bonds (distance) P-C4' energy: -75.058 flat angles C4'-P-C4' energy: -78.213 flat angles P-C4'-P energy: -57.563 tors. eta vs tors. theta energy: -113.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 124 Temperature: 0.950000 Total energy: -1285.924763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.924763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1318.674763 (E_RNA) where: Base-Base interactions energy: -885.926 where: short stacking energy: -399.625 Base-Backbone interact. energy: -0.016 local terms energy: -432.733264 where: bonds (distance) C4'-P energy: -79.345 bonds (distance) P-C4' energy: -87.748 flat angles C4'-P-C4' energy: -89.112 flat angles P-C4'-P energy: -66.114 tors. eta vs tors. theta energy: -110.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 124 Temperature: 1.000000 Total energy: -1168.093221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.093221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.843221 (E_RNA) where: Base-Base interactions energy: -804.348 where: short stacking energy: -341.079 Base-Backbone interact. energy: -0.919 local terms energy: -395.576481 where: bonds (distance) C4'-P energy: -86.899 bonds (distance) P-C4' energy: -77.114 flat angles C4'-P-C4' energy: -85.731 flat angles P-C4'-P energy: -57.370 tors. eta vs tors. theta energy: -88.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 124 Temperature: 1.050000 Total energy: -1110.981479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.981479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.731479 (E_RNA) where: Base-Base interactions energy: -748.156 where: short stacking energy: -334.361 Base-Backbone interact. energy: -4.429 local terms energy: -391.146675 where: bonds (distance) C4'-P energy: -70.130 bonds (distance) P-C4' energy: -86.378 flat angles C4'-P-C4' energy: -90.290 flat angles P-C4'-P energy: -53.259 tors. eta vs tors. theta energy: -91.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 124 Temperature: 1.100000 Total energy: -1026.424447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.424447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.174447 (E_RNA) where: Base-Base interactions energy: -712.367 where: short stacking energy: -315.568 Base-Backbone interact. energy: 1.393 local terms energy: -348.201204 where: bonds (distance) C4'-P energy: -60.488 bonds (distance) P-C4' energy: -74.227 flat angles C4'-P-C4' energy: -76.787 flat angles P-C4'-P energy: -55.048 tors. eta vs tors. theta energy: -81.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 124 Temperature: 1.150000 Total energy: -911.283185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -911.283185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.033185 (E_RNA) where: Base-Base interactions energy: -612.602 where: short stacking energy: -282.497 Base-Backbone interact. energy: -0.923 local terms energy: -330.508299 where: bonds (distance) C4'-P energy: -73.864 bonds (distance) P-C4' energy: -73.534 flat angles C4'-P-C4' energy: -77.856 flat angles P-C4'-P energy: -47.983 tors. eta vs tors. theta energy: -57.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 124 Temperature: 1.200000 Total energy: -779.286312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.286312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.036312 (E_RNA) where: Base-Base interactions energy: -492.499 where: short stacking energy: -222.820 Base-Backbone interact. energy: -0.562 local terms energy: -318.975440 where: bonds (distance) C4'-P energy: -63.948 bonds (distance) P-C4' energy: -79.662 flat angles C4'-P-C4' energy: -71.977 flat angles P-C4'-P energy: -48.547 tors. eta vs tors. theta energy: -54.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 124 Temperature: 1.250000 Total energy: -717.295373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -717.295373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.045373 (E_RNA) where: Base-Base interactions energy: -455.883 where: short stacking energy: -219.094 Base-Backbone interact. energy: -1.036 local terms energy: -293.126195 where: bonds (distance) C4'-P energy: -67.871 bonds (distance) P-C4' energy: -60.651 flat angles C4'-P-C4' energy: -68.242 flat angles P-C4'-P energy: -49.360 tors. eta vs tors. theta energy: -47.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 124 Temperature: 1.300000 Total energy: -469.522972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.522972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.272972 (E_RNA) where: Base-Base interactions energy: -269.855 where: short stacking energy: -143.953 Base-Backbone interact. energy: -0.951 local terms energy: -231.466698 where: bonds (distance) C4'-P energy: -61.195 bonds (distance) P-C4' energy: -71.027 flat angles C4'-P-C4' energy: -63.146 flat angles P-C4'-P energy: -34.103 tors. eta vs tors. theta energy: -1.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 124 Temperature: 1.350000 Total energy: -304.211094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.211094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.961094 (E_RNA) where: Base-Base interactions energy: -124.031 where: short stacking energy: -88.308 Base-Backbone interact. energy: 3.020 local terms energy: -215.949966 where: bonds (distance) C4'-P energy: -67.275 bonds (distance) P-C4' energy: -71.392 flat angles C4'-P-C4' energy: -57.037 flat angles P-C4'-P energy: -33.583 tors. eta vs tors. theta energy: 13.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 125 Temperature: 0.900000 Total energy: -1313.446498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.446498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.196498 (E_RNA) where: Base-Base interactions energy: -908.792 where: short stacking energy: -377.686 Base-Backbone interact. energy: -0.874 local terms energy: -436.530468 where: bonds (distance) C4'-P energy: -86.080 bonds (distance) P-C4' energy: -87.863 flat angles C4'-P-C4' energy: -95.155 flat angles P-C4'-P energy: -60.111 tors. eta vs tors. theta energy: -107.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 125 Temperature: 0.950000 Total energy: -1288.440195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.440195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.190195 (E_RNA) where: Base-Base interactions energy: -900.836 where: short stacking energy: -397.454 Base-Backbone interact. energy: -1.977 local terms energy: -418.377528 where: bonds (distance) C4'-P energy: -78.212 bonds (distance) P-C4' energy: -85.159 flat angles C4'-P-C4' energy: -87.803 flat angles P-C4'-P energy: -52.757 tors. eta vs tors. theta energy: -114.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 125 Temperature: 1.000000 Total energy: -1174.776759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.776759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.526759 (E_RNA) where: Base-Base interactions energy: -808.406 where: short stacking energy: -357.210 Base-Backbone interact. energy: 3.660 local terms energy: -402.780854 where: bonds (distance) C4'-P energy: -78.424 bonds (distance) P-C4' energy: -94.872 flat angles C4'-P-C4' energy: -78.684 flat angles P-C4'-P energy: -58.566 tors. eta vs tors. theta energy: -92.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 125 Temperature: 1.050000 Total energy: -1115.059915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1115.059915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.809915 (E_RNA) where: Base-Base interactions energy: -771.509 where: short stacking energy: -329.141 Base-Backbone interact. energy: -1.098 local terms energy: -375.202256 where: bonds (distance) C4'-P energy: -75.414 bonds (distance) P-C4' energy: -68.798 flat angles C4'-P-C4' energy: -84.357 flat angles P-C4'-P energy: -53.557 tors. eta vs tors. theta energy: -93.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 125 Temperature: 1.100000 Total energy: -1033.149996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.149996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1065.899996 (E_RNA) where: Base-Base interactions energy: -713.731 where: short stacking energy: -293.528 Base-Backbone interact. energy: 1.506 local terms energy: -353.675279 where: bonds (distance) C4'-P energy: -73.255 bonds (distance) P-C4' energy: -73.995 flat angles C4'-P-C4' energy: -72.163 flat angles P-C4'-P energy: -55.914 tors. eta vs tors. theta energy: -78.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 125 Temperature: 1.150000 Total energy: -813.033870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.033870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.783870 (E_RNA) where: Base-Base interactions energy: -543.486 where: short stacking energy: -268.792 Base-Backbone interact. energy: 0.711 local terms energy: -303.008840 where: bonds (distance) C4'-P energy: -68.801 bonds (distance) P-C4' energy: -58.090 flat angles C4'-P-C4' energy: -67.525 flat angles P-C4'-P energy: -58.730 tors. eta vs tors. theta energy: -49.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 125 Temperature: 1.200000 Total energy: -869.101517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.101517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.851517 (E_RNA) where: Base-Base interactions energy: -589.825 where: short stacking energy: -251.555 Base-Backbone interact. energy: -0.965 local terms energy: -311.060795 where: bonds (distance) C4'-P energy: -78.386 bonds (distance) P-C4' energy: -77.568 flat angles C4'-P-C4' energy: -55.811 flat angles P-C4'-P energy: -48.750 tors. eta vs tors. theta energy: -50.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 125 Temperature: 1.250000 Total energy: -715.459365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.459365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.209365 (E_RNA) where: Base-Base interactions energy: -452.890 where: short stacking energy: -186.001 Base-Backbone interact. energy: -1.293 local terms energy: -294.026105 where: bonds (distance) C4'-P energy: -68.831 bonds (distance) P-C4' energy: -73.091 flat angles C4'-P-C4' energy: -71.990 flat angles P-C4'-P energy: -42.841 tors. eta vs tors. theta energy: -37.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 125 Temperature: 1.300000 Total energy: -501.741006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.741006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.491006 (E_RNA) where: Base-Base interactions energy: -285.655 where: short stacking energy: -164.870 Base-Backbone interact. energy: -1.515 local terms energy: -247.320562 where: bonds (distance) C4'-P energy: -60.842 bonds (distance) P-C4' energy: -72.472 flat angles C4'-P-C4' energy: -55.661 flat angles P-C4'-P energy: -43.233 tors. eta vs tors. theta energy: -15.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 125 Temperature: 1.350000 Total energy: -304.754582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.754582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.504582 (E_RNA) where: Base-Base interactions energy: -136.337 where: short stacking energy: -115.433 Base-Backbone interact. energy: -0.652 local terms energy: -200.516021 where: bonds (distance) C4'-P energy: -51.225 bonds (distance) P-C4' energy: -75.624 flat angles C4'-P-C4' energy: -58.665 flat angles P-C4'-P energy: -23.561 tors. eta vs tors. theta energy: 8.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 126 Temperature: 0.900000 Total energy: -1312.365556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.365556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.115556 (E_RNA) where: Base-Base interactions energy: -915.216 where: short stacking energy: -389.431 Base-Backbone interact. energy: -0.701 local terms energy: -429.198130 where: bonds (distance) C4'-P energy: -85.121 bonds (distance) P-C4' energy: -82.298 flat angles C4'-P-C4' energy: -93.069 flat angles P-C4'-P energy: -57.598 tors. eta vs tors. theta energy: -111.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 126 Temperature: 0.950000 Total energy: -1273.819887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.819887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.569887 (E_RNA) where: Base-Base interactions energy: -875.902 where: short stacking energy: -388.443 Base-Backbone interact. energy: -3.313 local terms energy: -427.355085 where: bonds (distance) C4'-P energy: -64.188 bonds (distance) P-C4' energy: -86.580 flat angles C4'-P-C4' energy: -99.374 flat angles P-C4'-P energy: -64.325 tors. eta vs tors. theta energy: -112.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 126 Temperature: 1.000000 Total energy: -1223.649081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.649081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.399081 (E_RNA) where: Base-Base interactions energy: -868.076 where: short stacking energy: -379.150 Base-Backbone interact. energy: -1.340 local terms energy: -386.983796 where: bonds (distance) C4'-P energy: -61.869 bonds (distance) P-C4' energy: -87.416 flat angles C4'-P-C4' energy: -95.547 flat angles P-C4'-P energy: -40.194 tors. eta vs tors. theta energy: -101.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 126 Temperature: 1.050000 Total energy: -1131.793067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.793067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.543067 (E_RNA) where: Base-Base interactions energy: -785.899 where: short stacking energy: -327.385 Base-Backbone interact. energy: -0.653 local terms energy: -377.991633 where: bonds (distance) C4'-P energy: -71.392 bonds (distance) P-C4' energy: -76.618 flat angles C4'-P-C4' energy: -86.718 flat angles P-C4'-P energy: -69.389 tors. eta vs tors. theta energy: -73.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 126 Temperature: 1.100000 Total energy: -1046.431303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.431303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.181303 (E_RNA) where: Base-Base interactions energy: -705.158 where: short stacking energy: -299.136 Base-Backbone interact. energy: -1.524 local terms energy: -372.498720 where: bonds (distance) C4'-P energy: -71.914 bonds (distance) P-C4' energy: -77.242 flat angles C4'-P-C4' energy: -84.346 flat angles P-C4'-P energy: -55.245 tors. eta vs tors. theta energy: -83.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 126 Temperature: 1.150000 Total energy: -827.853080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.853080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.603080 (E_RNA) where: Base-Base interactions energy: -540.196 where: short stacking energy: -262.796 Base-Backbone interact. energy: 0.520 local terms energy: -320.926324 where: bonds (distance) C4'-P energy: -64.651 bonds (distance) P-C4' energy: -77.922 flat angles C4'-P-C4' energy: -80.502 flat angles P-C4'-P energy: -42.934 tors. eta vs tors. theta energy: -54.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 126 Temperature: 1.200000 Total energy: -889.943797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.943797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.693797 (E_RNA) where: Base-Base interactions energy: -610.705 where: short stacking energy: -271.038 Base-Backbone interact. energy: -2.315 local terms energy: -309.815778 where: bonds (distance) C4'-P energy: -64.549 bonds (distance) P-C4' energy: -78.826 flat angles C4'-P-C4' energy: -66.609 flat angles P-C4'-P energy: -32.883 tors. eta vs tors. theta energy: -66.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.142 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 126 Temperature: 1.250000 Total energy: -633.800656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -633.800656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.550656 (E_RNA) where: Base-Base interactions energy: -406.136 where: short stacking energy: -178.842 Base-Backbone interact. energy: 0.894 local terms energy: -261.308458 where: bonds (distance) C4'-P energy: -58.362 bonds (distance) P-C4' energy: -70.107 flat angles C4'-P-C4' energy: -66.084 flat angles P-C4'-P energy: -41.527 tors. eta vs tors. theta energy: -25.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 126 Temperature: 1.300000 Total energy: -498.915052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.915052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.665052 (E_RNA) where: Base-Base interactions energy: -309.224 where: short stacking energy: -150.996 Base-Backbone interact. energy: 1.315 local terms energy: -223.756087 where: bonds (distance) C4'-P energy: -72.693 bonds (distance) P-C4' energy: -66.924 flat angles C4'-P-C4' energy: -56.201 flat angles P-C4'-P energy: -33.198 tors. eta vs tors. theta energy: 5.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 126 Temperature: 1.350000 Total energy: -312.840767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.840767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.590767 (E_RNA) where: Base-Base interactions energy: -123.710 where: short stacking energy: -104.879 Base-Backbone interact. energy: -1.247 local terms energy: -220.633900 where: bonds (distance) C4'-P energy: -73.094 bonds (distance) P-C4' energy: -63.861 flat angles C4'-P-C4' energy: -60.190 flat angles P-C4'-P energy: -34.085 tors. eta vs tors. theta energy: 10.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 127 Temperature: 0.900000 Total energy: -1335.729868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.729868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.479868 (E_RNA) where: Base-Base interactions energy: -938.276 where: short stacking energy: -400.301 Base-Backbone interact. energy: -3.439 local terms energy: -426.765296 where: bonds (distance) C4'-P energy: -82.975 bonds (distance) P-C4' energy: -77.158 flat angles C4'-P-C4' energy: -92.583 flat angles P-C4'-P energy: -61.657 tors. eta vs tors. theta energy: -112.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 127 Temperature: 0.950000 Total energy: -1274.679709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.679709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.429709 (E_RNA) where: Base-Base interactions energy: -903.541 where: short stacking energy: -390.512 Base-Backbone interact. energy: 0.335 local terms energy: -404.223781 where: bonds (distance) C4'-P energy: -75.795 bonds (distance) P-C4' energy: -88.430 flat angles C4'-P-C4' energy: -84.588 flat angles P-C4'-P energy: -46.262 tors. eta vs tors. theta energy: -109.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 127 Temperature: 1.000000 Total energy: -1214.639430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.639430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.389430 (E_RNA) where: Base-Base interactions energy: -833.400 where: short stacking energy: -357.424 Base-Backbone interact. energy: -3.343 local terms energy: -410.646433 where: bonds (distance) C4'-P energy: -83.208 bonds (distance) P-C4' energy: -81.819 flat angles C4'-P-C4' energy: -83.148 flat angles P-C4'-P energy: -65.746 tors. eta vs tors. theta energy: -96.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 127 Temperature: 1.050000 Total energy: -1102.386855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.386855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.136855 (E_RNA) where: Base-Base interactions energy: -761.960 where: short stacking energy: -308.638 Base-Backbone interact. energy: 3.196 local terms energy: -376.482660 where: bonds (distance) C4'-P energy: -82.832 bonds (distance) P-C4' energy: -82.654 flat angles C4'-P-C4' energy: -89.517 flat angles P-C4'-P energy: -50.534 tors. eta vs tors. theta energy: -70.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.110 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 127 Temperature: 1.100000 Total energy: -1063.614226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.614226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1096.364226 (E_RNA) where: Base-Base interactions energy: -726.419 where: short stacking energy: -321.428 Base-Backbone interact. energy: -0.119 local terms energy: -369.825898 where: bonds (distance) C4'-P energy: -75.822 bonds (distance) P-C4' energy: -78.965 flat angles C4'-P-C4' energy: -79.680 flat angles P-C4'-P energy: -44.225 tors. eta vs tors. theta energy: -91.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 127 Temperature: 1.150000 Total energy: -842.168525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -842.168525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.918525 (E_RNA) where: Base-Base interactions energy: -532.485 where: short stacking energy: -256.229 Base-Backbone interact. energy: -2.725 local terms energy: -339.708930 where: bonds (distance) C4'-P energy: -76.111 bonds (distance) P-C4' energy: -77.109 flat angles C4'-P-C4' energy: -74.672 flat angles P-C4'-P energy: -64.657 tors. eta vs tors. theta energy: -47.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 127 Temperature: 1.200000 Total energy: -855.012919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.012919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.762919 (E_RNA) where: Base-Base interactions energy: -579.199 where: short stacking energy: -255.226 Base-Backbone interact. energy: 4.190 local terms energy: -312.753798 where: bonds (distance) C4'-P energy: -69.746 bonds (distance) P-C4' energy: -88.542 flat angles C4'-P-C4' energy: -68.676 flat angles P-C4'-P energy: -29.994 tors. eta vs tors. theta energy: -55.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 127 Temperature: 1.250000 Total energy: -657.661948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -657.661948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.411948 (E_RNA) where: Base-Base interactions energy: -416.338 where: short stacking energy: -189.052 Base-Backbone interact. energy: -1.843 local terms energy: -272.230906 where: bonds (distance) C4'-P energy: -55.027 bonds (distance) P-C4' energy: -64.125 flat angles C4'-P-C4' energy: -65.293 flat angles P-C4'-P energy: -51.471 tors. eta vs tors. theta energy: -36.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 127 Temperature: 1.300000 Total energy: -539.749289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.749289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.499289 (E_RNA) where: Base-Base interactions energy: -326.977 where: short stacking energy: -147.909 Base-Backbone interact. energy: -2.160 local terms energy: -243.362207 where: bonds (distance) C4'-P energy: -54.556 bonds (distance) P-C4' energy: -78.762 flat angles C4'-P-C4' energy: -69.537 flat angles P-C4'-P energy: -41.857 tors. eta vs tors. theta energy: 1.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 127 Temperature: 1.350000 Total energy: -284.275397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.275397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.025397 (E_RNA) where: Base-Base interactions energy: -92.792 where: short stacking energy: -66.720 Base-Backbone interact. energy: 0.314 local terms energy: -224.546795 where: bonds (distance) C4'-P energy: -62.180 bonds (distance) P-C4' energy: -71.167 flat angles C4'-P-C4' energy: -49.618 flat angles P-C4'-P energy: -53.834 tors. eta vs tors. theta energy: 12.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 128 Temperature: 0.900000 Total energy: -1349.958049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1349.958049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.708049 (E_RNA) where: Base-Base interactions energy: -945.861 where: short stacking energy: -385.027 Base-Backbone interact. energy: -2.791 local terms energy: -434.056057 where: bonds (distance) C4'-P energy: -79.589 bonds (distance) P-C4' energy: -95.191 flat angles C4'-P-C4' energy: -89.592 flat angles P-C4'-P energy: -57.231 tors. eta vs tors. theta energy: -112.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 128 Temperature: 0.950000 Total energy: -1282.138764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.138764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.888764 (E_RNA) where: Base-Base interactions energy: -887.127 where: short stacking energy: -386.778 Base-Backbone interact. energy: -1.911 local terms energy: -425.850590 where: bonds (distance) C4'-P energy: -78.836 bonds (distance) P-C4' energy: -84.417 flat angles C4'-P-C4' energy: -80.089 flat angles P-C4'-P energy: -64.163 tors. eta vs tors. theta energy: -118.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 128 Temperature: 1.000000 Total energy: -1195.050802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.050802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1227.800802 (E_RNA) where: Base-Base interactions energy: -833.396 where: short stacking energy: -343.689 Base-Backbone interact. energy: 0.509 local terms energy: -396.576242 where: bonds (distance) C4'-P energy: -74.062 bonds (distance) P-C4' energy: -82.613 flat angles C4'-P-C4' energy: -86.261 flat angles P-C4'-P energy: -64.212 tors. eta vs tors. theta energy: -89.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.663 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 128 Temperature: 1.050000 Total energy: -1137.314637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1137.314637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.064637 (E_RNA) where: Base-Base interactions energy: -794.782 where: short stacking energy: -322.153 Base-Backbone interact. energy: 2.630 local terms energy: -377.913178 where: bonds (distance) C4'-P energy: -73.648 bonds (distance) P-C4' energy: -88.318 flat angles C4'-P-C4' energy: -84.957 flat angles P-C4'-P energy: -51.485 tors. eta vs tors. theta energy: -79.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 128 Temperature: 1.100000 Total energy: -1068.283718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.283718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.033718 (E_RNA) where: Base-Base interactions energy: -714.349 where: short stacking energy: -322.583 Base-Backbone interact. energy: -0.755 local terms energy: -385.929959 where: bonds (distance) C4'-P energy: -66.249 bonds (distance) P-C4' energy: -83.099 flat angles C4'-P-C4' energy: -87.799 flat angles P-C4'-P energy: -54.014 tors. eta vs tors. theta energy: -94.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 128 Temperature: 1.150000 Total energy: -849.451340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.451340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.201340 (E_RNA) where: Base-Base interactions energy: -525.105 where: short stacking energy: -256.995 Base-Backbone interact. energy: -0.406 local terms energy: -356.689626 where: bonds (distance) C4'-P energy: -83.081 bonds (distance) P-C4' energy: -84.260 flat angles C4'-P-C4' energy: -80.444 flat angles P-C4'-P energy: -49.172 tors. eta vs tors. theta energy: -59.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 128 Temperature: 1.200000 Total energy: -895.899472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.899472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.649472 (E_RNA) where: Base-Base interactions energy: -614.310 where: short stacking energy: -275.270 Base-Backbone interact. energy: -2.062 local terms energy: -312.277352 where: bonds (distance) C4'-P energy: -73.721 bonds (distance) P-C4' energy: -66.211 flat angles C4'-P-C4' energy: -70.666 flat angles P-C4'-P energy: -45.181 tors. eta vs tors. theta energy: -56.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 128 Temperature: 1.250000 Total energy: -655.164491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.164491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.914491 (E_RNA) where: Base-Base interactions energy: -398.118 where: short stacking energy: -170.025 Base-Backbone interact. energy: -2.608 local terms energy: -287.189253 where: bonds (distance) C4'-P energy: -86.128 bonds (distance) P-C4' energy: -71.734 flat angles C4'-P-C4' energy: -61.994 flat angles P-C4'-P energy: -43.704 tors. eta vs tors. theta energy: -23.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 128 Temperature: 1.300000 Total energy: -465.821063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.821063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.571063 (E_RNA) where: Base-Base interactions energy: -277.968 where: short stacking energy: -148.641 Base-Backbone interact. energy: -1.393 local terms energy: -219.209836 where: bonds (distance) C4'-P energy: -57.610 bonds (distance) P-C4' energy: -71.822 flat angles C4'-P-C4' energy: -61.850 flat angles P-C4'-P energy: -32.322 tors. eta vs tors. theta energy: 4.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 128 Temperature: 1.350000 Total energy: -290.932716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.932716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.682716 (E_RNA) where: Base-Base interactions energy: -106.095 where: short stacking energy: -92.540 Base-Backbone interact. energy: -0.332 local terms energy: -218.274136 where: bonds (distance) C4'-P energy: -67.395 bonds (distance) P-C4' energy: -75.272 flat angles C4'-P-C4' energy: -63.502 flat angles P-C4'-P energy: -34.858 tors. eta vs tors. theta energy: 22.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.018 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 129 Temperature: 0.900000 Total energy: -1343.739887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.739887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.489887 (E_RNA) where: Base-Base interactions energy: -929.283 where: short stacking energy: -384.983 Base-Backbone interact. energy: -2.646 local terms energy: -444.560295 where: bonds (distance) C4'-P energy: -89.816 bonds (distance) P-C4' energy: -84.758 flat angles C4'-P-C4' energy: -101.126 flat angles P-C4'-P energy: -65.630 tors. eta vs tors. theta energy: -103.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 129 Temperature: 0.950000 Total energy: -1301.162481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.162481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.912481 (E_RNA) where: Base-Base interactions energy: -921.432 where: short stacking energy: -386.498 Base-Backbone interact. energy: 1.263 local terms energy: -413.743455 where: bonds (distance) C4'-P energy: -84.493 bonds (distance) P-C4' energy: -76.150 flat angles C4'-P-C4' energy: -86.508 flat angles P-C4'-P energy: -51.696 tors. eta vs tors. theta energy: -114.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 129 Temperature: 1.000000 Total energy: -1224.604276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.604276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.354276 (E_RNA) where: Base-Base interactions energy: -860.769 where: short stacking energy: -371.546 Base-Backbone interact. energy: -4.652 local terms energy: -391.932922 where: bonds (distance) C4'-P energy: -74.366 bonds (distance) P-C4' energy: -63.757 flat angles C4'-P-C4' energy: -93.762 flat angles P-C4'-P energy: -58.509 tors. eta vs tors. theta energy: -101.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 129 Temperature: 1.050000 Total energy: -1135.112297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.112297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.862297 (E_RNA) where: Base-Base interactions energy: -790.314 where: short stacking energy: -329.742 Base-Backbone interact. energy: 4.115 local terms energy: -381.663792 where: bonds (distance) C4'-P energy: -68.139 bonds (distance) P-C4' energy: -74.110 flat angles C4'-P-C4' energy: -86.607 flat angles P-C4'-P energy: -69.067 tors. eta vs tors. theta energy: -83.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 129 Temperature: 1.100000 Total energy: -1053.314838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.314838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.064838 (E_RNA) where: Base-Base interactions energy: -717.821 where: short stacking energy: -333.454 Base-Backbone interact. energy: -2.075 local terms energy: -366.168726 where: bonds (distance) C4'-P energy: -64.158 bonds (distance) P-C4' energy: -78.291 flat angles C4'-P-C4' energy: -83.605 flat angles P-C4'-P energy: -44.110 tors. eta vs tors. theta energy: -96.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 129 Temperature: 1.150000 Total energy: -963.515225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.515225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.265225 (E_RNA) where: Base-Base interactions energy: -651.754 where: short stacking energy: -309.321 Base-Backbone interact. energy: 0.057 local terms energy: -344.567746 where: bonds (distance) C4'-P energy: -68.720 bonds (distance) P-C4' energy: -78.038 flat angles C4'-P-C4' energy: -79.727 flat angles P-C4'-P energy: -44.858 tors. eta vs tors. theta energy: -73.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 129 Temperature: 1.200000 Total energy: -851.484372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.484372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.234372 (E_RNA) where: Base-Base interactions energy: -541.030 where: short stacking energy: -263.506 Base-Backbone interact. energy: -0.784 local terms energy: -342.420812 where: bonds (distance) C4'-P energy: -85.064 bonds (distance) P-C4' energy: -77.808 flat angles C4'-P-C4' energy: -68.428 flat angles P-C4'-P energy: -49.575 tors. eta vs tors. theta energy: -61.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 129 Temperature: 1.250000 Total energy: -627.092726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -627.092726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.842726 (E_RNA) where: Base-Base interactions energy: -385.464 where: short stacking energy: -167.797 Base-Backbone interact. energy: -1.338 local terms energy: -273.040232 where: bonds (distance) C4'-P energy: -78.040 bonds (distance) P-C4' energy: -83.080 flat angles C4'-P-C4' energy: -65.059 flat angles P-C4'-P energy: -26.183 tors. eta vs tors. theta energy: -20.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 129 Temperature: 1.300000 Total energy: -459.853737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.853737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.603737 (E_RNA) where: Base-Base interactions energy: -264.171 where: short stacking energy: -141.300 Base-Backbone interact. energy: 0.342 local terms energy: -228.774882 where: bonds (distance) C4'-P energy: -63.622 bonds (distance) P-C4' energy: -67.769 flat angles C4'-P-C4' energy: -59.629 flat angles P-C4'-P energy: -37.626 tors. eta vs tors. theta energy: -0.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 129 Temperature: 1.350000 Total energy: -291.200062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.200062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.950062 (E_RNA) where: Base-Base interactions energy: -103.645 where: short stacking energy: -87.743 Base-Backbone interact. energy: -0.908 local terms energy: -219.396830 where: bonds (distance) C4'-P energy: -59.228 bonds (distance) P-C4' energy: -72.880 flat angles C4'-P-C4' energy: -58.413 flat angles P-C4'-P energy: -41.891 tors. eta vs tors. theta energy: 13.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 130 Temperature: 0.900000 Total energy: -1328.068900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.068900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.818900 (E_RNA) where: Base-Base interactions energy: -934.142 where: short stacking energy: -388.892 Base-Backbone interact. energy: -1.146 local terms energy: -425.530223 where: bonds (distance) C4'-P energy: -74.928 bonds (distance) P-C4' energy: -80.903 flat angles C4'-P-C4' energy: -96.258 flat angles P-C4'-P energy: -63.071 tors. eta vs tors. theta energy: -110.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 130 Temperature: 0.950000 Total energy: -1295.727578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.727578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.477578 (E_RNA) where: Base-Base interactions energy: -914.267 where: short stacking energy: -385.131 Base-Backbone interact. energy: -2.306 local terms energy: -411.905204 where: bonds (distance) C4'-P energy: -72.629 bonds (distance) P-C4' energy: -75.938 flat angles C4'-P-C4' energy: -89.920 flat angles P-C4'-P energy: -61.861 tors. eta vs tors. theta energy: -111.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 130 Temperature: 1.000000 Total energy: -1208.908628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.908628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.658628 (E_RNA) where: Base-Base interactions energy: -861.237 where: short stacking energy: -349.082 Base-Backbone interact. energy: -2.510 local terms energy: -377.911445 where: bonds (distance) C4'-P energy: -69.675 bonds (distance) P-C4' energy: -75.259 flat angles C4'-P-C4' energy: -81.474 flat angles P-C4'-P energy: -56.872 tors. eta vs tors. theta energy: -94.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 130 Temperature: 1.050000 Total energy: -1110.815731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.815731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.565731 (E_RNA) where: Base-Base interactions energy: -779.866 where: short stacking energy: -300.170 Base-Backbone interact. energy: -1.530 local terms energy: -362.170016 where: bonds (distance) C4'-P energy: -79.972 bonds (distance) P-C4' energy: -75.781 flat angles C4'-P-C4' energy: -75.177 flat angles P-C4'-P energy: -49.643 tors. eta vs tors. theta energy: -81.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 130 Temperature: 1.100000 Total energy: -1067.110192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.110192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.860192 (E_RNA) where: Base-Base interactions energy: -737.337 where: short stacking energy: -324.261 Base-Backbone interact. energy: -1.087 local terms energy: -361.435981 where: bonds (distance) C4'-P energy: -63.174 bonds (distance) P-C4' energy: -67.898 flat angles C4'-P-C4' energy: -81.944 flat angles P-C4'-P energy: -47.382 tors. eta vs tors. theta energy: -101.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 130 Temperature: 1.150000 Total energy: -971.189924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.189924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.939924 (E_RNA) where: Base-Base interactions energy: -653.824 where: short stacking energy: -302.999 Base-Backbone interact. energy: -0.411 local terms energy: -349.705084 where: bonds (distance) C4'-P energy: -66.728 bonds (distance) P-C4' energy: -85.511 flat angles C4'-P-C4' energy: -87.998 flat angles P-C4'-P energy: -39.918 tors. eta vs tors. theta energy: -69.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 130 Temperature: 1.200000 Total energy: -829.650547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.650547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.400547 (E_RNA) where: Base-Base interactions energy: -543.203 where: short stacking energy: -245.819 Base-Backbone interact. energy: -1.302 local terms energy: -317.894913 where: bonds (distance) C4'-P energy: -74.251 bonds (distance) P-C4' energy: -70.746 flat angles C4'-P-C4' energy: -65.332 flat angles P-C4'-P energy: -47.141 tors. eta vs tors. theta energy: -60.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 130 Temperature: 1.250000 Total energy: -588.954473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.954473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.704473 (E_RNA) where: Base-Base interactions energy: -354.547 where: short stacking energy: -162.120 Base-Backbone interact. energy: -1.984 local terms energy: -265.174102 where: bonds (distance) C4'-P energy: -82.347 bonds (distance) P-C4' energy: -65.501 flat angles C4'-P-C4' energy: -56.147 flat angles P-C4'-P energy: -40.657 tors. eta vs tors. theta energy: -20.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 130 Temperature: 1.300000 Total energy: -513.313074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.313074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -546.063074 (E_RNA) where: Base-Base interactions energy: -288.112 where: short stacking energy: -152.255 Base-Backbone interact. energy: 0.807 local terms energy: -258.758479 where: bonds (distance) C4'-P energy: -72.016 bonds (distance) P-C4' energy: -59.666 flat angles C4'-P-C4' energy: -70.646 flat angles P-C4'-P energy: -39.062 tors. eta vs tors. theta energy: -17.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 130 Temperature: 1.350000 Total energy: -324.445699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.445699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.195699 (E_RNA) where: Base-Base interactions energy: -159.866 where: short stacking energy: -107.391 Base-Backbone interact. energy: 0.815 local terms energy: -198.145517 where: bonds (distance) C4'-P energy: -58.512 bonds (distance) P-C4' energy: -67.745 flat angles C4'-P-C4' energy: -54.978 flat angles P-C4'-P energy: -26.666 tors. eta vs tors. theta energy: 9.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 131 Temperature: 0.900000 Total energy: -1329.914499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.914499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.664499 (E_RNA) where: Base-Base interactions energy: -923.947 where: short stacking energy: -397.218 Base-Backbone interact. energy: -0.451 local terms energy: -438.266529 where: bonds (distance) C4'-P energy: -69.399 bonds (distance) P-C4' energy: -90.938 flat angles C4'-P-C4' energy: -94.179 flat angles P-C4'-P energy: -66.736 tors. eta vs tors. theta energy: -117.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 131 Temperature: 0.950000 Total energy: -1294.896476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.896476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.646476 (E_RNA) where: Base-Base interactions energy: -915.747 where: short stacking energy: -357.604 Base-Backbone interact. energy: -3.699 local terms energy: -408.200861 where: bonds (distance) C4'-P energy: -80.984 bonds (distance) P-C4' energy: -78.033 flat angles C4'-P-C4' energy: -85.471 flat angles P-C4'-P energy: -60.604 tors. eta vs tors. theta energy: -103.108 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 131 Temperature: 1.000000 Total energy: -1206.913178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.913178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.663178 (E_RNA) where: Base-Base interactions energy: -831.713 where: short stacking energy: -363.895 Base-Backbone interact. energy: -0.619 local terms energy: -407.330520 where: bonds (distance) C4'-P energy: -79.540 bonds (distance) P-C4' energy: -85.526 flat angles C4'-P-C4' energy: -84.224 flat angles P-C4'-P energy: -60.951 tors. eta vs tors. theta energy: -97.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 131 Temperature: 1.050000 Total energy: -1160.667267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.667267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.417267 (E_RNA) where: Base-Base interactions energy: -823.287 where: short stacking energy: -342.696 Base-Backbone interact. energy: -3.903 local terms energy: -366.226682 where: bonds (distance) C4'-P energy: -72.624 bonds (distance) P-C4' energy: -77.232 flat angles C4'-P-C4' energy: -80.824 flat angles P-C4'-P energy: -46.123 tors. eta vs tors. theta energy: -89.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 131 Temperature: 1.100000 Total energy: -1084.266294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.266294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.016294 (E_RNA) where: Base-Base interactions energy: -748.959 where: short stacking energy: -367.559 Base-Backbone interact. energy: 1.154 local terms energy: -369.211154 where: bonds (distance) C4'-P energy: -68.960 bonds (distance) P-C4' energy: -60.015 flat angles C4'-P-C4' energy: -88.413 flat angles P-C4'-P energy: -48.183 tors. eta vs tors. theta energy: -103.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 131 Temperature: 1.150000 Total energy: -954.157356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.157356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.907356 (E_RNA) where: Base-Base interactions energy: -644.115 where: short stacking energy: -275.903 Base-Backbone interact. energy: -0.290 local terms energy: -342.502560 where: bonds (distance) C4'-P energy: -70.158 bonds (distance) P-C4' energy: -73.079 flat angles C4'-P-C4' energy: -76.067 flat angles P-C4'-P energy: -43.069 tors. eta vs tors. theta energy: -80.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 131 Temperature: 1.200000 Total energy: -824.483529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.483529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.233529 (E_RNA) where: Base-Base interactions energy: -527.753 where: short stacking energy: -244.720 Base-Backbone interact. energy: 1.595 local terms energy: -331.075339 where: bonds (distance) C4'-P energy: -68.555 bonds (distance) P-C4' energy: -68.791 flat angles C4'-P-C4' energy: -83.882 flat angles P-C4'-P energy: -52.716 tors. eta vs tors. theta energy: -57.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 131 Temperature: 1.250000 Total energy: -535.654059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.654059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.404059 (E_RNA) where: Base-Base interactions energy: -292.636 where: short stacking energy: -171.543 Base-Backbone interact. energy: -1.024 local terms energy: -274.743422 where: bonds (distance) C4'-P energy: -74.429 bonds (distance) P-C4' energy: -80.250 flat angles C4'-P-C4' energy: -52.308 flat angles P-C4'-P energy: -41.928 tors. eta vs tors. theta energy: -25.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 131 Temperature: 1.300000 Total energy: -566.727104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.727104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.477104 (E_RNA) where: Base-Base interactions energy: -348.898 where: short stacking energy: -174.113 Base-Backbone interact. energy: 2.894 local terms energy: -253.473800 where: bonds (distance) C4'-P energy: -66.400 bonds (distance) P-C4' energy: -63.273 flat angles C4'-P-C4' energy: -72.095 flat angles P-C4'-P energy: -34.522 tors. eta vs tors. theta energy: -17.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 131 Temperature: 1.350000 Total energy: -324.727635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.727635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.477635 (E_RNA) where: Base-Base interactions energy: -124.368 where: short stacking energy: -116.103 Base-Backbone interact. energy: 5.343 local terms energy: -238.452989 where: bonds (distance) C4'-P energy: -62.077 bonds (distance) P-C4' energy: -70.470 flat angles C4'-P-C4' energy: -63.724 flat angles P-C4'-P energy: -38.280 tors. eta vs tors. theta energy: -3.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 132 Temperature: 0.900000 Total energy: -1357.401528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.401528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.151528 (E_RNA) where: Base-Base interactions energy: -953.974 where: short stacking energy: -407.006 Base-Backbone interact. energy: -1.576 local terms energy: -434.601249 where: bonds (distance) C4'-P energy: -79.427 bonds (distance) P-C4' energy: -84.817 flat angles C4'-P-C4' energy: -93.763 flat angles P-C4'-P energy: -60.145 tors. eta vs tors. theta energy: -116.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 132 Temperature: 0.950000 Total energy: -1275.636444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.636444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.386444 (E_RNA) where: Base-Base interactions energy: -894.175 where: short stacking energy: -364.229 Base-Backbone interact. energy: -0.758 local terms energy: -413.453386 where: bonds (distance) C4'-P energy: -89.221 bonds (distance) P-C4' energy: -72.250 flat angles C4'-P-C4' energy: -90.145 flat angles P-C4'-P energy: -66.725 tors. eta vs tors. theta energy: -95.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 132 Temperature: 1.000000 Total energy: -1170.818045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1170.818045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1203.568045 (E_RNA) where: Base-Base interactions energy: -818.459 where: short stacking energy: -330.977 Base-Backbone interact. energy: -2.094 local terms energy: -383.015687 where: bonds (distance) C4'-P energy: -77.107 bonds (distance) P-C4' energy: -79.200 flat angles C4'-P-C4' energy: -86.515 flat angles P-C4'-P energy: -52.518 tors. eta vs tors. theta energy: -87.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 132 Temperature: 1.050000 Total energy: -1165.492031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.492031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.242031 (E_RNA) where: Base-Base interactions energy: -826.644 where: short stacking energy: -335.418 Base-Backbone interact. energy: 0.469 local terms energy: -372.067223 where: bonds (distance) C4'-P energy: -73.799 bonds (distance) P-C4' energy: -76.628 flat angles C4'-P-C4' energy: -86.401 flat angles P-C4'-P energy: -44.373 tors. eta vs tors. theta energy: -90.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 132 Temperature: 1.100000 Total energy: -1044.023916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.023916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.773916 (E_RNA) where: Base-Base interactions energy: -716.165 where: short stacking energy: -308.961 Base-Backbone interact. energy: 0.231 local terms energy: -360.840261 where: bonds (distance) C4'-P energy: -71.681 bonds (distance) P-C4' energy: -68.138 flat angles C4'-P-C4' energy: -86.834 flat angles P-C4'-P energy: -54.910 tors. eta vs tors. theta energy: -79.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 132 Temperature: 1.150000 Total energy: -948.467696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.467696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.217696 (E_RNA) where: Base-Base interactions energy: -630.296 where: short stacking energy: -277.027 Base-Backbone interact. energy: -1.278 local terms energy: -349.643863 where: bonds (distance) C4'-P energy: -68.275 bonds (distance) P-C4' energy: -74.245 flat angles C4'-P-C4' energy: -79.613 flat angles P-C4'-P energy: -45.130 tors. eta vs tors. theta energy: -82.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 132 Temperature: 1.200000 Total energy: -857.594445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.594445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -890.344445 (E_RNA) where: Base-Base interactions energy: -537.959 where: short stacking energy: -249.306 Base-Backbone interact. energy: -1.910 local terms energy: -350.475636 where: bonds (distance) C4'-P energy: -79.474 bonds (distance) P-C4' energy: -72.487 flat angles C4'-P-C4' energy: -68.626 flat angles P-C4'-P energy: -64.550 tors. eta vs tors. theta energy: -65.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 132 Temperature: 1.250000 Total energy: -534.857500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.857500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.607500 (E_RNA) where: Base-Base interactions energy: -306.049 where: short stacking energy: -187.067 Base-Backbone interact. energy: 2.044 local terms energy: -263.602450 where: bonds (distance) C4'-P energy: -66.945 bonds (distance) P-C4' energy: -75.610 flat angles C4'-P-C4' energy: -62.245 flat angles P-C4'-P energy: -37.849 tors. eta vs tors. theta energy: -20.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 132 Temperature: 1.300000 Total energy: -571.942585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.942585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.692585 (E_RNA) where: Base-Base interactions energy: -348.017 where: short stacking energy: -172.733 Base-Backbone interact. energy: 0.670 local terms energy: -257.345949 where: bonds (distance) C4'-P energy: -62.104 bonds (distance) P-C4' energy: -75.185 flat angles C4'-P-C4' energy: -54.791 flat angles P-C4'-P energy: -42.701 tors. eta vs tors. theta energy: -22.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 132 Temperature: 1.350000 Total energy: -303.448538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.448538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.198538 (E_RNA) where: Base-Base interactions energy: -120.326 where: short stacking energy: -104.763 Base-Backbone interact. energy: 0.018 local terms energy: -216.956909 where: bonds (distance) C4'-P energy: -73.467 bonds (distance) P-C4' energy: -58.276 flat angles C4'-P-C4' energy: -65.755 flat angles P-C4'-P energy: -28.815 tors. eta vs tors. theta energy: 9.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.066 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 133 Temperature: 0.900000 Total energy: -1332.941964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.941964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.691964 (E_RNA) where: Base-Base interactions energy: -933.922 where: short stacking energy: -404.340 Base-Backbone interact. energy: 1.700 local terms energy: -433.469865 where: bonds (distance) C4'-P energy: -81.369 bonds (distance) P-C4' energy: -84.080 flat angles C4'-P-C4' energy: -91.822 flat angles P-C4'-P energy: -63.360 tors. eta vs tors. theta energy: -112.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 133 Temperature: 0.950000 Total energy: -1281.291801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.291801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.041801 (E_RNA) where: Base-Base interactions energy: -902.076 where: short stacking energy: -378.893 Base-Backbone interact. energy: -5.046 local terms energy: -406.919861 where: bonds (distance) C4'-P energy: -78.585 bonds (distance) P-C4' energy: -76.172 flat angles C4'-P-C4' energy: -82.474 flat angles P-C4'-P energy: -66.000 tors. eta vs tors. theta energy: -103.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 133 Temperature: 1.000000 Total energy: -1172.042538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.042538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.792538 (E_RNA) where: Base-Base interactions energy: -811.074 where: short stacking energy: -343.603 Base-Backbone interact. energy: -1.182 local terms energy: -392.537034 where: bonds (distance) C4'-P energy: -71.170 bonds (distance) P-C4' energy: -77.432 flat angles C4'-P-C4' energy: -87.793 flat angles P-C4'-P energy: -66.860 tors. eta vs tors. theta energy: -89.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 133 Temperature: 1.050000 Total energy: -1120.309936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.309936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.059936 (E_RNA) where: Base-Base interactions energy: -765.544 where: short stacking energy: -345.951 Base-Backbone interact. energy: -1.914 local terms energy: -385.601649 where: bonds (distance) C4'-P energy: -75.274 bonds (distance) P-C4' energy: -88.830 flat angles C4'-P-C4' energy: -72.097 flat angles P-C4'-P energy: -46.879 tors. eta vs tors. theta energy: -102.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 133 Temperature: 1.100000 Total energy: -1092.898848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.898848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1125.648848 (E_RNA) where: Base-Base interactions energy: -780.329 where: short stacking energy: -315.848 Base-Backbone interact. energy: 4.680 local terms energy: -349.999704 where: bonds (distance) C4'-P energy: -72.402 bonds (distance) P-C4' energy: -68.203 flat angles C4'-P-C4' energy: -83.843 flat angles P-C4'-P energy: -55.365 tors. eta vs tors. theta energy: -70.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 133 Temperature: 1.150000 Total energy: -967.329104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.329104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.079104 (E_RNA) where: Base-Base interactions energy: -653.263 where: short stacking energy: -294.772 Base-Backbone interact. energy: 2.042 local terms energy: -349.558128 where: bonds (distance) C4'-P energy: -73.899 bonds (distance) P-C4' energy: -63.045 flat angles C4'-P-C4' energy: -84.561 flat angles P-C4'-P energy: -60.101 tors. eta vs tors. theta energy: -67.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.701 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 133 Temperature: 1.200000 Total energy: -840.330988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.330988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.080988 (E_RNA) where: Base-Base interactions energy: -569.812 where: short stacking energy: -251.728 Base-Backbone interact. energy: -1.346 local terms energy: -301.922966 where: bonds (distance) C4'-P energy: -58.459 bonds (distance) P-C4' energy: -72.701 flat angles C4'-P-C4' energy: -70.192 flat angles P-C4'-P energy: -42.195 tors. eta vs tors. theta energy: -58.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 133 Temperature: 1.250000 Total energy: -681.940020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.940020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.690020 (E_RNA) where: Base-Base interactions energy: -422.893 where: short stacking energy: -203.154 Base-Backbone interact. energy: -1.193 local terms energy: -290.604829 where: bonds (distance) C4'-P energy: -75.417 bonds (distance) P-C4' energy: -80.681 flat angles C4'-P-C4' energy: -63.036 flat angles P-C4'-P energy: -37.376 tors. eta vs tors. theta energy: -34.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 133 Temperature: 1.300000 Total energy: -508.951864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.951864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -541.701864 (E_RNA) where: Base-Base interactions energy: -299.663 where: short stacking energy: -158.471 Base-Backbone interact. energy: 6.165 local terms energy: -248.203585 where: bonds (distance) C4'-P energy: -70.641 bonds (distance) P-C4' energy: -60.268 flat angles C4'-P-C4' energy: -67.663 flat angles P-C4'-P energy: -41.820 tors. eta vs tors. theta energy: -7.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 133 Temperature: 1.350000 Total energy: -358.479381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.479381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.229381 (E_RNA) where: Base-Base interactions energy: -186.989 where: short stacking energy: -124.944 Base-Backbone interact. energy: 1.325 local terms energy: -205.565211 where: bonds (distance) C4'-P energy: -72.290 bonds (distance) P-C4' energy: -52.016 flat angles C4'-P-C4' energy: -56.480 flat angles P-C4'-P energy: -28.972 tors. eta vs tors. theta energy: 4.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 134 Temperature: 0.900000 Total energy: -1334.436771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.436771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.186771 (E_RNA) where: Base-Base interactions energy: -941.300 where: short stacking energy: -404.886 Base-Backbone interact. energy: -2.899 local terms energy: -422.987453 where: bonds (distance) C4'-P energy: -78.808 bonds (distance) P-C4' energy: -80.896 flat angles C4'-P-C4' energy: -95.547 flat angles P-C4'-P energy: -51.785 tors. eta vs tors. theta energy: -115.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 134 Temperature: 0.950000 Total energy: -1299.657185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.657185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.407185 (E_RNA) where: Base-Base interactions energy: -906.823 where: short stacking energy: -383.534 Base-Backbone interact. energy: -4.753 local terms energy: -420.830925 where: bonds (distance) C4'-P energy: -76.844 bonds (distance) P-C4' energy: -87.140 flat angles C4'-P-C4' energy: -89.721 flat angles P-C4'-P energy: -66.410 tors. eta vs tors. theta energy: -100.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 134 Temperature: 1.000000 Total energy: -1166.175929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.175929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.925929 (E_RNA) where: Base-Base interactions energy: -780.627 where: short stacking energy: -352.084 Base-Backbone interact. energy: -1.885 local terms energy: -416.414061 where: bonds (distance) C4'-P energy: -92.618 bonds (distance) P-C4' energy: -75.297 flat angles C4'-P-C4' energy: -86.819 flat angles P-C4'-P energy: -54.554 tors. eta vs tors. theta energy: -107.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 134 Temperature: 1.050000 Total energy: -1119.385542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1119.385542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.135542 (E_RNA) where: Base-Base interactions energy: -773.035 where: short stacking energy: -325.630 Base-Backbone interact. energy: -1.008 local terms energy: -378.092976 where: bonds (distance) C4'-P energy: -75.196 bonds (distance) P-C4' energy: -81.263 flat angles C4'-P-C4' energy: -80.341 flat angles P-C4'-P energy: -55.489 tors. eta vs tors. theta energy: -85.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 134 Temperature: 1.100000 Total energy: -1102.960514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.960514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1135.710514 (E_RNA) where: Base-Base interactions energy: -766.657 where: short stacking energy: -352.773 Base-Backbone interact. energy: 4.828 local terms energy: -373.881314 where: bonds (distance) C4'-P energy: -73.280 bonds (distance) P-C4' energy: -79.000 flat angles C4'-P-C4' energy: -79.532 flat angles P-C4'-P energy: -52.000 tors. eta vs tors. theta energy: -90.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 134 Temperature: 1.150000 Total energy: -988.907434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.907434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.657434 (E_RNA) where: Base-Base interactions energy: -661.048 where: short stacking energy: -304.391 Base-Backbone interact. energy: -3.000 local terms energy: -357.609297 where: bonds (distance) C4'-P energy: -68.653 bonds (distance) P-C4' energy: -78.407 flat angles C4'-P-C4' energy: -80.957 flat angles P-C4'-P energy: -51.057 tors. eta vs tors. theta energy: -78.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 134 Temperature: 1.200000 Total energy: -822.639731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.639731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.389731 (E_RNA) where: Base-Base interactions energy: -538.188 where: short stacking energy: -254.079 Base-Backbone interact. energy: -2.000 local terms energy: -315.201588 where: bonds (distance) C4'-P energy: -65.475 bonds (distance) P-C4' energy: -78.466 flat angles C4'-P-C4' energy: -68.490 flat angles P-C4'-P energy: -47.267 tors. eta vs tors. theta energy: -55.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 134 Temperature: 1.250000 Total energy: -626.327215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.327215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.077215 (E_RNA) where: Base-Base interactions energy: -389.183 where: short stacking energy: -193.497 Base-Backbone interact. energy: 0.110 local terms energy: -270.003760 where: bonds (distance) C4'-P energy: -72.014 bonds (distance) P-C4' energy: -74.027 flat angles C4'-P-C4' energy: -51.639 flat angles P-C4'-P energy: -44.331 tors. eta vs tors. theta energy: -27.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 134 Temperature: 1.300000 Total energy: -519.992543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.992543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.742543 (E_RNA) where: Base-Base interactions energy: -313.340 where: short stacking energy: -169.476 Base-Backbone interact. energy: -1.646 local terms energy: -237.756648 where: bonds (distance) C4'-P energy: -59.187 bonds (distance) P-C4' energy: -78.287 flat angles C4'-P-C4' energy: -54.114 flat angles P-C4'-P energy: -40.842 tors. eta vs tors. theta energy: -5.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 134 Temperature: 1.350000 Total energy: -317.494876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -317.494876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.244876 (E_RNA) where: Base-Base interactions energy: -149.944 where: short stacking energy: -96.212 Base-Backbone interact. energy: -1.196 local terms energy: -199.105339 where: bonds (distance) C4'-P energy: -55.617 bonds (distance) P-C4' energy: -62.950 flat angles C4'-P-C4' energy: -59.876 flat angles P-C4'-P energy: -40.815 tors. eta vs tors. theta energy: 20.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 135 Temperature: 0.900000 Total energy: -1352.372458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.372458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.122458 (E_RNA) where: Base-Base interactions energy: -938.487 where: short stacking energy: -401.577 Base-Backbone interact. energy: -1.577 local terms energy: -445.057696 where: bonds (distance) C4'-P energy: -74.710 bonds (distance) P-C4' energy: -95.234 flat angles C4'-P-C4' energy: -99.683 flat angles P-C4'-P energy: -62.286 tors. eta vs tors. theta energy: -113.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 135 Temperature: 0.950000 Total energy: -1302.905350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.905350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.655350 (E_RNA) where: Base-Base interactions energy: -917.023 where: short stacking energy: -379.545 Base-Backbone interact. energy: -1.816 local terms energy: -416.816955 where: bonds (distance) C4'-P energy: -80.113 bonds (distance) P-C4' energy: -89.888 flat angles C4'-P-C4' energy: -83.073 flat angles P-C4'-P energy: -59.945 tors. eta vs tors. theta energy: -103.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 135 Temperature: 1.000000 Total energy: -1179.737800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.737800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.487800 (E_RNA) where: Base-Base interactions energy: -805.654 where: short stacking energy: -358.464 Base-Backbone interact. energy: -1.692 local terms energy: -405.142541 where: bonds (distance) C4'-P energy: -76.771 bonds (distance) P-C4' energy: -79.993 flat angles C4'-P-C4' energy: -88.332 flat angles P-C4'-P energy: -59.610 tors. eta vs tors. theta energy: -100.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 135 Temperature: 1.050000 Total energy: -1136.191715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.191715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.941715 (E_RNA) where: Base-Base interactions energy: -787.926 where: short stacking energy: -325.562 Base-Backbone interact. energy: -2.603 local terms energy: -378.412624 where: bonds (distance) C4'-P energy: -69.640 bonds (distance) P-C4' energy: -82.801 flat angles C4'-P-C4' energy: -87.227 flat angles P-C4'-P energy: -53.182 tors. eta vs tors. theta energy: -85.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 135 Temperature: 1.100000 Total energy: -1074.258621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1074.258621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.008621 (E_RNA) where: Base-Base interactions energy: -733.210 where: short stacking energy: -318.782 Base-Backbone interact. energy: -2.325 local terms energy: -371.473500 where: bonds (distance) C4'-P energy: -70.349 bonds (distance) P-C4' energy: -71.834 flat angles C4'-P-C4' energy: -85.736 flat angles P-C4'-P energy: -53.358 tors. eta vs tors. theta energy: -90.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 135 Temperature: 1.150000 Total energy: -893.259197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.259197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.009197 (E_RNA) where: Base-Base interactions energy: -602.668 where: short stacking energy: -288.384 Base-Backbone interact. energy: -1.965 local terms energy: -321.375856 where: bonds (distance) C4'-P energy: -63.881 bonds (distance) P-C4' energy: -80.813 flat angles C4'-P-C4' energy: -80.021 flat angles P-C4'-P energy: -33.456 tors. eta vs tors. theta energy: -63.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 135 Temperature: 1.200000 Total energy: -938.097312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.097312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.847312 (E_RNA) where: Base-Base interactions energy: -641.740 where: short stacking energy: -282.040 Base-Backbone interact. energy: -2.745 local terms energy: -326.362758 where: bonds (distance) C4'-P energy: -71.988 bonds (distance) P-C4' energy: -70.074 flat angles C4'-P-C4' energy: -78.642 flat angles P-C4'-P energy: -37.985 tors. eta vs tors. theta energy: -67.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 135 Temperature: 1.250000 Total energy: -651.742431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.742431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.492431 (E_RNA) where: Base-Base interactions energy: -397.725 where: short stacking energy: -173.709 Base-Backbone interact. energy: -1.769 local terms energy: -284.998690 where: bonds (distance) C4'-P energy: -66.575 bonds (distance) P-C4' energy: -84.125 flat angles C4'-P-C4' energy: -62.679 flat angles P-C4'-P energy: -46.768 tors. eta vs tors. theta energy: -24.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 135 Temperature: 1.300000 Total energy: -500.260888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.260888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.010888 (E_RNA) where: Base-Base interactions energy: -294.023 where: short stacking energy: -151.888 Base-Backbone interact. energy: 0.912 local terms energy: -239.899440 where: bonds (distance) C4'-P energy: -71.400 bonds (distance) P-C4' energy: -58.817 flat angles C4'-P-C4' energy: -63.133 flat angles P-C4'-P energy: -34.660 tors. eta vs tors. theta energy: -11.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 135 Temperature: 1.350000 Total energy: -393.279775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.279775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.029775 (E_RNA) where: Base-Base interactions energy: -220.279 where: short stacking energy: -113.346 Base-Backbone interact. energy: -0.206 local terms energy: -205.545022 where: bonds (distance) C4'-P energy: -57.124 bonds (distance) P-C4' energy: -57.088 flat angles C4'-P-C4' energy: -52.843 flat angles P-C4'-P energy: -49.034 tors. eta vs tors. theta energy: 10.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 136 Temperature: 0.900000 Total energy: -1330.833548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.833548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.583548 (E_RNA) where: Base-Base interactions energy: -926.856 where: short stacking energy: -406.946 Base-Backbone interact. energy: -2.823 local terms energy: -433.903837 where: bonds (distance) C4'-P energy: -89.472 bonds (distance) P-C4' energy: -74.503 flat angles C4'-P-C4' energy: -85.110 flat angles P-C4'-P energy: -67.272 tors. eta vs tors. theta energy: -117.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 136 Temperature: 0.950000 Total energy: -1277.658563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.658563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.408563 (E_RNA) where: Base-Base interactions energy: -909.839 where: short stacking energy: -382.374 Base-Backbone interact. energy: -2.947 local terms energy: -397.622142 where: bonds (distance) C4'-P energy: -79.828 bonds (distance) P-C4' energy: -88.304 flat angles C4'-P-C4' energy: -89.460 flat angles P-C4'-P energy: -46.617 tors. eta vs tors. theta energy: -93.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 136 Temperature: 1.000000 Total energy: -1186.833482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.833482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.583482 (E_RNA) where: Base-Base interactions energy: -806.030 where: short stacking energy: -340.779 Base-Backbone interact. energy: -2.503 local terms energy: -411.050577 where: bonds (distance) C4'-P energy: -82.509 bonds (distance) P-C4' energy: -86.606 flat angles C4'-P-C4' energy: -90.080 flat angles P-C4'-P energy: -60.755 tors. eta vs tors. theta energy: -91.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 136 Temperature: 1.050000 Total energy: -1121.909351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.909351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.659351 (E_RNA) where: Base-Base interactions energy: -765.178 where: short stacking energy: -368.155 Base-Backbone interact. energy: -0.449 local terms energy: -389.032188 where: bonds (distance) C4'-P energy: -77.306 bonds (distance) P-C4' energy: -76.387 flat angles C4'-P-C4' energy: -81.995 flat angles P-C4'-P energy: -46.552 tors. eta vs tors. theta energy: -106.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 136 Temperature: 1.100000 Total energy: -1092.068787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1092.068787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.818787 (E_RNA) where: Base-Base interactions energy: -748.937 where: short stacking energy: -326.050 Base-Backbone interact. energy: -1.138 local terms energy: -374.743504 where: bonds (distance) C4'-P energy: -59.710 bonds (distance) P-C4' energy: -82.691 flat angles C4'-P-C4' energy: -85.881 flat angles P-C4'-P energy: -55.439 tors. eta vs tors. theta energy: -91.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 136 Temperature: 1.150000 Total energy: -926.707341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.707341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.457341 (E_RNA) where: Base-Base interactions energy: -629.087 where: short stacking energy: -272.258 Base-Backbone interact. energy: -0.772 local terms energy: -329.598233 where: bonds (distance) C4'-P energy: -65.068 bonds (distance) P-C4' energy: -72.576 flat angles C4'-P-C4' energy: -76.164 flat angles P-C4'-P energy: -48.044 tors. eta vs tors. theta energy: -67.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 136 Temperature: 1.200000 Total energy: -920.485509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.485509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.235509 (E_RNA) where: Base-Base interactions energy: -621.392 where: short stacking energy: -262.189 Base-Backbone interact. energy: -2.377 local terms energy: -329.625133 where: bonds (distance) C4'-P energy: -57.195 bonds (distance) P-C4' energy: -76.594 flat angles C4'-P-C4' energy: -84.241 flat angles P-C4'-P energy: -48.061 tors. eta vs tors. theta energy: -63.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.158 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 136 Temperature: 1.250000 Total energy: -734.305621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.305621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.055621 (E_RNA) where: Base-Base interactions energy: -483.984 where: short stacking energy: -196.067 Base-Backbone interact. energy: -1.425 local terms energy: -281.646953 where: bonds (distance) C4'-P energy: -72.698 bonds (distance) P-C4' energy: -65.520 flat angles C4'-P-C4' energy: -54.821 flat angles P-C4'-P energy: -43.443 tors. eta vs tors. theta energy: -45.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 136 Temperature: 1.300000 Total energy: -476.007916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.007916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.757916 (E_RNA) where: Base-Base interactions energy: -278.707 where: short stacking energy: -162.471 Base-Backbone interact. energy: 6.537 local terms energy: -236.587957 where: bonds (distance) C4'-P energy: -63.435 bonds (distance) P-C4' energy: -66.903 flat angles C4'-P-C4' energy: -55.454 flat angles P-C4'-P energy: -40.197 tors. eta vs tors. theta energy: -10.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 136 Temperature: 1.350000 Total energy: -401.897468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.897468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.647468 (E_RNA) where: Base-Base interactions energy: -211.881 where: short stacking energy: -126.215 Base-Backbone interact. energy: -0.749 local terms energy: -222.016989 where: bonds (distance) C4'-P energy: -73.161 bonds (distance) P-C4' energy: -59.698 flat angles C4'-P-C4' energy: -61.299 flat angles P-C4'-P energy: -33.023 tors. eta vs tors. theta energy: 5.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 137 Temperature: 0.900000 Total energy: -1306.907369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.907369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.657369 (E_RNA) where: Base-Base interactions energy: -916.705 where: short stacking energy: -394.411 Base-Backbone interact. energy: 1.007 local terms energy: -425.719559 where: bonds (distance) C4'-P energy: -90.056 bonds (distance) P-C4' energy: -81.333 flat angles C4'-P-C4' energy: -88.261 flat angles P-C4'-P energy: -63.621 tors. eta vs tors. theta energy: -102.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.760 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 137 Temperature: 0.950000 Total energy: -1308.176595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.176595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.926595 (E_RNA) where: Base-Base interactions energy: -937.690 where: short stacking energy: -397.709 Base-Backbone interact. energy: -0.851 local terms energy: -402.385455 where: bonds (distance) C4'-P energy: -71.496 bonds (distance) P-C4' energy: -79.133 flat angles C4'-P-C4' energy: -80.184 flat angles P-C4'-P energy: -61.731 tors. eta vs tors. theta energy: -109.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 137 Temperature: 1.000000 Total energy: -1190.221232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.221232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.971232 (E_RNA) where: Base-Base interactions energy: -815.550 where: short stacking energy: -369.488 Base-Backbone interact. energy: -5.011 local terms energy: -402.409915 where: bonds (distance) C4'-P energy: -78.045 bonds (distance) P-C4' energy: -76.436 flat angles C4'-P-C4' energy: -93.511 flat angles P-C4'-P energy: -57.710 tors. eta vs tors. theta energy: -96.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 137 Temperature: 1.050000 Total energy: -1098.756660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.756660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.506660 (E_RNA) where: Base-Base interactions energy: -769.134 where: short stacking energy: -313.896 Base-Backbone interact. energy: 0.014 local terms energy: -362.555309 where: bonds (distance) C4'-P energy: -82.674 bonds (distance) P-C4' energy: -75.341 flat angles C4'-P-C4' energy: -73.973 flat angles P-C4'-P energy: -50.567 tors. eta vs tors. theta energy: -80.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.169 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 137 Temperature: 1.100000 Total energy: -1070.369966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.369966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.119966 (E_RNA) where: Base-Base interactions energy: -739.750 where: short stacking energy: -332.295 Base-Backbone interact. energy: -1.708 local terms energy: -361.661922 where: bonds (distance) C4'-P energy: -65.423 bonds (distance) P-C4' energy: -82.210 flat angles C4'-P-C4' energy: -76.425 flat angles P-C4'-P energy: -48.425 tors. eta vs tors. theta energy: -89.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 137 Temperature: 1.150000 Total energy: -977.888302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.888302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.638302 (E_RNA) where: Base-Base interactions energy: -668.354 where: short stacking energy: -323.656 Base-Backbone interact. energy: -0.864 local terms energy: -341.420638 where: bonds (distance) C4'-P energy: -60.383 bonds (distance) P-C4' energy: -73.677 flat angles C4'-P-C4' energy: -64.598 flat angles P-C4'-P energy: -57.340 tors. eta vs tors. theta energy: -85.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 137 Temperature: 1.200000 Total energy: -889.993053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.993053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.743053 (E_RNA) where: Base-Base interactions energy: -599.949 where: short stacking energy: -259.458 Base-Backbone interact. energy: 1.546 local terms energy: -324.339573 where: bonds (distance) C4'-P energy: -81.932 bonds (distance) P-C4' energy: -67.328 flat angles C4'-P-C4' energy: -72.880 flat angles P-C4'-P energy: -44.126 tors. eta vs tors. theta energy: -58.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 137 Temperature: 1.250000 Total energy: -763.945707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.945707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.695707 (E_RNA) where: Base-Base interactions energy: -488.876 where: short stacking energy: -215.922 Base-Backbone interact. energy: 1.964 local terms energy: -309.782950 where: bonds (distance) C4'-P energy: -71.072 bonds (distance) P-C4' energy: -77.031 flat angles C4'-P-C4' energy: -73.529 flat angles P-C4'-P energy: -41.172 tors. eta vs tors. theta energy: -46.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 137 Temperature: 1.300000 Total energy: -460.653777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.653777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.403777 (E_RNA) where: Base-Base interactions energy: -242.170 where: short stacking energy: -128.597 Base-Backbone interact. energy: -1.569 local terms energy: -249.664745 where: bonds (distance) C4'-P energy: -70.597 bonds (distance) P-C4' energy: -70.887 flat angles C4'-P-C4' energy: -76.840 flat angles P-C4'-P energy: -31.205 tors. eta vs tors. theta energy: -0.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 137 Temperature: 1.350000 Total energy: -379.722513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.722513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.472513 (E_RNA) where: Base-Base interactions energy: -187.422 where: short stacking energy: -115.418 Base-Backbone interact. energy: 1.589 local terms energy: -226.640269 where: bonds (distance) C4'-P energy: -75.240 bonds (distance) P-C4' energy: -71.327 flat angles C4'-P-C4' energy: -40.640 flat angles P-C4'-P energy: -33.211 tors. eta vs tors. theta energy: -6.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 138 Temperature: 0.900000 Total energy: -1329.556108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.556108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.306108 (E_RNA) where: Base-Base interactions energy: -941.584 where: short stacking energy: -386.552 Base-Backbone interact. energy: -1.428 local terms energy: -419.294082 where: bonds (distance) C4'-P energy: -77.827 bonds (distance) P-C4' energy: -92.533 flat angles C4'-P-C4' energy: -89.713 flat angles P-C4'-P energy: -62.485 tors. eta vs tors. theta energy: -96.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 138 Temperature: 0.950000 Total energy: -1301.114084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.114084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.864084 (E_RNA) where: Base-Base interactions energy: -915.679 where: short stacking energy: -381.570 Base-Backbone interact. energy: -3.773 local terms energy: -414.411421 where: bonds (distance) C4'-P energy: -83.326 bonds (distance) P-C4' energy: -81.163 flat angles C4'-P-C4' energy: -81.555 flat angles P-C4'-P energy: -64.427 tors. eta vs tors. theta energy: -103.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 138 Temperature: 1.000000 Total energy: -1206.701043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.701043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.451043 (E_RNA) where: Base-Base interactions energy: -818.421 where: short stacking energy: -349.238 Base-Backbone interact. energy: -1.406 local terms energy: -419.623831 where: bonds (distance) C4'-P energy: -73.973 bonds (distance) P-C4' energy: -83.279 flat angles C4'-P-C4' energy: -91.352 flat angles P-C4'-P energy: -61.664 tors. eta vs tors. theta energy: -109.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 138 Temperature: 1.050000 Total energy: -1108.366385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.366385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.116385 (E_RNA) where: Base-Base interactions energy: -768.296 where: short stacking energy: -330.402 Base-Backbone interact. energy: -0.746 local terms energy: -372.074361 where: bonds (distance) C4'-P energy: -78.524 bonds (distance) P-C4' energy: -80.201 flat angles C4'-P-C4' energy: -72.506 flat angles P-C4'-P energy: -53.047 tors. eta vs tors. theta energy: -87.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 138 Temperature: 1.100000 Total energy: -1071.717327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.717327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.467327 (E_RNA) where: Base-Base interactions energy: -749.231 where: short stacking energy: -321.285 Base-Backbone interact. energy: -0.089 local terms energy: -355.146649 where: bonds (distance) C4'-P energy: -65.368 bonds (distance) P-C4' energy: -73.717 flat angles C4'-P-C4' energy: -86.132 flat angles P-C4'-P energy: -51.788 tors. eta vs tors. theta energy: -78.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 138 Temperature: 1.150000 Total energy: -1011.915208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.915208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.665208 (E_RNA) where: Base-Base interactions energy: -691.323 where: short stacking energy: -324.482 Base-Backbone interact. energy: -0.856 local terms energy: -352.486802 where: bonds (distance) C4'-P energy: -69.706 bonds (distance) P-C4' energy: -66.454 flat angles C4'-P-C4' energy: -86.751 flat angles P-C4'-P energy: -54.373 tors. eta vs tors. theta energy: -75.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 138 Temperature: 1.200000 Total energy: -929.372325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -929.372325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.122325 (E_RNA) where: Base-Base interactions energy: -632.417 where: short stacking energy: -275.932 Base-Backbone interact. energy: 3.407 local terms energy: -333.112499 where: bonds (distance) C4'-P energy: -76.812 bonds (distance) P-C4' energy: -74.453 flat angles C4'-P-C4' energy: -69.453 flat angles P-C4'-P energy: -49.877 tors. eta vs tors. theta energy: -62.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 138 Temperature: 1.250000 Total energy: -711.748905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.748905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.498905 (E_RNA) where: Base-Base interactions energy: -455.347 where: short stacking energy: -211.361 Base-Backbone interact. energy: -0.450 local terms energy: -288.701540 where: bonds (distance) C4'-P energy: -71.587 bonds (distance) P-C4' energy: -69.244 flat angles C4'-P-C4' energy: -61.729 flat angles P-C4'-P energy: -46.354 tors. eta vs tors. theta energy: -39.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 138 Temperature: 1.300000 Total energy: -474.939427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.939427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.689427 (E_RNA) where: Base-Base interactions energy: -244.730 where: short stacking energy: -150.922 Base-Backbone interact. energy: 0.511 local terms energy: -263.470605 where: bonds (distance) C4'-P energy: -65.989 bonds (distance) P-C4' energy: -76.208 flat angles C4'-P-C4' energy: -72.703 flat angles P-C4'-P energy: -30.399 tors. eta vs tors. theta energy: -18.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 138 Temperature: 1.350000 Total energy: -389.425896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.425896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.175896 (E_RNA) where: Base-Base interactions energy: -187.877 where: short stacking energy: -128.646 Base-Backbone interact. energy: 2.500 local terms energy: -236.798722 where: bonds (distance) C4'-P energy: -72.888 bonds (distance) P-C4' energy: -73.312 flat angles C4'-P-C4' energy: -57.287 flat angles P-C4'-P energy: -31.370 tors. eta vs tors. theta energy: -1.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 139 Temperature: 0.900000 Total energy: -1341.854173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.854173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.604173 (E_RNA) where: Base-Base interactions energy: -942.603 where: short stacking energy: -387.168 Base-Backbone interact. energy: -3.273 local terms energy: -428.728094 where: bonds (distance) C4'-P energy: -81.902 bonds (distance) P-C4' energy: -87.103 flat angles C4'-P-C4' energy: -85.468 flat angles P-C4'-P energy: -71.530 tors. eta vs tors. theta energy: -102.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 139 Temperature: 0.950000 Total energy: -1301.386999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.386999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.136999 (E_RNA) where: Base-Base interactions energy: -922.749 where: short stacking energy: -374.943 Base-Backbone interact. energy: -2.980 local terms energy: -408.407764 where: bonds (distance) C4'-P energy: -68.133 bonds (distance) P-C4' energy: -86.613 flat angles C4'-P-C4' energy: -88.075 flat angles P-C4'-P energy: -63.627 tors. eta vs tors. theta energy: -101.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 139 Temperature: 1.000000 Total energy: -1193.441109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.441109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.191109 (E_RNA) where: Base-Base interactions energy: -829.101 where: short stacking energy: -354.898 Base-Backbone interact. energy: -1.974 local terms energy: -395.116084 where: bonds (distance) C4'-P energy: -81.087 bonds (distance) P-C4' energy: -73.271 flat angles C4'-P-C4' energy: -92.686 flat angles P-C4'-P energy: -57.691 tors. eta vs tors. theta energy: -90.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 139 Temperature: 1.050000 Total energy: -1118.857147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.857147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1151.607147 (E_RNA) where: Base-Base interactions energy: -779.572 where: short stacking energy: -338.959 Base-Backbone interact. energy: 0.601 local terms energy: -372.635511 where: bonds (distance) C4'-P energy: -70.450 bonds (distance) P-C4' energy: -75.015 flat angles C4'-P-C4' energy: -78.883 flat angles P-C4'-P energy: -60.997 tors. eta vs tors. theta energy: -87.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 139 Temperature: 1.100000 Total energy: -1068.031281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.031281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.781281 (E_RNA) where: Base-Base interactions energy: -743.409 where: short stacking energy: -308.900 Base-Backbone interact. energy: 0.895 local terms energy: -358.267350 where: bonds (distance) C4'-P energy: -78.075 bonds (distance) P-C4' energy: -62.320 flat angles C4'-P-C4' energy: -76.060 flat angles P-C4'-P energy: -57.732 tors. eta vs tors. theta energy: -84.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 139 Temperature: 1.150000 Total energy: -997.499493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.499493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.249493 (E_RNA) where: Base-Base interactions energy: -699.069 where: short stacking energy: -296.708 Base-Backbone interact. energy: -3.135 local terms energy: -328.046156 where: bonds (distance) C4'-P energy: -64.040 bonds (distance) P-C4' energy: -68.701 flat angles C4'-P-C4' energy: -80.467 flat angles P-C4'-P energy: -47.258 tors. eta vs tors. theta energy: -67.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 139 Temperature: 1.200000 Total energy: -876.629376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.629376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.379376 (E_RNA) where: Base-Base interactions energy: -611.041 where: short stacking energy: -269.752 Base-Backbone interact. energy: -1.448 local terms energy: -297.020488 where: bonds (distance) C4'-P energy: -81.765 bonds (distance) P-C4' energy: -62.194 flat angles C4'-P-C4' energy: -70.356 flat angles P-C4'-P energy: -19.500 tors. eta vs tors. theta energy: -63.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.131 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 139 Temperature: 1.250000 Total energy: -680.558586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.558586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -713.308586 (E_RNA) where: Base-Base interactions energy: -441.258 where: short stacking energy: -199.115 Base-Backbone interact. energy: 0.961 local terms energy: -273.012000 where: bonds (distance) C4'-P energy: -56.121 bonds (distance) P-C4' energy: -78.314 flat angles C4'-P-C4' energy: -60.443 flat angles P-C4'-P energy: -43.145 tors. eta vs tors. theta energy: -34.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 139 Temperature: 1.300000 Total energy: -441.600398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.600398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.350398 (E_RNA) where: Base-Base interactions energy: -239.207 where: short stacking energy: -118.803 Base-Backbone interact. energy: -0.871 local terms energy: -234.272002 where: bonds (distance) C4'-P energy: -73.963 bonds (distance) P-C4' energy: -71.366 flat angles C4'-P-C4' energy: -61.964 flat angles P-C4'-P energy: -39.911 tors. eta vs tors. theta energy: 12.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 139 Temperature: 1.350000 Total energy: -353.775382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.775382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.525382 (E_RNA) where: Base-Base interactions energy: -178.540 where: short stacking energy: -106.469 Base-Backbone interact. energy: -0.614 local terms energy: -207.371074 where: bonds (distance) C4'-P energy: -56.212 bonds (distance) P-C4' energy: -64.390 flat angles C4'-P-C4' energy: -51.858 flat angles P-C4'-P energy: -33.319 tors. eta vs tors. theta energy: -1.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 140 Temperature: 0.900000 Total energy: -1344.726446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.726446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.476446 (E_RNA) where: Base-Base interactions energy: -930.079 where: short stacking energy: -381.484 Base-Backbone interact. energy: -1.656 local terms energy: -445.741298 where: bonds (distance) C4'-P energy: -87.072 bonds (distance) P-C4' energy: -89.719 flat angles C4'-P-C4' energy: -94.891 flat angles P-C4'-P energy: -59.365 tors. eta vs tors. theta energy: -114.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 140 Temperature: 0.950000 Total energy: -1307.479934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.479934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.229934 (E_RNA) where: Base-Base interactions energy: -929.591 where: short stacking energy: -389.014 Base-Backbone interact. energy: -1.544 local terms energy: -409.095106 where: bonds (distance) C4'-P energy: -83.325 bonds (distance) P-C4' energy: -82.293 flat angles C4'-P-C4' energy: -87.169 flat angles P-C4'-P energy: -48.843 tors. eta vs tors. theta energy: -107.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 140 Temperature: 1.000000 Total energy: -1134.608742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.608742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.358742 (E_RNA) where: Base-Base interactions energy: -777.016 where: short stacking energy: -346.717 Base-Backbone interact. energy: -1.975 local terms energy: -388.367245 where: bonds (distance) C4'-P energy: -75.115 bonds (distance) P-C4' energy: -79.993 flat angles C4'-P-C4' energy: -90.327 flat angles P-C4'-P energy: -58.057 tors. eta vs tors. theta energy: -84.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 140 Temperature: 1.050000 Total energy: -1100.363716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.363716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1133.113716 (E_RNA) where: Base-Base interactions energy: -769.903 where: short stacking energy: -342.863 Base-Backbone interact. energy: -2.452 local terms energy: -360.758515 where: bonds (distance) C4'-P energy: -75.285 bonds (distance) P-C4' energy: -76.530 flat angles C4'-P-C4' energy: -78.607 flat angles P-C4'-P energy: -47.803 tors. eta vs tors. theta energy: -82.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 140 Temperature: 1.100000 Total energy: -1094.377959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1094.377959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1127.127959 (E_RNA) where: Base-Base interactions energy: -725.058 where: short stacking energy: -332.916 Base-Backbone interact. energy: -1.601 local terms energy: -400.469047 where: bonds (distance) C4'-P energy: -80.333 bonds (distance) P-C4' energy: -73.440 flat angles C4'-P-C4' energy: -84.277 flat angles P-C4'-P energy: -61.819 tors. eta vs tors. theta energy: -100.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 140 Temperature: 1.150000 Total energy: -1001.118555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.118555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1033.868555 (E_RNA) where: Base-Base interactions energy: -685.349 where: short stacking energy: -283.009 Base-Backbone interact. energy: -1.506 local terms energy: -347.013456 where: bonds (distance) C4'-P energy: -69.054 bonds (distance) P-C4' energy: -74.743 flat angles C4'-P-C4' energy: -83.902 flat angles P-C4'-P energy: -48.789 tors. eta vs tors. theta energy: -70.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 140 Temperature: 1.200000 Total energy: -862.865108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.865108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.615108 (E_RNA) where: Base-Base interactions energy: -563.718 where: short stacking energy: -238.158 Base-Backbone interact. energy: -2.363 local terms energy: -329.533967 where: bonds (distance) C4'-P energy: -73.219 bonds (distance) P-C4' energy: -79.822 flat angles C4'-P-C4' energy: -79.690 flat angles P-C4'-P energy: -53.180 tors. eta vs tors. theta energy: -43.624 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 140 Temperature: 1.250000 Total energy: -707.270467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.270467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.020467 (E_RNA) where: Base-Base interactions energy: -438.339 where: short stacking energy: -199.259 Base-Backbone interact. energy: -1.491 local terms energy: -300.190221 where: bonds (distance) C4'-P energy: -68.185 bonds (distance) P-C4' energy: -72.231 flat angles C4'-P-C4' energy: -69.776 flat angles P-C4'-P energy: -48.101 tors. eta vs tors. theta energy: -41.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 140 Temperature: 1.300000 Total energy: -464.523415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.523415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.273415 (E_RNA) where: Base-Base interactions energy: -238.947 where: short stacking energy: -134.152 Base-Backbone interact. energy: 0.085 local terms energy: -258.411435 where: bonds (distance) C4'-P energy: -65.558 bonds (distance) P-C4' energy: -83.380 flat angles C4'-P-C4' energy: -68.842 flat angles P-C4'-P energy: -38.487 tors. eta vs tors. theta energy: -2.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 140 Temperature: 1.350000 Total energy: -357.009681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -357.009681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.759681 (E_RNA) where: Base-Base interactions energy: -175.200 where: short stacking energy: -114.127 Base-Backbone interact. energy: 0.813 local terms energy: -215.372849 where: bonds (distance) C4'-P energy: -70.244 bonds (distance) P-C4' energy: -62.515 flat angles C4'-P-C4' energy: -58.232 flat angles P-C4'-P energy: -23.397 tors. eta vs tors. theta energy: -0.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 141 Temperature: 0.900000 Total energy: -1334.778949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.778949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.528949 (E_RNA) where: Base-Base interactions energy: -907.265 where: short stacking energy: -398.390 Base-Backbone interact. energy: -2.896 local terms energy: -457.367375 where: bonds (distance) C4'-P energy: -85.010 bonds (distance) P-C4' energy: -87.324 flat angles C4'-P-C4' energy: -104.459 flat angles P-C4'-P energy: -65.804 tors. eta vs tors. theta energy: -114.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 141 Temperature: 0.950000 Total energy: -1301.674573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.674573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.424573 (E_RNA) where: Base-Base interactions energy: -911.519 where: short stacking energy: -368.251 Base-Backbone interact. energy: -1.592 local terms energy: -421.313707 where: bonds (distance) C4'-P energy: -83.682 bonds (distance) P-C4' energy: -85.423 flat angles C4'-P-C4' energy: -93.210 flat angles P-C4'-P energy: -53.596 tors. eta vs tors. theta energy: -105.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 141 Temperature: 1.000000 Total energy: -1198.160901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.160901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.910901 (E_RNA) where: Base-Base interactions energy: -807.769 where: short stacking energy: -347.530 Base-Backbone interact. energy: -1.441 local terms energy: -421.700989 where: bonds (distance) C4'-P energy: -74.052 bonds (distance) P-C4' energy: -91.470 flat angles C4'-P-C4' energy: -94.925 flat angles P-C4'-P energy: -70.967 tors. eta vs tors. theta energy: -90.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 141 Temperature: 1.050000 Total energy: -1103.839078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.839078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.589078 (E_RNA) where: Base-Base interactions energy: -773.077 where: short stacking energy: -304.751 Base-Backbone interact. energy: -1.443 local terms energy: -362.070056 where: bonds (distance) C4'-P energy: -75.737 bonds (distance) P-C4' energy: -76.239 flat angles C4'-P-C4' energy: -83.144 flat angles P-C4'-P energy: -54.361 tors. eta vs tors. theta energy: -72.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 141 Temperature: 1.100000 Total energy: -1084.059413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.059413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1116.809413 (E_RNA) where: Base-Base interactions energy: -756.057 where: short stacking energy: -338.741 Base-Backbone interact. energy: -0.151 local terms energy: -360.601601 where: bonds (distance) C4'-P energy: -62.417 bonds (distance) P-C4' energy: -77.137 flat angles C4'-P-C4' energy: -78.621 flat angles P-C4'-P energy: -45.220 tors. eta vs tors. theta energy: -97.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 141 Temperature: 1.150000 Total energy: -971.227160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -971.227160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.977160 (E_RNA) where: Base-Base interactions energy: -648.316 where: short stacking energy: -283.273 Base-Backbone interact. energy: -2.302 local terms energy: -353.359133 where: bonds (distance) C4'-P energy: -75.554 bonds (distance) P-C4' energy: -72.740 flat angles C4'-P-C4' energy: -76.370 flat angles P-C4'-P energy: -58.641 tors. eta vs tors. theta energy: -70.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 141 Temperature: 1.200000 Total energy: -878.621307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.621307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -911.371307 (E_RNA) where: Base-Base interactions energy: -591.400 where: short stacking energy: -273.444 Base-Backbone interact. energy: -0.676 local terms energy: -319.295306 where: bonds (distance) C4'-P energy: -59.248 bonds (distance) P-C4' energy: -72.236 flat angles C4'-P-C4' energy: -76.973 flat angles P-C4'-P energy: -43.301 tors. eta vs tors. theta energy: -67.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 141 Temperature: 1.250000 Total energy: -748.001317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.001317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.751317 (E_RNA) where: Base-Base interactions energy: -514.251 where: short stacking energy: -223.256 Base-Backbone interact. energy: -2.769 local terms energy: -263.731327 where: bonds (distance) C4'-P energy: -55.739 bonds (distance) P-C4' energy: -70.422 flat angles C4'-P-C4' energy: -66.884 flat angles P-C4'-P energy: -36.753 tors. eta vs tors. theta energy: -33.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 141 Temperature: 1.300000 Total energy: -495.885183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.885183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.635183 (E_RNA) where: Base-Base interactions energy: -287.557 where: short stacking energy: -139.159 Base-Backbone interact. energy: -2.282 local terms energy: -238.795952 where: bonds (distance) C4'-P energy: -79.161 bonds (distance) P-C4' energy: -71.235 flat angles C4'-P-C4' energy: -47.448 flat angles P-C4'-P energy: -35.418 tors. eta vs tors. theta energy: -5.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 141 Temperature: 1.350000 Total energy: -355.635294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.635294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.385294 (E_RNA) where: Base-Base interactions energy: -173.903 where: short stacking energy: -96.884 Base-Backbone interact. energy: 2.721 local terms energy: -217.203159 where: bonds (distance) C4'-P energy: -69.974 bonds (distance) P-C4' energy: -81.464 flat angles C4'-P-C4' energy: -58.394 flat angles P-C4'-P energy: -19.719 tors. eta vs tors. theta energy: 12.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 142 Temperature: 0.900000 Total energy: -1329.186353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1329.186353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.936353 (E_RNA) where: Base-Base interactions energy: -939.929 where: short stacking energy: -420.587 Base-Backbone interact. energy: -2.843 local terms energy: -419.164331 where: bonds (distance) C4'-P energy: -79.054 bonds (distance) P-C4' energy: -82.814 flat angles C4'-P-C4' energy: -87.952 flat angles P-C4'-P energy: -55.455 tors. eta vs tors. theta energy: -113.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 142 Temperature: 0.950000 Total energy: -1319.461229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.461229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.211229 (E_RNA) where: Base-Base interactions energy: -938.231 where: short stacking energy: -398.588 Base-Backbone interact. energy: 0.169 local terms energy: -414.148445 where: bonds (distance) C4'-P energy: -76.054 bonds (distance) P-C4' energy: -88.005 flat angles C4'-P-C4' energy: -97.937 flat angles P-C4'-P energy: -42.764 tors. eta vs tors. theta energy: -109.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 142 Temperature: 1.000000 Total energy: -1189.777221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.777221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.527221 (E_RNA) where: Base-Base interactions energy: -818.941 where: short stacking energy: -350.425 Base-Backbone interact. energy: -3.849 local terms energy: -399.736504 where: bonds (distance) C4'-P energy: -80.447 bonds (distance) P-C4' energy: -85.343 flat angles C4'-P-C4' energy: -91.857 flat angles P-C4'-P energy: -53.322 tors. eta vs tors. theta energy: -88.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 142 Temperature: 1.050000 Total energy: -1073.741063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.741063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.491063 (E_RNA) where: Base-Base interactions energy: -769.900 where: short stacking energy: -329.347 Base-Backbone interact. energy: -2.421 local terms energy: -334.169576 where: bonds (distance) C4'-P energy: -61.627 bonds (distance) P-C4' energy: -61.268 flat angles C4'-P-C4' energy: -79.473 flat angles P-C4'-P energy: -50.151 tors. eta vs tors. theta energy: -81.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 142 Temperature: 1.100000 Total energy: -1095.882052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.882052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.632052 (E_RNA) where: Base-Base interactions energy: -765.224 where: short stacking energy: -330.019 Base-Backbone interact. energy: 0.607 local terms energy: -364.014716 where: bonds (distance) C4'-P energy: -77.746 bonds (distance) P-C4' energy: -52.105 flat angles C4'-P-C4' energy: -83.417 flat angles P-C4'-P energy: -47.371 tors. eta vs tors. theta energy: -103.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 142 Temperature: 1.150000 Total energy: -1028.357578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1028.357578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.107578 (E_RNA) where: Base-Base interactions energy: -705.676 where: short stacking energy: -331.561 Base-Backbone interact. energy: -0.752 local terms energy: -354.678929 where: bonds (distance) C4'-P energy: -57.993 bonds (distance) P-C4' energy: -77.516 flat angles C4'-P-C4' energy: -80.375 flat angles P-C4'-P energy: -48.268 tors. eta vs tors. theta energy: -90.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 142 Temperature: 1.200000 Total energy: -894.544525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.544525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.294525 (E_RNA) where: Base-Base interactions energy: -605.613 where: short stacking energy: -272.787 Base-Backbone interact. energy: -1.396 local terms energy: -320.285639 where: bonds (distance) C4'-P energy: -62.370 bonds (distance) P-C4' energy: -77.510 flat angles C4'-P-C4' energy: -72.623 flat angles P-C4'-P energy: -43.881 tors. eta vs tors. theta energy: -63.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 142 Temperature: 1.250000 Total energy: -752.525442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.525442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.275442 (E_RNA) where: Base-Base interactions energy: -505.778 where: short stacking energy: -207.278 Base-Backbone interact. energy: -1.170 local terms energy: -278.327203 where: bonds (distance) C4'-P energy: -67.642 bonds (distance) P-C4' energy: -65.000 flat angles C4'-P-C4' energy: -70.828 flat angles P-C4'-P energy: -39.197 tors. eta vs tors. theta energy: -35.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 142 Temperature: 1.300000 Total energy: -517.361753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.361753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.111753 (E_RNA) where: Base-Base interactions energy: -272.740 where: short stacking energy: -131.207 Base-Backbone interact. energy: 0.176 local terms energy: -277.547874 where: bonds (distance) C4'-P energy: -78.525 bonds (distance) P-C4' energy: -81.938 flat angles C4'-P-C4' energy: -62.982 flat angles P-C4'-P energy: -47.535 tors. eta vs tors. theta energy: -6.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 142 Temperature: 1.350000 Total energy: -392.843416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.843416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.593416 (E_RNA) where: Base-Base interactions energy: -196.745 where: short stacking energy: -98.522 Base-Backbone interact. energy: -3.321 local terms energy: -225.528332 where: bonds (distance) C4'-P energy: -66.740 bonds (distance) P-C4' energy: -75.039 flat angles C4'-P-C4' energy: -54.344 flat angles P-C4'-P energy: -44.112 tors. eta vs tors. theta energy: 14.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 143 Temperature: 0.900000 Total energy: -1330.015983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.015983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.765983 (E_RNA) where: Base-Base interactions energy: -925.304 where: short stacking energy: -394.319 Base-Backbone interact. energy: -1.742 local terms energy: -435.720712 where: bonds (distance) C4'-P energy: -70.908 bonds (distance) P-C4' energy: -90.834 flat angles C4'-P-C4' energy: -86.262 flat angles P-C4'-P energy: -69.251 tors. eta vs tors. theta energy: -118.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 143 Temperature: 0.950000 Total energy: -1293.510650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.510650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.260650 (E_RNA) where: Base-Base interactions energy: -921.947 where: short stacking energy: -378.641 Base-Backbone interact. energy: 1.009 local terms energy: -405.322791 where: bonds (distance) C4'-P energy: -72.800 bonds (distance) P-C4' energy: -88.634 flat angles C4'-P-C4' energy: -86.872 flat angles P-C4'-P energy: -58.302 tors. eta vs tors. theta energy: -98.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 143 Temperature: 1.000000 Total energy: -1177.667488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.667488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.417488 (E_RNA) where: Base-Base interactions energy: -802.401 where: short stacking energy: -338.109 Base-Backbone interact. energy: -0.949 local terms energy: -407.067289 where: bonds (distance) C4'-P energy: -82.711 bonds (distance) P-C4' energy: -81.328 flat angles C4'-P-C4' energy: -83.495 flat angles P-C4'-P energy: -60.560 tors. eta vs tors. theta energy: -98.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 143 Temperature: 1.050000 Total energy: -1105.476277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.476277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.226277 (E_RNA) where: Base-Base interactions energy: -744.065 where: short stacking energy: -339.240 Base-Backbone interact. energy: -0.547 local terms energy: -393.614436 where: bonds (distance) C4'-P energy: -79.055 bonds (distance) P-C4' energy: -97.353 flat angles C4'-P-C4' energy: -73.822 flat angles P-C4'-P energy: -47.356 tors. eta vs tors. theta energy: -96.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 143 Temperature: 1.100000 Total energy: -1047.049648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.049648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.799648 (E_RNA) where: Base-Base interactions energy: -714.120 where: short stacking energy: -308.062 Base-Backbone interact. energy: -0.800 local terms energy: -364.879103 where: bonds (distance) C4'-P energy: -59.193 bonds (distance) P-C4' energy: -81.016 flat angles C4'-P-C4' energy: -84.651 flat angles P-C4'-P energy: -60.796 tors. eta vs tors. theta energy: -79.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 143 Temperature: 1.150000 Total energy: -1043.785624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.785624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.535624 (E_RNA) where: Base-Base interactions energy: -725.992 where: short stacking energy: -329.310 Base-Backbone interact. energy: -2.557 local terms energy: -347.986661 where: bonds (distance) C4'-P energy: -56.357 bonds (distance) P-C4' energy: -73.144 flat angles C4'-P-C4' energy: -66.684 flat angles P-C4'-P energy: -61.946 tors. eta vs tors. theta energy: -89.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 143 Temperature: 1.200000 Total energy: -927.928231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.928231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.678231 (E_RNA) where: Base-Base interactions energy: -631.153 where: short stacking energy: -292.926 Base-Backbone interact. energy: -0.491 local terms energy: -329.296897 where: bonds (distance) C4'-P energy: -82.320 bonds (distance) P-C4' energy: -69.812 flat angles C4'-P-C4' energy: -67.697 flat angles P-C4'-P energy: -46.058 tors. eta vs tors. theta energy: -63.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.262 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 143 Temperature: 1.250000 Total energy: -749.497117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.497117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.247117 (E_RNA) where: Base-Base interactions energy: -497.192 where: short stacking energy: -233.203 Base-Backbone interact. energy: -0.898 local terms energy: -284.156404 where: bonds (distance) C4'-P energy: -70.037 bonds (distance) P-C4' energy: -58.719 flat angles C4'-P-C4' energy: -80.273 flat angles P-C4'-P energy: -29.265 tors. eta vs tors. theta energy: -45.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 143 Temperature: 1.300000 Total energy: -494.384059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.384059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.134059 (E_RNA) where: Base-Base interactions energy: -278.607 where: short stacking energy: -153.580 Base-Backbone interact. energy: 1.208 local terms energy: -249.734703 where: bonds (distance) C4'-P energy: -76.943 bonds (distance) P-C4' energy: -56.144 flat angles C4'-P-C4' energy: -64.431 flat angles P-C4'-P energy: -35.409 tors. eta vs tors. theta energy: -16.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 143 Temperature: 1.350000 Total energy: -383.399791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.399791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.149791 (E_RNA) where: Base-Base interactions energy: -157.424 where: short stacking energy: -99.503 Base-Backbone interact. energy: 0.067 local terms energy: -258.792537 where: bonds (distance) C4'-P energy: -82.382 bonds (distance) P-C4' energy: -63.246 flat angles C4'-P-C4' energy: -65.982 flat angles P-C4'-P energy: -44.376 tors. eta vs tors. theta energy: -2.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 144 Temperature: 0.900000 Total energy: -1333.365521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.365521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1366.115521 (E_RNA) where: Base-Base interactions energy: -914.167 where: short stacking energy: -406.747 Base-Backbone interact. energy: -1.422 local terms energy: -450.526624 where: bonds (distance) C4'-P energy: -79.718 bonds (distance) P-C4' energy: -86.686 flat angles C4'-P-C4' energy: -91.794 flat angles P-C4'-P energy: -74.059 tors. eta vs tors. theta energy: -118.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 144 Temperature: 0.950000 Total energy: -1300.287865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.287865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.037865 (E_RNA) where: Base-Base interactions energy: -922.355 where: short stacking energy: -387.654 Base-Backbone interact. energy: -3.405 local terms energy: -407.277560 where: bonds (distance) C4'-P energy: -80.148 bonds (distance) P-C4' energy: -77.261 flat angles C4'-P-C4' energy: -87.536 flat angles P-C4'-P energy: -56.807 tors. eta vs tors. theta energy: -105.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 144 Temperature: 1.000000 Total energy: -1165.810401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.810401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.560401 (E_RNA) where: Base-Base interactions energy: -795.993 where: short stacking energy: -337.757 Base-Backbone interact. energy: 0.651 local terms energy: -403.889482 where: bonds (distance) C4'-P energy: -74.600 bonds (distance) P-C4' energy: -88.541 flat angles C4'-P-C4' energy: -87.306 flat angles P-C4'-P energy: -65.739 tors. eta vs tors. theta energy: -87.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.671 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 144 Temperature: 1.050000 Total energy: -1114.373180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1114.373180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.123180 (E_RNA) where: Base-Base interactions energy: -754.580 where: short stacking energy: -339.289 Base-Backbone interact. energy: -0.763 local terms energy: -391.780220 where: bonds (distance) C4'-P energy: -73.161 bonds (distance) P-C4' energy: -75.403 flat angles C4'-P-C4' energy: -80.581 flat angles P-C4'-P energy: -61.087 tors. eta vs tors. theta energy: -101.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 144 Temperature: 1.100000 Total energy: -1060.274728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.274728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.024728 (E_RNA) where: Base-Base interactions energy: -704.330 where: short stacking energy: -305.883 Base-Backbone interact. energy: -1.000 local terms energy: -387.694227 where: bonds (distance) C4'-P energy: -78.464 bonds (distance) P-C4' energy: -76.087 flat angles C4'-P-C4' energy: -90.296 flat angles P-C4'-P energy: -62.378 tors. eta vs tors. theta energy: -80.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 144 Temperature: 1.150000 Total energy: -996.737658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.737658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.487658 (E_RNA) where: Base-Base interactions energy: -702.687 where: short stacking energy: -307.448 Base-Backbone interact. energy: -3.660 local terms energy: -323.140354 where: bonds (distance) C4'-P energy: -57.687 bonds (distance) P-C4' energy: -71.861 flat angles C4'-P-C4' energy: -81.446 flat angles P-C4'-P energy: -39.404 tors. eta vs tors. theta energy: -72.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 144 Temperature: 1.200000 Total energy: -902.160723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.160723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.910723 (E_RNA) where: Base-Base interactions energy: -626.840 where: short stacking energy: -260.632 Base-Backbone interact. energy: 1.470 local terms energy: -310.085715 where: bonds (distance) C4'-P energy: -73.535 bonds (distance) P-C4' energy: -74.242 flat angles C4'-P-C4' energy: -69.460 flat angles P-C4'-P energy: -40.056 tors. eta vs tors. theta energy: -52.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.544 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 144 Temperature: 1.250000 Total energy: -669.351220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.351220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.101220 (E_RNA) where: Base-Base interactions energy: -434.934 where: short stacking energy: -192.994 Base-Backbone interact. energy: -0.828 local terms energy: -266.340022 where: bonds (distance) C4'-P energy: -69.058 bonds (distance) P-C4' energy: -69.100 flat angles C4'-P-C4' energy: -59.960 flat angles P-C4'-P energy: -43.932 tors. eta vs tors. theta energy: -24.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 144 Temperature: 1.300000 Total energy: -519.444852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.444852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.194852 (E_RNA) where: Base-Base interactions energy: -280.873 where: short stacking energy: -152.718 Base-Backbone interact. energy: -1.134 local terms energy: -270.187658 where: bonds (distance) C4'-P energy: -61.359 bonds (distance) P-C4' energy: -78.336 flat angles C4'-P-C4' energy: -63.971 flat angles P-C4'-P energy: -43.354 tors. eta vs tors. theta energy: -23.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 144 Temperature: 1.350000 Total energy: -334.933125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.933125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -367.683125 (E_RNA) where: Base-Base interactions energy: -163.552 where: short stacking energy: -106.129 Base-Backbone interact. energy: 5.559 local terms energy: -209.690799 where: bonds (distance) C4'-P energy: -65.063 bonds (distance) P-C4' energy: -62.163 flat angles C4'-P-C4' energy: -73.087 flat angles P-C4'-P energy: -31.149 tors. eta vs tors. theta energy: 21.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 145 Temperature: 0.900000 Total energy: -1320.478904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1320.478904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.228904 (E_RNA) where: Base-Base interactions energy: -942.061 where: short stacking energy: -421.240 Base-Backbone interact. energy: -1.503 local terms energy: -410.004587 where: bonds (distance) C4'-P energy: -63.589 bonds (distance) P-C4' energy: -77.715 flat angles C4'-P-C4' energy: -87.695 flat angles P-C4'-P energy: -61.127 tors. eta vs tors. theta energy: -119.879 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.340 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 145 Temperature: 0.950000 Total energy: -1288.548829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.548829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.298829 (E_RNA) where: Base-Base interactions energy: -905.293 where: short stacking energy: -381.379 Base-Backbone interact. energy: -2.990 local terms energy: -413.015810 where: bonds (distance) C4'-P energy: -85.231 bonds (distance) P-C4' energy: -85.284 flat angles C4'-P-C4' energy: -82.683 flat angles P-C4'-P energy: -58.706 tors. eta vs tors. theta energy: -101.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 145 Temperature: 1.000000 Total energy: -1167.220387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.220387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.970387 (E_RNA) where: Base-Base interactions energy: -805.059 where: short stacking energy: -336.495 Base-Backbone interact. energy: -1.816 local terms energy: -393.096001 where: bonds (distance) C4'-P energy: -78.306 bonds (distance) P-C4' energy: -80.910 flat angles C4'-P-C4' energy: -86.696 flat angles P-C4'-P energy: -50.382 tors. eta vs tors. theta energy: -96.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 145 Temperature: 1.050000 Total energy: -1134.941537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.941537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.691537 (E_RNA) where: Base-Base interactions energy: -780.544 where: short stacking energy: -335.284 Base-Backbone interact. energy: -1.243 local terms energy: -385.904531 where: bonds (distance) C4'-P energy: -79.798 bonds (distance) P-C4' energy: -66.726 flat angles C4'-P-C4' energy: -81.423 flat angles P-C4'-P energy: -63.111 tors. eta vs tors. theta energy: -94.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 145 Temperature: 1.100000 Total energy: -1101.532861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.532861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.282861 (E_RNA) where: Base-Base interactions energy: -756.026 where: short stacking energy: -348.730 Base-Backbone interact. energy: -0.419 local terms energy: -377.837678 where: bonds (distance) C4'-P energy: -59.822 bonds (distance) P-C4' energy: -88.275 flat angles C4'-P-C4' energy: -82.101 flat angles P-C4'-P energy: -45.430 tors. eta vs tors. theta energy: -102.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 145 Temperature: 1.150000 Total energy: -920.600901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.600901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.350901 (E_RNA) where: Base-Base interactions energy: -640.389 where: short stacking energy: -274.110 Base-Backbone interact. energy: -2.570 local terms energy: -310.391282 where: bonds (distance) C4'-P energy: -63.068 bonds (distance) P-C4' energy: -61.979 flat angles C4'-P-C4' energy: -77.189 flat angles P-C4'-P energy: -48.050 tors. eta vs tors. theta energy: -60.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 145 Temperature: 1.200000 Total energy: -949.233085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.233085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -981.983085 (E_RNA) where: Base-Base interactions energy: -679.470 where: short stacking energy: -277.990 Base-Backbone interact. energy: -0.648 local terms energy: -301.864680 where: bonds (distance) C4'-P energy: -67.215 bonds (distance) P-C4' energy: -67.029 flat angles C4'-P-C4' energy: -76.033 flat angles P-C4'-P energy: -34.260 tors. eta vs tors. theta energy: -57.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 145 Temperature: 1.250000 Total energy: -644.307147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.307147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.057147 (E_RNA) where: Base-Base interactions energy: -411.164 where: short stacking energy: -196.897 Base-Backbone interact. energy: -0.715 local terms energy: -265.177753 where: bonds (distance) C4'-P energy: -71.693 bonds (distance) P-C4' energy: -62.542 flat angles C4'-P-C4' energy: -71.141 flat angles P-C4'-P energy: -34.684 tors. eta vs tors. theta energy: -25.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 145 Temperature: 1.300000 Total energy: -517.854858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.854858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.604858 (E_RNA) where: Base-Base interactions energy: -281.673 where: short stacking energy: -171.769 Base-Backbone interact. energy: 0.455 local terms energy: -269.386408 where: bonds (distance) C4'-P energy: -69.839 bonds (distance) P-C4' energy: -82.029 flat angles C4'-P-C4' energy: -55.253 flat angles P-C4'-P energy: -49.531 tors. eta vs tors. theta energy: -12.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 145 Temperature: 1.350000 Total energy: -288.308714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.308714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.058714 (E_RNA) where: Base-Base interactions energy: -116.294 where: short stacking energy: -89.597 Base-Backbone interact. energy: 0.060 local terms energy: -204.825237 where: bonds (distance) C4'-P energy: -50.791 bonds (distance) P-C4' energy: -70.898 flat angles C4'-P-C4' energy: -69.864 flat angles P-C4'-P energy: -32.237 tors. eta vs tors. theta energy: 18.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 32.750 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)