SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta301-601-61bb83c1/inputs/seq.fa: 1 curr_seq: _GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GGGUGGGCGGCGCGCCGCGGCGAACUCCUCUACCUUCGGGGCCGGCGACUGCGGUAGUACAGCGGGCUUCUCCUCGACCUGCCCAUGCUCGGCCUCGGAGAGCCCUUCGCCGGCCGACAGGACGGCGACGACCUCAACCAGCCCCUUAGACCAUUAUUGUGGUCAUGCCUGCCCAGUGAUGGGAGCUGCGGCGGCGGUCGUCUCCUCCUCCUCCUGCUGAACAUGGCCGUCAGCGACCUCUAAUAGAGAGCCAUGGAAGCCCUCGUCCGGUGGCCGCGGUUCCUGUGUUUCGGUUACCCG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -1206.805203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.805203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.805203 (E_RNA) where: Base-Base interactions energy: -39.356 where: short stacking energy: -39.356 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1450.939536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.939536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.939536 (E_RNA) where: Base-Base interactions energy: -631.928 where: short stacking energy: -629.368 Base-Backbone interact. energy: 0.090 local terms energy: -819.101663 where: bonds (distance) C4'-P energy: -185.340 bonds (distance) P-C4' energy: -186.094 flat angles C4'-P-C4' energy: -193.577 flat angles P-C4'-P energy: -112.381 tors. eta vs tors. theta energy: -141.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1416.470769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.470769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.470769 (E_RNA) where: Base-Base interactions energy: -607.233 where: short stacking energy: -600.007 Base-Backbone interact. energy: -0.573 local terms energy: -808.665070 where: bonds (distance) C4'-P energy: -192.368 bonds (distance) P-C4' energy: -178.396 flat angles C4'-P-C4' energy: -187.031 flat angles P-C4'-P energy: -95.646 tors. eta vs tors. theta energy: -155.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1317.205919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.205919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.205919 (E_RNA) where: Base-Base interactions energy: -569.945 where: short stacking energy: -554.135 Base-Backbone interact. energy: -0.371 local terms energy: -746.890267 where: bonds (distance) C4'-P energy: -183.112 bonds (distance) P-C4' energy: -168.586 flat angles C4'-P-C4' energy: -166.752 flat angles P-C4'-P energy: -105.051 tors. eta vs tors. theta energy: -123.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1249.931397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.931397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.931397 (E_RNA) where: Base-Base interactions energy: -517.398 where: short stacking energy: -515.975 Base-Backbone interact. energy: -0.502 local terms energy: -732.031516 where: bonds (distance) C4'-P energy: -179.431 bonds (distance) P-C4' energy: -189.151 flat angles C4'-P-C4' energy: -164.314 flat angles P-C4'-P energy: -83.420 tors. eta vs tors. theta energy: -115.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1220.179135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.179135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.179135 (E_RNA) where: Base-Base interactions energy: -75.915 where: short stacking energy: -75.915 Base-Backbone interact. energy: -0.000 local terms energy: -1144.263447 where: bonds (distance) C4'-P energy: -277.138 bonds (distance) P-C4' energy: -256.084 flat angles C4'-P-C4' energy: -221.942 flat angles P-C4'-P energy: -249.405 tors. eta vs tors. theta energy: -139.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1220.811542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.811542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.811542 (E_RNA) where: Base-Base interactions energy: -78.019 where: short stacking energy: -78.019 Base-Backbone interact. energy: -0.000 local terms energy: -1142.791995 where: bonds (distance) C4'-P energy: -277.063 bonds (distance) P-C4' energy: -255.983 flat angles C4'-P-C4' energy: -220.855 flat angles P-C4'-P energy: -248.256 tors. eta vs tors. theta energy: -140.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -1221.533647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.533647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.533647 (E_RNA) where: Base-Base interactions energy: -79.701 where: short stacking energy: -79.701 Base-Backbone interact. energy: -0.000 local terms energy: -1141.832374 where: bonds (distance) C4'-P energy: -277.287 bonds (distance) P-C4' energy: -255.983 flat angles C4'-P-C4' energy: -220.169 flat angles P-C4'-P energy: -248.758 tors. eta vs tors. theta energy: -139.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -1234.293225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.293225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.293225 (E_RNA) where: Base-Base interactions energy: -157.596 where: short stacking energy: -157.596 Base-Backbone interact. energy: -0.000 local terms energy: -1076.696676 where: bonds (distance) C4'-P energy: -241.765 bonds (distance) P-C4' energy: -224.483 flat angles C4'-P-C4' energy: -222.351 flat angles P-C4'-P energy: -238.742 tors. eta vs tors. theta energy: -149.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -1222.717677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.717677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.717677 (E_RNA) where: Base-Base interactions energy: -77.500 where: short stacking energy: -77.500 Base-Backbone interact. energy: -0.000 local terms energy: -1145.217760 where: bonds (distance) C4'-P energy: -277.171 bonds (distance) P-C4' energy: -260.707 flat angles C4'-P-C4' energy: -219.509 flat angles P-C4'-P energy: -248.620 tors. eta vs tors. theta energy: -139.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -1229.889881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.889881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.889881 (E_RNA) where: Base-Base interactions energy: -85.018 where: short stacking energy: -85.018 Base-Backbone interact. energy: -0.000 local terms energy: -1144.871585 where: bonds (distance) C4'-P energy: -276.869 bonds (distance) P-C4' energy: -260.939 flat angles C4'-P-C4' energy: -219.285 flat angles P-C4'-P energy: -248.444 tors. eta vs tors. theta energy: -139.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1484.106406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.106406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.106406 (E_RNA) where: Base-Base interactions energy: -654.540 where: short stacking energy: -649.914 Base-Backbone interact. energy: -0.313 local terms energy: -829.253406 where: bonds (distance) C4'-P energy: -174.422 bonds (distance) P-C4' energy: -179.791 flat angles C4'-P-C4' energy: -186.078 flat angles P-C4'-P energy: -126.135 tors. eta vs tors. theta energy: -162.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1463.572048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.572048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.572048 (E_RNA) where: Base-Base interactions energy: -626.088 where: short stacking energy: -620.616 Base-Backbone interact. energy: 1.415 local terms energy: -838.898758 where: bonds (distance) C4'-P energy: -190.428 bonds (distance) P-C4' energy: -188.571 flat angles C4'-P-C4' energy: -179.601 flat angles P-C4'-P energy: -119.232 tors. eta vs tors. theta energy: -161.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1369.729549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1369.729549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1369.729549 (E_RNA) where: Base-Base interactions energy: -616.347 where: short stacking energy: -595.945 Base-Backbone interact. energy: -1.994 local terms energy: -751.388365 where: bonds (distance) C4'-P energy: -169.383 bonds (distance) P-C4' energy: -179.004 flat angles C4'-P-C4' energy: -176.674 flat angles P-C4'-P energy: -93.533 tors. eta vs tors. theta energy: -132.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1242.689974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.689974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.689974 (E_RNA) where: Base-Base interactions energy: -496.874 where: short stacking energy: -496.504 Base-Backbone interact. energy: -0.772 local terms energy: -745.044117 where: bonds (distance) C4'-P energy: -176.247 bonds (distance) P-C4' energy: -182.741 flat angles C4'-P-C4' energy: -170.120 flat angles P-C4'-P energy: -112.213 tors. eta vs tors. theta energy: -103.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1131.882640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.882640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.882640 (E_RNA) where: Base-Base interactions energy: -450.752 where: short stacking energy: -446.416 Base-Backbone interact. energy: -0.229 local terms energy: -680.901736 where: bonds (distance) C4'-P energy: -136.407 bonds (distance) P-C4' energy: -190.670 flat angles C4'-P-C4' energy: -175.729 flat angles P-C4'-P energy: -96.827 tors. eta vs tors. theta energy: -81.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1044.258407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1044.258407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1044.258407 (E_RNA) where: Base-Base interactions energy: -424.613 where: short stacking energy: -404.301 Base-Backbone interact. energy: 0.295 local terms energy: -619.940032 where: bonds (distance) C4'-P energy: -173.177 bonds (distance) P-C4' energy: -161.437 flat angles C4'-P-C4' energy: -153.338 flat angles P-C4'-P energy: -67.546 tors. eta vs tors. theta energy: -64.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -955.320511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -955.320511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -955.320511 (E_RNA) where: Base-Base interactions energy: -365.083 where: short stacking energy: -350.267 Base-Backbone interact. energy: 2.433 local terms energy: -592.669826 where: bonds (distance) C4'-P energy: -152.384 bonds (distance) P-C4' energy: -163.284 flat angles C4'-P-C4' energy: -148.154 flat angles P-C4'-P energy: -73.516 tors. eta vs tors. theta energy: -55.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -879.627434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.627434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.627434 (E_RNA) where: Base-Base interactions energy: -329.915 where: short stacking energy: -321.676 Base-Backbone interact. energy: 3.403 local terms energy: -553.115434 where: bonds (distance) C4'-P energy: -161.877 bonds (distance) P-C4' energy: -158.650 flat angles C4'-P-C4' energy: -142.131 flat angles P-C4'-P energy: -71.605 tors. eta vs tors. theta energy: -18.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -863.569174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.569174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.569174 (E_RNA) where: Base-Base interactions energy: -339.222 where: short stacking energy: -285.522 Base-Backbone interact. energy: -0.154 local terms energy: -524.193974 where: bonds (distance) C4'-P energy: -154.877 bonds (distance) P-C4' energy: -135.633 flat angles C4'-P-C4' energy: -160.667 flat angles P-C4'-P energy: -59.782 tors. eta vs tors. theta energy: -13.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -745.572216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -745.572216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -745.572216 (E_RNA) where: Base-Base interactions energy: -258.716 where: short stacking energy: -250.141 Base-Backbone interact. energy: 1.159 local terms energy: -488.015332 where: bonds (distance) C4'-P energy: -143.909 bonds (distance) P-C4' energy: -151.667 flat angles C4'-P-C4' energy: -126.442 flat angles P-C4'-P energy: -71.451 tors. eta vs tors. theta energy: 5.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1581.612551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1581.612551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1581.612551 (E_RNA) where: Base-Base interactions energy: -700.097 where: short stacking energy: -697.406 Base-Backbone interact. energy: 0.669 local terms energy: -882.184443 where: bonds (distance) C4'-P energy: -168.471 bonds (distance) P-C4' energy: -189.333 flat angles C4'-P-C4' energy: -207.337 flat angles P-C4'-P energy: -134.305 tors. eta vs tors. theta energy: -182.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1440.105732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.105732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.105732 (E_RNA) where: Base-Base interactions energy: -616.688 where: short stacking energy: -616.573 Base-Backbone interact. energy: -1.150 local terms energy: -822.268472 where: bonds (distance) C4'-P energy: -177.709 bonds (distance) P-C4' energy: -194.973 flat angles C4'-P-C4' energy: -184.977 flat angles P-C4'-P energy: -121.336 tors. eta vs tors. theta energy: -143.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1393.954409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.954409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.954409 (E_RNA) where: Base-Base interactions energy: -611.051 where: short stacking energy: -580.235 Base-Backbone interact. energy: -0.993 local terms energy: -781.910583 where: bonds (distance) C4'-P energy: -179.356 bonds (distance) P-C4' energy: -177.289 flat angles C4'-P-C4' energy: -189.675 flat angles P-C4'-P energy: -105.677 tors. eta vs tors. theta energy: -129.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1253.498886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.498886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.498886 (E_RNA) where: Base-Base interactions energy: -532.408 where: short stacking energy: -529.673 Base-Backbone interact. energy: -0.702 local terms energy: -720.388599 where: bonds (distance) C4'-P energy: -167.768 bonds (distance) P-C4' energy: -173.246 flat angles C4'-P-C4' energy: -156.224 flat angles P-C4'-P energy: -118.630 tors. eta vs tors. theta energy: -104.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1169.229191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.229191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.229191 (E_RNA) where: Base-Base interactions energy: -505.588 where: short stacking energy: -438.841 Base-Backbone interact. energy: 0.106 local terms energy: -663.746582 where: bonds (distance) C4'-P energy: -183.868 bonds (distance) P-C4' energy: -155.214 flat angles C4'-P-C4' energy: -157.059 flat angles P-C4'-P energy: -99.080 tors. eta vs tors. theta energy: -68.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1037.055545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.055545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.055545 (E_RNA) where: Base-Base interactions energy: -416.447 where: short stacking energy: -402.572 Base-Backbone interact. energy: 0.475 local terms energy: -621.083969 where: bonds (distance) C4'-P energy: -172.172 bonds (distance) P-C4' energy: -164.332 flat angles C4'-P-C4' energy: -145.465 flat angles P-C4'-P energy: -79.327 tors. eta vs tors. theta energy: -59.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -956.355299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -956.355299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -956.355299 (E_RNA) where: Base-Base interactions energy: -383.738 where: short stacking energy: -333.291 Base-Backbone interact. energy: -0.422 local terms energy: -572.195940 where: bonds (distance) C4'-P energy: -150.146 bonds (distance) P-C4' energy: -147.633 flat angles C4'-P-C4' energy: -137.754 flat angles P-C4'-P energy: -91.358 tors. eta vs tors. theta energy: -45.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -913.260071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.260071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.260071 (E_RNA) where: Base-Base interactions energy: -320.484 where: short stacking energy: -303.679 Base-Backbone interact. energy: -2.520 local terms energy: -590.255492 where: bonds (distance) C4'-P energy: -176.298 bonds (distance) P-C4' energy: -145.216 flat angles C4'-P-C4' energy: -139.679 flat angles P-C4'-P energy: -98.893 tors. eta vs tors. theta energy: -30.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -865.514538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.514538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.514538 (E_RNA) where: Base-Base interactions energy: -378.468 where: short stacking energy: -286.635 Base-Backbone interact. energy: 1.421 local terms energy: -488.467314 where: bonds (distance) C4'-P energy: -129.946 bonds (distance) P-C4' energy: -157.757 flat angles C4'-P-C4' energy: -117.529 flat angles P-C4'-P energy: -79.746 tors. eta vs tors. theta energy: -3.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -702.596637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -702.596637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -702.596637 (E_RNA) where: Base-Base interactions energy: -234.402 where: short stacking energy: -217.511 Base-Backbone interact. energy: 8.935 local terms energy: -477.129349 where: bonds (distance) C4'-P energy: -150.510 bonds (distance) P-C4' energy: -141.059 flat angles C4'-P-C4' energy: -137.037 flat angles P-C4'-P energy: -70.219 tors. eta vs tors. theta energy: 21.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1605.270226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.270226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.270226 (E_RNA) where: Base-Base interactions energy: -742.955 where: short stacking energy: -731.579 Base-Backbone interact. energy: 0.086 local terms energy: -862.400275 where: bonds (distance) C4'-P energy: -182.023 bonds (distance) P-C4' energy: -186.789 flat angles C4'-P-C4' energy: -186.432 flat angles P-C4'-P energy: -119.671 tors. eta vs tors. theta energy: -187.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1515.728211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.728211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.728211 (E_RNA) where: Base-Base interactions energy: -692.281 where: short stacking energy: -667.716 Base-Backbone interact. energy: -0.070 local terms energy: -823.377356 where: bonds (distance) C4'-P energy: -174.153 bonds (distance) P-C4' energy: -192.153 flat angles C4'-P-C4' energy: -184.488 flat angles P-C4'-P energy: -111.590 tors. eta vs tors. theta energy: -160.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1359.697656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.697656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.697656 (E_RNA) where: Base-Base interactions energy: -591.872 where: short stacking energy: -569.798 Base-Backbone interact. energy: -1.443 local terms energy: -766.382384 where: bonds (distance) C4'-P energy: -159.883 bonds (distance) P-C4' energy: -169.645 flat angles C4'-P-C4' energy: -179.976 flat angles P-C4'-P energy: -124.973 tors. eta vs tors. theta energy: -131.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1449.716739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.716739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.716739 (E_RNA) where: Base-Base interactions energy: -685.641 where: short stacking energy: -526.447 Base-Backbone interact. energy: 3.736 local terms energy: -767.812126 where: bonds (distance) C4'-P energy: -169.829 bonds (distance) P-C4' energy: -180.533 flat angles C4'-P-C4' energy: -196.972 flat angles P-C4'-P energy: -102.456 tors. eta vs tors. theta energy: -118.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1149.611635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.611635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.611635 (E_RNA) where: Base-Base interactions energy: -457.919 where: short stacking energy: -446.445 Base-Backbone interact. energy: -0.411 local terms energy: -691.281052 where: bonds (distance) C4'-P energy: -148.399 bonds (distance) P-C4' energy: -179.481 flat angles C4'-P-C4' energy: -171.733 flat angles P-C4'-P energy: -100.286 tors. eta vs tors. theta energy: -91.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1085.378916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.378916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.378916 (E_RNA) where: Base-Base interactions energy: -466.558 where: short stacking energy: -377.285 Base-Backbone interact. energy: 6.824 local terms energy: -625.645447 where: bonds (distance) C4'-P energy: -158.894 bonds (distance) P-C4' energy: -176.196 flat angles C4'-P-C4' energy: -151.873 flat angles P-C4'-P energy: -94.746 tors. eta vs tors. theta energy: -43.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -958.259027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.259027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.259027 (E_RNA) where: Base-Base interactions energy: -377.164 where: short stacking energy: -348.752 Base-Backbone interact. energy: 6.124 local terms energy: -587.219662 where: bonds (distance) C4'-P energy: -141.838 bonds (distance) P-C4' energy: -166.749 flat angles C4'-P-C4' energy: -159.887 flat angles P-C4'-P energy: -94.129 tors. eta vs tors. theta energy: -24.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -959.430347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.430347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.430347 (E_RNA) where: Base-Base interactions energy: -396.146 where: short stacking energy: -331.993 Base-Backbone interact. energy: -0.538 local terms energy: -562.746684 where: bonds (distance) C4'-P energy: -153.674 bonds (distance) P-C4' energy: -171.263 flat angles C4'-P-C4' energy: -142.500 flat angles P-C4'-P energy: -76.925 tors. eta vs tors. theta energy: -18.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -816.121424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -816.121424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -816.121424 (E_RNA) where: Base-Base interactions energy: -328.109 where: short stacking energy: -303.779 Base-Backbone interact. energy: 1.083 local terms energy: -489.095469 where: bonds (distance) C4'-P energy: -129.574 bonds (distance) P-C4' energy: -150.102 flat angles C4'-P-C4' energy: -129.414 flat angles P-C4'-P energy: -73.927 tors. eta vs tors. theta energy: -6.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -690.516435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.516435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.516435 (E_RNA) where: Base-Base interactions energy: -211.420 where: short stacking energy: -192.087 Base-Backbone interact. energy: -0.846 local terms energy: -478.249569 where: bonds (distance) C4'-P energy: -168.245 bonds (distance) P-C4' energy: -163.649 flat angles C4'-P-C4' energy: -99.366 flat angles P-C4'-P energy: -83.729 tors. eta vs tors. theta energy: 36.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1729.591782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1729.591782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1729.591782 (E_RNA) where: Base-Base interactions energy: -814.226 where: short stacking energy: -770.329 Base-Backbone interact. energy: -1.104 local terms energy: -914.261817 where: bonds (distance) C4'-P energy: -189.715 bonds (distance) P-C4' energy: -192.937 flat angles C4'-P-C4' energy: -199.996 flat angles P-C4'-P energy: -136.136 tors. eta vs tors. theta energy: -195.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1527.202915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.202915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.202915 (E_RNA) where: Base-Base interactions energy: -711.213 where: short stacking energy: -679.684 Base-Backbone interact. energy: 1.913 local terms energy: -817.902115 where: bonds (distance) C4'-P energy: -175.057 bonds (distance) P-C4' energy: -185.359 flat angles C4'-P-C4' energy: -174.489 flat angles P-C4'-P energy: -124.180 tors. eta vs tors. theta energy: -158.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1643.164220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.164220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.164220 (E_RNA) where: Base-Base interactions energy: -856.934 where: short stacking energy: -581.134 Base-Backbone interact. energy: 0.024 local terms energy: -786.254173 where: bonds (distance) C4'-P energy: -173.983 bonds (distance) P-C4' energy: -177.824 flat angles C4'-P-C4' energy: -179.427 flat angles P-C4'-P energy: -120.990 tors. eta vs tors. theta energy: -134.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1328.358005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.358005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.358005 (E_RNA) where: Base-Base interactions energy: -616.901 where: short stacking energy: -519.788 Base-Backbone interact. energy: 4.726 local terms energy: -716.182707 where: bonds (distance) C4'-P energy: -164.837 bonds (distance) P-C4' energy: -174.019 flat angles C4'-P-C4' energy: -177.894 flat angles P-C4'-P energy: -92.858 tors. eta vs tors. theta energy: -106.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1158.345347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.345347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.345347 (E_RNA) where: Base-Base interactions energy: -470.340 where: short stacking energy: -422.235 Base-Backbone interact. energy: 0.123 local terms energy: -688.128432 where: bonds (distance) C4'-P energy: -164.600 bonds (distance) P-C4' energy: -176.780 flat angles C4'-P-C4' energy: -171.513 flat angles P-C4'-P energy: -117.500 tors. eta vs tors. theta energy: -57.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1145.177772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.177772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.177772 (E_RNA) where: Base-Base interactions energy: -534.144 where: short stacking energy: -407.099 Base-Backbone interact. energy: 2.199 local terms energy: -613.232729 where: bonds (distance) C4'-P energy: -148.311 bonds (distance) P-C4' energy: -171.760 flat angles C4'-P-C4' energy: -143.664 flat angles P-C4'-P energy: -93.532 tors. eta vs tors. theta energy: -55.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1003.700884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1003.700884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1003.700884 (E_RNA) where: Base-Base interactions energy: -438.974 where: short stacking energy: -338.083 Base-Backbone interact. energy: 1.827 local terms energy: -566.553931 where: bonds (distance) C4'-P energy: -164.238 bonds (distance) P-C4' energy: -162.842 flat angles C4'-P-C4' energy: -133.564 flat angles P-C4'-P energy: -70.492 tors. eta vs tors. theta energy: -35.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -877.805827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.805827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.805827 (E_RNA) where: Base-Base interactions energy: -364.130 where: short stacking energy: -339.428 Base-Backbone interact. energy: -0.163 local terms energy: -513.512096 where: bonds (distance) C4'-P energy: -149.449 bonds (distance) P-C4' energy: -164.538 flat angles C4'-P-C4' energy: -138.576 flat angles P-C4'-P energy: -58.486 tors. eta vs tors. theta energy: -2.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -820.075704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.075704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.075704 (E_RNA) where: Base-Base interactions energy: -313.627 where: short stacking energy: -271.258 Base-Backbone interact. energy: 4.562 local terms energy: -511.011111 where: bonds (distance) C4'-P energy: -150.681 bonds (distance) P-C4' energy: -160.920 flat angles C4'-P-C4' energy: -104.520 flat angles P-C4'-P energy: -73.351 tors. eta vs tors. theta energy: -21.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -731.531696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.531696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.531696 (E_RNA) where: Base-Base interactions energy: -268.242 where: short stacking energy: -223.636 Base-Backbone interact. energy: 0.244 local terms energy: -463.533763 where: bonds (distance) C4'-P energy: -135.964 bonds (distance) P-C4' energy: -163.662 flat angles C4'-P-C4' energy: -123.640 flat angles P-C4'-P energy: -62.925 tors. eta vs tors. theta energy: 22.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1724.749217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1724.749217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.749217 (E_RNA) where: Base-Base interactions energy: -840.073 where: short stacking energy: -772.320 Base-Backbone interact. energy: -1.162 local terms energy: -883.514873 where: bonds (distance) C4'-P energy: -163.096 bonds (distance) P-C4' energy: -193.206 flat angles C4'-P-C4' energy: -192.994 flat angles P-C4'-P energy: -129.740 tors. eta vs tors. theta energy: -204.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1930.721818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1930.721818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1930.721818 (E_RNA) where: Base-Base interactions energy: -1117.472 where: short stacking energy: -684.928 Base-Backbone interact. energy: -2.551 local terms energy: -810.699125 where: bonds (distance) C4'-P energy: -170.659 bonds (distance) P-C4' energy: -183.758 flat angles C4'-P-C4' energy: -200.762 flat angles P-C4'-P energy: -101.434 tors. eta vs tors. theta energy: -154.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1418.777221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.777221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.777221 (E_RNA) where: Base-Base interactions energy: -635.546 where: short stacking energy: -574.286 Base-Backbone interact. energy: -2.156 local terms energy: -781.075175 where: bonds (distance) C4'-P energy: -178.080 bonds (distance) P-C4' energy: -199.447 flat angles C4'-P-C4' energy: -167.223 flat angles P-C4'-P energy: -107.396 tors. eta vs tors. theta energy: -128.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1406.739776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.739776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.739776 (E_RNA) where: Base-Base interactions energy: -681.568 where: short stacking energy: -556.124 Base-Backbone interact. energy: -2.932 local terms energy: -722.240196 where: bonds (distance) C4'-P energy: -168.454 bonds (distance) P-C4' energy: -165.333 flat angles C4'-P-C4' energy: -176.306 flat angles P-C4'-P energy: -95.405 tors. eta vs tors. theta energy: -116.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1171.088183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1171.088183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1171.088183 (E_RNA) where: Base-Base interactions energy: -492.382 where: short stacking energy: -435.549 Base-Backbone interact. energy: -0.575 local terms energy: -678.131506 where: bonds (distance) C4'-P energy: -159.171 bonds (distance) P-C4' energy: -178.023 flat angles C4'-P-C4' energy: -162.825 flat angles P-C4'-P energy: -111.080 tors. eta vs tors. theta energy: -67.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1122.698048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.698048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.698048 (E_RNA) where: Base-Base interactions energy: -495.686 where: short stacking energy: -357.218 Base-Backbone interact. energy: -1.583 local terms energy: -625.429518 where: bonds (distance) C4'-P energy: -155.255 bonds (distance) P-C4' energy: -171.331 flat angles C4'-P-C4' energy: -163.950 flat angles P-C4'-P energy: -102.473 tors. eta vs tors. theta energy: -32.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1060.910722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.910722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.910722 (E_RNA) where: Base-Base interactions energy: -480.067 where: short stacking energy: -348.544 Base-Backbone interact. energy: 1.360 local terms energy: -582.203957 where: bonds (distance) C4'-P energy: -159.086 bonds (distance) P-C4' energy: -167.437 flat angles C4'-P-C4' energy: -143.322 flat angles P-C4'-P energy: -89.798 tors. eta vs tors. theta energy: -22.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -907.451950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.451950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.451950 (E_RNA) where: Base-Base interactions energy: -407.679 where: short stacking energy: -310.306 Base-Backbone interact. energy: -2.012 local terms energy: -497.760540 where: bonds (distance) C4'-P energy: -159.505 bonds (distance) P-C4' energy: -139.053 flat angles C4'-P-C4' energy: -141.250 flat angles P-C4'-P energy: -74.960 tors. eta vs tors. theta energy: 17.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -795.175659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.175659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.175659 (E_RNA) where: Base-Base interactions energy: -313.167 where: short stacking energy: -220.980 Base-Backbone interact. energy: -1.035 local terms energy: -480.973805 where: bonds (distance) C4'-P energy: -147.844 bonds (distance) P-C4' energy: -161.780 flat angles C4'-P-C4' energy: -130.621 flat angles P-C4'-P energy: -74.486 tors. eta vs tors. theta energy: 33.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -730.002214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.002214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.002214 (E_RNA) where: Base-Base interactions energy: -248.710 where: short stacking energy: -190.743 Base-Backbone interact. energy: 0.376 local terms energy: -481.667956 where: bonds (distance) C4'-P energy: -156.377 bonds (distance) P-C4' energy: -172.245 flat angles C4'-P-C4' energy: -116.332 flat angles P-C4'-P energy: -64.848 tors. eta vs tors. theta energy: 28.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -2053.444355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2053.444355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2053.444355 (E_RNA) where: Base-Base interactions energy: -1221.328 where: short stacking energy: -745.265 Base-Backbone interact. energy: 1.268 local terms energy: -833.383560 where: bonds (distance) C4'-P energy: -169.404 bonds (distance) P-C4' energy: -180.359 flat angles C4'-P-C4' energy: -202.723 flat angles P-C4'-P energy: -117.876 tors. eta vs tors. theta energy: -163.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1707.090494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.090494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.090494 (E_RNA) where: Base-Base interactions energy: -810.351 where: short stacking energy: -711.104 Base-Backbone interact. energy: -2.582 local terms energy: -894.157359 where: bonds (distance) C4'-P energy: -175.346 bonds (distance) P-C4' energy: -184.814 flat angles C4'-P-C4' energy: -199.268 flat angles P-C4'-P energy: -133.695 tors. eta vs tors. theta energy: -201.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1460.635534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1460.635534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1460.635534 (E_RNA) where: Base-Base interactions energy: -687.723 where: short stacking energy: -587.084 Base-Backbone interact. energy: 2.453 local terms energy: -775.365740 where: bonds (distance) C4'-P energy: -183.363 bonds (distance) P-C4' energy: -178.755 flat angles C4'-P-C4' energy: -173.249 flat angles P-C4'-P energy: -111.333 tors. eta vs tors. theta energy: -128.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1469.299977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.299977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.299977 (E_RNA) where: Base-Base interactions energy: -767.065 where: short stacking energy: -516.438 Base-Backbone interact. energy: 0.557 local terms energy: -702.792382 where: bonds (distance) C4'-P energy: -163.252 bonds (distance) P-C4' energy: -168.567 flat angles C4'-P-C4' energy: -168.426 flat angles P-C4'-P energy: -108.998 tors. eta vs tors. theta energy: -93.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1231.106715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.106715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.106715 (E_RNA) where: Base-Base interactions energy: -595.622 where: short stacking energy: -417.412 Base-Backbone interact. energy: 0.283 local terms energy: -635.767402 where: bonds (distance) C4'-P energy: -151.200 bonds (distance) P-C4' energy: -180.341 flat angles C4'-P-C4' energy: -160.382 flat angles P-C4'-P energy: -80.696 tors. eta vs tors. theta energy: -63.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1255.960604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.960604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.960604 (E_RNA) where: Base-Base interactions energy: -583.639 where: short stacking energy: -403.686 Base-Backbone interact. energy: -1.820 local terms energy: -670.500875 where: bonds (distance) C4'-P energy: -164.694 bonds (distance) P-C4' energy: -198.561 flat angles C4'-P-C4' energy: -171.921 flat angles P-C4'-P energy: -84.095 tors. eta vs tors. theta energy: -51.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1123.750418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1123.750418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1123.750418 (E_RNA) where: Base-Base interactions energy: -535.971 where: short stacking energy: -372.690 Base-Backbone interact. energy: 2.738 local terms energy: -590.517425 where: bonds (distance) C4'-P energy: -157.934 bonds (distance) P-C4' energy: -168.182 flat angles C4'-P-C4' energy: -130.952 flat angles P-C4'-P energy: -89.264 tors. eta vs tors. theta energy: -44.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -933.421547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.421547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.421547 (E_RNA) where: Base-Base interactions energy: -411.938 where: short stacking energy: -312.072 Base-Backbone interact. energy: 6.282 local terms energy: -527.765561 where: bonds (distance) C4'-P energy: -138.608 bonds (distance) P-C4' energy: -164.007 flat angles C4'-P-C4' energy: -153.165 flat angles P-C4'-P energy: -69.072 tors. eta vs tors. theta energy: -2.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -855.174287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.174287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.174287 (E_RNA) where: Base-Base interactions energy: -361.142 where: short stacking energy: -293.207 Base-Backbone interact. energy: 1.448 local terms energy: -495.479971 where: bonds (distance) C4'-P energy: -141.910 bonds (distance) P-C4' energy: -148.165 flat angles C4'-P-C4' energy: -141.931 flat angles P-C4'-P energy: -55.121 tors. eta vs tors. theta energy: -8.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -692.472567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -692.472567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -692.472567 (E_RNA) where: Base-Base interactions energy: -258.122 where: short stacking energy: -204.721 Base-Backbone interact. energy: -1.792 local terms energy: -432.559235 where: bonds (distance) C4'-P energy: -138.714 bonds (distance) P-C4' energy: -162.652 flat angles C4'-P-C4' energy: -91.143 flat angles P-C4'-P energy: -99.122 tors. eta vs tors. theta energy: 59.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -2083.806815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2083.806815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2083.806815 (E_RNA) where: Base-Base interactions energy: -1245.393 where: short stacking energy: -690.172 Base-Backbone interact. energy: -2.575 local terms energy: -835.838767 where: bonds (distance) C4'-P energy: -188.170 bonds (distance) P-C4' energy: -183.227 flat angles C4'-P-C4' energy: -181.376 flat angles P-C4'-P energy: -126.171 tors. eta vs tors. theta energy: -156.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1607.843683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1607.843683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.843683 (E_RNA) where: Base-Base interactions energy: -781.119 where: short stacking energy: -614.015 Base-Backbone interact. energy: 0.161 local terms energy: -826.885253 where: bonds (distance) C4'-P energy: -189.671 bonds (distance) P-C4' energy: -173.902 flat angles C4'-P-C4' energy: -192.526 flat angles P-C4'-P energy: -125.689 tors. eta vs tors. theta energy: -145.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1544.284969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.284969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.284969 (E_RNA) where: Base-Base interactions energy: -773.221 where: short stacking energy: -601.089 Base-Backbone interact. energy: -3.378 local terms energy: -767.685853 where: bonds (distance) C4'-P energy: -166.044 bonds (distance) P-C4' energy: -185.483 flat angles C4'-P-C4' energy: -175.446 flat angles P-C4'-P energy: -113.620 tors. eta vs tors. theta energy: -127.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1517.254641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.254641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.254641 (E_RNA) where: Base-Base interactions energy: -784.639 where: short stacking energy: -546.669 Base-Backbone interact. energy: -0.365 local terms energy: -732.250395 where: bonds (distance) C4'-P energy: -169.548 bonds (distance) P-C4' energy: -171.596 flat angles C4'-P-C4' energy: -186.654 flat angles P-C4'-P energy: -96.010 tors. eta vs tors. theta energy: -108.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1301.251832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.251832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.251832 (E_RNA) where: Base-Base interactions energy: -635.262 where: short stacking energy: -445.031 Base-Backbone interact. energy: 0.038 local terms energy: -666.027767 where: bonds (distance) C4'-P energy: -157.646 bonds (distance) P-C4' energy: -174.443 flat angles C4'-P-C4' energy: -150.714 flat angles P-C4'-P energy: -102.786 tors. eta vs tors. theta energy: -80.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1249.572505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.572505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.572505 (E_RNA) where: Base-Base interactions energy: -597.004 where: short stacking energy: -394.057 Base-Backbone interact. energy: -1.009 local terms energy: -651.558797 where: bonds (distance) C4'-P energy: -166.534 bonds (distance) P-C4' energy: -183.112 flat angles C4'-P-C4' energy: -174.318 flat angles P-C4'-P energy: -83.589 tors. eta vs tors. theta energy: -44.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1101.573985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.573985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.573985 (E_RNA) where: Base-Base interactions energy: -560.758 where: short stacking energy: -381.586 Base-Backbone interact. energy: 1.172 local terms energy: -541.987991 where: bonds (distance) C4'-P energy: -130.990 bonds (distance) P-C4' energy: -181.132 flat angles C4'-P-C4' energy: -140.325 flat angles P-C4'-P energy: -66.932 tors. eta vs tors. theta energy: -22.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1008.219418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.219418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.219418 (E_RNA) where: Base-Base interactions energy: -451.504 where: short stacking energy: -334.372 Base-Backbone interact. energy: -1.548 local terms energy: -555.167478 where: bonds (distance) C4'-P energy: -162.668 bonds (distance) P-C4' energy: -168.071 flat angles C4'-P-C4' energy: -129.313 flat angles P-C4'-P energy: -75.870 tors. eta vs tors. theta energy: -19.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -871.624957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.624957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.624957 (E_RNA) where: Base-Base interactions energy: -374.765 where: short stacking energy: -276.261 Base-Backbone interact. energy: -4.837 local terms energy: -492.022857 where: bonds (distance) C4'-P energy: -130.210 bonds (distance) P-C4' energy: -153.582 flat angles C4'-P-C4' energy: -123.414 flat angles P-C4'-P energy: -80.804 tors. eta vs tors. theta energy: -4.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -728.067951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.067951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.067951 (E_RNA) where: Base-Base interactions energy: -250.569 where: short stacking energy: -218.432 Base-Backbone interact. energy: 0.898 local terms energy: -478.397607 where: bonds (distance) C4'-P energy: -149.866 bonds (distance) P-C4' energy: -179.887 flat angles C4'-P-C4' energy: -104.118 flat angles P-C4'-P energy: -71.035 tors. eta vs tors. theta energy: 26.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -2174.931929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2174.931929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2174.931929 (E_RNA) where: Base-Base interactions energy: -1317.955 where: short stacking energy: -718.851 Base-Backbone interact. energy: 0.106 local terms energy: -857.083184 where: bonds (distance) C4'-P energy: -175.517 bonds (distance) P-C4' energy: -196.111 flat angles C4'-P-C4' energy: -200.228 flat angles P-C4'-P energy: -121.724 tors. eta vs tors. theta energy: -163.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1699.768386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1699.768386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.768386 (E_RNA) where: Base-Base interactions energy: -865.630 where: short stacking energy: -678.149 Base-Backbone interact. energy: -0.857 local terms energy: -833.281414 where: bonds (distance) C4'-P energy: -174.402 bonds (distance) P-C4' energy: -198.069 flat angles C4'-P-C4' energy: -193.640 flat angles P-C4'-P energy: -108.694 tors. eta vs tors. theta energy: -158.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1575.690552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.690552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.690552 (E_RNA) where: Base-Base interactions energy: -832.653 where: short stacking energy: -604.059 Base-Backbone interact. energy: 6.977 local terms energy: -750.014774 where: bonds (distance) C4'-P energy: -166.508 bonds (distance) P-C4' energy: -176.565 flat angles C4'-P-C4' energy: -171.128 flat angles P-C4'-P energy: -108.184 tors. eta vs tors. theta energy: -127.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1418.435170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.435170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.435170 (E_RNA) where: Base-Base interactions energy: -722.396 where: short stacking energy: -482.554 Base-Backbone interact. energy: 0.325 local terms energy: -696.364215 where: bonds (distance) C4'-P energy: -165.419 bonds (distance) P-C4' energy: -179.061 flat angles C4'-P-C4' energy: -166.349 flat angles P-C4'-P energy: -97.905 tors. eta vs tors. theta energy: -87.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1381.106050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.106050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.106050 (E_RNA) where: Base-Base interactions energy: -711.650 where: short stacking energy: -493.900 Base-Backbone interact. energy: 2.135 local terms energy: -671.590483 where: bonds (distance) C4'-P energy: -159.920 bonds (distance) P-C4' energy: -164.609 flat angles C4'-P-C4' energy: -173.580 flat angles P-C4'-P energy: -95.293 tors. eta vs tors. theta energy: -78.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1262.745995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.745995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.745995 (E_RNA) where: Base-Base interactions energy: -620.638 where: short stacking energy: -432.410 Base-Backbone interact. energy: 0.423 local terms energy: -642.530998 where: bonds (distance) C4'-P energy: -161.730 bonds (distance) P-C4' energy: -154.293 flat angles C4'-P-C4' energy: -161.101 flat angles P-C4'-P energy: -111.987 tors. eta vs tors. theta energy: -53.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1184.393486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.393486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.393486 (E_RNA) where: Base-Base interactions energy: -598.176 where: short stacking energy: -388.539 Base-Backbone interact. energy: 1.532 local terms energy: -587.749308 where: bonds (distance) C4'-P energy: -146.516 bonds (distance) P-C4' energy: -160.705 flat angles C4'-P-C4' energy: -145.370 flat angles P-C4'-P energy: -84.906 tors. eta vs tors. theta energy: -50.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -993.899343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.899343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.899343 (E_RNA) where: Base-Base interactions energy: -439.916 where: short stacking energy: -309.204 Base-Backbone interact. energy: -2.403 local terms energy: -551.579540 where: bonds (distance) C4'-P energy: -166.976 bonds (distance) P-C4' energy: -160.190 flat angles C4'-P-C4' energy: -126.112 flat angles P-C4'-P energy: -60.752 tors. eta vs tors. theta energy: -37.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -897.287837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.287837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.287837 (E_RNA) where: Base-Base interactions energy: -388.210 where: short stacking energy: -262.810 Base-Backbone interact. energy: 2.700 local terms energy: -511.778096 where: bonds (distance) C4'-P energy: -152.465 bonds (distance) P-C4' energy: -160.396 flat angles C4'-P-C4' energy: -129.263 flat angles P-C4'-P energy: -70.226 tors. eta vs tors. theta energy: 0.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -696.916102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -696.916102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -696.916102 (E_RNA) where: Base-Base interactions energy: -251.550 where: short stacking energy: -200.761 Base-Backbone interact. energy: 1.559 local terms energy: -446.925022 where: bonds (distance) C4'-P energy: -153.069 bonds (distance) P-C4' energy: -159.410 flat angles C4'-P-C4' energy: -128.293 flat angles P-C4'-P energy: -58.111 tors. eta vs tors. theta energy: 51.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -2193.272598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.272598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.272598 (E_RNA) where: Base-Base interactions energy: -1329.370 where: short stacking energy: -729.877 Base-Backbone interact. energy: -2.529 local terms energy: -861.373526 where: bonds (distance) C4'-P energy: -164.161 bonds (distance) P-C4' energy: -196.194 flat angles C4'-P-C4' energy: -205.127 flat angles P-C4'-P energy: -122.118 tors. eta vs tors. theta energy: -173.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1812.641914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1812.641914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1812.641914 (E_RNA) where: Base-Base interactions energy: -976.557 where: short stacking energy: -710.613 Base-Backbone interact. energy: -1.502 local terms energy: -834.582041 where: bonds (distance) C4'-P energy: -175.124 bonds (distance) P-C4' energy: -165.457 flat angles C4'-P-C4' energy: -184.320 flat angles P-C4'-P energy: -128.847 tors. eta vs tors. theta energy: -180.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1580.607036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.607036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.607036 (E_RNA) where: Base-Base interactions energy: -804.719 where: short stacking energy: -613.742 Base-Backbone interact. energy: -4.882 local terms energy: -771.006256 where: bonds (distance) C4'-P energy: -179.186 bonds (distance) P-C4' energy: -185.704 flat angles C4'-P-C4' energy: -166.033 flat angles P-C4'-P energy: -101.117 tors. eta vs tors. theta energy: -138.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1501.189746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.189746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.189746 (E_RNA) where: Base-Base interactions energy: -789.299 where: short stacking energy: -534.980 Base-Backbone interact. energy: -3.346 local terms energy: -708.544115 where: bonds (distance) C4'-P energy: -151.075 bonds (distance) P-C4' energy: -164.014 flat angles C4'-P-C4' energy: -178.022 flat angles P-C4'-P energy: -115.831 tors. eta vs tors. theta energy: -99.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1424.744664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1424.744664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1424.744664 (E_RNA) where: Base-Base interactions energy: -740.440 where: short stacking energy: -497.789 Base-Backbone interact. energy: 3.478 local terms energy: -687.782510 where: bonds (distance) C4'-P energy: -155.658 bonds (distance) P-C4' energy: -182.216 flat angles C4'-P-C4' energy: -169.081 flat angles P-C4'-P energy: -95.696 tors. eta vs tors. theta energy: -85.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1176.989286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.989286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.989286 (E_RNA) where: Base-Base interactions energy: -559.506 where: short stacking energy: -359.698 Base-Backbone interact. energy: 4.305 local terms energy: -621.788178 where: bonds (distance) C4'-P energy: -164.971 bonds (distance) P-C4' energy: -175.865 flat angles C4'-P-C4' energy: -155.951 flat angles P-C4'-P energy: -77.145 tors. eta vs tors. theta energy: -47.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1214.210989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1214.210989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1214.210989 (E_RNA) where: Base-Base interactions energy: -606.971 where: short stacking energy: -392.762 Base-Backbone interact. energy: -0.076 local terms energy: -607.164586 where: bonds (distance) C4'-P energy: -157.453 bonds (distance) P-C4' energy: -171.340 flat angles C4'-P-C4' energy: -161.392 flat angles P-C4'-P energy: -84.779 tors. eta vs tors. theta energy: -32.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1042.174800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.174800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.174800 (E_RNA) where: Base-Base interactions energy: -511.285 where: short stacking energy: -330.765 Base-Backbone interact. energy: -0.477 local terms energy: -530.413043 where: bonds (distance) C4'-P energy: -156.402 bonds (distance) P-C4' energy: -155.643 flat angles C4'-P-C4' energy: -130.881 flat angles P-C4'-P energy: -78.831 tors. eta vs tors. theta energy: -8.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -897.861488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.861488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.861488 (E_RNA) where: Base-Base interactions energy: -405.028 where: short stacking energy: -255.084 Base-Backbone interact. energy: 3.456 local terms energy: -496.289445 where: bonds (distance) C4'-P energy: -147.767 bonds (distance) P-C4' energy: -163.173 flat angles C4'-P-C4' energy: -144.346 flat angles P-C4'-P energy: -62.168 tors. eta vs tors. theta energy: 21.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -806.834705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.834705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.834705 (E_RNA) where: Base-Base interactions energy: -327.632 where: short stacking energy: -259.215 Base-Backbone interact. energy: 2.813 local terms energy: -482.016247 where: bonds (distance) C4'-P energy: -150.694 bonds (distance) P-C4' energy: -148.508 flat angles C4'-P-C4' energy: -157.052 flat angles P-C4'-P energy: -53.234 tors. eta vs tors. theta energy: 27.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -2263.982163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2263.982163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2263.982163 (E_RNA) where: Base-Base interactions energy: -1385.957 where: short stacking energy: -767.858 Base-Backbone interact. energy: -2.370 local terms energy: -875.655378 where: bonds (distance) C4'-P energy: -193.779 bonds (distance) P-C4' energy: -177.076 flat angles C4'-P-C4' energy: -189.769 flat angles P-C4'-P energy: -119.469 tors. eta vs tors. theta energy: -195.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1885.323694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.323694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.323694 (E_RNA) where: Base-Base interactions energy: -1083.872 where: short stacking energy: -696.417 Base-Backbone interact. energy: -1.336 local terms energy: -800.115197 where: bonds (distance) C4'-P energy: -173.694 bonds (distance) P-C4' energy: -185.944 flat angles C4'-P-C4' energy: -182.207 flat angles P-C4'-P energy: -105.443 tors. eta vs tors. theta energy: -152.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1515.683656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.683656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.683656 (E_RNA) where: Base-Base interactions energy: -764.464 where: short stacking energy: -576.520 Base-Backbone interact. energy: -2.044 local terms energy: -749.175735 where: bonds (distance) C4'-P energy: -162.144 bonds (distance) P-C4' energy: -187.167 flat angles C4'-P-C4' energy: -175.082 flat angles P-C4'-P energy: -115.530 tors. eta vs tors. theta energy: -109.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1507.529090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.529090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.529090 (E_RNA) where: Base-Base interactions energy: -784.904 where: short stacking energy: -538.347 Base-Backbone interact. energy: -1.308 local terms energy: -721.316865 where: bonds (distance) C4'-P energy: -181.120 bonds (distance) P-C4' energy: -166.747 flat angles C4'-P-C4' energy: -177.176 flat angles P-C4'-P energy: -93.660 tors. eta vs tors. theta energy: -102.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1381.408578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1381.408578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1381.408578 (E_RNA) where: Base-Base interactions energy: -677.039 where: short stacking energy: -466.877 Base-Backbone interact. energy: -1.670 local terms energy: -702.699567 where: bonds (distance) C4'-P energy: -172.733 bonds (distance) P-C4' energy: -171.761 flat angles C4'-P-C4' energy: -161.960 flat angles P-C4'-P energy: -103.808 tors. eta vs tors. theta energy: -92.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1283.310959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.310959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.310959 (E_RNA) where: Base-Base interactions energy: -673.104 where: short stacking energy: -451.297 Base-Backbone interact. energy: 2.428 local terms energy: -612.634917 where: bonds (distance) C4'-P energy: -165.770 bonds (distance) P-C4' energy: -166.465 flat angles C4'-P-C4' energy: -140.326 flat angles P-C4'-P energy: -94.609 tors. eta vs tors. theta energy: -45.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1174.103555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.103555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.103555 (E_RNA) where: Base-Base interactions energy: -573.472 where: short stacking energy: -366.688 Base-Backbone interact. energy: 0.666 local terms energy: -601.297659 where: bonds (distance) C4'-P energy: -158.479 bonds (distance) P-C4' energy: -178.252 flat angles C4'-P-C4' energy: -147.657 flat angles P-C4'-P energy: -97.297 tors. eta vs tors. theta energy: -19.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1030.822248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.822248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.822248 (E_RNA) where: Base-Base interactions energy: -492.869 where: short stacking energy: -330.531 Base-Backbone interact. energy: 4.777 local terms energy: -542.730237 where: bonds (distance) C4'-P energy: -144.750 bonds (distance) P-C4' energy: -162.581 flat angles C4'-P-C4' energy: -142.061 flat angles P-C4'-P energy: -78.189 tors. eta vs tors. theta energy: -15.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -1011.667896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.667896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.667896 (E_RNA) where: Base-Base interactions energy: -438.673 where: short stacking energy: -290.395 Base-Backbone interact. energy: 2.095 local terms energy: -575.089507 where: bonds (distance) C4'-P energy: -143.835 bonds (distance) P-C4' energy: -196.853 flat angles C4'-P-C4' energy: -119.087 flat angles P-C4'-P energy: -92.034 tors. eta vs tors. theta energy: -23.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -756.400372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.400372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.400372 (E_RNA) where: Base-Base interactions energy: -294.359 where: short stacking energy: -235.074 Base-Backbone interact. energy: 2.235 local terms energy: -464.277195 where: bonds (distance) C4'-P energy: -139.493 bonds (distance) P-C4' energy: -144.374 flat angles C4'-P-C4' energy: -133.560 flat angles P-C4'-P energy: -67.428 tors. eta vs tors. theta energy: 20.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -2311.481435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2311.481435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.481435 (E_RNA) where: Base-Base interactions energy: -1423.440 where: short stacking energy: -758.947 Base-Backbone interact. energy: 0.365 local terms energy: -888.405645 where: bonds (distance) C4'-P energy: -179.819 bonds (distance) P-C4' energy: -196.687 flat angles C4'-P-C4' energy: -194.152 flat angles P-C4'-P energy: -128.046 tors. eta vs tors. theta energy: -189.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1994.584304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1994.584304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1994.584304 (E_RNA) where: Base-Base interactions energy: -1150.601 where: short stacking energy: -713.799 Base-Backbone interact. energy: -2.501 local terms energy: -841.481551 where: bonds (distance) C4'-P energy: -194.400 bonds (distance) P-C4' energy: -183.425 flat angles C4'-P-C4' energy: -175.602 flat angles P-C4'-P energy: -120.906 tors. eta vs tors. theta energy: -167.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1586.014567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1586.014567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1586.014567 (E_RNA) where: Base-Base interactions energy: -837.296 where: short stacking energy: -590.335 Base-Backbone interact. energy: -0.477 local terms energy: -748.241666 where: bonds (distance) C4'-P energy: -159.156 bonds (distance) P-C4' energy: -172.783 flat angles C4'-P-C4' energy: -183.801 flat angles P-C4'-P energy: -121.417 tors. eta vs tors. theta energy: -111.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1560.028156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.028156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.028156 (E_RNA) where: Base-Base interactions energy: -810.021 where: short stacking energy: -554.627 Base-Backbone interact. energy: -4.254 local terms energy: -745.752649 where: bonds (distance) C4'-P energy: -156.262 bonds (distance) P-C4' energy: -185.908 flat angles C4'-P-C4' energy: -181.065 flat angles P-C4'-P energy: -108.064 tors. eta vs tors. theta energy: -114.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1390.051345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1390.051345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1390.051345 (E_RNA) where: Base-Base interactions energy: -696.238 where: short stacking energy: -484.998 Base-Backbone interact. energy: -3.021 local terms energy: -690.792795 where: bonds (distance) C4'-P energy: -164.240 bonds (distance) P-C4' energy: -168.291 flat angles C4'-P-C4' energy: -160.236 flat angles P-C4'-P energy: -101.564 tors. eta vs tors. theta energy: -96.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1365.916452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.916452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.916452 (E_RNA) where: Base-Base interactions energy: -701.506 where: short stacking energy: -432.946 Base-Backbone interact. energy: -4.510 local terms energy: -659.899898 where: bonds (distance) C4'-P energy: -157.310 bonds (distance) P-C4' energy: -171.208 flat angles C4'-P-C4' energy: -147.667 flat angles P-C4'-P energy: -113.478 tors. eta vs tors. theta energy: -70.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1247.039988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.039988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.039988 (E_RNA) where: Base-Base interactions energy: -662.987 where: short stacking energy: -409.249 Base-Backbone interact. energy: -1.927 local terms energy: -582.126439 where: bonds (distance) C4'-P energy: -159.853 bonds (distance) P-C4' energy: -156.086 flat angles C4'-P-C4' energy: -129.590 flat angles P-C4'-P energy: -92.484 tors. eta vs tors. theta energy: -44.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1029.227225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.227225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.227225 (E_RNA) where: Base-Base interactions energy: -498.001 where: short stacking energy: -360.421 Base-Backbone interact. energy: 5.051 local terms energy: -536.277817 where: bonds (distance) C4'-P energy: -133.378 bonds (distance) P-C4' energy: -153.473 flat angles C4'-P-C4' energy: -122.564 flat angles P-C4'-P energy: -99.858 tors. eta vs tors. theta energy: -27.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -934.952432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.952432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.952432 (E_RNA) where: Base-Base interactions energy: -403.139 where: short stacking energy: -277.899 Base-Backbone interact. energy: 6.897 local terms energy: -538.710367 where: bonds (distance) C4'-P energy: -146.807 bonds (distance) P-C4' energy: -171.192 flat angles C4'-P-C4' energy: -140.813 flat angles P-C4'-P energy: -76.167 tors. eta vs tors. theta energy: -3.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -726.168374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.168374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.168374 (E_RNA) where: Base-Base interactions energy: -298.026 where: short stacking energy: -215.627 Base-Backbone interact. energy: 14.182 local terms energy: -442.324553 where: bonds (distance) C4'-P energy: -151.743 bonds (distance) P-C4' energy: -153.333 flat angles C4'-P-C4' energy: -108.081 flat angles P-C4'-P energy: -50.994 tors. eta vs tors. theta energy: 21.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -2312.697444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2312.697444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2312.697444 (E_RNA) where: Base-Base interactions energy: -1420.270 where: short stacking energy: -745.444 Base-Backbone interact. energy: -2.503 local terms energy: -889.924727 where: bonds (distance) C4'-P energy: -191.513 bonds (distance) P-C4' energy: -196.370 flat angles C4'-P-C4' energy: -198.927 flat angles P-C4'-P energy: -122.629 tors. eta vs tors. theta energy: -180.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -2080.698369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2080.698369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2080.698369 (E_RNA) where: Base-Base interactions energy: -1211.618 where: short stacking energy: -756.167 Base-Backbone interact. energy: -1.086 local terms energy: -867.994196 where: bonds (distance) C4'-P energy: -177.331 bonds (distance) P-C4' energy: -182.952 flat angles C4'-P-C4' energy: -191.469 flat angles P-C4'-P energy: -121.018 tors. eta vs tors. theta energy: -195.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1773.936630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1773.936630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1773.936630 (E_RNA) where: Base-Base interactions energy: -1016.121 where: short stacking energy: -605.798 Base-Backbone interact. energy: -1.560 local terms energy: -756.256266 where: bonds (distance) C4'-P energy: -160.124 bonds (distance) P-C4' energy: -160.190 flat angles C4'-P-C4' energy: -191.307 flat angles P-C4'-P energy: -122.036 tors. eta vs tors. theta energy: -122.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1479.313572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.313572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.313572 (E_RNA) where: Base-Base interactions energy: -760.991 where: short stacking energy: -531.733 Base-Backbone interact. energy: -1.108 local terms energy: -717.215005 where: bonds (distance) C4'-P energy: -142.129 bonds (distance) P-C4' energy: -178.475 flat angles C4'-P-C4' energy: -180.732 flat angles P-C4'-P energy: -117.925 tors. eta vs tors. theta energy: -97.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1524.900555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.900555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.900555 (E_RNA) where: Base-Base interactions energy: -833.227 where: short stacking energy: -510.840 Base-Backbone interact. energy: 0.103 local terms energy: -691.776255 where: bonds (distance) C4'-P energy: -169.559 bonds (distance) P-C4' energy: -182.554 flat angles C4'-P-C4' energy: -162.750 flat angles P-C4'-P energy: -77.703 tors. eta vs tors. theta energy: -99.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1301.788808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.788808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.788808 (E_RNA) where: Base-Base interactions energy: -660.355 where: short stacking energy: -414.157 Base-Backbone interact. energy: 1.135 local terms energy: -642.568916 where: bonds (distance) C4'-P energy: -169.298 bonds (distance) P-C4' energy: -184.231 flat angles C4'-P-C4' energy: -149.373 flat angles P-C4'-P energy: -105.379 tors. eta vs tors. theta energy: -34.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1279.960098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.960098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1279.960098 (E_RNA) where: Base-Base interactions energy: -673.447 where: short stacking energy: -409.515 Base-Backbone interact. energy: 6.255 local terms energy: -612.768285 where: bonds (distance) C4'-P energy: -162.106 bonds (distance) P-C4' energy: -141.963 flat angles C4'-P-C4' energy: -153.973 flat angles P-C4'-P energy: -96.976 tors. eta vs tors. theta energy: -57.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1153.883206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1153.883206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.883206 (E_RNA) where: Base-Base interactions energy: -603.172 where: short stacking energy: -334.408 Base-Backbone interact. energy: 6.146 local terms energy: -556.856304 where: bonds (distance) C4'-P energy: -164.549 bonds (distance) P-C4' energy: -144.498 flat angles C4'-P-C4' energy: -146.212 flat angles P-C4'-P energy: -90.495 tors. eta vs tors. theta energy: -11.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -987.237460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.237460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.237460 (E_RNA) where: Base-Base interactions energy: -479.540 where: short stacking energy: -320.722 Base-Backbone interact. energy: 4.067 local terms energy: -511.764125 where: bonds (distance) C4'-P energy: -165.049 bonds (distance) P-C4' energy: -131.504 flat angles C4'-P-C4' energy: -134.713 flat angles P-C4'-P energy: -67.854 tors. eta vs tors. theta energy: -12.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -722.323997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -722.323997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -722.323997 (E_RNA) where: Base-Base interactions energy: -272.905 where: short stacking energy: -241.478 Base-Backbone interact. energy: 5.743 local terms energy: -455.162284 where: bonds (distance) C4'-P energy: -141.606 bonds (distance) P-C4' energy: -166.579 flat angles C4'-P-C4' energy: -105.860 flat angles P-C4'-P energy: -65.483 tors. eta vs tors. theta energy: 24.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -2361.682790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2361.682790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2361.682790 (E_RNA) where: Base-Base interactions energy: -1479.302 where: short stacking energy: -795.821 Base-Backbone interact. energy: 0.233 local terms energy: -882.614013 where: bonds (distance) C4'-P energy: -177.161 bonds (distance) P-C4' energy: -179.139 flat angles C4'-P-C4' energy: -212.249 flat angles P-C4'-P energy: -121.080 tors. eta vs tors. theta energy: -192.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -2062.316527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2062.316527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2062.316527 (E_RNA) where: Base-Base interactions energy: -1221.540 where: short stacking energy: -711.663 Base-Backbone interact. energy: 0.982 local terms energy: -841.757687 where: bonds (distance) C4'-P energy: -184.790 bonds (distance) P-C4' energy: -173.987 flat angles C4'-P-C4' energy: -200.385 flat angles P-C4'-P energy: -111.324 tors. eta vs tors. theta energy: -171.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1959.292203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.292203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1959.292203 (E_RNA) where: Base-Base interactions energy: -1142.205 where: short stacking energy: -669.130 Base-Backbone interact. energy: 0.452 local terms energy: -817.538891 where: bonds (distance) C4'-P energy: -166.453 bonds (distance) P-C4' energy: -189.780 flat angles C4'-P-C4' energy: -194.572 flat angles P-C4'-P energy: -112.466 tors. eta vs tors. theta energy: -154.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1688.491299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.491299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.491299 (E_RNA) where: Base-Base interactions energy: -937.215 where: short stacking energy: -543.672 Base-Backbone interact. energy: -2.276 local terms energy: -749.000248 where: bonds (distance) C4'-P energy: -145.735 bonds (distance) P-C4' energy: -175.718 flat angles C4'-P-C4' energy: -186.995 flat angles P-C4'-P energy: -124.894 tors. eta vs tors. theta energy: -115.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1356.469151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.469151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.469151 (E_RNA) where: Base-Base interactions energy: -673.783 where: short stacking energy: -475.775 Base-Backbone interact. energy: 5.660 local terms energy: -688.346049 where: bonds (distance) C4'-P energy: -174.694 bonds (distance) P-C4' energy: -181.183 flat angles C4'-P-C4' energy: -159.561 flat angles P-C4'-P energy: -103.322 tors. eta vs tors. theta energy: -69.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1322.541830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.541830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.541830 (E_RNA) where: Base-Base interactions energy: -705.512 where: short stacking energy: -434.301 Base-Backbone interact. energy: 0.748 local terms energy: -617.777207 where: bonds (distance) C4'-P energy: -121.662 bonds (distance) P-C4' energy: -160.746 flat angles C4'-P-C4' energy: -164.677 flat angles P-C4'-P energy: -107.346 tors. eta vs tors. theta energy: -63.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1255.317405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.317405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.317405 (E_RNA) where: Base-Base interactions energy: -641.441 where: short stacking energy: -395.584 Base-Backbone interact. energy: -2.690 local terms energy: -611.186808 where: bonds (distance) C4'-P energy: -159.728 bonds (distance) P-C4' energy: -165.536 flat angles C4'-P-C4' energy: -165.999 flat angles P-C4'-P energy: -84.047 tors. eta vs tors. theta energy: -35.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1292.382596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.382596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.382596 (E_RNA) where: Base-Base interactions energy: -696.379 where: short stacking energy: -384.612 Base-Backbone interact. energy: -0.396 local terms energy: -595.607332 where: bonds (distance) C4'-P energy: -140.383 bonds (distance) P-C4' energy: -181.725 flat angles C4'-P-C4' energy: -145.786 flat angles P-C4'-P energy: -81.738 tors. eta vs tors. theta energy: -45.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -988.854043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.854043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.854043 (E_RNA) where: Base-Base interactions energy: -485.332 where: short stacking energy: -323.542 Base-Backbone interact. energy: 0.717 local terms energy: -504.239718 where: bonds (distance) C4'-P energy: -139.974 bonds (distance) P-C4' energy: -151.829 flat angles C4'-P-C4' energy: -121.780 flat angles P-C4'-P energy: -78.419 tors. eta vs tors. theta energy: -12.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -699.788311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.788311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.788311 (E_RNA) where: Base-Base interactions energy: -296.266 where: short stacking energy: -183.058 Base-Backbone interact. energy: 0.952 local terms energy: -404.474770 where: bonds (distance) C4'-P energy: -127.519 bonds (distance) P-C4' energy: -121.418 flat angles C4'-P-C4' energy: -129.117 flat angles P-C4'-P energy: -72.976 tors. eta vs tors. theta energy: 46.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2454.783471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2454.783471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2454.783471 (E_RNA) where: Base-Base interactions energy: -1579.525 where: short stacking energy: -814.240 Base-Backbone interact. energy: 0.566 local terms energy: -875.824991 where: bonds (distance) C4'-P energy: -177.923 bonds (distance) P-C4' energy: -171.198 flat angles C4'-P-C4' energy: -202.733 flat angles P-C4'-P energy: -114.549 tors. eta vs tors. theta energy: -209.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -2082.318904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.318904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.318904 (E_RNA) where: Base-Base interactions energy: -1223.704 where: short stacking energy: -690.710 Base-Backbone interact. energy: 4.360 local terms energy: -862.974845 where: bonds (distance) C4'-P energy: -174.585 bonds (distance) P-C4' energy: -188.629 flat angles C4'-P-C4' energy: -199.405 flat angles P-C4'-P energy: -128.279 tors. eta vs tors. theta energy: -172.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1918.101361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1918.101361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1918.101361 (E_RNA) where: Base-Base interactions energy: -1134.604 where: short stacking energy: -660.532 Base-Backbone interact. energy: -2.789 local terms energy: -780.707656 where: bonds (distance) C4'-P energy: -158.520 bonds (distance) P-C4' energy: -165.983 flat angles C4'-P-C4' energy: -188.018 flat angles P-C4'-P energy: -106.463 tors. eta vs tors. theta energy: -161.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1863.274202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1863.274202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1863.274202 (E_RNA) where: Base-Base interactions energy: -1084.305 where: short stacking energy: -650.176 Base-Backbone interact. energy: 0.101 local terms energy: -779.069442 where: bonds (distance) C4'-P energy: -161.599 bonds (distance) P-C4' energy: -185.769 flat angles C4'-P-C4' energy: -169.689 flat angles P-C4'-P energy: -110.764 tors. eta vs tors. theta energy: -151.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1326.545965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.545965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.545965 (E_RNA) where: Base-Base interactions energy: -659.100 where: short stacking energy: -414.243 Base-Backbone interact. energy: 0.051 local terms energy: -667.497181 where: bonds (distance) C4'-P energy: -157.751 bonds (distance) P-C4' energy: -162.186 flat angles C4'-P-C4' energy: -162.761 flat angles P-C4'-P energy: -108.731 tors. eta vs tors. theta energy: -76.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1358.593572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.593572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.593572 (E_RNA) where: Base-Base interactions energy: -735.159 where: short stacking energy: -467.154 Base-Backbone interact. energy: -0.295 local terms energy: -623.139931 where: bonds (distance) C4'-P energy: -163.048 bonds (distance) P-C4' energy: -148.719 flat angles C4'-P-C4' energy: -150.099 flat angles P-C4'-P energy: -95.339 tors. eta vs tors. theta energy: -65.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1427.341288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.341288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.341288 (E_RNA) where: Base-Base interactions energy: -810.346 where: short stacking energy: -425.826 Base-Backbone interact. energy: 0.202 local terms energy: -617.197571 where: bonds (distance) C4'-P energy: -177.254 bonds (distance) P-C4' energy: -152.868 flat angles C4'-P-C4' energy: -149.837 flat angles P-C4'-P energy: -94.694 tors. eta vs tors. theta energy: -42.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1226.126252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.126252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.126252 (E_RNA) where: Base-Base interactions energy: -685.478 where: short stacking energy: -381.384 Base-Backbone interact. energy: 2.758 local terms energy: -543.406581 where: bonds (distance) C4'-P energy: -148.398 bonds (distance) P-C4' energy: -159.474 flat angles C4'-P-C4' energy: -129.245 flat angles P-C4'-P energy: -67.854 tors. eta vs tors. theta energy: -38.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -972.147664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.147664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.147664 (E_RNA) where: Base-Base interactions energy: -480.866 where: short stacking energy: -316.245 Base-Backbone interact. energy: -0.160 local terms energy: -491.121328 where: bonds (distance) C4'-P energy: -137.701 bonds (distance) P-C4' energy: -158.474 flat angles C4'-P-C4' energy: -105.381 flat angles P-C4'-P energy: -75.607 tors. eta vs tors. theta energy: -13.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -730.182126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.182126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.182126 (E_RNA) where: Base-Base interactions energy: -233.320 where: short stacking energy: -186.040 Base-Backbone interact. energy: 1.836 local terms energy: -498.698650 where: bonds (distance) C4'-P energy: -140.274 bonds (distance) P-C4' energy: -157.828 flat angles C4'-P-C4' energy: -144.257 flat angles P-C4'-P energy: -76.847 tors. eta vs tors. theta energy: 20.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2473.313561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2473.313561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2473.313561 (E_RNA) where: Base-Base interactions energy: -1576.343 where: short stacking energy: -790.529 Base-Backbone interact. energy: -1.269 local terms energy: -895.701838 where: bonds (distance) C4'-P energy: -175.949 bonds (distance) P-C4' energy: -193.871 flat angles C4'-P-C4' energy: -193.080 flat angles P-C4'-P energy: -121.721 tors. eta vs tors. theta energy: -211.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -2135.132302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2135.132302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2135.132302 (E_RNA) where: Base-Base interactions energy: -1333.283 where: short stacking energy: -768.280 Base-Backbone interact. energy: 4.793 local terms energy: -806.641378 where: bonds (distance) C4'-P energy: -176.890 bonds (distance) P-C4' energy: -169.189 flat angles C4'-P-C4' energy: -191.708 flat angles P-C4'-P energy: -97.026 tors. eta vs tors. theta energy: -171.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1963.440632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1963.440632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1963.440632 (E_RNA) where: Base-Base interactions energy: -1169.154 where: short stacking energy: -663.594 Base-Backbone interact. energy: 2.766 local terms energy: -797.052717 where: bonds (distance) C4'-P energy: -170.265 bonds (distance) P-C4' energy: -170.290 flat angles C4'-P-C4' energy: -192.143 flat angles P-C4'-P energy: -112.839 tors. eta vs tors. theta energy: -151.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1858.937324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1858.937324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1858.937324 (E_RNA) where: Base-Base interactions energy: -1094.106 where: short stacking energy: -640.422 Base-Backbone interact. energy: -2.179 local terms energy: -762.652529 where: bonds (distance) C4'-P energy: -172.291 bonds (distance) P-C4' energy: -180.603 flat angles C4'-P-C4' energy: -178.468 flat angles P-C4'-P energy: -94.975 tors. eta vs tors. theta energy: -136.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1442.707391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.707391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.707391 (E_RNA) where: Base-Base interactions energy: -784.052 where: short stacking energy: -470.683 Base-Backbone interact. energy: -2.660 local terms energy: -655.995455 where: bonds (distance) C4'-P energy: -166.660 bonds (distance) P-C4' energy: -158.961 flat angles C4'-P-C4' energy: -145.389 flat angles P-C4'-P energy: -82.384 tors. eta vs tors. theta energy: -102.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1614.009928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1614.009928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1614.009928 (E_RNA) where: Base-Base interactions energy: -938.475 where: short stacking energy: -504.317 Base-Backbone interact. energy: -0.327 local terms energy: -675.208225 where: bonds (distance) C4'-P energy: -169.017 bonds (distance) P-C4' energy: -174.908 flat angles C4'-P-C4' energy: -155.615 flat angles P-C4'-P energy: -87.565 tors. eta vs tors. theta energy: -88.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1279.551666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.551666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1279.551666 (E_RNA) where: Base-Base interactions energy: -670.519 where: short stacking energy: -388.404 Base-Backbone interact. energy: 2.396 local terms energy: -611.428283 where: bonds (distance) C4'-P energy: -158.197 bonds (distance) P-C4' energy: -181.030 flat angles C4'-P-C4' energy: -141.024 flat angles P-C4'-P energy: -94.105 tors. eta vs tors. theta energy: -37.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1222.026969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.026969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.026969 (E_RNA) where: Base-Base interactions energy: -700.931 where: short stacking energy: -352.728 Base-Backbone interact. energy: -2.234 local terms energy: -518.862148 where: bonds (distance) C4'-P energy: -145.936 bonds (distance) P-C4' energy: -154.998 flat angles C4'-P-C4' energy: -134.421 flat angles P-C4'-P energy: -59.731 tors. eta vs tors. theta energy: -23.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -960.684624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.684624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.684624 (E_RNA) where: Base-Base interactions energy: -471.918 where: short stacking energy: -309.698 Base-Backbone interact. energy: -0.984 local terms energy: -487.781675 where: bonds (distance) C4'-P energy: -128.869 bonds (distance) P-C4' energy: -160.886 flat angles C4'-P-C4' energy: -131.024 flat angles P-C4'-P energy: -71.903 tors. eta vs tors. theta energy: 4.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -714.502493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.502493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.502493 (E_RNA) where: Base-Base interactions energy: -292.035 where: short stacking energy: -243.623 Base-Backbone interact. energy: 5.839 local terms energy: -428.306350 where: bonds (distance) C4'-P energy: -139.621 bonds (distance) P-C4' energy: -141.055 flat angles C4'-P-C4' energy: -124.795 flat angles P-C4'-P energy: -68.896 tors. eta vs tors. theta energy: 46.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2428.785429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2428.785429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2428.785429 (E_RNA) where: Base-Base interactions energy: -1510.724 where: short stacking energy: -787.321 Base-Backbone interact. energy: -0.522 local terms energy: -917.538804 where: bonds (distance) C4'-P energy: -186.275 bonds (distance) P-C4' energy: -187.419 flat angles C4'-P-C4' energy: -208.012 flat angles P-C4'-P energy: -147.539 tors. eta vs tors. theta energy: -188.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -2101.187867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.187867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.187867 (E_RNA) where: Base-Base interactions energy: -1242.391 where: short stacking energy: -708.652 Base-Backbone interact. energy: -6.093 local terms energy: -852.704021 where: bonds (distance) C4'-P energy: -174.119 bonds (distance) P-C4' energy: -186.743 flat angles C4'-P-C4' energy: -189.617 flat angles P-C4'-P energy: -115.825 tors. eta vs tors. theta energy: -186.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1971.785134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.785134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.785134 (E_RNA) where: Base-Base interactions energy: -1169.673 where: short stacking energy: -683.323 Base-Backbone interact. energy: 4.099 local terms energy: -806.211167 where: bonds (distance) C4'-P energy: -166.450 bonds (distance) P-C4' energy: -196.498 flat angles C4'-P-C4' energy: -179.038 flat angles P-C4'-P energy: -104.168 tors. eta vs tors. theta energy: -160.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1869.906213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1869.906213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1869.906213 (E_RNA) where: Base-Base interactions energy: -1139.402 where: short stacking energy: -570.180 Base-Backbone interact. energy: -3.236 local terms energy: -727.268252 where: bonds (distance) C4'-P energy: -148.818 bonds (distance) P-C4' energy: -171.936 flat angles C4'-P-C4' energy: -179.058 flat angles P-C4'-P energy: -108.109 tors. eta vs tors. theta energy: -119.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1795.078225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1795.078225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1795.078225 (E_RNA) where: Base-Base interactions energy: -1103.101 where: short stacking energy: -557.062 Base-Backbone interact. energy: 2.419 local terms energy: -694.396382 where: bonds (distance) C4'-P energy: -134.871 bonds (distance) P-C4' energy: -168.478 flat angles C4'-P-C4' energy: -178.946 flat angles P-C4'-P energy: -110.480 tors. eta vs tors. theta energy: -101.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1408.787061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.787061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.787061 (E_RNA) where: Base-Base interactions energy: -739.755 where: short stacking energy: -515.172 Base-Backbone interact. energy: 3.586 local terms energy: -672.617503 where: bonds (distance) C4'-P energy: -144.625 bonds (distance) P-C4' energy: -148.980 flat angles C4'-P-C4' energy: -179.871 flat angles P-C4'-P energy: -91.465 tors. eta vs tors. theta energy: -107.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1273.382396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.382396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.382396 (E_RNA) where: Base-Base interactions energy: -690.600 where: short stacking energy: -373.615 Base-Backbone interact. energy: 0.260 local terms energy: -583.042063 where: bonds (distance) C4'-P energy: -163.041 bonds (distance) P-C4' energy: -164.439 flat angles C4'-P-C4' energy: -136.881 flat angles P-C4'-P energy: -93.576 tors. eta vs tors. theta energy: -25.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1187.534767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.534767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.534767 (E_RNA) where: Base-Base interactions energy: -614.361 where: short stacking energy: -354.350 Base-Backbone interact. energy: -1.896 local terms energy: -571.277178 where: bonds (distance) C4'-P energy: -144.882 bonds (distance) P-C4' energy: -167.377 flat angles C4'-P-C4' energy: -137.040 flat angles P-C4'-P energy: -87.755 tors. eta vs tors. theta energy: -34.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -991.655990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.655990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.655990 (E_RNA) where: Base-Base interactions energy: -487.405 where: short stacking energy: -327.988 Base-Backbone interact. energy: 4.577 local terms energy: -508.827464 where: bonds (distance) C4'-P energy: -162.279 bonds (distance) P-C4' energy: -147.060 flat angles C4'-P-C4' energy: -130.914 flat angles P-C4'-P energy: -67.922 tors. eta vs tors. theta energy: -0.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -781.787614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.787614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.787614 (E_RNA) where: Base-Base interactions energy: -325.768 where: short stacking energy: -250.701 Base-Backbone interact. energy: -1.493 local terms energy: -454.526852 where: bonds (distance) C4'-P energy: -114.468 bonds (distance) P-C4' energy: -137.724 flat angles C4'-P-C4' energy: -123.792 flat angles P-C4'-P energy: -90.848 tors. eta vs tors. theta energy: 12.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2460.331573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2460.331573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2460.331573 (E_RNA) where: Base-Base interactions energy: -1541.738 where: short stacking energy: -800.144 Base-Backbone interact. energy: 0.015 local terms energy: -918.608681 where: bonds (distance) C4'-P energy: -175.155 bonds (distance) P-C4' energy: -196.723 flat angles C4'-P-C4' energy: -203.612 flat angles P-C4'-P energy: -134.976 tors. eta vs tors. theta energy: -208.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -2162.574216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.574216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2162.574216 (E_RNA) where: Base-Base interactions energy: -1313.439 where: short stacking energy: -763.724 Base-Backbone interact. energy: 1.217 local terms energy: -850.352602 where: bonds (distance) C4'-P energy: -163.919 bonds (distance) P-C4' energy: -181.843 flat angles C4'-P-C4' energy: -189.582 flat angles P-C4'-P energy: -111.427 tors. eta vs tors. theta energy: -203.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1930.736631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1930.736631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1930.736631 (E_RNA) where: Base-Base interactions energy: -1152.376 where: short stacking energy: -638.475 Base-Backbone interact. energy: -0.254 local terms energy: -778.106665 where: bonds (distance) C4'-P energy: -160.209 bonds (distance) P-C4' energy: -175.540 flat angles C4'-P-C4' energy: -182.428 flat angles P-C4'-P energy: -116.437 tors. eta vs tors. theta energy: -143.492 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1927.088026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1927.088026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1927.088026 (E_RNA) where: Base-Base interactions energy: -1134.274 where: short stacking energy: -654.597 Base-Backbone interact. energy: -2.377 local terms energy: -790.437027 where: bonds (distance) C4'-P energy: -155.118 bonds (distance) P-C4' energy: -173.185 flat angles C4'-P-C4' energy: -196.431 flat angles P-C4'-P energy: -114.215 tors. eta vs tors. theta energy: -151.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1869.617941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1869.617941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1869.617941 (E_RNA) where: Base-Base interactions energy: -1125.195 where: short stacking energy: -574.860 Base-Backbone interact. energy: -0.790 local terms energy: -743.632957 where: bonds (distance) C4'-P energy: -162.694 bonds (distance) P-C4' energy: -189.365 flat angles C4'-P-C4' energy: -171.284 flat angles P-C4'-P energy: -103.050 tors. eta vs tors. theta energy: -117.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1344.171887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.171887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.171887 (E_RNA) where: Base-Base interactions energy: -697.325 where: short stacking energy: -420.230 Base-Backbone interact. energy: -0.907 local terms energy: -645.939834 where: bonds (distance) C4'-P energy: -155.855 bonds (distance) P-C4' energy: -177.561 flat angles C4'-P-C4' energy: -162.908 flat angles P-C4'-P energy: -106.253 tors. eta vs tors. theta energy: -43.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1274.003119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.003119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.003119 (E_RNA) where: Base-Base interactions energy: -660.488 where: short stacking energy: -423.084 Base-Backbone interact. energy: 0.937 local terms energy: -614.452363 where: bonds (distance) C4'-P energy: -146.440 bonds (distance) P-C4' energy: -168.076 flat angles C4'-P-C4' energy: -175.344 flat angles P-C4'-P energy: -84.913 tors. eta vs tors. theta energy: -39.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1185.648545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.648545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.648545 (E_RNA) where: Base-Base interactions energy: -648.167 where: short stacking energy: -374.248 Base-Backbone interact. energy: 1.061 local terms energy: -538.542972 where: bonds (distance) C4'-P energy: -132.334 bonds (distance) P-C4' energy: -157.994 flat angles C4'-P-C4' energy: -141.916 flat angles P-C4'-P energy: -68.119 tors. eta vs tors. theta energy: -38.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -997.643066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.643066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.643066 (E_RNA) where: Base-Base interactions energy: -475.292 where: short stacking energy: -298.480 Base-Backbone interact. energy: 1.192 local terms energy: -523.543272 where: bonds (distance) C4'-P energy: -134.040 bonds (distance) P-C4' energy: -157.756 flat angles C4'-P-C4' energy: -129.374 flat angles P-C4'-P energy: -88.800 tors. eta vs tors. theta energy: -13.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -834.153485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.153485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.153485 (E_RNA) where: Base-Base interactions energy: -358.972 where: short stacking energy: -219.836 Base-Backbone interact. energy: 4.479 local terms energy: -479.660631 where: bonds (distance) C4'-P energy: -134.120 bonds (distance) P-C4' energy: -151.044 flat angles C4'-P-C4' energy: -139.578 flat angles P-C4'-P energy: -85.229 tors. eta vs tors. theta energy: 30.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2466.124102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2466.124102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2466.124102 (E_RNA) where: Base-Base interactions energy: -1562.969 where: short stacking energy: -815.511 Base-Backbone interact. energy: 0.133 local terms energy: -903.287760 where: bonds (distance) C4'-P energy: -170.804 bonds (distance) P-C4' energy: -185.893 flat angles C4'-P-C4' energy: -206.685 flat angles P-C4'-P energy: -127.657 tors. eta vs tors. theta energy: -212.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -2217.311100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2217.311100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2217.311100 (E_RNA) where: Base-Base interactions energy: -1358.046 where: short stacking energy: -764.527 Base-Backbone interact. energy: -1.281 local terms energy: -857.984303 where: bonds (distance) C4'-P energy: -179.728 bonds (distance) P-C4' energy: -176.188 flat angles C4'-P-C4' energy: -205.480 flat angles P-C4'-P energy: -115.161 tors. eta vs tors. theta energy: -181.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1988.263974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1988.263974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1988.263974 (E_RNA) where: Base-Base interactions energy: -1180.296 where: short stacking energy: -681.260 Base-Backbone interact. energy: -1.106 local terms energy: -806.861860 where: bonds (distance) C4'-P energy: -149.149 bonds (distance) P-C4' energy: -185.662 flat angles C4'-P-C4' energy: -201.791 flat angles P-C4'-P energy: -119.644 tors. eta vs tors. theta energy: -150.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1837.055958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1837.055958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1837.055958 (E_RNA) where: Base-Base interactions energy: -1076.469 where: short stacking energy: -587.364 Base-Backbone interact. energy: -1.397 local terms energy: -759.190569 where: bonds (distance) C4'-P energy: -172.013 bonds (distance) P-C4' energy: -171.278 flat angles C4'-P-C4' energy: -183.421 flat angles P-C4'-P energy: -106.414 tors. eta vs tors. theta energy: -126.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1921.582621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1921.582621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1921.582621 (E_RNA) where: Base-Base interactions energy: -1175.546 where: short stacking energy: -616.079 Base-Backbone interact. energy: -0.594 local terms energy: -745.442150 where: bonds (distance) C4'-P energy: -155.304 bonds (distance) P-C4' energy: -171.909 flat angles C4'-P-C4' energy: -182.742 flat angles P-C4'-P energy: -101.050 tors. eta vs tors. theta energy: -134.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1444.347149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.347149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.347149 (E_RNA) where: Base-Base interactions energy: -789.309 where: short stacking energy: -481.545 Base-Backbone interact. energy: -1.206 local terms energy: -653.832432 where: bonds (distance) C4'-P energy: -139.132 bonds (distance) P-C4' energy: -182.529 flat angles C4'-P-C4' energy: -163.126 flat angles P-C4'-P energy: -89.874 tors. eta vs tors. theta energy: -79.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1330.633350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.633350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.633350 (E_RNA) where: Base-Base interactions energy: -717.486 where: short stacking energy: -432.117 Base-Backbone interact. energy: -2.030 local terms energy: -611.117744 where: bonds (distance) C4'-P energy: -156.004 bonds (distance) P-C4' energy: -147.407 flat angles C4'-P-C4' energy: -161.417 flat angles P-C4'-P energy: -73.285 tors. eta vs tors. theta energy: -73.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1122.968783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.968783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.968783 (E_RNA) where: Base-Base interactions energy: -569.860 where: short stacking energy: -353.111 Base-Backbone interact. energy: 4.124 local terms energy: -557.233278 where: bonds (distance) C4'-P energy: -134.834 bonds (distance) P-C4' energy: -141.745 flat angles C4'-P-C4' energy: -148.839 flat angles P-C4'-P energy: -99.138 tors. eta vs tors. theta energy: -32.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1042.188092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.188092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.188092 (E_RNA) where: Base-Base interactions energy: -511.970 where: short stacking energy: -333.193 Base-Backbone interact. energy: 0.138 local terms energy: -530.356394 where: bonds (distance) C4'-P energy: -121.699 bonds (distance) P-C4' energy: -156.827 flat angles C4'-P-C4' energy: -148.865 flat angles P-C4'-P energy: -79.206 tors. eta vs tors. theta energy: -23.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -858.343372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.343372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.343372 (E_RNA) where: Base-Base interactions energy: -357.512 where: short stacking energy: -227.177 Base-Backbone interact. energy: 0.104 local terms energy: -500.935267 where: bonds (distance) C4'-P energy: -142.870 bonds (distance) P-C4' energy: -171.415 flat angles C4'-P-C4' energy: -138.769 flat angles P-C4'-P energy: -76.988 tors. eta vs tors. theta energy: 29.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2460.627701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2460.627701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2460.627701 (E_RNA) where: Base-Base interactions energy: -1517.952 where: short stacking energy: -760.408 Base-Backbone interact. energy: -2.992 local terms energy: -939.683963 where: bonds (distance) C4'-P energy: -200.400 bonds (distance) P-C4' energy: -202.628 flat angles C4'-P-C4' energy: -207.390 flat angles P-C4'-P energy: -125.235 tors. eta vs tors. theta energy: -204.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -2309.487950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2309.487950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2309.487950 (E_RNA) where: Base-Base interactions energy: -1439.714 where: short stacking energy: -745.143 Base-Backbone interact. energy: -0.951 local terms energy: -868.822732 where: bonds (distance) C4'-P energy: -173.974 bonds (distance) P-C4' energy: -188.630 flat angles C4'-P-C4' energy: -197.712 flat angles P-C4'-P energy: -125.962 tors. eta vs tors. theta energy: -182.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1965.328737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1965.328737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1965.328737 (E_RNA) where: Base-Base interactions energy: -1186.202 where: short stacking energy: -633.250 Base-Backbone interact. energy: 3.574 local terms energy: -782.700936 where: bonds (distance) C4'-P energy: -164.225 bonds (distance) P-C4' energy: -183.942 flat angles C4'-P-C4' energy: -181.077 flat angles P-C4'-P energy: -109.297 tors. eta vs tors. theta energy: -144.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -2063.498680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2063.498680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2063.498680 (E_RNA) where: Base-Base interactions energy: -1285.114 where: short stacking energy: -608.355 Base-Backbone interact. energy: -4.161 local terms energy: -774.223744 where: bonds (distance) C4'-P energy: -156.024 bonds (distance) P-C4' energy: -170.487 flat angles C4'-P-C4' energy: -189.243 flat angles P-C4'-P energy: -125.034 tors. eta vs tors. theta energy: -133.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1809.109473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1809.109473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.109473 (E_RNA) where: Base-Base interactions energy: -1127.749 where: short stacking energy: -598.525 Base-Backbone interact. energy: -3.235 local terms energy: -678.125451 where: bonds (distance) C4'-P energy: -147.442 bonds (distance) P-C4' energy: -171.413 flat angles C4'-P-C4' energy: -160.526 flat angles P-C4'-P energy: -88.223 tors. eta vs tors. theta energy: -110.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1552.304219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1552.304219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1552.304219 (E_RNA) where: Base-Base interactions energy: -878.279 where: short stacking energy: -482.330 Base-Backbone interact. energy: -4.940 local terms energy: -669.085516 where: bonds (distance) C4'-P energy: -157.659 bonds (distance) P-C4' energy: -174.861 flat angles C4'-P-C4' energy: -150.128 flat angles P-C4'-P energy: -94.063 tors. eta vs tors. theta energy: -92.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1374.493233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.493233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.493233 (E_RNA) where: Base-Base interactions energy: -735.226 where: short stacking energy: -444.284 Base-Backbone interact. energy: 3.074 local terms energy: -642.341795 where: bonds (distance) C4'-P energy: -151.884 bonds (distance) P-C4' energy: -158.211 flat angles C4'-P-C4' energy: -158.498 flat angles P-C4'-P energy: -101.036 tors. eta vs tors. theta energy: -72.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1162.173557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.173557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.173557 (E_RNA) where: Base-Base interactions energy: -586.900 where: short stacking energy: -359.655 Base-Backbone interact. energy: 3.045 local terms energy: -578.318439 where: bonds (distance) C4'-P energy: -150.891 bonds (distance) P-C4' energy: -149.245 flat angles C4'-P-C4' energy: -139.439 flat angles P-C4'-P energy: -104.005 tors. eta vs tors. theta energy: -34.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1124.934602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.934602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.934602 (E_RNA) where: Base-Base interactions energy: -543.183 where: short stacking energy: -308.950 Base-Backbone interact. energy: -2.066 local terms energy: -579.685803 where: bonds (distance) C4'-P energy: -152.857 bonds (distance) P-C4' energy: -161.580 flat angles C4'-P-C4' energy: -153.176 flat angles P-C4'-P energy: -84.639 tors. eta vs tors. theta energy: -27.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -868.902489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.902489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.902489 (E_RNA) where: Base-Base interactions energy: -400.283 where: short stacking energy: -236.347 Base-Backbone interact. energy: -2.651 local terms energy: -465.968356 where: bonds (distance) C4'-P energy: -128.660 bonds (distance) P-C4' energy: -149.184 flat angles C4'-P-C4' energy: -142.285 flat angles P-C4'-P energy: -64.284 tors. eta vs tors. theta energy: 18.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2467.579924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2467.579924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2467.579924 (E_RNA) where: Base-Base interactions energy: -1576.933 where: short stacking energy: -814.258 Base-Backbone interact. energy: 0.483 local terms energy: -891.130309 where: bonds (distance) C4'-P energy: -184.840 bonds (distance) P-C4' energy: -171.781 flat angles C4'-P-C4' energy: -208.233 flat angles P-C4'-P energy: -120.945 tors. eta vs tors. theta energy: -205.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -2321.643048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2321.643048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2321.643048 (E_RNA) where: Base-Base interactions energy: -1482.438 where: short stacking energy: -754.364 Base-Backbone interact. energy: -2.159 local terms energy: -837.045834 where: bonds (distance) C4'-P energy: -154.871 bonds (distance) P-C4' energy: -188.630 flat angles C4'-P-C4' energy: -201.276 flat angles P-C4'-P energy: -116.487 tors. eta vs tors. theta energy: -175.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -2289.115491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2289.115491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2289.115491 (E_RNA) where: Base-Base interactions energy: -1471.599 where: short stacking energy: -740.775 Base-Backbone interact. energy: -4.764 local terms energy: -812.752452 where: bonds (distance) C4'-P energy: -172.330 bonds (distance) P-C4' energy: -168.765 flat angles C4'-P-C4' energy: -184.532 flat angles P-C4'-P energy: -103.119 tors. eta vs tors. theta energy: -184.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1898.344866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1898.344866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1898.344866 (E_RNA) where: Base-Base interactions energy: -1120.318 where: short stacking energy: -606.785 Base-Backbone interact. energy: -3.684 local terms energy: -774.342856 where: bonds (distance) C4'-P energy: -163.809 bonds (distance) P-C4' energy: -178.946 flat angles C4'-P-C4' energy: -195.331 flat angles P-C4'-P energy: -102.327 tors. eta vs tors. theta energy: -133.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1749.669875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1749.669875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1749.669875 (E_RNA) where: Base-Base interactions energy: -1043.238 where: short stacking energy: -507.386 Base-Backbone interact. energy: 8.474 local terms energy: -714.906104 where: bonds (distance) C4'-P energy: -176.865 bonds (distance) P-C4' energy: -168.641 flat angles C4'-P-C4' energy: -159.749 flat angles P-C4'-P energy: -115.119 tors. eta vs tors. theta energy: -94.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1611.225737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1611.225737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1611.225737 (E_RNA) where: Base-Base interactions energy: -944.546 where: short stacking energy: -487.657 Base-Backbone interact. energy: -1.107 local terms energy: -665.572938 where: bonds (distance) C4'-P energy: -168.108 bonds (distance) P-C4' energy: -179.485 flat angles C4'-P-C4' energy: -131.840 flat angles P-C4'-P energy: -92.282 tors. eta vs tors. theta energy: -93.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1457.050419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.050419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.050419 (E_RNA) where: Base-Base interactions energy: -843.512 where: short stacking energy: -423.192 Base-Backbone interact. energy: 2.238 local terms energy: -615.776613 where: bonds (distance) C4'-P energy: -150.021 bonds (distance) P-C4' energy: -169.444 flat angles C4'-P-C4' energy: -168.430 flat angles P-C4'-P energy: -78.858 tors. eta vs tors. theta energy: -49.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1235.752294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.752294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1235.752294 (E_RNA) where: Base-Base interactions energy: -651.456 where: short stacking energy: -373.677 Base-Backbone interact. energy: 1.473 local terms energy: -585.769378 where: bonds (distance) C4'-P energy: -157.656 bonds (distance) P-C4' energy: -142.832 flat angles C4'-P-C4' energy: -144.649 flat angles P-C4'-P energy: -99.871 tors. eta vs tors. theta energy: -40.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1159.119492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.119492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.119492 (E_RNA) where: Base-Base interactions energy: -576.912 where: short stacking energy: -323.053 Base-Backbone interact. energy: 4.465 local terms energy: -586.672528 where: bonds (distance) C4'-P energy: -165.103 bonds (distance) P-C4' energy: -164.615 flat angles C4'-P-C4' energy: -137.539 flat angles P-C4'-P energy: -82.564 tors. eta vs tors. theta energy: -36.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -836.430200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.430200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.430200 (E_RNA) where: Base-Base interactions energy: -385.408 where: short stacking energy: -264.528 Base-Backbone interact. energy: 3.126 local terms energy: -454.148192 where: bonds (distance) C4'-P energy: -143.648 bonds (distance) P-C4' energy: -146.748 flat angles C4'-P-C4' energy: -113.408 flat angles P-C4'-P energy: -78.809 tors. eta vs tors. theta energy: 28.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2540.511386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2540.511386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2540.511386 (E_RNA) where: Base-Base interactions energy: -1632.409 where: short stacking energy: -798.157 Base-Backbone interact. energy: -1.799 local terms energy: -906.303209 where: bonds (distance) C4'-P energy: -189.223 bonds (distance) P-C4' energy: -186.883 flat angles C4'-P-C4' energy: -200.974 flat angles P-C4'-P energy: -126.224 tors. eta vs tors. theta energy: -202.999 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -2433.986614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2433.986614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2433.986614 (E_RNA) where: Base-Base interactions energy: -1590.649 where: short stacking energy: -787.160 Base-Backbone interact. energy: 0.518 local terms energy: -843.855970 where: bonds (distance) C4'-P energy: -163.299 bonds (distance) P-C4' energy: -164.872 flat angles C4'-P-C4' energy: -198.131 flat angles P-C4'-P energy: -123.094 tors. eta vs tors. theta energy: -194.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -2255.609080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2255.609080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2255.609080 (E_RNA) where: Base-Base interactions energy: -1426.325 where: short stacking energy: -723.831 Base-Backbone interact. energy: -4.213 local terms energy: -825.071113 where: bonds (distance) C4'-P energy: -167.433 bonds (distance) P-C4' energy: -190.056 flat angles C4'-P-C4' energy: -179.261 flat angles P-C4'-P energy: -121.129 tors. eta vs tors. theta energy: -167.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1853.113322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1853.113322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1853.113322 (E_RNA) where: Base-Base interactions energy: -1080.484 where: short stacking energy: -586.041 Base-Backbone interact. energy: -3.541 local terms energy: -769.089056 where: bonds (distance) C4'-P energy: -163.382 bonds (distance) P-C4' energy: -180.174 flat angles C4'-P-C4' energy: -179.558 flat angles P-C4'-P energy: -111.163 tors. eta vs tors. theta energy: -134.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1879.034420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1879.034420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1879.034420 (E_RNA) where: Base-Base interactions energy: -1137.254 where: short stacking energy: -601.741 Base-Backbone interact. energy: -1.218 local terms energy: -740.562157 where: bonds (distance) C4'-P energy: -170.247 bonds (distance) P-C4' energy: -154.535 flat angles C4'-P-C4' energy: -178.354 flat angles P-C4'-P energy: -116.755 tors. eta vs tors. theta energy: -120.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1720.446427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1720.446427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1720.446427 (E_RNA) where: Base-Base interactions energy: -1035.413 where: short stacking energy: -554.627 Base-Backbone interact. energy: -0.855 local terms energy: -684.178504 where: bonds (distance) C4'-P energy: -155.744 bonds (distance) P-C4' energy: -159.990 flat angles C4'-P-C4' energy: -166.422 flat angles P-C4'-P energy: -100.632 tors. eta vs tors. theta energy: -101.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1603.964601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1603.964601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1603.964601 (E_RNA) where: Base-Base interactions energy: -979.172 where: short stacking energy: -499.247 Base-Backbone interact. energy: -3.493 local terms energy: -621.299327 where: bonds (distance) C4'-P energy: -137.573 bonds (distance) P-C4' energy: -165.799 flat angles C4'-P-C4' energy: -158.845 flat angles P-C4'-P energy: -97.761 tors. eta vs tors. theta energy: -61.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1300.102201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.102201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.102201 (E_RNA) where: Base-Base interactions energy: -745.389 where: short stacking energy: -409.635 Base-Backbone interact. energy: 5.321 local terms energy: -560.033903 where: bonds (distance) C4'-P energy: -147.256 bonds (distance) P-C4' energy: -157.188 flat angles C4'-P-C4' energy: -134.583 flat angles P-C4'-P energy: -89.375 tors. eta vs tors. theta energy: -31.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1276.047905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.047905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.047905 (E_RNA) where: Base-Base interactions energy: -736.097 where: short stacking energy: -374.169 Base-Backbone interact. energy: 1.626 local terms energy: -541.577171 where: bonds (distance) C4'-P energy: -155.628 bonds (distance) P-C4' energy: -153.314 flat angles C4'-P-C4' energy: -137.661 flat angles P-C4'-P energy: -75.004 tors. eta vs tors. theta energy: -19.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -869.136784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.136784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.136784 (E_RNA) where: Base-Base interactions energy: -391.463 where: short stacking energy: -279.066 Base-Backbone interact. energy: -0.072 local terms energy: -477.601486 where: bonds (distance) C4'-P energy: -122.730 bonds (distance) P-C4' energy: -165.249 flat angles C4'-P-C4' energy: -124.127 flat angles P-C4'-P energy: -84.419 tors. eta vs tors. theta energy: 18.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2546.131264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2546.131264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2546.131264 (E_RNA) where: Base-Base interactions energy: -1642.525 where: short stacking energy: -817.844 Base-Backbone interact. energy: -1.372 local terms energy: -902.234819 where: bonds (distance) C4'-P energy: -171.097 bonds (distance) P-C4' energy: -184.496 flat angles C4'-P-C4' energy: -196.872 flat angles P-C4'-P energy: -140.659 tors. eta vs tors. theta energy: -209.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -2433.661928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2433.661928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2433.661928 (E_RNA) where: Base-Base interactions energy: -1559.960 where: short stacking energy: -733.141 Base-Backbone interact. energy: -1.216 local terms energy: -872.486246 where: bonds (distance) C4'-P energy: -173.241 bonds (distance) P-C4' energy: -198.351 flat angles C4'-P-C4' energy: -193.793 flat angles P-C4'-P energy: -126.123 tors. eta vs tors. theta energy: -180.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -2262.702536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2262.702536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.702536 (E_RNA) where: Base-Base interactions energy: -1424.332 where: short stacking energy: -732.526 Base-Backbone interact. energy: -5.841 local terms energy: -832.528736 where: bonds (distance) C4'-P energy: -174.727 bonds (distance) P-C4' energy: -192.408 flat angles C4'-P-C4' energy: -182.672 flat angles P-C4'-P energy: -103.174 tors. eta vs tors. theta energy: -179.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1919.318181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1919.318181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1919.318181 (E_RNA) where: Base-Base interactions energy: -1193.875 where: short stacking energy: -648.272 Base-Backbone interact. energy: -0.230 local terms energy: -725.213818 where: bonds (distance) C4'-P energy: -165.461 bonds (distance) P-C4' energy: -160.183 flat angles C4'-P-C4' energy: -178.457 flat angles P-C4'-P energy: -94.219 tors. eta vs tors. theta energy: -126.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1958.240967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1958.240967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1958.240967 (E_RNA) where: Base-Base interactions energy: -1186.750 where: short stacking energy: -623.784 Base-Backbone interact. energy: -3.015 local terms energy: -768.476416 where: bonds (distance) C4'-P energy: -155.401 bonds (distance) P-C4' energy: -173.471 flat angles C4'-P-C4' energy: -183.607 flat angles P-C4'-P energy: -116.710 tors. eta vs tors. theta energy: -139.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1731.714419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.714419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.714419 (E_RNA) where: Base-Base interactions energy: -1042.441 where: short stacking energy: -556.556 Base-Backbone interact. energy: 4.472 local terms energy: -693.744565 where: bonds (distance) C4'-P energy: -153.881 bonds (distance) P-C4' energy: -170.291 flat angles C4'-P-C4' energy: -159.317 flat angles P-C4'-P energy: -103.283 tors. eta vs tors. theta energy: -106.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1575.660185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1575.660185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1575.660185 (E_RNA) where: Base-Base interactions energy: -963.092 where: short stacking energy: -499.125 Base-Backbone interact. energy: 2.694 local terms energy: -615.262307 where: bonds (distance) C4'-P energy: -141.234 bonds (distance) P-C4' energy: -149.831 flat angles C4'-P-C4' energy: -152.105 flat angles P-C4'-P energy: -102.879 tors. eta vs tors. theta energy: -69.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1251.861452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.861452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.861452 (E_RNA) where: Base-Base interactions energy: -701.617 where: short stacking energy: -364.136 Base-Backbone interact. energy: 3.905 local terms energy: -554.150104 where: bonds (distance) C4'-P energy: -149.128 bonds (distance) P-C4' energy: -157.327 flat angles C4'-P-C4' energy: -126.629 flat angles P-C4'-P energy: -86.651 tors. eta vs tors. theta energy: -34.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -1222.001075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.001075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.001075 (E_RNA) where: Base-Base interactions energy: -684.188 where: short stacking energy: -355.820 Base-Backbone interact. energy: 1.420 local terms energy: -539.232750 where: bonds (distance) C4'-P energy: -146.360 bonds (distance) P-C4' energy: -162.870 flat angles C4'-P-C4' energy: -122.054 flat angles P-C4'-P energy: -83.743 tors. eta vs tors. theta energy: -24.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -873.468442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.468442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.468442 (E_RNA) where: Base-Base interactions energy: -418.052 where: short stacking energy: -260.467 Base-Backbone interact. energy: -2.168 local terms energy: -453.248391 where: bonds (distance) C4'-P energy: -136.390 bonds (distance) P-C4' energy: -149.359 flat angles C4'-P-C4' energy: -106.359 flat angles P-C4'-P energy: -67.966 tors. eta vs tors. theta energy: 6.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2540.944669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2540.944669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2540.944669 (E_RNA) where: Base-Base interactions energy: -1624.029 where: short stacking energy: -807.786 Base-Backbone interact. energy: -4.265 local terms energy: -912.650801 where: bonds (distance) C4'-P energy: -182.324 bonds (distance) P-C4' energy: -195.519 flat angles C4'-P-C4' energy: -200.328 flat angles P-C4'-P energy: -127.047 tors. eta vs tors. theta energy: -207.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -2547.047875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2547.047875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2547.047875 (E_RNA) where: Base-Base interactions energy: -1639.600 where: short stacking energy: -816.990 Base-Backbone interact. energy: -3.930 local terms energy: -903.518405 where: bonds (distance) C4'-P energy: -177.154 bonds (distance) P-C4' energy: -186.210 flat angles C4'-P-C4' energy: -201.426 flat angles P-C4'-P energy: -115.743 tors. eta vs tors. theta energy: -222.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -2198.091410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2198.091410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2198.091410 (E_RNA) where: Base-Base interactions energy: -1379.669 where: short stacking energy: -739.823 Base-Backbone interact. energy: 2.633 local terms energy: -821.054836 where: bonds (distance) C4'-P energy: -172.797 bonds (distance) P-C4' energy: -180.979 flat angles C4'-P-C4' energy: -182.347 flat angles P-C4'-P energy: -101.496 tors. eta vs tors. theta energy: -183.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -2019.877689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2019.877689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2019.877689 (E_RNA) where: Base-Base interactions energy: -1243.347 where: short stacking energy: -649.579 Base-Backbone interact. energy: -0.800 local terms energy: -775.729813 where: bonds (distance) C4'-P energy: -170.312 bonds (distance) P-C4' energy: -184.470 flat angles C4'-P-C4' energy: -171.337 flat angles P-C4'-P energy: -104.640 tors. eta vs tors. theta energy: -144.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1918.376825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1918.376825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1918.376825 (E_RNA) where: Base-Base interactions energy: -1188.134 where: short stacking energy: -623.961 Base-Backbone interact. energy: -0.799 local terms energy: -729.443598 where: bonds (distance) C4'-P energy: -161.638 bonds (distance) P-C4' energy: -162.837 flat angles C4'-P-C4' energy: -167.653 flat angles P-C4'-P energy: -89.612 tors. eta vs tors. theta energy: -147.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1738.740022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1738.740022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.740022 (E_RNA) where: Base-Base interactions energy: -1069.768 where: short stacking energy: -535.410 Base-Backbone interact. energy: -2.806 local terms energy: -666.166058 where: bonds (distance) C4'-P energy: -142.293 bonds (distance) P-C4' energy: -166.763 flat angles C4'-P-C4' energy: -177.299 flat angles P-C4'-P energy: -91.261 tors. eta vs tors. theta energy: -88.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1548.108549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1548.108549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1548.108549 (E_RNA) where: Base-Base interactions energy: -924.358 where: short stacking energy: -475.853 Base-Backbone interact. energy: 0.379 local terms energy: -624.129999 where: bonds (distance) C4'-P energy: -154.167 bonds (distance) P-C4' energy: -146.140 flat angles C4'-P-C4' energy: -157.555 flat angles P-C4'-P energy: -84.910 tors. eta vs tors. theta energy: -81.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1300.995681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.995681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.995681 (E_RNA) where: Base-Base interactions energy: -727.270 where: short stacking energy: -381.586 Base-Backbone interact. energy: -1.932 local terms energy: -571.793871 where: bonds (distance) C4'-P energy: -160.787 bonds (distance) P-C4' energy: -146.178 flat angles C4'-P-C4' energy: -138.256 flat angles P-C4'-P energy: -68.096 tors. eta vs tors. theta energy: -58.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1239.482999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.482999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.482999 (E_RNA) where: Base-Base interactions energy: -669.900 where: short stacking energy: -349.120 Base-Backbone interact. energy: 0.311 local terms energy: -569.894383 where: bonds (distance) C4'-P energy: -144.805 bonds (distance) P-C4' energy: -146.370 flat angles C4'-P-C4' energy: -149.816 flat angles P-C4'-P energy: -94.292 tors. eta vs tors. theta energy: -34.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -845.627381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.627381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.627381 (E_RNA) where: Base-Base interactions energy: -378.750 where: short stacking energy: -236.014 Base-Backbone interact. energy: 3.907 local terms energy: -470.784648 where: bonds (distance) C4'-P energy: -146.203 bonds (distance) P-C4' energy: -144.896 flat angles C4'-P-C4' energy: -106.234 flat angles P-C4'-P energy: -93.735 tors. eta vs tors. theta energy: 20.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2623.721749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2623.721749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2623.721749 (E_RNA) where: Base-Base interactions energy: -1689.817 where: short stacking energy: -811.321 Base-Backbone interact. energy: -3.069 local terms energy: -930.835726 where: bonds (distance) C4'-P energy: -183.558 bonds (distance) P-C4' energy: -189.566 flat angles C4'-P-C4' energy: -207.755 flat angles P-C4'-P energy: -143.449 tors. eta vs tors. theta energy: -206.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2424.265194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2424.265194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2424.265194 (E_RNA) where: Base-Base interactions energy: -1539.831 where: short stacking energy: -770.537 Base-Backbone interact. energy: 0.509 local terms energy: -884.943262 where: bonds (distance) C4'-P energy: -173.233 bonds (distance) P-C4' energy: -189.537 flat angles C4'-P-C4' energy: -202.595 flat angles P-C4'-P energy: -131.880 tors. eta vs tors. theta energy: -187.699 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -2247.094575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2247.094575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2247.094575 (E_RNA) where: Base-Base interactions energy: -1397.052 where: short stacking energy: -720.441 Base-Backbone interact. energy: -1.149 local terms energy: -848.893393 where: bonds (distance) C4'-P energy: -178.501 bonds (distance) P-C4' energy: -181.228 flat angles C4'-P-C4' energy: -193.031 flat angles P-C4'-P energy: -122.307 tors. eta vs tors. theta energy: -173.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1985.386624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1985.386624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1985.386624 (E_RNA) where: Base-Base interactions energy: -1217.776 where: short stacking energy: -607.474 Base-Backbone interact. energy: -4.057 local terms energy: -763.553853 where: bonds (distance) C4'-P energy: -159.896 bonds (distance) P-C4' energy: -191.639 flat angles C4'-P-C4' energy: -180.649 flat angles P-C4'-P energy: -101.060 tors. eta vs tors. theta energy: -130.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1928.398809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.398809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.398809 (E_RNA) where: Base-Base interactions energy: -1151.592 where: short stacking energy: -619.249 Base-Backbone interact. energy: -2.163 local terms energy: -774.643752 where: bonds (distance) C4'-P energy: -143.529 bonds (distance) P-C4' energy: -186.634 flat angles C4'-P-C4' energy: -194.805 flat angles P-C4'-P energy: -103.805 tors. eta vs tors. theta energy: -145.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1808.706887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1808.706887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1808.706887 (E_RNA) where: Base-Base interactions energy: -1103.811 where: short stacking energy: -531.678 Base-Backbone interact. energy: -2.746 local terms energy: -702.149654 where: bonds (distance) C4'-P energy: -148.769 bonds (distance) P-C4' energy: -192.424 flat angles C4'-P-C4' energy: -156.322 flat angles P-C4'-P energy: -107.850 tors. eta vs tors. theta energy: -96.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1539.268196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1539.268196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.268196 (E_RNA) where: Base-Base interactions energy: -896.954 where: short stacking energy: -468.198 Base-Backbone interact. energy: 1.010 local terms energy: -643.324370 where: bonds (distance) C4'-P energy: -158.283 bonds (distance) P-C4' energy: -158.958 flat angles C4'-P-C4' energy: -146.686 flat angles P-C4'-P energy: -96.126 tors. eta vs tors. theta energy: -83.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1430.904314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.904314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.904314 (E_RNA) where: Base-Base interactions energy: -853.778 where: short stacking energy: -438.231 Base-Backbone interact. energy: -1.714 local terms energy: -575.411900 where: bonds (distance) C4'-P energy: -140.196 bonds (distance) P-C4' energy: -153.929 flat angles C4'-P-C4' energy: -134.218 flat angles P-C4'-P energy: -95.054 tors. eta vs tors. theta energy: -52.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1154.988587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.988587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.988587 (E_RNA) where: Base-Base interactions energy: -603.322 where: short stacking energy: -330.329 Base-Backbone interact. energy: -4.441 local terms energy: -547.225316 where: bonds (distance) C4'-P energy: -159.803 bonds (distance) P-C4' energy: -150.974 flat angles C4'-P-C4' energy: -128.300 flat angles P-C4'-P energy: -88.855 tors. eta vs tors. theta energy: -19.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -799.301596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.301596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.301596 (E_RNA) where: Base-Base interactions energy: -338.874 where: short stacking energy: -209.088 Base-Backbone interact. energy: -2.565 local terms energy: -457.862688 where: bonds (distance) C4'-P energy: -129.657 bonds (distance) P-C4' energy: -166.329 flat angles C4'-P-C4' energy: -116.116 flat angles P-C4'-P energy: -50.358 tors. eta vs tors. theta energy: 4.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2683.573734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2683.573734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2683.573734 (E_RNA) where: Base-Base interactions energy: -1742.360 where: short stacking energy: -870.132 Base-Backbone interact. energy: -2.787 local terms energy: -938.426739 where: bonds (distance) C4'-P energy: -177.434 bonds (distance) P-C4' energy: -187.898 flat angles C4'-P-C4' energy: -200.898 flat angles P-C4'-P energy: -143.068 tors. eta vs tors. theta energy: -229.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2394.008040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2394.008040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2394.008040 (E_RNA) where: Base-Base interactions energy: -1552.039 where: short stacking energy: -821.040 Base-Backbone interact. energy: -3.606 local terms energy: -838.362963 where: bonds (distance) C4'-P energy: -162.738 bonds (distance) P-C4' energy: -180.409 flat angles C4'-P-C4' energy: -187.090 flat angles P-C4'-P energy: -107.045 tors. eta vs tors. theta energy: -201.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -2246.181054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2246.181054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2246.181054 (E_RNA) where: Base-Base interactions energy: -1423.333 where: short stacking energy: -727.050 Base-Backbone interact. energy: -1.471 local terms energy: -821.377781 where: bonds (distance) C4'-P energy: -170.558 bonds (distance) P-C4' energy: -183.317 flat angles C4'-P-C4' energy: -187.517 flat angles P-C4'-P energy: -119.370 tors. eta vs tors. theta energy: -160.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -2033.204208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.204208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.204208 (E_RNA) where: Base-Base interactions energy: -1243.390 where: short stacking energy: -677.631 Base-Backbone interact. energy: 2.190 local terms energy: -792.004854 where: bonds (distance) C4'-P energy: -149.468 bonds (distance) P-C4' energy: -182.972 flat angles C4'-P-C4' energy: -205.094 flat angles P-C4'-P energy: -99.407 tors. eta vs tors. theta energy: -155.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1915.200866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.200866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.200866 (E_RNA) where: Base-Base interactions energy: -1187.741 where: short stacking energy: -628.840 Base-Backbone interact. energy: -1.409 local terms energy: -726.050712 where: bonds (distance) C4'-P energy: -144.000 bonds (distance) P-C4' energy: -163.463 flat angles C4'-P-C4' energy: -171.188 flat angles P-C4'-P energy: -109.175 tors. eta vs tors. theta energy: -138.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1776.419560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.419560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.419560 (E_RNA) where: Base-Base interactions energy: -1114.301 where: short stacking energy: -543.182 Base-Backbone interact. energy: -0.073 local terms energy: -662.044765 where: bonds (distance) C4'-P energy: -164.109 bonds (distance) P-C4' energy: -166.426 flat angles C4'-P-C4' energy: -139.957 flat angles P-C4'-P energy: -79.549 tors. eta vs tors. theta energy: -112.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1512.588329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.588329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1512.588329 (E_RNA) where: Base-Base interactions energy: -895.673 where: short stacking energy: -448.886 Base-Backbone interact. energy: 3.645 local terms energy: -620.560023 where: bonds (distance) C4'-P energy: -136.915 bonds (distance) P-C4' energy: -169.146 flat angles C4'-P-C4' energy: -163.086 flat angles P-C4'-P energy: -97.058 tors. eta vs tors. theta energy: -54.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1522.339521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.339521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.339521 (E_RNA) where: Base-Base interactions energy: -907.689 where: short stacking energy: -455.834 Base-Backbone interact. energy: -1.819 local terms energy: -612.831239 where: bonds (distance) C4'-P energy: -147.119 bonds (distance) P-C4' energy: -134.204 flat angles C4'-P-C4' energy: -167.414 flat angles P-C4'-P energy: -83.684 tors. eta vs tors. theta energy: -80.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1244.233088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.233088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.233088 (E_RNA) where: Base-Base interactions energy: -719.764 where: short stacking energy: -380.192 Base-Backbone interact. energy: 4.977 local terms energy: -529.445440 where: bonds (distance) C4'-P energy: -140.202 bonds (distance) P-C4' energy: -142.409 flat angles C4'-P-C4' energy: -142.433 flat angles P-C4'-P energy: -76.660 tors. eta vs tors. theta energy: -27.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -952.230131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -952.230131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -952.230131 (E_RNA) where: Base-Base interactions energy: -443.222 where: short stacking energy: -291.265 Base-Backbone interact. energy: -1.639 local terms energy: -507.368459 where: bonds (distance) C4'-P energy: -145.758 bonds (distance) P-C4' energy: -165.669 flat angles C4'-P-C4' energy: -114.124 flat angles P-C4'-P energy: -82.084 tors. eta vs tors. theta energy: 0.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2736.737571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2736.737571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2736.737571 (E_RNA) where: Base-Base interactions energy: -1802.573 where: short stacking energy: -911.872 Base-Backbone interact. energy: -5.301 local terms energy: -928.863719 where: bonds (distance) C4'-P energy: -173.910 bonds (distance) P-C4' energy: -189.179 flat angles C4'-P-C4' energy: -205.046 flat angles P-C4'-P energy: -128.076 tors. eta vs tors. theta energy: -232.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -2373.833490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2373.833490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2373.833490 (E_RNA) where: Base-Base interactions energy: -1514.233 where: short stacking energy: -755.875 Base-Backbone interact. energy: -2.320 local terms energy: -857.280479 where: bonds (distance) C4'-P energy: -187.204 bonds (distance) P-C4' energy: -177.215 flat angles C4'-P-C4' energy: -181.054 flat angles P-C4'-P energy: -123.325 tors. eta vs tors. theta energy: -188.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -2256.782019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2256.782019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2256.782019 (E_RNA) where: Base-Base interactions energy: -1413.148 where: short stacking energy: -690.762 Base-Backbone interact. energy: -3.202 local terms energy: -840.432172 where: bonds (distance) C4'-P energy: -191.770 bonds (distance) P-C4' energy: -195.265 flat angles C4'-P-C4' energy: -175.005 flat angles P-C4'-P energy: -117.200 tors. eta vs tors. theta energy: -161.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -2043.194130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2043.194130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2043.194130 (E_RNA) where: Base-Base interactions energy: -1214.633 where: short stacking energy: -634.515 Base-Backbone interact. energy: -2.635 local terms energy: -825.925991 where: bonds (distance) C4'-P energy: -171.454 bonds (distance) P-C4' energy: -162.927 flat angles C4'-P-C4' energy: -205.909 flat angles P-C4'-P energy: -123.464 tors. eta vs tors. theta energy: -162.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1854.162088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1854.162088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1854.162088 (E_RNA) where: Base-Base interactions energy: -1107.571 where: short stacking energy: -595.118 Base-Backbone interact. energy: -3.997 local terms energy: -742.593653 where: bonds (distance) C4'-P energy: -154.368 bonds (distance) P-C4' energy: -182.180 flat angles C4'-P-C4' energy: -163.582 flat angles P-C4'-P energy: -107.980 tors. eta vs tors. theta energy: -134.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1833.447703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1833.447703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1833.447703 (E_RNA) where: Base-Base interactions energy: -1144.995 where: short stacking energy: -565.035 Base-Backbone interact. energy: -0.183 local terms energy: -688.269682 where: bonds (distance) C4'-P energy: -159.999 bonds (distance) P-C4' energy: -165.682 flat angles C4'-P-C4' energy: -156.904 flat angles P-C4'-P energy: -102.539 tors. eta vs tors. theta energy: -103.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1512.708924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.708924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1512.708924 (E_RNA) where: Base-Base interactions energy: -899.960 where: short stacking energy: -439.008 Base-Backbone interact. energy: 0.828 local terms energy: -613.577278 where: bonds (distance) C4'-P energy: -151.635 bonds (distance) P-C4' energy: -163.522 flat angles C4'-P-C4' energy: -145.971 flat angles P-C4'-P energy: -93.865 tors. eta vs tors. theta energy: -58.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1530.402841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.402841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1530.402841 (E_RNA) where: Base-Base interactions energy: -900.982 where: short stacking energy: -462.372 Base-Backbone interact. energy: -1.934 local terms energy: -627.486411 where: bonds (distance) C4'-P energy: -133.051 bonds (distance) P-C4' energy: -145.986 flat angles C4'-P-C4' energy: -153.449 flat angles P-C4'-P energy: -99.976 tors. eta vs tors. theta energy: -95.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1260.473848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1260.473848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1260.473848 (E_RNA) where: Base-Base interactions energy: -745.388 where: short stacking energy: -365.077 Base-Backbone interact. energy: -0.484 local terms energy: -514.601802 where: bonds (distance) C4'-P energy: -135.430 bonds (distance) P-C4' energy: -151.054 flat angles C4'-P-C4' energy: -134.956 flat angles P-C4'-P energy: -86.594 tors. eta vs tors. theta energy: -6.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -860.285803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.285803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.285803 (E_RNA) where: Base-Base interactions energy: -391.114 where: short stacking energy: -259.634 Base-Backbone interact. energy: 1.719 local terms energy: -470.890916 where: bonds (distance) C4'-P energy: -127.806 bonds (distance) P-C4' energy: -147.458 flat angles C4'-P-C4' energy: -116.038 flat angles P-C4'-P energy: -83.311 tors. eta vs tors. theta energy: 3.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2684.018839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2684.018839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2684.018839 (E_RNA) where: Base-Base interactions energy: -1758.080 where: short stacking energy: -853.340 Base-Backbone interact. energy: -7.355 local terms energy: -918.583825 where: bonds (distance) C4'-P energy: -171.932 bonds (distance) P-C4' energy: -190.832 flat angles C4'-P-C4' energy: -203.429 flat angles P-C4'-P energy: -133.509 tors. eta vs tors. theta energy: -218.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -2364.661010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2364.661010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2364.661010 (E_RNA) where: Base-Base interactions energy: -1484.212 where: short stacking energy: -735.866 Base-Backbone interact. energy: -4.507 local terms energy: -875.942760 where: bonds (distance) C4'-P energy: -179.256 bonds (distance) P-C4' energy: -185.822 flat angles C4'-P-C4' energy: -196.518 flat angles P-C4'-P energy: -138.184 tors. eta vs tors. theta energy: -176.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -2294.446993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2294.446993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2294.446993 (E_RNA) where: Base-Base interactions energy: -1482.693 where: short stacking energy: -718.091 Base-Backbone interact. energy: -3.507 local terms energy: -808.246545 where: bonds (distance) C4'-P energy: -176.761 bonds (distance) P-C4' energy: -165.992 flat angles C4'-P-C4' energy: -196.375 flat angles P-C4'-P energy: -112.797 tors. eta vs tors. theta energy: -156.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -2042.153456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2042.153456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2042.153456 (E_RNA) where: Base-Base interactions energy: -1269.694 where: short stacking energy: -639.411 Base-Backbone interact. energy: 1.808 local terms energy: -774.267758 where: bonds (distance) C4'-P energy: -168.357 bonds (distance) P-C4' energy: -163.617 flat angles C4'-P-C4' energy: -171.355 flat angles P-C4'-P energy: -127.274 tors. eta vs tors. theta energy: -143.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1944.352202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1944.352202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1944.352202 (E_RNA) where: Base-Base interactions energy: -1181.463 where: short stacking energy: -596.516 Base-Backbone interact. energy: -0.530 local terms energy: -762.358840 where: bonds (distance) C4'-P energy: -155.568 bonds (distance) P-C4' energy: -179.828 flat angles C4'-P-C4' energy: -169.696 flat angles P-C4'-P energy: -112.705 tors. eta vs tors. theta energy: -144.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1773.462829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1773.462829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1773.462829 (E_RNA) where: Base-Base interactions energy: -1089.981 where: short stacking energy: -544.465 Base-Backbone interact. energy: -1.219 local terms energy: -682.261961 where: bonds (distance) C4'-P energy: -135.830 bonds (distance) P-C4' energy: -168.293 flat angles C4'-P-C4' energy: -182.466 flat angles P-C4'-P energy: -104.321 tors. eta vs tors. theta energy: -91.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1501.203558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1501.203558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1501.203558 (E_RNA) where: Base-Base interactions energy: -879.559 where: short stacking energy: -465.439 Base-Backbone interact. energy: -0.018 local terms energy: -621.626081 where: bonds (distance) C4'-P energy: -129.388 bonds (distance) P-C4' energy: -176.414 flat angles C4'-P-C4' energy: -149.070 flat angles P-C4'-P energy: -104.138 tors. eta vs tors. theta energy: -62.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1500.772727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.772727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.772727 (E_RNA) where: Base-Base interactions energy: -910.089 where: short stacking energy: -462.680 Base-Backbone interact. energy: -3.423 local terms energy: -587.261041 where: bonds (distance) C4'-P energy: -148.644 bonds (distance) P-C4' energy: -160.716 flat angles C4'-P-C4' energy: -144.271 flat angles P-C4'-P energy: -87.085 tors. eta vs tors. theta energy: -46.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1333.384935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.384935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.384935 (E_RNA) where: Base-Base interactions energy: -761.034 where: short stacking energy: -374.726 Base-Backbone interact. energy: 5.226 local terms energy: -577.577291 where: bonds (distance) C4'-P energy: -167.509 bonds (distance) P-C4' energy: -143.145 flat angles C4'-P-C4' energy: -159.648 flat angles P-C4'-P energy: -82.476 tors. eta vs tors. theta energy: -24.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -865.168619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.168619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.168619 (E_RNA) where: Base-Base interactions energy: -356.769 where: short stacking energy: -222.473 Base-Backbone interact. energy: -3.345 local terms energy: -505.054330 where: bonds (distance) C4'-P energy: -163.554 bonds (distance) P-C4' energy: -158.989 flat angles C4'-P-C4' energy: -132.783 flat angles P-C4'-P energy: -85.860 tors. eta vs tors. theta energy: 36.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2717.799380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2717.799380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2717.799380 (E_RNA) where: Base-Base interactions energy: -1793.536 where: short stacking energy: -862.253 Base-Backbone interact. energy: -2.744 local terms energy: -921.519214 where: bonds (distance) C4'-P energy: -172.273 bonds (distance) P-C4' energy: -195.904 flat angles C4'-P-C4' energy: -201.783 flat angles P-C4'-P energy: -123.279 tors. eta vs tors. theta energy: -228.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -2363.197114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2363.197114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2363.197114 (E_RNA) where: Base-Base interactions energy: -1505.483 where: short stacking energy: -746.600 Base-Backbone interact. energy: 0.141 local terms energy: -857.855314 where: bonds (distance) C4'-P energy: -168.426 bonds (distance) P-C4' energy: -182.580 flat angles C4'-P-C4' energy: -214.576 flat angles P-C4'-P energy: -125.049 tors. eta vs tors. theta energy: -167.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -2284.248413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2284.248413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2284.248413 (E_RNA) where: Base-Base interactions energy: -1478.587 where: short stacking energy: -739.466 Base-Backbone interact. energy: 2.922 local terms energy: -808.583021 where: bonds (distance) C4'-P energy: -164.661 bonds (distance) P-C4' energy: -191.776 flat angles C4'-P-C4' energy: -187.260 flat angles P-C4'-P energy: -108.568 tors. eta vs tors. theta energy: -156.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -2050.731619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2050.731619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2050.731619 (E_RNA) where: Base-Base interactions energy: -1317.829 where: short stacking energy: -689.164 Base-Backbone interact. energy: -1.293 local terms energy: -731.609001 where: bonds (distance) C4'-P energy: -153.227 bonds (distance) P-C4' energy: -169.662 flat angles C4'-P-C4' energy: -161.998 flat angles P-C4'-P energy: -83.448 tors. eta vs tors. theta energy: -163.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -2041.126444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.126444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2041.126444 (E_RNA) where: Base-Base interactions energy: -1282.560 where: short stacking energy: -654.795 Base-Backbone interact. energy: -3.743 local terms energy: -754.823127 where: bonds (distance) C4'-P energy: -159.115 bonds (distance) P-C4' energy: -163.377 flat angles C4'-P-C4' energy: -172.336 flat angles P-C4'-P energy: -108.932 tors. eta vs tors. theta energy: -151.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1764.702027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1764.702027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.702027 (E_RNA) where: Base-Base interactions energy: -1105.640 where: short stacking energy: -530.529 Base-Backbone interact. energy: -0.204 local terms energy: -658.858256 where: bonds (distance) C4'-P energy: -148.310 bonds (distance) P-C4' energy: -166.720 flat angles C4'-P-C4' energy: -163.819 flat angles P-C4'-P energy: -80.545 tors. eta vs tors. theta energy: -99.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1621.431165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1621.431165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1621.431165 (E_RNA) where: Base-Base interactions energy: -959.145 where: short stacking energy: -517.548 Base-Backbone interact. energy: 0.128 local terms energy: -662.413700 where: bonds (distance) C4'-P energy: -145.094 bonds (distance) P-C4' energy: -149.841 flat angles C4'-P-C4' energy: -182.366 flat angles P-C4'-P energy: -85.166 tors. eta vs tors. theta energy: -99.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1371.926882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.926882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.926882 (E_RNA) where: Base-Base interactions energy: -803.882 where: short stacking energy: -432.994 Base-Backbone interact. energy: 1.561 local terms energy: -569.605956 where: bonds (distance) C4'-P energy: -144.733 bonds (distance) P-C4' energy: -158.243 flat angles C4'-P-C4' energy: -143.199 flat angles P-C4'-P energy: -73.672 tors. eta vs tors. theta energy: -49.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1356.013995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.013995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.013995 (E_RNA) where: Base-Base interactions energy: -792.142 where: short stacking energy: -410.449 Base-Backbone interact. energy: 1.748 local terms energy: -565.620394 where: bonds (distance) C4'-P energy: -135.070 bonds (distance) P-C4' energy: -142.309 flat angles C4'-P-C4' energy: -147.701 flat angles P-C4'-P energy: -90.199 tors. eta vs tors. theta energy: -50.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -910.631324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.631324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.631324 (E_RNA) where: Base-Base interactions energy: -440.786 where: short stacking energy: -244.426 Base-Backbone interact. energy: -0.421 local terms energy: -469.424225 where: bonds (distance) C4'-P energy: -137.928 bonds (distance) P-C4' energy: -158.577 flat angles C4'-P-C4' energy: -137.197 flat angles P-C4'-P energy: -56.215 tors. eta vs tors. theta energy: 20.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2741.750057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2741.750057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2741.750057 (E_RNA) where: Base-Base interactions energy: -1811.624 where: short stacking energy: -889.207 Base-Backbone interact. energy: 1.154 local terms energy: -931.280060 where: bonds (distance) C4'-P energy: -171.173 bonds (distance) P-C4' energy: -184.581 flat angles C4'-P-C4' energy: -206.566 flat angles P-C4'-P energy: -135.469 tors. eta vs tors. theta energy: -233.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -2470.838870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2470.838870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2470.838870 (E_RNA) where: Base-Base interactions energy: -1574.873 where: short stacking energy: -781.391 Base-Backbone interact. energy: -5.253 local terms energy: -890.712382 where: bonds (distance) C4'-P energy: -176.102 bonds (distance) P-C4' energy: -176.505 flat angles C4'-P-C4' energy: -197.104 flat angles P-C4'-P energy: -143.214 tors. eta vs tors. theta energy: -197.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -2322.629681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2322.629681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2322.629681 (E_RNA) where: Base-Base interactions energy: -1514.142 where: short stacking energy: -697.062 Base-Backbone interact. energy: -2.740 local terms energy: -805.748031 where: bonds (distance) C4'-P energy: -168.601 bonds (distance) P-C4' energy: -177.575 flat angles C4'-P-C4' energy: -177.586 flat angles P-C4'-P energy: -110.620 tors. eta vs tors. theta energy: -171.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -2134.354414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2134.354414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2134.354414 (E_RNA) where: Base-Base interactions energy: -1348.314 where: short stacking energy: -654.814 Base-Backbone interact. energy: -1.752 local terms energy: -784.288787 where: bonds (distance) C4'-P energy: -159.591 bonds (distance) P-C4' energy: -173.426 flat angles C4'-P-C4' energy: -177.753 flat angles P-C4'-P energy: -117.943 tors. eta vs tors. theta energy: -155.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -2034.538394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2034.538394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2034.538394 (E_RNA) where: Base-Base interactions energy: -1304.195 where: short stacking energy: -630.696 Base-Backbone interact. energy: -3.078 local terms energy: -727.265353 where: bonds (distance) C4'-P energy: -148.232 bonds (distance) P-C4' energy: -162.074 flat angles C4'-P-C4' energy: -176.136 flat angles P-C4'-P energy: -98.417 tors. eta vs tors. theta energy: -142.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1867.559630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1867.559630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1867.559630 (E_RNA) where: Base-Base interactions energy: -1133.952 where: short stacking energy: -564.180 Base-Backbone interact. energy: 0.727 local terms energy: -734.334593 where: bonds (distance) C4'-P energy: -160.898 bonds (distance) P-C4' energy: -190.460 flat angles C4'-P-C4' energy: -157.712 flat angles P-C4'-P energy: -119.072 tors. eta vs tors. theta energy: -106.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1655.895453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1655.895453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1655.895453 (E_RNA) where: Base-Base interactions energy: -1009.425 where: short stacking energy: -516.986 Base-Backbone interact. energy: 6.560 local terms energy: -653.030062 where: bonds (distance) C4'-P energy: -156.554 bonds (distance) P-C4' energy: -154.526 flat angles C4'-P-C4' energy: -158.282 flat angles P-C4'-P energy: -92.152 tors. eta vs tors. theta energy: -91.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1357.146619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.146619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.146619 (E_RNA) where: Base-Base interactions energy: -764.852 where: short stacking energy: -398.372 Base-Backbone interact. energy: -1.967 local terms energy: -590.328558 where: bonds (distance) C4'-P energy: -165.435 bonds (distance) P-C4' energy: -142.911 flat angles C4'-P-C4' energy: -128.853 flat angles P-C4'-P energy: -92.191 tors. eta vs tors. theta energy: -60.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1310.634397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.634397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.634397 (E_RNA) where: Base-Base interactions energy: -744.536 where: short stacking energy: -380.904 Base-Backbone interact. energy: 0.008 local terms energy: -566.106279 where: bonds (distance) C4'-P energy: -135.779 bonds (distance) P-C4' energy: -147.284 flat angles C4'-P-C4' energy: -147.317 flat angles P-C4'-P energy: -79.477 tors. eta vs tors. theta energy: -56.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -970.542870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.542870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.542870 (E_RNA) where: Base-Base interactions energy: -509.685 where: short stacking energy: -284.893 Base-Backbone interact. energy: -0.070 local terms energy: -460.787603 where: bonds (distance) C4'-P energy: -132.496 bonds (distance) P-C4' energy: -156.465 flat angles C4'-P-C4' energy: -99.433 flat angles P-C4'-P energy: -86.976 tors. eta vs tors. theta energy: 14.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2757.791948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2757.791948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2757.791948 (E_RNA) where: Base-Base interactions energy: -1809.436 where: short stacking energy: -870.751 Base-Backbone interact. energy: -3.379 local terms energy: -944.976855 where: bonds (distance) C4'-P energy: -179.398 bonds (distance) P-C4' energy: -198.475 flat angles C4'-P-C4' energy: -211.361 flat angles P-C4'-P energy: -126.986 tors. eta vs tors. theta energy: -228.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -2458.549400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2458.549400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2458.549400 (E_RNA) where: Base-Base interactions energy: -1610.345 where: short stacking energy: -798.060 Base-Backbone interact. energy: 1.470 local terms energy: -849.674063 where: bonds (distance) C4'-P energy: -166.508 bonds (distance) P-C4' energy: -186.899 flat angles C4'-P-C4' energy: -178.262 flat angles P-C4'-P energy: -122.118 tors. eta vs tors. theta energy: -195.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -2336.089440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2336.089440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2336.089440 (E_RNA) where: Base-Base interactions energy: -1480.727 where: short stacking energy: -725.802 Base-Backbone interact. energy: 2.265 local terms energy: -857.627433 where: bonds (distance) C4'-P energy: -184.991 bonds (distance) P-C4' energy: -185.895 flat angles C4'-P-C4' energy: -179.387 flat angles P-C4'-P energy: -131.052 tors. eta vs tors. theta energy: -176.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -2159.685787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2159.685787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2159.685787 (E_RNA) where: Base-Base interactions energy: -1363.231 where: short stacking energy: -691.668 Base-Backbone interact. energy: -1.622 local terms energy: -794.832992 where: bonds (distance) C4'-P energy: -172.555 bonds (distance) P-C4' energy: -165.410 flat angles C4'-P-C4' energy: -185.719 flat angles P-C4'-P energy: -109.043 tors. eta vs tors. theta energy: -162.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -2060.218896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2060.218896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2060.218896 (E_RNA) where: Base-Base interactions energy: -1294.514 where: short stacking energy: -654.139 Base-Backbone interact. energy: -0.882 local terms energy: -764.823670 where: bonds (distance) C4'-P energy: -155.250 bonds (distance) P-C4' energy: -164.248 flat angles C4'-P-C4' energy: -186.166 flat angles P-C4'-P energy: -99.435 tors. eta vs tors. theta energy: -159.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1840.922685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1840.922685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1840.922685 (E_RNA) where: Base-Base interactions energy: -1149.798 where: short stacking energy: -564.972 Base-Backbone interact. energy: -0.757 local terms energy: -690.367441 where: bonds (distance) C4'-P energy: -142.135 bonds (distance) P-C4' energy: -164.715 flat angles C4'-P-C4' energy: -180.894 flat angles P-C4'-P energy: -99.113 tors. eta vs tors. theta energy: -103.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1635.913874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1635.913874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1635.913874 (E_RNA) where: Base-Base interactions energy: -994.014 where: short stacking energy: -537.733 Base-Backbone interact. energy: 3.312 local terms energy: -645.211866 where: bonds (distance) C4'-P energy: -135.035 bonds (distance) P-C4' energy: -177.054 flat angles C4'-P-C4' energy: -158.756 flat angles P-C4'-P energy: -72.635 tors. eta vs tors. theta energy: -101.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1412.649270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.649270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.649270 (E_RNA) where: Base-Base interactions energy: -830.723 where: short stacking energy: -472.805 Base-Backbone interact. energy: 1.990 local terms energy: -583.916445 where: bonds (distance) C4'-P energy: -145.680 bonds (distance) P-C4' energy: -157.733 flat angles C4'-P-C4' energy: -145.217 flat angles P-C4'-P energy: -78.329 tors. eta vs tors. theta energy: -56.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1298.940602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.940602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.940602 (E_RNA) where: Base-Base interactions energy: -759.476 where: short stacking energy: -401.349 Base-Backbone interact. energy: 1.518 local terms energy: -540.982399 where: bonds (distance) C4'-P energy: -135.635 bonds (distance) P-C4' energy: -156.100 flat angles C4'-P-C4' energy: -131.021 flat angles P-C4'-P energy: -82.839 tors. eta vs tors. theta energy: -35.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -990.932813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.932813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.932813 (E_RNA) where: Base-Base interactions energy: -508.649 where: short stacking energy: -338.985 Base-Backbone interact. energy: 6.088 local terms energy: -488.372026 where: bonds (distance) C4'-P energy: -125.546 bonds (distance) P-C4' energy: -161.402 flat angles C4'-P-C4' energy: -120.922 flat angles P-C4'-P energy: -82.353 tors. eta vs tors. theta energy: 1.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2753.853849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2753.853849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2753.853849 (E_RNA) where: Base-Base interactions energy: -1839.284 where: short stacking energy: -861.637 Base-Backbone interact. energy: 0.586 local terms energy: -915.155564 where: bonds (distance) C4'-P energy: -177.300 bonds (distance) P-C4' energy: -187.410 flat angles C4'-P-C4' energy: -196.167 flat angles P-C4'-P energy: -118.764 tors. eta vs tors. theta energy: -235.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -2435.393035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2435.393035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2435.393035 (E_RNA) where: Base-Base interactions energy: -1542.976 where: short stacking energy: -791.807 Base-Backbone interact. energy: -2.416 local terms energy: -890.001156 where: bonds (distance) C4'-P energy: -191.548 bonds (distance) P-C4' energy: -182.147 flat angles C4'-P-C4' energy: -194.115 flat angles P-C4'-P energy: -126.446 tors. eta vs tors. theta energy: -195.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -2348.181290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2348.181290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2348.181290 (E_RNA) where: Base-Base interactions energy: -1517.232 where: short stacking energy: -752.206 Base-Backbone interact. energy: 1.491 local terms energy: -832.440956 where: bonds (distance) C4'-P energy: -167.426 bonds (distance) P-C4' energy: -178.857 flat angles C4'-P-C4' energy: -188.065 flat angles P-C4'-P energy: -105.556 tors. eta vs tors. theta energy: -192.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -2155.839034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2155.839034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2155.839034 (E_RNA) where: Base-Base interactions energy: -1374.911 where: short stacking energy: -675.512 Base-Backbone interact. energy: -1.761 local terms energy: -779.167208 where: bonds (distance) C4'-P energy: -177.100 bonds (distance) P-C4' energy: -160.961 flat angles C4'-P-C4' energy: -180.334 flat angles P-C4'-P energy: -109.847 tors. eta vs tors. theta energy: -150.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -2055.326951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.326951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.326951 (E_RNA) where: Base-Base interactions energy: -1253.630 where: short stacking energy: -651.802 Base-Backbone interact. energy: -2.585 local terms energy: -799.111942 where: bonds (distance) C4'-P energy: -159.364 bonds (distance) P-C4' energy: -171.471 flat angles C4'-P-C4' energy: -188.210 flat angles P-C4'-P energy: -115.666 tors. eta vs tors. theta energy: -164.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1934.197564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1934.197564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1934.197564 (E_RNA) where: Base-Base interactions energy: -1220.664 where: short stacking energy: -580.131 Base-Backbone interact. energy: -0.142 local terms energy: -713.392048 where: bonds (distance) C4'-P energy: -142.264 bonds (distance) P-C4' energy: -171.069 flat angles C4'-P-C4' energy: -163.316 flat angles P-C4'-P energy: -107.529 tors. eta vs tors. theta energy: -129.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1668.567213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.567213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.567213 (E_RNA) where: Base-Base interactions energy: -1025.381 where: short stacking energy: -563.706 Base-Backbone interact. energy: 6.844 local terms energy: -650.029900 where: bonds (distance) C4'-P energy: -166.074 bonds (distance) P-C4' energy: -148.485 flat angles C4'-P-C4' energy: -146.535 flat angles P-C4'-P energy: -89.693 tors. eta vs tors. theta energy: -99.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1515.973411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.973411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.973411 (E_RNA) where: Base-Base interactions energy: -909.393 where: short stacking energy: -465.283 Base-Backbone interact. energy: -1.876 local terms energy: -604.704339 where: bonds (distance) C4'-P energy: -147.227 bonds (distance) P-C4' energy: -145.603 flat angles C4'-P-C4' energy: -139.204 flat angles P-C4'-P energy: -95.837 tors. eta vs tors. theta energy: -76.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1223.239418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.239418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.239418 (E_RNA) where: Base-Base interactions energy: -700.385 where: short stacking energy: -326.328 Base-Backbone interact. energy: -0.695 local terms energy: -522.159121 where: bonds (distance) C4'-P energy: -138.209 bonds (distance) P-C4' energy: -158.179 flat angles C4'-P-C4' energy: -142.914 flat angles P-C4'-P energy: -81.448 tors. eta vs tors. theta energy: -1.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -928.233445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.233445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.233445 (E_RNA) where: Base-Base interactions energy: -460.547 where: short stacking energy: -279.153 Base-Backbone interact. energy: -0.885 local terms energy: -466.801734 where: bonds (distance) C4'-P energy: -153.977 bonds (distance) P-C4' energy: -127.104 flat angles C4'-P-C4' energy: -115.027 flat angles P-C4'-P energy: -77.957 tors. eta vs tors. theta energy: 7.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2779.443567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2779.443567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2779.443567 (E_RNA) where: Base-Base interactions energy: -1822.633 where: short stacking energy: -876.523 Base-Backbone interact. energy: -4.495 local terms energy: -952.315451 where: bonds (distance) C4'-P energy: -176.264 bonds (distance) P-C4' energy: -202.003 flat angles C4'-P-C4' energy: -206.732 flat angles P-C4'-P energy: -134.920 tors. eta vs tors. theta energy: -232.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2500.093615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2500.093615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2500.093615 (E_RNA) where: Base-Base interactions energy: -1634.058 where: short stacking energy: -822.828 Base-Backbone interact. energy: -1.280 local terms energy: -864.755080 where: bonds (distance) C4'-P energy: -166.926 bonds (distance) P-C4' energy: -173.634 flat angles C4'-P-C4' energy: -187.029 flat angles P-C4'-P energy: -136.396 tors. eta vs tors. theta energy: -200.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -2321.161197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2321.161197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2321.161197 (E_RNA) where: Base-Base interactions energy: -1500.946 where: short stacking energy: -750.189 Base-Backbone interact. energy: -1.218 local terms energy: -818.997200 where: bonds (distance) C4'-P energy: -168.763 bonds (distance) P-C4' energy: -167.718 flat angles C4'-P-C4' energy: -189.649 flat angles P-C4'-P energy: -110.494 tors. eta vs tors. theta energy: -182.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -2136.356689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2136.356689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2136.356689 (E_RNA) where: Base-Base interactions energy: -1335.577 where: short stacking energy: -641.154 Base-Backbone interact. energy: 0.433 local terms energy: -801.212755 where: bonds (distance) C4'-P energy: -168.558 bonds (distance) P-C4' energy: -181.144 flat angles C4'-P-C4' energy: -187.124 flat angles P-C4'-P energy: -106.125 tors. eta vs tors. theta energy: -158.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -2010.561928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2010.561928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2010.561928 (E_RNA) where: Base-Base interactions energy: -1270.531 where: short stacking energy: -596.808 Base-Backbone interact. energy: -2.538 local terms energy: -737.492739 where: bonds (distance) C4'-P energy: -163.220 bonds (distance) P-C4' energy: -157.199 flat angles C4'-P-C4' energy: -187.535 flat angles P-C4'-P energy: -96.522 tors. eta vs tors. theta energy: -133.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1943.874592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.874592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.874592 (E_RNA) where: Base-Base interactions energy: -1230.000 where: short stacking energy: -571.717 Base-Backbone interact. energy: 7.260 local terms energy: -721.135212 where: bonds (distance) C4'-P energy: -154.947 bonds (distance) P-C4' energy: -155.063 flat angles C4'-P-C4' energy: -189.445 flat angles P-C4'-P energy: -96.050 tors. eta vs tors. theta energy: -125.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1633.648910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.648910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.648910 (E_RNA) where: Base-Base interactions energy: -997.224 where: short stacking energy: -529.489 Base-Backbone interact. energy: -0.652 local terms energy: -635.773050 where: bonds (distance) C4'-P energy: -145.848 bonds (distance) P-C4' energy: -163.475 flat angles C4'-P-C4' energy: -164.017 flat angles P-C4'-P energy: -78.556 tors. eta vs tors. theta energy: -83.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1535.401510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.401510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.401510 (E_RNA) where: Base-Base interactions energy: -909.619 where: short stacking energy: -451.523 Base-Backbone interact. energy: -0.959 local terms energy: -624.824153 where: bonds (distance) C4'-P energy: -153.737 bonds (distance) P-C4' energy: -176.587 flat angles C4'-P-C4' energy: -151.311 flat angles P-C4'-P energy: -93.467 tors. eta vs tors. theta energy: -49.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1299.638664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.638664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.638664 (E_RNA) where: Base-Base interactions energy: -780.409 where: short stacking energy: -402.093 Base-Backbone interact. energy: 4.716 local terms energy: -523.945547 where: bonds (distance) C4'-P energy: -138.792 bonds (distance) P-C4' energy: -146.515 flat angles C4'-P-C4' energy: -124.886 flat angles P-C4'-P energy: -86.538 tors. eta vs tors. theta energy: -27.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -985.543375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.543375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.543375 (E_RNA) where: Base-Base interactions energy: -492.045 where: short stacking energy: -290.556 Base-Backbone interact. energy: 0.972 local terms energy: -494.470147 where: bonds (distance) C4'-P energy: -128.347 bonds (distance) P-C4' energy: -146.153 flat angles C4'-P-C4' energy: -142.381 flat angles P-C4'-P energy: -75.627 tors. eta vs tors. theta energy: -1.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2813.461450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2813.461450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2813.461450 (E_RNA) where: Base-Base interactions energy: -1870.741 where: short stacking energy: -889.208 Base-Backbone interact. energy: -0.470 local terms energy: -942.249896 where: bonds (distance) C4'-P energy: -169.656 bonds (distance) P-C4' energy: -194.463 flat angles C4'-P-C4' energy: -206.794 flat angles P-C4'-P energy: -131.652 tors. eta vs tors. theta energy: -239.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2507.828472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2507.828472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2507.828472 (E_RNA) where: Base-Base interactions energy: -1614.303 where: short stacking energy: -809.143 Base-Backbone interact. energy: -3.062 local terms energy: -890.463446 where: bonds (distance) C4'-P energy: -182.052 bonds (distance) P-C4' energy: -177.356 flat angles C4'-P-C4' energy: -205.674 flat angles P-C4'-P energy: -119.009 tors. eta vs tors. theta energy: -206.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -2337.367079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2337.367079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2337.367079 (E_RNA) where: Base-Base interactions energy: -1539.299 where: short stacking energy: -745.040 Base-Backbone interact. energy: -0.486 local terms energy: -797.581951 where: bonds (distance) C4'-P energy: -160.227 bonds (distance) P-C4' energy: -174.449 flat angles C4'-P-C4' energy: -179.411 flat angles P-C4'-P energy: -114.896 tors. eta vs tors. theta energy: -168.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -2162.453838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.453838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2162.453838 (E_RNA) where: Base-Base interactions energy: -1371.187 where: short stacking energy: -695.739 Base-Backbone interact. energy: -1.090 local terms energy: -790.176312 where: bonds (distance) C4'-P energy: -166.621 bonds (distance) P-C4' energy: -165.525 flat angles C4'-P-C4' energy: -181.863 flat angles P-C4'-P energy: -118.305 tors. eta vs tors. theta energy: -157.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -2006.716422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2006.716422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2006.716422 (E_RNA) where: Base-Base interactions energy: -1279.316 where: short stacking energy: -666.094 Base-Backbone interact. energy: -2.661 local terms energy: -724.739315 where: bonds (distance) C4'-P energy: -162.186 bonds (distance) P-C4' energy: -150.948 flat angles C4'-P-C4' energy: -190.121 flat angles P-C4'-P energy: -89.361 tors. eta vs tors. theta energy: -132.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1978.325383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1978.325383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1978.325383 (E_RNA) where: Base-Base interactions energy: -1248.698 where: short stacking energy: -605.190 Base-Backbone interact. energy: -1.736 local terms energy: -727.892003 where: bonds (distance) C4'-P energy: -149.856 bonds (distance) P-C4' energy: -172.675 flat angles C4'-P-C4' energy: -176.377 flat angles P-C4'-P energy: -103.141 tors. eta vs tors. theta energy: -125.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1699.204637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1699.204637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1699.204637 (E_RNA) where: Base-Base interactions energy: -1016.264 where: short stacking energy: -508.707 Base-Backbone interact. energy: -1.118 local terms energy: -681.822712 where: bonds (distance) C4'-P energy: -165.050 bonds (distance) P-C4' energy: -158.850 flat angles C4'-P-C4' energy: -158.581 flat angles P-C4'-P energy: -102.023 tors. eta vs tors. theta energy: -97.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1513.833870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1513.833870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1513.833870 (E_RNA) where: Base-Base interactions energy: -914.308 where: short stacking energy: -446.642 Base-Backbone interact. energy: -0.250 local terms energy: -599.276508 where: bonds (distance) C4'-P energy: -146.607 bonds (distance) P-C4' energy: -147.927 flat angles C4'-P-C4' energy: -161.781 flat angles P-C4'-P energy: -75.894 tors. eta vs tors. theta energy: -67.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1177.374987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.374987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1177.374987 (E_RNA) where: Base-Base interactions energy: -626.598 where: short stacking energy: -329.598 Base-Backbone interact. energy: 0.129 local terms energy: -550.906140 where: bonds (distance) C4'-P energy: -145.597 bonds (distance) P-C4' energy: -152.775 flat angles C4'-P-C4' energy: -163.622 flat angles P-C4'-P energy: -80.130 tors. eta vs tors. theta energy: -8.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1047.368421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.368421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.368421 (E_RNA) where: Base-Base interactions energy: -541.353 where: short stacking energy: -305.246 Base-Backbone interact. energy: -2.051 local terms energy: -503.963622 where: bonds (distance) C4'-P energy: -146.833 bonds (distance) P-C4' energy: -142.159 flat angles C4'-P-C4' energy: -128.419 flat angles P-C4'-P energy: -83.322 tors. eta vs tors. theta energy: -3.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2838.923553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2838.923553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2838.923553 (E_RNA) where: Base-Base interactions energy: -1879.510 where: short stacking energy: -910.743 Base-Backbone interact. energy: -1.665 local terms energy: -957.749237 where: bonds (distance) C4'-P energy: -175.586 bonds (distance) P-C4' energy: -185.080 flat angles C4'-P-C4' energy: -210.620 flat angles P-C4'-P energy: -134.173 tors. eta vs tors. theta energy: -252.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2431.840763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2431.840763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2431.840763 (E_RNA) where: Base-Base interactions energy: -1532.662 where: short stacking energy: -777.858 Base-Backbone interact. energy: 0.818 local terms energy: -899.997216 where: bonds (distance) C4'-P energy: -190.585 bonds (distance) P-C4' energy: -190.529 flat angles C4'-P-C4' energy: -193.387 flat angles P-C4'-P energy: -121.757 tors. eta vs tors. theta energy: -203.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -2365.243419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2365.243419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2365.243419 (E_RNA) where: Base-Base interactions energy: -1535.707 where: short stacking energy: -765.811 Base-Backbone interact. energy: -1.045 local terms energy: -828.491436 where: bonds (distance) C4'-P energy: -175.735 bonds (distance) P-C4' energy: -185.540 flat angles C4'-P-C4' energy: -172.308 flat angles P-C4'-P energy: -116.847 tors. eta vs tors. theta energy: -178.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -2174.375878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2174.375878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2174.375878 (E_RNA) where: Base-Base interactions energy: -1390.422 where: short stacking energy: -699.351 Base-Backbone interact. energy: 4.265 local terms energy: -788.218898 where: bonds (distance) C4'-P energy: -158.284 bonds (distance) P-C4' energy: -173.813 flat angles C4'-P-C4' energy: -198.168 flat angles P-C4'-P energy: -115.479 tors. eta vs tors. theta energy: -142.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1997.058402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1997.058402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1997.058402 (E_RNA) where: Base-Base interactions energy: -1222.852 where: short stacking energy: -619.881 Base-Backbone interact. energy: -3.030 local terms energy: -771.176558 where: bonds (distance) C4'-P energy: -180.454 bonds (distance) P-C4' energy: -180.103 flat angles C4'-P-C4' energy: -166.006 flat angles P-C4'-P energy: -118.520 tors. eta vs tors. theta energy: -126.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1883.392103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.392103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.392103 (E_RNA) where: Base-Base interactions energy: -1157.809 where: short stacking energy: -562.345 Base-Backbone interact. energy: 4.080 local terms energy: -729.663825 where: bonds (distance) C4'-P energy: -151.600 bonds (distance) P-C4' energy: -166.568 flat angles C4'-P-C4' energy: -153.615 flat angles P-C4'-P energy: -126.478 tors. eta vs tors. theta energy: -131.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1648.722537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.722537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.722537 (E_RNA) where: Base-Base interactions energy: -981.120 where: short stacking energy: -520.842 Base-Backbone interact. energy: -0.446 local terms energy: -667.156074 where: bonds (distance) C4'-P energy: -162.302 bonds (distance) P-C4' energy: -160.630 flat angles C4'-P-C4' energy: -156.118 flat angles P-C4'-P energy: -91.446 tors. eta vs tors. theta energy: -96.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1489.708954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.708954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.708954 (E_RNA) where: Base-Base interactions energy: -918.308 where: short stacking energy: -473.176 Base-Backbone interact. energy: 1.025 local terms energy: -572.426001 where: bonds (distance) C4'-P energy: -137.859 bonds (distance) P-C4' energy: -160.246 flat angles C4'-P-C4' energy: -131.388 flat angles P-C4'-P energy: -83.499 tors. eta vs tors. theta energy: -59.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1257.364289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.364289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.364289 (E_RNA) where: Base-Base interactions energy: -763.344 where: short stacking energy: -384.124 Base-Backbone interact. energy: -3.370 local terms energy: -490.650616 where: bonds (distance) C4'-P energy: -112.571 bonds (distance) P-C4' energy: -134.307 flat angles C4'-P-C4' energy: -127.858 flat angles P-C4'-P energy: -81.165 tors. eta vs tors. theta energy: -34.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -990.410604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.410604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.410604 (E_RNA) where: Base-Base interactions energy: -516.598 where: short stacking energy: -285.406 Base-Backbone interact. energy: -4.258 local terms energy: -469.555393 where: bonds (distance) C4'-P energy: -132.017 bonds (distance) P-C4' energy: -162.404 flat angles C4'-P-C4' energy: -119.354 flat angles P-C4'-P energy: -63.093 tors. eta vs tors. theta energy: 7.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2804.541697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2804.541697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2804.541697 (E_RNA) where: Base-Base interactions energy: -1881.764 where: short stacking energy: -861.705 Base-Backbone interact. energy: -2.055 local terms energy: -920.722563 where: bonds (distance) C4'-P energy: -176.028 bonds (distance) P-C4' energy: -191.982 flat angles C4'-P-C4' energy: -200.195 flat angles P-C4'-P energy: -128.135 tors. eta vs tors. theta energy: -224.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2490.065809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2490.065809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2490.065809 (E_RNA) where: Base-Base interactions energy: -1604.507 where: short stacking energy: -823.729 Base-Backbone interact. energy: -2.031 local terms energy: -883.527851 where: bonds (distance) C4'-P energy: -181.268 bonds (distance) P-C4' energy: -184.319 flat angles C4'-P-C4' energy: -209.875 flat angles P-C4'-P energy: -103.439 tors. eta vs tors. theta energy: -204.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -2354.613600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2354.613600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2354.613600 (E_RNA) where: Base-Base interactions energy: -1545.343 where: short stacking energy: -714.309 Base-Backbone interact. energy: -5.382 local terms energy: -803.888678 where: bonds (distance) C4'-P energy: -160.150 bonds (distance) P-C4' energy: -179.335 flat angles C4'-P-C4' energy: -172.319 flat angles P-C4'-P energy: -119.866 tors. eta vs tors. theta energy: -172.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -2152.470267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2152.470267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2152.470267 (E_RNA) where: Base-Base interactions energy: -1379.855 where: short stacking energy: -658.010 Base-Backbone interact. energy: -1.197 local terms energy: -771.419090 where: bonds (distance) C4'-P energy: -167.445 bonds (distance) P-C4' energy: -172.162 flat angles C4'-P-C4' energy: -165.799 flat angles P-C4'-P energy: -116.634 tors. eta vs tors. theta energy: -149.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -2013.275199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2013.275199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2013.275199 (E_RNA) where: Base-Base interactions energy: -1268.648 where: short stacking energy: -618.928 Base-Backbone interact. energy: -2.676 local terms energy: -741.950869 where: bonds (distance) C4'-P energy: -169.037 bonds (distance) P-C4' energy: -170.809 flat angles C4'-P-C4' energy: -154.138 flat angles P-C4'-P energy: -113.853 tors. eta vs tors. theta energy: -134.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1903.805557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1903.805557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1903.805557 (E_RNA) where: Base-Base interactions energy: -1202.334 where: short stacking energy: -583.623 Base-Backbone interact. energy: -0.054 local terms energy: -701.417966 where: bonds (distance) C4'-P energy: -159.964 bonds (distance) P-C4' energy: -165.359 flat angles C4'-P-C4' energy: -145.650 flat angles P-C4'-P energy: -105.700 tors. eta vs tors. theta energy: -124.745 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1645.678064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1645.678064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1645.678064 (E_RNA) where: Base-Base interactions energy: -980.586 where: short stacking energy: -482.777 Base-Backbone interact. energy: -1.191 local terms energy: -663.901200 where: bonds (distance) C4'-P energy: -163.707 bonds (distance) P-C4' energy: -153.277 flat angles C4'-P-C4' energy: -162.461 flat angles P-C4'-P energy: -96.990 tors. eta vs tors. theta energy: -87.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1497.973948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.973948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1497.973948 (E_RNA) where: Base-Base interactions energy: -884.738 where: short stacking energy: -449.860 Base-Backbone interact. energy: 4.518 local terms energy: -617.754156 where: bonds (distance) C4'-P energy: -144.748 bonds (distance) P-C4' energy: -160.447 flat angles C4'-P-C4' energy: -150.426 flat angles P-C4'-P energy: -90.116 tors. eta vs tors. theta energy: -72.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1268.410648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.410648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.410648 (E_RNA) where: Base-Base interactions energy: -735.316 where: short stacking energy: -388.015 Base-Backbone interact. energy: 3.778 local terms energy: -536.872667 where: bonds (distance) C4'-P energy: -137.130 bonds (distance) P-C4' energy: -130.567 flat angles C4'-P-C4' energy: -133.365 flat angles P-C4'-P energy: -78.137 tors. eta vs tors. theta energy: -57.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1068.009949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.009949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.009949 (E_RNA) where: Base-Base interactions energy: -566.259 where: short stacking energy: -320.698 Base-Backbone interact. energy: 1.390 local terms energy: -503.141098 where: bonds (distance) C4'-P energy: -133.597 bonds (distance) P-C4' energy: -129.001 flat angles C4'-P-C4' energy: -128.536 flat angles P-C4'-P energy: -85.259 tors. eta vs tors. theta energy: -26.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2789.281828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2789.281828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2789.281828 (E_RNA) where: Base-Base interactions energy: -1913.163 where: short stacking energy: -841.165 Base-Backbone interact. energy: 1.077 local terms energy: -877.195906 where: bonds (distance) C4'-P energy: -189.622 bonds (distance) P-C4' energy: -161.188 flat angles C4'-P-C4' energy: -199.898 flat angles P-C4'-P energy: -122.064 tors. eta vs tors. theta energy: -204.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2473.391456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2473.391456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2473.391456 (E_RNA) where: Base-Base interactions energy: -1604.947 where: short stacking energy: -831.575 Base-Backbone interact. energy: -0.221 local terms energy: -868.223549 where: bonds (distance) C4'-P energy: -182.296 bonds (distance) P-C4' energy: -187.831 flat angles C4'-P-C4' energy: -190.237 flat angles P-C4'-P energy: -107.213 tors. eta vs tors. theta energy: -200.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -2406.653650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2406.653650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2406.653650 (E_RNA) where: Base-Base interactions energy: -1574.914 where: short stacking energy: -748.311 Base-Backbone interact. energy: 0.588 local terms energy: -832.327871 where: bonds (distance) C4'-P energy: -167.851 bonds (distance) P-C4' energy: -181.050 flat angles C4'-P-C4' energy: -183.414 flat angles P-C4'-P energy: -114.011 tors. eta vs tors. theta energy: -186.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -2181.034152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2181.034152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.034152 (E_RNA) where: Base-Base interactions energy: -1393.484 where: short stacking energy: -657.487 Base-Backbone interact. energy: 1.511 local terms energy: -789.061015 where: bonds (distance) C4'-P energy: -161.961 bonds (distance) P-C4' energy: -173.795 flat angles C4'-P-C4' energy: -173.086 flat angles P-C4'-P energy: -114.978 tors. eta vs tors. theta energy: -165.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1995.377952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1995.377952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1995.377952 (E_RNA) where: Base-Base interactions energy: -1227.524 where: short stacking energy: -577.933 Base-Backbone interact. energy: -4.659 local terms energy: -763.194072 where: bonds (distance) C4'-P energy: -167.466 bonds (distance) P-C4' energy: -177.215 flat angles C4'-P-C4' energy: -166.943 flat angles P-C4'-P energy: -112.403 tors. eta vs tors. theta energy: -139.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1971.465283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.465283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.465283 (E_RNA) where: Base-Base interactions energy: -1232.346 where: short stacking energy: -615.006 Base-Backbone interact. energy: -0.033 local terms energy: -739.086591 where: bonds (distance) C4'-P energy: -154.623 bonds (distance) P-C4' energy: -150.038 flat angles C4'-P-C4' energy: -177.404 flat angles P-C4'-P energy: -107.315 tors. eta vs tors. theta energy: -149.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1722.741895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1722.741895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1722.741895 (E_RNA) where: Base-Base interactions energy: -1054.969 where: short stacking energy: -541.802 Base-Backbone interact. energy: -2.238 local terms energy: -665.535543 where: bonds (distance) C4'-P energy: -138.237 bonds (distance) P-C4' energy: -190.214 flat angles C4'-P-C4' energy: -167.121 flat angles P-C4'-P energy: -90.059 tors. eta vs tors. theta energy: -79.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1502.244737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.244737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.244737 (E_RNA) where: Base-Base interactions energy: -868.683 where: short stacking energy: -451.322 Base-Backbone interact. energy: -1.673 local terms energy: -631.888005 where: bonds (distance) C4'-P energy: -151.082 bonds (distance) P-C4' energy: -151.638 flat angles C4'-P-C4' energy: -164.534 flat angles P-C4'-P energy: -75.334 tors. eta vs tors. theta energy: -89.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1301.656119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.656119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.656119 (E_RNA) where: Base-Base interactions energy: -746.373 where: short stacking energy: -397.154 Base-Backbone interact. energy: -2.242 local terms energy: -553.041030 where: bonds (distance) C4'-P energy: -136.502 bonds (distance) P-C4' energy: -164.583 flat angles C4'-P-C4' energy: -145.379 flat angles P-C4'-P energy: -80.100 tors. eta vs tors. theta energy: -26.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1029.121626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.121626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.121626 (E_RNA) where: Base-Base interactions energy: -532.075 where: short stacking energy: -276.216 Base-Backbone interact. energy: -4.852 local terms energy: -492.194384 where: bonds (distance) C4'-P energy: -140.238 bonds (distance) P-C4' energy: -132.906 flat angles C4'-P-C4' energy: -133.426 flat angles P-C4'-P energy: -75.412 tors. eta vs tors. theta energy: -10.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2817.393841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2817.393841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2817.393841 (E_RNA) where: Base-Base interactions energy: -1878.162 where: short stacking energy: -851.202 Base-Backbone interact. energy: -0.494 local terms energy: -938.737647 where: bonds (distance) C4'-P energy: -187.064 bonds (distance) P-C4' energy: -202.751 flat angles C4'-P-C4' energy: -205.015 flat angles P-C4'-P energy: -128.511 tors. eta vs tors. theta energy: -215.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2455.519978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2455.519978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2455.519978 (E_RNA) where: Base-Base interactions energy: -1580.436 where: short stacking energy: -789.327 Base-Backbone interact. energy: -1.665 local terms energy: -873.418143 where: bonds (distance) C4'-P energy: -171.444 bonds (distance) P-C4' energy: -192.608 flat angles C4'-P-C4' energy: -195.208 flat angles P-C4'-P energy: -124.487 tors. eta vs tors. theta energy: -189.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -2364.467870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2364.467870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2364.467870 (E_RNA) where: Base-Base interactions energy: -1516.695 where: short stacking energy: -723.256 Base-Backbone interact. energy: -0.568 local terms energy: -847.205003 where: bonds (distance) C4'-P energy: -183.236 bonds (distance) P-C4' energy: -188.550 flat angles C4'-P-C4' energy: -184.928 flat angles P-C4'-P energy: -120.201 tors. eta vs tors. theta energy: -170.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -2227.379221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2227.379221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2227.379221 (E_RNA) where: Base-Base interactions energy: -1403.935 where: short stacking energy: -725.574 Base-Backbone interact. energy: -2.479 local terms energy: -820.964851 where: bonds (distance) C4'-P energy: -162.967 bonds (distance) P-C4' energy: -172.961 flat angles C4'-P-C4' energy: -184.072 flat angles P-C4'-P energy: -125.330 tors. eta vs tors. theta energy: -175.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -2055.317341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.317341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.317341 (E_RNA) where: Base-Base interactions energy: -1319.876 where: short stacking energy: -596.592 Base-Backbone interact. energy: -1.562 local terms energy: -733.879341 where: bonds (distance) C4'-P energy: -161.640 bonds (distance) P-C4' energy: -161.934 flat angles C4'-P-C4' energy: -171.904 flat angles P-C4'-P energy: -106.325 tors. eta vs tors. theta energy: -132.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1874.609384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1874.609384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1874.609384 (E_RNA) where: Base-Base interactions energy: -1181.903 where: short stacking energy: -572.917 Base-Backbone interact. energy: 0.041 local terms energy: -692.747731 where: bonds (distance) C4'-P energy: -161.287 bonds (distance) P-C4' energy: -159.032 flat angles C4'-P-C4' energy: -159.914 flat angles P-C4'-P energy: -107.040 tors. eta vs tors. theta energy: -105.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1666.421273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.421273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.421273 (E_RNA) where: Base-Base interactions energy: -1002.466 where: short stacking energy: -528.287 Base-Backbone interact. energy: -2.035 local terms energy: -661.920589 where: bonds (distance) C4'-P energy: -140.548 bonds (distance) P-C4' energy: -171.324 flat angles C4'-P-C4' energy: -152.554 flat angles P-C4'-P energy: -100.000 tors. eta vs tors. theta energy: -97.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1431.165758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1431.165758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1431.165758 (E_RNA) where: Base-Base interactions energy: -825.104 where: short stacking energy: -393.075 Base-Backbone interact. energy: 8.855 local terms energy: -614.917112 where: bonds (distance) C4'-P energy: -152.259 bonds (distance) P-C4' energy: -154.390 flat angles C4'-P-C4' energy: -156.039 flat angles P-C4'-P energy: -97.883 tors. eta vs tors. theta energy: -54.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1328.466993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.466993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.466993 (E_RNA) where: Base-Base interactions energy: -806.631 where: short stacking energy: -360.177 Base-Backbone interact. energy: 0.317 local terms energy: -522.153021 where: bonds (distance) C4'-P energy: -145.350 bonds (distance) P-C4' energy: -151.235 flat angles C4'-P-C4' energy: -121.626 flat angles P-C4'-P energy: -72.368 tors. eta vs tors. theta energy: -31.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1021.711739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.711739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.711739 (E_RNA) where: Base-Base interactions energy: -529.884 where: short stacking energy: -327.303 Base-Backbone interact. energy: -0.146 local terms energy: -491.682042 where: bonds (distance) C4'-P energy: -141.932 bonds (distance) P-C4' energy: -150.013 flat angles C4'-P-C4' energy: -110.374 flat angles P-C4'-P energy: -85.796 tors. eta vs tors. theta energy: -3.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2858.258336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2858.258336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2858.258336 (E_RNA) where: Base-Base interactions energy: -1929.717 where: short stacking energy: -894.115 Base-Backbone interact. energy: -6.300 local terms energy: -922.241554 where: bonds (distance) C4'-P energy: -172.000 bonds (distance) P-C4' energy: -171.355 flat angles C4'-P-C4' energy: -208.226 flat angles P-C4'-P energy: -133.690 tors. eta vs tors. theta energy: -236.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2526.603436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.603436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.603436 (E_RNA) where: Base-Base interactions energy: -1604.408 where: short stacking energy: -824.662 Base-Backbone interact. energy: -3.203 local terms energy: -918.992638 where: bonds (distance) C4'-P energy: -176.985 bonds (distance) P-C4' energy: -181.153 flat angles C4'-P-C4' energy: -211.965 flat angles P-C4'-P energy: -126.598 tors. eta vs tors. theta energy: -222.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2428.422543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2428.422543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2428.422543 (E_RNA) where: Base-Base interactions energy: -1578.663 where: short stacking energy: -771.598 Base-Backbone interact. energy: -2.296 local terms energy: -847.463935 where: bonds (distance) C4'-P energy: -168.115 bonds (distance) P-C4' energy: -175.028 flat angles C4'-P-C4' energy: -183.445 flat angles P-C4'-P energy: -128.054 tors. eta vs tors. theta energy: -192.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -2245.464020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2245.464020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2245.464020 (E_RNA) where: Base-Base interactions energy: -1437.567 where: short stacking energy: -709.616 Base-Backbone interact. energy: -3.365 local terms energy: -804.532486 where: bonds (distance) C4'-P energy: -164.015 bonds (distance) P-C4' energy: -162.779 flat angles C4'-P-C4' energy: -184.716 flat angles P-C4'-P energy: -109.735 tors. eta vs tors. theta energy: -183.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -2202.887185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2202.887185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2202.887185 (E_RNA) where: Base-Base interactions energy: -1458.200 where: short stacking energy: -695.808 Base-Backbone interact. energy: 2.547 local terms energy: -747.234678 where: bonds (distance) C4'-P energy: -153.745 bonds (distance) P-C4' energy: -167.755 flat angles C4'-P-C4' energy: -162.146 flat angles P-C4'-P energy: -112.593 tors. eta vs tors. theta energy: -150.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1941.651285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1941.651285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1941.651285 (E_RNA) where: Base-Base interactions energy: -1253.344 where: short stacking energy: -606.427 Base-Backbone interact. energy: -1.525 local terms energy: -686.781991 where: bonds (distance) C4'-P energy: -144.156 bonds (distance) P-C4' energy: -142.451 flat angles C4'-P-C4' energy: -158.590 flat angles P-C4'-P energy: -108.676 tors. eta vs tors. theta energy: -132.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1732.334518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.334518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1732.334518 (E_RNA) where: Base-Base interactions energy: -1066.686 where: short stacking energy: -543.449 Base-Backbone interact. energy: 3.076 local terms energy: -668.724783 where: bonds (distance) C4'-P energy: -136.507 bonds (distance) P-C4' energy: -162.877 flat angles C4'-P-C4' energy: -152.181 flat angles P-C4'-P energy: -116.614 tors. eta vs tors. theta energy: -100.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1428.464262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.464262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.464262 (E_RNA) where: Base-Base interactions energy: -808.076 where: short stacking energy: -419.645 Base-Backbone interact. energy: -2.348 local terms energy: -618.040976 where: bonds (distance) C4'-P energy: -145.300 bonds (distance) P-C4' energy: -159.093 flat angles C4'-P-C4' energy: -160.873 flat angles P-C4'-P energy: -89.554 tors. eta vs tors. theta energy: -63.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1257.055870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.055870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.055870 (E_RNA) where: Base-Base interactions energy: -746.915 where: short stacking energy: -386.456 Base-Backbone interact. energy: 3.776 local terms energy: -513.916877 where: bonds (distance) C4'-P energy: -133.181 bonds (distance) P-C4' energy: -149.621 flat angles C4'-P-C4' energy: -125.586 flat angles P-C4'-P energy: -68.068 tors. eta vs tors. theta energy: -37.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -932.121661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -932.121661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -932.121661 (E_RNA) where: Base-Base interactions energy: -476.281 where: short stacking energy: -262.121 Base-Backbone interact. energy: -4.999 local terms energy: -450.841002 where: bonds (distance) C4'-P energy: -117.657 bonds (distance) P-C4' energy: -132.848 flat angles C4'-P-C4' energy: -128.360 flat angles P-C4'-P energy: -73.045 tors. eta vs tors. theta energy: 1.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2877.207943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2877.207943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2877.207943 (E_RNA) where: Base-Base interactions energy: -1920.045 where: short stacking energy: -894.492 Base-Backbone interact. energy: -5.820 local terms energy: -951.343776 where: bonds (distance) C4'-P energy: -182.746 bonds (distance) P-C4' energy: -207.213 flat angles C4'-P-C4' energy: -188.572 flat angles P-C4'-P energy: -136.304 tors. eta vs tors. theta energy: -236.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2502.165301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2502.165301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2502.165301 (E_RNA) where: Base-Base interactions energy: -1621.082 where: short stacking energy: -795.388 Base-Backbone interact. energy: -0.400 local terms energy: -880.683683 where: bonds (distance) C4'-P energy: -164.280 bonds (distance) P-C4' energy: -181.434 flat angles C4'-P-C4' energy: -201.602 flat angles P-C4'-P energy: -141.440 tors. eta vs tors. theta energy: -191.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2405.894481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2405.894481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2405.894481 (E_RNA) where: Base-Base interactions energy: -1557.771 where: short stacking energy: -752.275 Base-Backbone interact. energy: -3.232 local terms energy: -844.892181 where: bonds (distance) C4'-P energy: -164.307 bonds (distance) P-C4' energy: -173.966 flat angles C4'-P-C4' energy: -207.787 flat angles P-C4'-P energy: -120.144 tors. eta vs tors. theta energy: -178.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -2259.514607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2259.514607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2259.514607 (E_RNA) where: Base-Base interactions energy: -1449.041 where: short stacking energy: -698.007 Base-Backbone interact. energy: -1.068 local terms energy: -809.405750 where: bonds (distance) C4'-P energy: -166.363 bonds (distance) P-C4' energy: -169.283 flat angles C4'-P-C4' energy: -184.262 flat angles P-C4'-P energy: -106.815 tors. eta vs tors. theta energy: -182.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -2192.559589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2192.559589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2192.559589 (E_RNA) where: Base-Base interactions energy: -1407.063 where: short stacking energy: -674.043 Base-Backbone interact. energy: -4.514 local terms energy: -780.982673 where: bonds (distance) C4'-P energy: -157.381 bonds (distance) P-C4' energy: -179.126 flat angles C4'-P-C4' energy: -186.153 flat angles P-C4'-P energy: -93.825 tors. eta vs tors. theta energy: -164.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -2005.166483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2005.166483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2005.166483 (E_RNA) where: Base-Base interactions energy: -1285.174 where: short stacking energy: -650.372 Base-Backbone interact. energy: -4.746 local terms energy: -715.246479 where: bonds (distance) C4'-P energy: -147.225 bonds (distance) P-C4' energy: -166.185 flat angles C4'-P-C4' energy: -162.336 flat angles P-C4'-P energy: -102.263 tors. eta vs tors. theta energy: -137.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1690.862572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.862572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1690.862572 (E_RNA) where: Base-Base interactions energy: -1031.500 where: short stacking energy: -521.405 Base-Backbone interact. energy: -2.062 local terms energy: -657.300486 where: bonds (distance) C4'-P energy: -172.356 bonds (distance) P-C4' energy: -150.005 flat angles C4'-P-C4' energy: -151.249 flat angles P-C4'-P energy: -88.566 tors. eta vs tors. theta energy: -95.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1442.492332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.492332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.492332 (E_RNA) where: Base-Base interactions energy: -860.556 where: short stacking energy: -415.416 Base-Backbone interact. energy: 3.248 local terms energy: -585.184724 where: bonds (distance) C4'-P energy: -137.364 bonds (distance) P-C4' energy: -167.669 flat angles C4'-P-C4' energy: -150.614 flat angles P-C4'-P energy: -66.018 tors. eta vs tors. theta energy: -63.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1194.185541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.185541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.185541 (E_RNA) where: Base-Base interactions energy: -679.739 where: short stacking energy: -336.977 Base-Backbone interact. energy: 1.454 local terms energy: -515.900360 where: bonds (distance) C4'-P energy: -143.914 bonds (distance) P-C4' energy: -156.768 flat angles C4'-P-C4' energy: -126.786 flat angles P-C4'-P energy: -79.665 tors. eta vs tors. theta energy: -8.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -909.029680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.029680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.029680 (E_RNA) where: Base-Base interactions energy: -438.848 where: short stacking energy: -271.543 Base-Backbone interact. energy: 3.571 local terms energy: -473.752766 where: bonds (distance) C4'-P energy: -125.418 bonds (distance) P-C4' energy: -138.752 flat angles C4'-P-C4' energy: -120.113 flat angles P-C4'-P energy: -82.246 tors. eta vs tors. theta energy: -7.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2870.331927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2870.331927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2870.331927 (E_RNA) where: Base-Base interactions energy: -1932.879 where: short stacking energy: -898.135 Base-Backbone interact. energy: -3.394 local terms energy: -934.059816 where: bonds (distance) C4'-P energy: -196.038 bonds (distance) P-C4' energy: -180.539 flat angles C4'-P-C4' energy: -190.428 flat angles P-C4'-P energy: -140.920 tors. eta vs tors. theta energy: -226.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2475.623833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2475.623833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2475.623833 (E_RNA) where: Base-Base interactions energy: -1606.841 where: short stacking energy: -792.846 Base-Backbone interact. energy: -0.284 local terms energy: -868.499062 where: bonds (distance) C4'-P energy: -174.374 bonds (distance) P-C4' energy: -175.859 flat angles C4'-P-C4' energy: -190.046 flat angles P-C4'-P energy: -123.019 tors. eta vs tors. theta energy: -205.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2417.313114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2417.313114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2417.313114 (E_RNA) where: Base-Base interactions energy: -1597.590 where: short stacking energy: -767.538 Base-Backbone interact. energy: -0.547 local terms energy: -819.175309 where: bonds (distance) C4'-P energy: -174.382 bonds (distance) P-C4' energy: -152.366 flat angles C4'-P-C4' energy: -180.965 flat angles P-C4'-P energy: -125.726 tors. eta vs tors. theta energy: -185.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -2201.614994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2201.614994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2201.614994 (E_RNA) where: Base-Base interactions energy: -1400.992 where: short stacking energy: -669.231 Base-Backbone interact. energy: 0.906 local terms energy: -801.528949 where: bonds (distance) C4'-P energy: -170.741 bonds (distance) P-C4' energy: -184.014 flat angles C4'-P-C4' energy: -183.702 flat angles P-C4'-P energy: -100.739 tors. eta vs tors. theta energy: -162.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -2254.780166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2254.780166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2254.780166 (E_RNA) where: Base-Base interactions energy: -1493.545 where: short stacking energy: -676.735 Base-Backbone interact. energy: 1.777 local terms energy: -763.012452 where: bonds (distance) C4'-P energy: -152.585 bonds (distance) P-C4' energy: -161.337 flat angles C4'-P-C4' energy: -172.607 flat angles P-C4'-P energy: -100.587 tors. eta vs tors. theta energy: -175.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -2021.203860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2021.203860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2021.203860 (E_RNA) where: Base-Base interactions energy: -1248.928 where: short stacking energy: -582.740 Base-Backbone interact. energy: 1.539 local terms energy: -773.814746 where: bonds (distance) C4'-P energy: -158.487 bonds (distance) P-C4' energy: -180.063 flat angles C4'-P-C4' energy: -173.687 flat angles P-C4'-P energy: -121.514 tors. eta vs tors. theta energy: -140.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1718.469567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1718.469567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1718.469567 (E_RNA) where: Base-Base interactions energy: -1054.640 where: short stacking energy: -518.606 Base-Backbone interact. energy: 4.683 local terms energy: -668.513382 where: bonds (distance) C4'-P energy: -162.068 bonds (distance) P-C4' energy: -160.784 flat angles C4'-P-C4' energy: -157.975 flat angles P-C4'-P energy: -107.968 tors. eta vs tors. theta energy: -79.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1532.521750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.521750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.521750 (E_RNA) where: Base-Base interactions energy: -891.143 where: short stacking energy: -416.602 Base-Backbone interact. energy: 2.323 local terms energy: -643.701129 where: bonds (distance) C4'-P energy: -153.550 bonds (distance) P-C4' energy: -171.798 flat angles C4'-P-C4' energy: -163.115 flat angles P-C4'-P energy: -99.298 tors. eta vs tors. theta energy: -55.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1246.721397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.721397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.721397 (E_RNA) where: Base-Base interactions energy: -693.354 where: short stacking energy: -394.911 Base-Backbone interact. energy: 0.556 local terms energy: -553.923306 where: bonds (distance) C4'-P energy: -162.751 bonds (distance) P-C4' energy: -143.158 flat angles C4'-P-C4' energy: -132.095 flat angles P-C4'-P energy: -83.409 tors. eta vs tors. theta energy: -32.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -889.345391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.345391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.345391 (E_RNA) where: Base-Base interactions energy: -443.248 where: short stacking energy: -245.430 Base-Backbone interact. energy: 3.348 local terms energy: -449.445638 where: bonds (distance) C4'-P energy: -128.591 bonds (distance) P-C4' energy: -161.258 flat angles C4'-P-C4' energy: -127.236 flat angles P-C4'-P energy: -65.128 tors. eta vs tors. theta energy: 32.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2873.281475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2873.281475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2873.281475 (E_RNA) where: Base-Base interactions energy: -1906.022 where: short stacking energy: -901.730 Base-Backbone interact. energy: -1.792 local terms energy: -965.467737 where: bonds (distance) C4'-P energy: -177.522 bonds (distance) P-C4' energy: -189.250 flat angles C4'-P-C4' energy: -208.068 flat angles P-C4'-P energy: -142.660 tors. eta vs tors. theta energy: -247.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2511.553562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2511.553562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2511.553562 (E_RNA) where: Base-Base interactions energy: -1599.941 where: short stacking energy: -787.052 Base-Backbone interact. energy: -2.420 local terms energy: -909.192014 where: bonds (distance) C4'-P energy: -182.261 bonds (distance) P-C4' energy: -170.913 flat angles C4'-P-C4' energy: -211.962 flat angles P-C4'-P energy: -130.408 tors. eta vs tors. theta energy: -213.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2424.621492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2424.621492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2424.621492 (E_RNA) where: Base-Base interactions energy: -1584.116 where: short stacking energy: -751.432 Base-Backbone interact. energy: -0.613 local terms energy: -839.892278 where: bonds (distance) C4'-P energy: -160.436 bonds (distance) P-C4' energy: -178.158 flat angles C4'-P-C4' energy: -179.945 flat angles P-C4'-P energy: -133.779 tors. eta vs tors. theta energy: -187.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -2335.047840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2335.047840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2335.047840 (E_RNA) where: Base-Base interactions energy: -1550.242 where: short stacking energy: -689.941 Base-Backbone interact. energy: 6.640 local terms energy: -791.445744 where: bonds (distance) C4'-P energy: -148.920 bonds (distance) P-C4' energy: -171.628 flat angles C4'-P-C4' energy: -179.128 flat angles P-C4'-P energy: -119.190 tors. eta vs tors. theta energy: -172.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -2125.881185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2125.881185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2125.881185 (E_RNA) where: Base-Base interactions energy: -1348.355 where: short stacking energy: -659.842 Base-Backbone interact. energy: 2.420 local terms energy: -779.946157 where: bonds (distance) C4'-P energy: -167.478 bonds (distance) P-C4' energy: -177.122 flat angles C4'-P-C4' energy: -182.920 flat angles P-C4'-P energy: -102.750 tors. eta vs tors. theta energy: -149.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -2062.885042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2062.885042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2062.885042 (E_RNA) where: Base-Base interactions energy: -1305.281 where: short stacking energy: -604.782 Base-Backbone interact. energy: -2.314 local terms energy: -755.289756 where: bonds (distance) C4'-P energy: -164.808 bonds (distance) P-C4' energy: -185.880 flat angles C4'-P-C4' energy: -161.559 flat angles P-C4'-P energy: -110.373 tors. eta vs tors. theta energy: -132.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1674.570013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.570013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.570013 (E_RNA) where: Base-Base interactions energy: -1011.947 where: short stacking energy: -525.041 Base-Backbone interact. energy: -1.734 local terms energy: -660.888559 where: bonds (distance) C4'-P energy: -161.772 bonds (distance) P-C4' energy: -173.205 flat angles C4'-P-C4' energy: -148.084 flat angles P-C4'-P energy: -87.480 tors. eta vs tors. theta energy: -90.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1514.991628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1514.991628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1514.991628 (E_RNA) where: Base-Base interactions energy: -901.506 where: short stacking energy: -444.063 Base-Backbone interact. energy: -4.263 local terms energy: -609.222212 where: bonds (distance) C4'-P energy: -153.652 bonds (distance) P-C4' energy: -146.388 flat angles C4'-P-C4' energy: -143.199 flat angles P-C4'-P energy: -95.116 tors. eta vs tors. theta energy: -70.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1229.828155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.828155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.828155 (E_RNA) where: Base-Base interactions energy: -702.207 where: short stacking energy: -351.722 Base-Backbone interact. energy: 2.802 local terms energy: -530.422979 where: bonds (distance) C4'-P energy: -121.858 bonds (distance) P-C4' energy: -154.808 flat angles C4'-P-C4' energy: -142.278 flat angles P-C4'-P energy: -66.907 tors. eta vs tors. theta energy: -44.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -873.711369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -873.711369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -873.711369 (E_RNA) where: Base-Base interactions energy: -418.671 where: short stacking energy: -243.424 Base-Backbone interact. energy: -1.060 local terms energy: -453.980725 where: bonds (distance) C4'-P energy: -132.350 bonds (distance) P-C4' energy: -149.257 flat angles C4'-P-C4' energy: -128.639 flat angles P-C4'-P energy: -71.989 tors. eta vs tors. theta energy: 28.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2930.001886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2930.001886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2930.001886 (E_RNA) where: Base-Base interactions energy: -1938.710 where: short stacking energy: -877.825 Base-Backbone interact. energy: -1.480 local terms energy: -989.812333 where: bonds (distance) C4'-P energy: -206.778 bonds (distance) P-C4' energy: -203.951 flat angles C4'-P-C4' energy: -212.535 flat angles P-C4'-P energy: -121.282 tors. eta vs tors. theta energy: -245.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2497.094283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2497.094283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2497.094283 (E_RNA) where: Base-Base interactions energy: -1604.290 where: short stacking energy: -831.611 Base-Backbone interact. energy: -1.333 local terms energy: -891.470515 where: bonds (distance) C4'-P energy: -179.027 bonds (distance) P-C4' energy: -181.076 flat angles C4'-P-C4' energy: -179.012 flat angles P-C4'-P energy: -133.254 tors. eta vs tors. theta energy: -219.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -2499.910166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2499.910166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2499.910166 (E_RNA) where: Base-Base interactions energy: -1654.768 where: short stacking energy: -747.528 Base-Backbone interact. energy: -5.103 local terms energy: -840.039283 where: bonds (distance) C4'-P energy: -161.763 bonds (distance) P-C4' energy: -173.943 flat angles C4'-P-C4' energy: -202.240 flat angles P-C4'-P energy: -105.274 tors. eta vs tors. theta energy: -196.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -2318.957808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2318.957808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2318.957808 (E_RNA) where: Base-Base interactions energy: -1513.886 where: short stacking energy: -723.688 Base-Backbone interact. energy: -5.044 local terms energy: -800.027838 where: bonds (distance) C4'-P energy: -160.413 bonds (distance) P-C4' energy: -169.729 flat angles C4'-P-C4' energy: -177.761 flat angles P-C4'-P energy: -117.468 tors. eta vs tors. theta energy: -174.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -2218.191369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.191369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.191369 (E_RNA) where: Base-Base interactions energy: -1457.522 where: short stacking energy: -672.107 Base-Backbone interact. energy: -5.622 local terms energy: -755.047529 where: bonds (distance) C4'-P energy: -154.222 bonds (distance) P-C4' energy: -175.062 flat angles C4'-P-C4' energy: -163.556 flat angles P-C4'-P energy: -98.277 tors. eta vs tors. theta energy: -163.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1964.624071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.624071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.624071 (E_RNA) where: Base-Base interactions energy: -1272.068 where: short stacking energy: -587.727 Base-Backbone interact. energy: -3.633 local terms energy: -688.923090 where: bonds (distance) C4'-P energy: -135.161 bonds (distance) P-C4' energy: -164.984 flat angles C4'-P-C4' energy: -151.953 flat angles P-C4'-P energy: -107.504 tors. eta vs tors. theta energy: -129.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1679.104659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.104659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.104659 (E_RNA) where: Base-Base interactions energy: -998.130 where: short stacking energy: -495.764 Base-Backbone interact. energy: -3.337 local terms energy: -677.638103 where: bonds (distance) C4'-P energy: -156.607 bonds (distance) P-C4' energy: -153.204 flat angles C4'-P-C4' energy: -162.833 flat angles P-C4'-P energy: -107.395 tors. eta vs tors. theta energy: -97.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1544.857047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1544.857047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1544.857047 (E_RNA) where: Base-Base interactions energy: -969.236 where: short stacking energy: -481.288 Base-Backbone interact. energy: -0.235 local terms energy: -575.386475 where: bonds (distance) C4'-P energy: -126.451 bonds (distance) P-C4' energy: -143.389 flat angles C4'-P-C4' energy: -132.103 flat angles P-C4'-P energy: -99.280 tors. eta vs tors. theta energy: -74.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1370.261073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.261073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.261073 (E_RNA) where: Base-Base interactions energy: -801.351 where: short stacking energy: -381.626 Base-Backbone interact. energy: -1.683 local terms energy: -567.226844 where: bonds (distance) C4'-P energy: -156.256 bonds (distance) P-C4' energy: -139.868 flat angles C4'-P-C4' energy: -148.010 flat angles P-C4'-P energy: -71.798 tors. eta vs tors. theta energy: -51.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -1040.134555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.134555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.134555 (E_RNA) where: Base-Base interactions energy: -519.502 where: short stacking energy: -311.519 Base-Backbone interact. energy: 12.546 local terms energy: -533.178456 where: bonds (distance) C4'-P energy: -157.803 bonds (distance) P-C4' energy: -154.210 flat angles C4'-P-C4' energy: -133.904 flat angles P-C4'-P energy: -88.671 tors. eta vs tors. theta energy: 1.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2929.521572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2929.521572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2929.521572 (E_RNA) where: Base-Base interactions energy: -1978.443 where: short stacking energy: -920.870 Base-Backbone interact. energy: -3.834 local terms energy: -947.245178 where: bonds (distance) C4'-P energy: -184.851 bonds (distance) P-C4' energy: -181.923 flat angles C4'-P-C4' energy: -200.962 flat angles P-C4'-P energy: -134.017 tors. eta vs tors. theta energy: -245.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2560.845082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2560.845082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2560.845082 (E_RNA) where: Base-Base interactions energy: -1687.988 where: short stacking energy: -767.735 Base-Backbone interact. energy: -2.411 local terms energy: -870.446916 where: bonds (distance) C4'-P energy: -180.292 bonds (distance) P-C4' energy: -179.360 flat angles C4'-P-C4' energy: -195.350 flat angles P-C4'-P energy: -114.367 tors. eta vs tors. theta energy: -201.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -2431.819070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2431.819070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2431.819070 (E_RNA) where: Base-Base interactions energy: -1560.652 where: short stacking energy: -761.413 Base-Backbone interact. energy: -0.482 local terms energy: -870.685019 where: bonds (distance) C4'-P energy: -177.594 bonds (distance) P-C4' energy: -171.148 flat angles C4'-P-C4' energy: -198.420 flat angles P-C4'-P energy: -136.649 tors. eta vs tors. theta energy: -186.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -2326.961927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2326.961927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2326.961927 (E_RNA) where: Base-Base interactions energy: -1472.952 where: short stacking energy: -694.739 Base-Backbone interact. energy: 1.744 local terms energy: -855.753821 where: bonds (distance) C4'-P energy: -181.828 bonds (distance) P-C4' energy: -191.294 flat angles C4'-P-C4' energy: -172.386 flat angles P-C4'-P energy: -131.161 tors. eta vs tors. theta energy: -179.085 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -2324.258686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2324.258686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2324.258686 (E_RNA) where: Base-Base interactions energy: -1556.879 where: short stacking energy: -689.225 Base-Backbone interact. energy: -4.470 local terms energy: -762.910104 where: bonds (distance) C4'-P energy: -147.018 bonds (distance) P-C4' energy: -183.223 flat angles C4'-P-C4' energy: -148.008 flat angles P-C4'-P energy: -119.140 tors. eta vs tors. theta energy: -165.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1995.895943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1995.895943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1995.895943 (E_RNA) where: Base-Base interactions energy: -1285.518 where: short stacking energy: -624.006 Base-Backbone interact. energy: -0.270 local terms energy: -710.108389 where: bonds (distance) C4'-P energy: -111.760 bonds (distance) P-C4' energy: -165.655 flat angles C4'-P-C4' energy: -170.459 flat angles P-C4'-P energy: -112.402 tors. eta vs tors. theta energy: -149.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1694.590893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.590893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.590893 (E_RNA) where: Base-Base interactions energy: -1014.924 where: short stacking energy: -525.501 Base-Backbone interact. energy: -0.416 local terms energy: -679.251116 where: bonds (distance) C4'-P energy: -140.085 bonds (distance) P-C4' energy: -176.418 flat angles C4'-P-C4' energy: -151.725 flat angles P-C4'-P energy: -105.250 tors. eta vs tors. theta energy: -105.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1598.899995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.899995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.899995 (E_RNA) where: Base-Base interactions energy: -954.447 where: short stacking energy: -459.866 Base-Backbone interact. energy: -1.951 local terms energy: -642.502092 where: bonds (distance) C4'-P energy: -170.023 bonds (distance) P-C4' energy: -175.283 flat angles C4'-P-C4' energy: -145.804 flat angles P-C4'-P energy: -74.660 tors. eta vs tors. theta energy: -76.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1312.742629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1312.742629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1312.742629 (E_RNA) where: Base-Base interactions energy: -779.806 where: short stacking energy: -399.466 Base-Backbone interact. energy: -1.160 local terms energy: -531.777541 where: bonds (distance) C4'-P energy: -149.452 bonds (distance) P-C4' energy: -139.916 flat angles C4'-P-C4' energy: -119.372 flat angles P-C4'-P energy: -73.298 tors. eta vs tors. theta energy: -49.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1021.456542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.456542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.456542 (E_RNA) where: Base-Base interactions energy: -535.548 where: short stacking energy: -315.031 Base-Backbone interact. energy: -3.520 local terms energy: -482.388387 where: bonds (distance) C4'-P energy: -129.944 bonds (distance) P-C4' energy: -174.446 flat angles C4'-P-C4' energy: -130.646 flat angles P-C4'-P energy: -55.649 tors. eta vs tors. theta energy: 8.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2906.018258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2906.018258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2906.018258 (E_RNA) where: Base-Base interactions energy: -1955.765 where: short stacking energy: -892.336 Base-Backbone interact. energy: -3.131 local terms energy: -947.122701 where: bonds (distance) C4'-P energy: -190.227 bonds (distance) P-C4' energy: -187.472 flat angles C4'-P-C4' energy: -210.315 flat angles P-C4'-P energy: -133.159 tors. eta vs tors. theta energy: -225.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2648.998844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2648.998844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2648.998844 (E_RNA) where: Base-Base interactions energy: -1770.555 where: short stacking energy: -838.260 Base-Backbone interact. energy: -7.829 local terms energy: -870.614811 where: bonds (distance) C4'-P energy: -185.193 bonds (distance) P-C4' energy: -167.226 flat angles C4'-P-C4' energy: -183.772 flat angles P-C4'-P energy: -128.572 tors. eta vs tors. theta energy: -205.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -2331.811454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2331.811454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2331.811454 (E_RNA) where: Base-Base interactions energy: -1487.632 where: short stacking energy: -760.755 Base-Backbone interact. energy: -2.971 local terms energy: -841.208589 where: bonds (distance) C4'-P energy: -176.809 bonds (distance) P-C4' energy: -173.347 flat angles C4'-P-C4' energy: -205.342 flat angles P-C4'-P energy: -111.070 tors. eta vs tors. theta energy: -174.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -2377.981491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2377.981491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2377.981491 (E_RNA) where: Base-Base interactions energy: -1564.092 where: short stacking energy: -740.732 Base-Backbone interact. energy: -0.293 local terms energy: -813.596891 where: bonds (distance) C4'-P energy: -165.049 bonds (distance) P-C4' energy: -169.906 flat angles C4'-P-C4' energy: -174.262 flat angles P-C4'-P energy: -117.359 tors. eta vs tors. theta energy: -187.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -2311.932350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2311.932350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.932350 (E_RNA) where: Base-Base interactions energy: -1537.663 where: short stacking energy: -666.773 Base-Backbone interact. energy: -2.593 local terms energy: -771.676229 where: bonds (distance) C4'-P energy: -154.895 bonds (distance) P-C4' energy: -166.248 flat angles C4'-P-C4' energy: -176.264 flat angles P-C4'-P energy: -118.086 tors. eta vs tors. theta energy: -156.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1993.470271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.470271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1993.470271 (E_RNA) where: Base-Base interactions energy: -1264.542 where: short stacking energy: -601.815 Base-Backbone interact. energy: -3.312 local terms energy: -725.616455 where: bonds (distance) C4'-P energy: -152.381 bonds (distance) P-C4' energy: -156.574 flat angles C4'-P-C4' energy: -173.711 flat angles P-C4'-P energy: -112.018 tors. eta vs tors. theta energy: -130.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1659.619539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.619539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.619539 (E_RNA) where: Base-Base interactions energy: -980.800 where: short stacking energy: -492.672 Base-Backbone interact. energy: -1.892 local terms energy: -676.926980 where: bonds (distance) C4'-P energy: -158.773 bonds (distance) P-C4' energy: -168.304 flat angles C4'-P-C4' energy: -153.407 flat angles P-C4'-P energy: -104.786 tors. eta vs tors. theta energy: -91.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1643.510098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.510098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.510098 (E_RNA) where: Base-Base interactions energy: -1000.295 where: short stacking energy: -476.685 Base-Backbone interact. energy: -1.078 local terms energy: -642.136738 where: bonds (distance) C4'-P energy: -133.038 bonds (distance) P-C4' energy: -170.580 flat angles C4'-P-C4' energy: -163.072 flat angles P-C4'-P energy: -87.868 tors. eta vs tors. theta energy: -87.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1225.515975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.515975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.515975 (E_RNA) where: Base-Base interactions energy: -702.002 where: short stacking energy: -367.789 Base-Backbone interact. energy: -3.258 local terms energy: -520.255523 where: bonds (distance) C4'-P energy: -137.659 bonds (distance) P-C4' energy: -164.780 flat angles C4'-P-C4' energy: -109.058 flat angles P-C4'-P energy: -82.872 tors. eta vs tors. theta energy: -25.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1001.835571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.835571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.835571 (E_RNA) where: Base-Base interactions energy: -523.731 where: short stacking energy: -280.230 Base-Backbone interact. energy: -3.489 local terms energy: -474.615879 where: bonds (distance) C4'-P energy: -127.731 bonds (distance) P-C4' energy: -137.028 flat angles C4'-P-C4' energy: -138.104 flat angles P-C4'-P energy: -88.785 tors. eta vs tors. theta energy: 17.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2923.480488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2923.480488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2923.480488 (E_RNA) where: Base-Base interactions energy: -1992.899 where: short stacking energy: -872.367 Base-Backbone interact. energy: -1.391 local terms energy: -929.190492 where: bonds (distance) C4'-P energy: -177.661 bonds (distance) P-C4' energy: -187.900 flat angles C4'-P-C4' energy: -210.970 flat angles P-C4'-P energy: -121.744 tors. eta vs tors. theta energy: -230.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2718.798804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2718.798804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2718.798804 (E_RNA) where: Base-Base interactions energy: -1786.315 where: short stacking energy: -859.778 Base-Backbone interact. energy: -5.053 local terms energy: -927.431347 where: bonds (distance) C4'-P energy: -170.586 bonds (distance) P-C4' energy: -181.276 flat angles C4'-P-C4' energy: -199.776 flat angles P-C4'-P energy: -136.354 tors. eta vs tors. theta energy: -239.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -2366.559947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.559947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2366.559947 (E_RNA) where: Base-Base interactions energy: -1518.701 where: short stacking energy: -743.300 Base-Backbone interact. energy: -4.299 local terms energy: -843.560382 where: bonds (distance) C4'-P energy: -165.397 bonds (distance) P-C4' energy: -184.009 flat angles C4'-P-C4' energy: -190.222 flat angles P-C4'-P energy: -120.586 tors. eta vs tors. theta energy: -183.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -2355.877571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.877571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.877571 (E_RNA) where: Base-Base interactions energy: -1517.311 where: short stacking energy: -724.293 Base-Backbone interact. energy: -3.525 local terms energy: -835.041033 where: bonds (distance) C4'-P energy: -169.643 bonds (distance) P-C4' energy: -173.244 flat angles C4'-P-C4' energy: -193.760 flat angles P-C4'-P energy: -127.809 tors. eta vs tors. theta energy: -170.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -2342.159774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2342.159774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2342.159774 (E_RNA) where: Base-Base interactions energy: -1549.524 where: short stacking energy: -692.034 Base-Backbone interact. energy: -5.001 local terms energy: -787.634836 where: bonds (distance) C4'-P energy: -166.040 bonds (distance) P-C4' energy: -144.574 flat angles C4'-P-C4' energy: -178.147 flat angles P-C4'-P energy: -124.144 tors. eta vs tors. theta energy: -174.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1946.405715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1946.405715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1946.405715 (E_RNA) where: Base-Base interactions energy: -1190.537 where: short stacking energy: -544.368 Base-Backbone interact. energy: 3.950 local terms energy: -759.818451 where: bonds (distance) C4'-P energy: -155.518 bonds (distance) P-C4' energy: -195.391 flat angles C4'-P-C4' energy: -175.956 flat angles P-C4'-P energy: -112.866 tors. eta vs tors. theta energy: -120.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1658.050748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.050748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.050748 (E_RNA) where: Base-Base interactions energy: -984.042 where: short stacking energy: -498.683 Base-Backbone interact. energy: 0.462 local terms energy: -674.469879 where: bonds (distance) C4'-P energy: -174.589 bonds (distance) P-C4' energy: -148.663 flat angles C4'-P-C4' energy: -156.562 flat angles P-C4'-P energy: -102.262 tors. eta vs tors. theta energy: -92.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1598.617401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.617401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.617401 (E_RNA) where: Base-Base interactions energy: -939.900 where: short stacking energy: -441.631 Base-Backbone interact. energy: -3.639 local terms energy: -655.078388 where: bonds (distance) C4'-P energy: -157.375 bonds (distance) P-C4' energy: -170.798 flat angles C4'-P-C4' energy: -162.352 flat angles P-C4'-P energy: -98.657 tors. eta vs tors. theta energy: -65.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1247.119020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.119020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.119020 (E_RNA) where: Base-Base interactions energy: -704.660 where: short stacking energy: -393.690 Base-Backbone interact. energy: -2.326 local terms energy: -540.133463 where: bonds (distance) C4'-P energy: -156.139 bonds (distance) P-C4' energy: -137.344 flat angles C4'-P-C4' energy: -140.643 flat angles P-C4'-P energy: -67.867 tors. eta vs tors. theta energy: -38.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -980.573878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.573878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.573878 (E_RNA) where: Base-Base interactions energy: -514.159 where: short stacking energy: -253.525 Base-Backbone interact. energy: 0.566 local terms energy: -466.981311 where: bonds (distance) C4'-P energy: -160.395 bonds (distance) P-C4' energy: -125.783 flat angles C4'-P-C4' energy: -112.535 flat angles P-C4'-P energy: -79.010 tors. eta vs tors. theta energy: 10.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2911.343384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2911.343384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2911.343384 (E_RNA) where: Base-Base interactions energy: -1968.630 where: short stacking energy: -907.326 Base-Backbone interact. energy: -3.275 local terms energy: -939.438329 where: bonds (distance) C4'-P energy: -181.548 bonds (distance) P-C4' energy: -182.997 flat angles C4'-P-C4' energy: -209.227 flat angles P-C4'-P energy: -135.690 tors. eta vs tors. theta energy: -229.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2702.403324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2702.403324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2702.403324 (E_RNA) where: Base-Base interactions energy: -1821.906 where: short stacking energy: -863.705 Base-Backbone interact. energy: -1.643 local terms energy: -878.854745 where: bonds (distance) C4'-P energy: -168.508 bonds (distance) P-C4' energy: -173.333 flat angles C4'-P-C4' energy: -196.534 flat angles P-C4'-P energy: -117.150 tors. eta vs tors. theta energy: -223.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2428.651776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2428.651776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2428.651776 (E_RNA) where: Base-Base interactions energy: -1560.678 where: short stacking energy: -730.423 Base-Backbone interact. energy: -6.635 local terms energy: -861.339385 where: bonds (distance) C4'-P energy: -185.759 bonds (distance) P-C4' energy: -168.574 flat angles C4'-P-C4' energy: -194.787 flat angles P-C4'-P energy: -130.367 tors. eta vs tors. theta energy: -181.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2216.069307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.069307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2216.069307 (E_RNA) where: Base-Base interactions energy: -1437.536 where: short stacking energy: -662.455 Base-Backbone interact. energy: -3.592 local terms energy: -774.941906 where: bonds (distance) C4'-P energy: -162.923 bonds (distance) P-C4' energy: -181.085 flat angles C4'-P-C4' energy: -173.502 flat angles P-C4'-P energy: -112.906 tors. eta vs tors. theta energy: -144.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -2360.230799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2360.230799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2360.230799 (E_RNA) where: Base-Base interactions energy: -1558.336 where: short stacking energy: -735.217 Base-Backbone interact. energy: 0.366 local terms energy: -802.259999 where: bonds (distance) C4'-P energy: -152.093 bonds (distance) P-C4' energy: -155.202 flat angles C4'-P-C4' energy: -191.169 flat angles P-C4'-P energy: -114.863 tors. eta vs tors. theta energy: -188.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1923.401658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1923.401658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1923.401658 (E_RNA) where: Base-Base interactions energy: -1245.529 where: short stacking energy: -554.498 Base-Backbone interact. energy: -1.153 local terms energy: -676.720218 where: bonds (distance) C4'-P energy: -141.857 bonds (distance) P-C4' energy: -154.235 flat angles C4'-P-C4' energy: -161.196 flat angles P-C4'-P energy: -107.410 tors. eta vs tors. theta energy: -112.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1668.017936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.017936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.017936 (E_RNA) where: Base-Base interactions energy: -998.770 where: short stacking energy: -518.527 Base-Backbone interact. energy: 0.731 local terms energy: -669.979423 where: bonds (distance) C4'-P energy: -140.823 bonds (distance) P-C4' energy: -169.453 flat angles C4'-P-C4' energy: -157.469 flat angles P-C4'-P energy: -103.628 tors. eta vs tors. theta energy: -98.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1739.622324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.622324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.622324 (E_RNA) where: Base-Base interactions energy: -1113.366 where: short stacking energy: -502.222 Base-Backbone interact. energy: 0.859 local terms energy: -627.114846 where: bonds (distance) C4'-P energy: -137.640 bonds (distance) P-C4' energy: -160.041 flat angles C4'-P-C4' energy: -152.824 flat angles P-C4'-P energy: -86.849 tors. eta vs tors. theta energy: -89.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1223.075178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1223.075178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1223.075178 (E_RNA) where: Base-Base interactions energy: -722.075 where: short stacking energy: -357.015 Base-Backbone interact. energy: -0.902 local terms energy: -500.097953 where: bonds (distance) C4'-P energy: -141.292 bonds (distance) P-C4' energy: -138.490 flat angles C4'-P-C4' energy: -140.938 flat angles P-C4'-P energy: -57.874 tors. eta vs tors. theta energy: -21.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -1008.863636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.863636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.863636 (E_RNA) where: Base-Base interactions energy: -523.133 where: short stacking energy: -302.877 Base-Backbone interact. energy: 2.407 local terms energy: -488.138182 where: bonds (distance) C4'-P energy: -123.376 bonds (distance) P-C4' energy: -143.445 flat angles C4'-P-C4' energy: -129.258 flat angles P-C4'-P energy: -86.815 tors. eta vs tors. theta energy: -5.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2964.998869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2964.998869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2964.998869 (E_RNA) where: Base-Base interactions energy: -2030.433 where: short stacking energy: -893.526 Base-Backbone interact. energy: -0.866 local terms energy: -933.699585 where: bonds (distance) C4'-P energy: -174.508 bonds (distance) P-C4' energy: -194.498 flat angles C4'-P-C4' energy: -206.681 flat angles P-C4'-P energy: -120.644 tors. eta vs tors. theta energy: -237.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2686.185154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2686.185154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2686.185154 (E_RNA) where: Base-Base interactions energy: -1792.030 where: short stacking energy: -819.246 Base-Backbone interact. energy: -1.893 local terms energy: -892.262300 where: bonds (distance) C4'-P energy: -178.432 bonds (distance) P-C4' energy: -186.388 flat angles C4'-P-C4' energy: -191.834 flat angles P-C4'-P energy: -133.176 tors. eta vs tors. theta energy: -202.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2499.827717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2499.827717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2499.827717 (E_RNA) where: Base-Base interactions energy: -1639.157 where: short stacking energy: -785.430 Base-Backbone interact. energy: -5.007 local terms energy: -855.663763 where: bonds (distance) C4'-P energy: -181.520 bonds (distance) P-C4' energy: -174.585 flat angles C4'-P-C4' energy: -182.456 flat angles P-C4'-P energy: -119.958 tors. eta vs tors. theta energy: -197.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -2511.015926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2511.015926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2511.015926 (E_RNA) where: Base-Base interactions energy: -1685.187 where: short stacking energy: -771.942 Base-Backbone interact. energy: 0.096 local terms energy: -825.924695 where: bonds (distance) C4'-P energy: -153.790 bonds (distance) P-C4' energy: -166.391 flat angles C4'-P-C4' energy: -182.920 flat angles P-C4'-P energy: -129.704 tors. eta vs tors. theta energy: -193.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -2142.015131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2142.015131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2142.015131 (E_RNA) where: Base-Base interactions energy: -1381.424 where: short stacking energy: -661.273 Base-Backbone interact. energy: -2.008 local terms energy: -758.582991 where: bonds (distance) C4'-P energy: -146.205 bonds (distance) P-C4' energy: -177.046 flat angles C4'-P-C4' energy: -174.103 flat angles P-C4'-P energy: -109.243 tors. eta vs tors. theta energy: -151.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -2002.067446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2002.067446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2002.067446 (E_RNA) where: Base-Base interactions energy: -1265.617 where: short stacking energy: -603.659 Base-Backbone interact. energy: 1.604 local terms energy: -738.054737 where: bonds (distance) C4'-P energy: -143.055 bonds (distance) P-C4' energy: -180.772 flat angles C4'-P-C4' energy: -173.090 flat angles P-C4'-P energy: -89.248 tors. eta vs tors. theta energy: -151.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1725.604882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1725.604882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1725.604882 (E_RNA) where: Base-Base interactions energy: -1059.512 where: short stacking energy: -535.212 Base-Backbone interact. energy: -1.934 local terms energy: -664.158565 where: bonds (distance) C4'-P energy: -146.905 bonds (distance) P-C4' energy: -154.976 flat angles C4'-P-C4' energy: -170.510 flat angles P-C4'-P energy: -89.111 tors. eta vs tors. theta energy: -102.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1754.135147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1754.135147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.135147 (E_RNA) where: Base-Base interactions energy: -1115.269 where: short stacking energy: -534.994 Base-Backbone interact. energy: 1.825 local terms energy: -640.691345 where: bonds (distance) C4'-P energy: -144.000 bonds (distance) P-C4' energy: -127.957 flat angles C4'-P-C4' energy: -145.838 flat angles P-C4'-P energy: -111.624 tors. eta vs tors. theta energy: -111.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1193.625983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.625983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.625983 (E_RNA) where: Base-Base interactions energy: -632.907 where: short stacking energy: -348.511 Base-Backbone interact. energy: 9.005 local terms energy: -569.724259 where: bonds (distance) C4'-P energy: -141.295 bonds (distance) P-C4' energy: -153.546 flat angles C4'-P-C4' energy: -150.116 flat angles P-C4'-P energy: -90.934 tors. eta vs tors. theta energy: -33.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -983.585337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.585337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.585337 (E_RNA) where: Base-Base interactions energy: -524.623 where: short stacking energy: -298.721 Base-Backbone interact. energy: -2.243 local terms energy: -456.719855 where: bonds (distance) C4'-P energy: -117.610 bonds (distance) P-C4' energy: -157.101 flat angles C4'-P-C4' energy: -123.195 flat angles P-C4'-P energy: -52.761 tors. eta vs tors. theta energy: -6.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2944.438405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2944.438405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2944.438405 (E_RNA) where: Base-Base interactions energy: -2009.578 where: short stacking energy: -898.767 Base-Backbone interact. energy: -3.483 local terms energy: -931.377625 where: bonds (distance) C4'-P energy: -178.561 bonds (distance) P-C4' energy: -188.219 flat angles C4'-P-C4' energy: -215.195 flat angles P-C4'-P energy: -124.155 tors. eta vs tors. theta energy: -225.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2763.994501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2763.994501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2763.994501 (E_RNA) where: Base-Base interactions energy: -1874.861 where: short stacking energy: -832.218 Base-Backbone interact. energy: -5.254 local terms energy: -883.880026 where: bonds (distance) C4'-P energy: -171.283 bonds (distance) P-C4' energy: -173.853 flat angles C4'-P-C4' energy: -190.636 flat angles P-C4'-P energy: -125.079 tors. eta vs tors. theta energy: -223.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2481.498616 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2481.498616 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2481.498616 (E_RNA) where: Base-Base interactions energy: -1671.996 where: short stacking energy: -792.537 Base-Backbone interact. energy: -2.808 local terms energy: -806.695174 where: bonds (distance) C4'-P energy: -159.204 bonds (distance) P-C4' energy: -166.669 flat angles C4'-P-C4' energy: -192.191 flat angles P-C4'-P energy: -96.974 tors. eta vs tors. theta energy: -191.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -2570.644182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2570.644182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2570.644182 (E_RNA) where: Base-Base interactions energy: -1773.536 where: short stacking energy: -748.432 Base-Backbone interact. energy: -2.493 local terms energy: -794.615545 where: bonds (distance) C4'-P energy: -163.499 bonds (distance) P-C4' energy: -181.341 flat angles C4'-P-C4' energy: -166.159 flat angles P-C4'-P energy: -122.473 tors. eta vs tors. theta energy: -161.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -2170.220100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2170.220100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2170.220100 (E_RNA) where: Base-Base interactions energy: -1394.842 where: short stacking energy: -686.555 Base-Backbone interact. energy: 1.448 local terms energy: -776.826407 where: bonds (distance) C4'-P energy: -166.769 bonds (distance) P-C4' energy: -182.078 flat angles C4'-P-C4' energy: -171.251 flat angles P-C4'-P energy: -106.053 tors. eta vs tors. theta energy: -150.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1972.097055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1972.097055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1972.097055 (E_RNA) where: Base-Base interactions energy: -1232.989 where: short stacking energy: -552.750 Base-Backbone interact. energy: -3.465 local terms energy: -735.642987 where: bonds (distance) C4'-P energy: -171.944 bonds (distance) P-C4' energy: -179.965 flat angles C4'-P-C4' energy: -165.749 flat angles P-C4'-P energy: -100.541 tors. eta vs tors. theta energy: -117.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1743.111556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1743.111556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.111556 (E_RNA) where: Base-Base interactions energy: -1095.133 where: short stacking energy: -525.558 Base-Backbone interact. energy: -0.170 local terms energy: -647.809012 where: bonds (distance) C4'-P energy: -156.675 bonds (distance) P-C4' energy: -150.619 flat angles C4'-P-C4' energy: -152.911 flat angles P-C4'-P energy: -107.932 tors. eta vs tors. theta energy: -79.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1702.861383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.861383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.861383 (E_RNA) where: Base-Base interactions energy: -1068.354 where: short stacking energy: -480.120 Base-Backbone interact. energy: -0.826 local terms energy: -633.680562 where: bonds (distance) C4'-P energy: -151.408 bonds (distance) P-C4' energy: -153.982 flat angles C4'-P-C4' energy: -159.603 flat angles P-C4'-P energy: -88.271 tors. eta vs tors. theta energy: -80.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1192.326525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.326525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.326525 (E_RNA) where: Base-Base interactions energy: -631.352 where: short stacking energy: -338.884 Base-Backbone interact. energy: -2.415 local terms energy: -558.559771 where: bonds (distance) C4'-P energy: -138.725 bonds (distance) P-C4' energy: -162.147 flat angles C4'-P-C4' energy: -149.151 flat angles P-C4'-P energy: -88.843 tors. eta vs tors. theta energy: -19.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -1105.266724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1105.266724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1105.266724 (E_RNA) where: Base-Base interactions energy: -590.371 where: short stacking energy: -297.704 Base-Backbone interact. energy: -0.261 local terms energy: -514.634967 where: bonds (distance) C4'-P energy: -132.766 bonds (distance) P-C4' energy: -157.943 flat angles C4'-P-C4' energy: -137.833 flat angles P-C4'-P energy: -70.257 tors. eta vs tors. theta energy: -15.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2948.673642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2948.673642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2948.673642 (E_RNA) where: Base-Base interactions energy: -2021.696 where: short stacking energy: -901.706 Base-Backbone interact. energy: 0.425 local terms energy: -927.402153 where: bonds (distance) C4'-P energy: -190.109 bonds (distance) P-C4' energy: -183.262 flat angles C4'-P-C4' energy: -186.085 flat angles P-C4'-P energy: -125.990 tors. eta vs tors. theta energy: -241.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2784.575389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2784.575389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2784.575389 (E_RNA) where: Base-Base interactions energy: -1874.649 where: short stacking energy: -840.490 Base-Backbone interact. energy: -0.155 local terms energy: -909.771397 where: bonds (distance) C4'-P energy: -172.777 bonds (distance) P-C4' energy: -186.558 flat angles C4'-P-C4' energy: -192.776 flat angles P-C4'-P energy: -125.570 tors. eta vs tors. theta energy: -232.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2434.857202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2434.857202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2434.857202 (E_RNA) where: Base-Base interactions energy: -1604.484 where: short stacking energy: -730.408 Base-Backbone interact. energy: -2.135 local terms energy: -828.238312 where: bonds (distance) C4'-P energy: -168.038 bonds (distance) P-C4' energy: -172.902 flat angles C4'-P-C4' energy: -200.452 flat angles P-C4'-P energy: -122.759 tors. eta vs tors. theta energy: -164.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -2623.223180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2623.223180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2623.223180 (E_RNA) where: Base-Base interactions energy: -1781.470 where: short stacking energy: -801.407 Base-Backbone interact. energy: -5.066 local terms energy: -836.687639 where: bonds (distance) C4'-P energy: -142.479 bonds (distance) P-C4' energy: -166.401 flat angles C4'-P-C4' energy: -207.836 flat angles P-C4'-P energy: -111.879 tors. eta vs tors. theta energy: -208.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -2199.778172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.778172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2199.778172 (E_RNA) where: Base-Base interactions energy: -1443.081 where: short stacking energy: -682.866 Base-Backbone interact. energy: -0.182 local terms energy: -756.515067 where: bonds (distance) C4'-P energy: -147.963 bonds (distance) P-C4' energy: -160.483 flat angles C4'-P-C4' energy: -179.977 flat angles P-C4'-P energy: -110.619 tors. eta vs tors. theta energy: -157.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -2033.214828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.214828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.214828 (E_RNA) where: Base-Base interactions energy: -1320.571 where: short stacking energy: -621.401 Base-Backbone interact. energy: -4.991 local terms energy: -707.652496 where: bonds (distance) C4'-P energy: -159.726 bonds (distance) P-C4' energy: -151.624 flat angles C4'-P-C4' energy: -169.198 flat angles P-C4'-P energy: -93.222 tors. eta vs tors. theta energy: -133.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1772.432567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1772.432567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.432567 (E_RNA) where: Base-Base interactions energy: -1125.220 where: short stacking energy: -527.502 Base-Backbone interact. energy: 8.883 local terms energy: -656.095838 where: bonds (distance) C4'-P energy: -131.062 bonds (distance) P-C4' energy: -147.225 flat angles C4'-P-C4' energy: -164.216 flat angles P-C4'-P energy: -114.650 tors. eta vs tors. theta energy: -98.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1727.923728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.923728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.923728 (E_RNA) where: Base-Base interactions energy: -1091.806 where: short stacking energy: -488.119 Base-Backbone interact. energy: -0.834 local terms energy: -635.283514 where: bonds (distance) C4'-P energy: -147.922 bonds (distance) P-C4' energy: -141.790 flat angles C4'-P-C4' energy: -155.337 flat angles P-C4'-P energy: -113.100 tors. eta vs tors. theta energy: -77.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1196.783528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.783528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.783528 (E_RNA) where: Base-Base interactions energy: -693.521 where: short stacking energy: -360.504 Base-Backbone interact. energy: 4.690 local terms energy: -507.952260 where: bonds (distance) C4'-P energy: -149.322 bonds (distance) P-C4' energy: -139.780 flat angles C4'-P-C4' energy: -118.038 flat angles P-C4'-P energy: -82.683 tors. eta vs tors. theta energy: -18.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -1151.460826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.460826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1151.460826 (E_RNA) where: Base-Base interactions energy: -666.051 where: short stacking energy: -311.536 Base-Backbone interact. energy: 13.806 local terms energy: -499.215925 where: bonds (distance) C4'-P energy: -136.644 bonds (distance) P-C4' energy: -148.682 flat angles C4'-P-C4' energy: -138.499 flat angles P-C4'-P energy: -74.941 tors. eta vs tors. theta energy: -0.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2973.362694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2973.362694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2973.362694 (E_RNA) where: Base-Base interactions energy: -2012.267 where: short stacking energy: -921.468 Base-Backbone interact. energy: -9.173 local terms energy: -951.922440 where: bonds (distance) C4'-P energy: -190.049 bonds (distance) P-C4' energy: -183.941 flat angles C4'-P-C4' energy: -219.155 flat angles P-C4'-P energy: -120.702 tors. eta vs tors. theta energy: -238.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2766.553626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2766.553626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2766.553626 (E_RNA) where: Base-Base interactions energy: -1869.254 where: short stacking energy: -806.754 Base-Backbone interact. energy: -4.481 local terms energy: -892.819130 where: bonds (distance) C4'-P energy: -178.699 bonds (distance) P-C4' energy: -185.391 flat angles C4'-P-C4' energy: -202.933 flat angles P-C4'-P energy: -126.043 tors. eta vs tors. theta energy: -199.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2686.653955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2686.653955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2686.653955 (E_RNA) where: Base-Base interactions energy: -1824.524 where: short stacking energy: -780.469 Base-Backbone interact. energy: -6.211 local terms energy: -855.919112 where: bonds (distance) C4'-P energy: -182.856 bonds (distance) P-C4' energy: -170.757 flat angles C4'-P-C4' energy: -200.365 flat angles P-C4'-P energy: -109.560 tors. eta vs tors. theta energy: -192.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -2328.528879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2328.528879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2328.528879 (E_RNA) where: Base-Base interactions energy: -1523.319 where: short stacking energy: -729.534 Base-Backbone interact. energy: -4.378 local terms energy: -800.831820 where: bonds (distance) C4'-P energy: -176.411 bonds (distance) P-C4' energy: -152.292 flat angles C4'-P-C4' energy: -195.253 flat angles P-C4'-P energy: -99.754 tors. eta vs tors. theta energy: -177.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -2102.679361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2102.679361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2102.679361 (E_RNA) where: Base-Base interactions energy: -1331.855 where: short stacking energy: -654.872 Base-Backbone interact. energy: -2.000 local terms energy: -768.824467 where: bonds (distance) C4'-P energy: -158.128 bonds (distance) P-C4' energy: -163.260 flat angles C4'-P-C4' energy: -165.106 flat angles P-C4'-P energy: -128.711 tors. eta vs tors. theta energy: -153.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1950.167023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1950.167023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1950.167023 (E_RNA) where: Base-Base interactions energy: -1220.564 where: short stacking energy: -597.392 Base-Backbone interact. energy: -2.206 local terms energy: -727.396913 where: bonds (distance) C4'-P energy: -142.841 bonds (distance) P-C4' energy: -187.021 flat angles C4'-P-C4' energy: -155.568 flat angles P-C4'-P energy: -112.974 tors. eta vs tors. theta energy: -128.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1843.148611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1843.148611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1843.148611 (E_RNA) where: Base-Base interactions energy: -1174.109 where: short stacking energy: -562.883 Base-Backbone interact. energy: -2.624 local terms energy: -666.415474 where: bonds (distance) C4'-P energy: -135.109 bonds (distance) P-C4' energy: -153.528 flat angles C4'-P-C4' energy: -159.314 flat angles P-C4'-P energy: -100.570 tors. eta vs tors. theta energy: -117.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1639.773715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1639.773715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1639.773715 (E_RNA) where: Base-Base interactions energy: -1025.122 where: short stacking energy: -477.488 Base-Backbone interact. energy: -0.062 local terms energy: -614.589754 where: bonds (distance) C4'-P energy: -144.187 bonds (distance) P-C4' energy: -158.771 flat angles C4'-P-C4' energy: -143.407 flat angles P-C4'-P energy: -76.287 tors. eta vs tors. theta energy: -91.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1180.431855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.431855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.431855 (E_RNA) where: Base-Base interactions energy: -671.866 where: short stacking energy: -361.033 Base-Backbone interact. energy: 1.197 local terms energy: -509.762403 where: bonds (distance) C4'-P energy: -129.566 bonds (distance) P-C4' energy: -150.390 flat angles C4'-P-C4' energy: -104.168 flat angles P-C4'-P energy: -90.136 tors. eta vs tors. theta energy: -35.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -1090.168732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.168732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.168732 (E_RNA) where: Base-Base interactions energy: -594.278 where: short stacking energy: -321.689 Base-Backbone interact. energy: -3.591 local terms energy: -492.299277 where: bonds (distance) C4'-P energy: -138.417 bonds (distance) P-C4' energy: -140.200 flat angles C4'-P-C4' energy: -142.123 flat angles P-C4'-P energy: -68.232 tors. eta vs tors. theta energy: -3.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2947.569006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2947.569006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2947.569006 (E_RNA) where: Base-Base interactions energy: -1976.190 where: short stacking energy: -885.227 Base-Backbone interact. energy: -2.591 local terms energy: -968.787429 where: bonds (distance) C4'-P energy: -154.916 bonds (distance) P-C4' energy: -196.648 flat angles C4'-P-C4' energy: -212.217 flat angles P-C4'-P energy: -153.490 tors. eta vs tors. theta energy: -251.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2758.450293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2758.450293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2758.450293 (E_RNA) where: Base-Base interactions energy: -1853.500 where: short stacking energy: -821.193 Base-Backbone interact. energy: -2.350 local terms energy: -902.600231 where: bonds (distance) C4'-P energy: -189.162 bonds (distance) P-C4' energy: -170.993 flat angles C4'-P-C4' energy: -179.410 flat angles P-C4'-P energy: -141.865 tors. eta vs tors. theta energy: -221.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2733.096854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2733.096854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2733.096854 (E_RNA) where: Base-Base interactions energy: -1848.577 where: short stacking energy: -817.689 Base-Backbone interact. energy: -1.790 local terms energy: -882.729899 where: bonds (distance) C4'-P energy: -184.244 bonds (distance) P-C4' energy: -176.764 flat angles C4'-P-C4' energy: -197.121 flat angles P-C4'-P energy: -127.650 tors. eta vs tors. theta energy: -196.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -2368.591396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2368.591396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2368.591396 (E_RNA) where: Base-Base interactions energy: -1534.229 where: short stacking energy: -730.261 Base-Backbone interact. energy: -2.078 local terms energy: -832.284804 where: bonds (distance) C4'-P energy: -164.482 bonds (distance) P-C4' energy: -171.730 flat angles C4'-P-C4' energy: -198.882 flat angles P-C4'-P energy: -103.810 tors. eta vs tors. theta energy: -193.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -2107.935297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2107.935297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2107.935297 (E_RNA) where: Base-Base interactions energy: -1378.704 where: short stacking energy: -637.267 Base-Backbone interact. energy: 4.133 local terms energy: -733.364571 where: bonds (distance) C4'-P energy: -148.827 bonds (distance) P-C4' energy: -174.211 flat angles C4'-P-C4' energy: -164.446 flat angles P-C4'-P energy: -107.268 tors. eta vs tors. theta energy: -138.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1979.712916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1979.712916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1979.712916 (E_RNA) where: Base-Base interactions energy: -1205.538 where: short stacking energy: -605.722 Base-Backbone interact. energy: 8.231 local terms energy: -782.405887 where: bonds (distance) C4'-P energy: -174.103 bonds (distance) P-C4' energy: -171.741 flat angles C4'-P-C4' energy: -180.249 flat angles P-C4'-P energy: -114.027 tors. eta vs tors. theta energy: -142.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1953.027413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1953.027413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1953.027413 (E_RNA) where: Base-Base interactions energy: -1256.032 where: short stacking energy: -585.938 Base-Backbone interact. energy: 2.009 local terms energy: -699.004756 where: bonds (distance) C4'-P energy: -152.188 bonds (distance) P-C4' energy: -158.735 flat angles C4'-P-C4' energy: -158.531 flat angles P-C4'-P energy: -94.001 tors. eta vs tors. theta energy: -135.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1640.844623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.844623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.844623 (E_RNA) where: Base-Base interactions energy: -1062.386 where: short stacking energy: -469.110 Base-Backbone interact. energy: 1.102 local terms energy: -579.560943 where: bonds (distance) C4'-P energy: -151.261 bonds (distance) P-C4' energy: -155.836 flat angles C4'-P-C4' energy: -151.266 flat angles P-C4'-P energy: -58.537 tors. eta vs tors. theta energy: -62.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1259.098974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.098974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.098974 (E_RNA) where: Base-Base interactions energy: -748.093 where: short stacking energy: -376.369 Base-Backbone interact. energy: -2.198 local terms energy: -508.807694 where: bonds (distance) C4'-P energy: -121.640 bonds (distance) P-C4' energy: -145.580 flat angles C4'-P-C4' energy: -123.904 flat angles P-C4'-P energy: -105.469 tors. eta vs tors. theta energy: -12.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -1067.370989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.370989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.370989 (E_RNA) where: Base-Base interactions energy: -586.783 where: short stacking energy: -267.689 Base-Backbone interact. energy: 3.190 local terms energy: -483.777738 where: bonds (distance) C4'-P energy: -146.340 bonds (distance) P-C4' energy: -155.728 flat angles C4'-P-C4' energy: -135.106 flat angles P-C4'-P energy: -62.991 tors. eta vs tors. theta energy: 16.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2936.437560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2936.437560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2936.437560 (E_RNA) where: Base-Base interactions energy: -2022.326 where: short stacking energy: -891.129 Base-Backbone interact. energy: 0.619 local terms energy: -914.731277 where: bonds (distance) C4'-P energy: -178.286 bonds (distance) P-C4' energy: -176.190 flat angles C4'-P-C4' energy: -205.741 flat angles P-C4'-P energy: -118.280 tors. eta vs tors. theta energy: -236.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2777.500428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2777.500428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2777.500428 (E_RNA) where: Base-Base interactions energy: -1866.372 where: short stacking energy: -849.224 Base-Backbone interact. energy: -6.186 local terms energy: -904.942342 where: bonds (distance) C4'-P energy: -179.568 bonds (distance) P-C4' energy: -180.323 flat angles C4'-P-C4' energy: -187.462 flat angles P-C4'-P energy: -128.213 tors. eta vs tors. theta energy: -229.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2733.679370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2733.679370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2733.679370 (E_RNA) where: Base-Base interactions energy: -1884.537 where: short stacking energy: -800.118 Base-Backbone interact. energy: -6.334 local terms energy: -842.808556 where: bonds (distance) C4'-P energy: -163.780 bonds (distance) P-C4' energy: -172.948 flat angles C4'-P-C4' energy: -181.315 flat angles P-C4'-P energy: -131.707 tors. eta vs tors. theta energy: -193.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -2316.357364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.357364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2316.357364 (E_RNA) where: Base-Base interactions energy: -1526.206 where: short stacking energy: -684.909 Base-Backbone interact. energy: -0.362 local terms energy: -789.789083 where: bonds (distance) C4'-P energy: -162.267 bonds (distance) P-C4' energy: -166.242 flat angles C4'-P-C4' energy: -177.244 flat angles P-C4'-P energy: -103.394 tors. eta vs tors. theta energy: -180.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -2117.148191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2117.148191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2117.148191 (E_RNA) where: Base-Base interactions energy: -1356.741 where: short stacking energy: -661.827 Base-Backbone interact. energy: 1.450 local terms energy: -761.857305 where: bonds (distance) C4'-P energy: -155.528 bonds (distance) P-C4' energy: -168.329 flat angles C4'-P-C4' energy: -185.373 flat angles P-C4'-P energy: -102.157 tors. eta vs tors. theta energy: -150.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1914.781936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.781936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.781936 (E_RNA) where: Base-Base interactions energy: -1183.995 where: short stacking energy: -598.375 Base-Backbone interact. energy: 1.881 local terms energy: -732.668625 where: bonds (distance) C4'-P energy: -156.653 bonds (distance) P-C4' energy: -167.541 flat angles C4'-P-C4' energy: -177.328 flat angles P-C4'-P energy: -109.322 tors. eta vs tors. theta energy: -121.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1994.514652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1994.514652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1994.514652 (E_RNA) where: Base-Base interactions energy: -1290.066 where: short stacking energy: -588.474 Base-Backbone interact. energy: -2.973 local terms energy: -701.475863 where: bonds (distance) C4'-P energy: -160.244 bonds (distance) P-C4' energy: -143.786 flat angles C4'-P-C4' energy: -173.483 flat angles P-C4'-P energy: -100.749 tors. eta vs tors. theta energy: -123.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1787.663064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.663064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.663064 (E_RNA) where: Base-Base interactions energy: -1141.099 where: short stacking energy: -521.912 Base-Backbone interact. energy: 4.799 local terms energy: -651.362877 where: bonds (distance) C4'-P energy: -153.121 bonds (distance) P-C4' energy: -150.361 flat angles C4'-P-C4' energy: -146.220 flat angles P-C4'-P energy: -115.992 tors. eta vs tors. theta energy: -85.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1252.932765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.932765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.932765 (E_RNA) where: Base-Base interactions energy: -683.911 where: short stacking energy: -373.767 Base-Backbone interact. energy: 2.353 local terms energy: -571.374312 where: bonds (distance) C4'-P energy: -140.465 bonds (distance) P-C4' energy: -176.346 flat angles C4'-P-C4' energy: -141.834 flat angles P-C4'-P energy: -77.787 tors. eta vs tors. theta energy: -34.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -1086.503176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1086.503176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1086.503176 (E_RNA) where: Base-Base interactions energy: -605.497 where: short stacking energy: -328.920 Base-Backbone interact. energy: -1.796 local terms energy: -479.210181 where: bonds (distance) C4'-P energy: -120.897 bonds (distance) P-C4' energy: -163.703 flat angles C4'-P-C4' energy: -128.788 flat angles P-C4'-P energy: -68.943 tors. eta vs tors. theta energy: 3.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2933.491249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2933.491249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2933.491249 (E_RNA) where: Base-Base interactions energy: -1991.101 where: short stacking energy: -875.976 Base-Backbone interact. energy: -4.567 local terms energy: -937.823669 where: bonds (distance) C4'-P energy: -181.436 bonds (distance) P-C4' energy: -190.277 flat angles C4'-P-C4' energy: -202.712 flat angles P-C4'-P energy: -128.824 tors. eta vs tors. theta energy: -234.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2777.255689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2777.255689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2777.255689 (E_RNA) where: Base-Base interactions energy: -1856.747 where: short stacking energy: -866.855 Base-Backbone interact. energy: -3.696 local terms energy: -916.812433 where: bonds (distance) C4'-P energy: -173.611 bonds (distance) P-C4' energy: -180.850 flat angles C4'-P-C4' energy: -203.053 flat angles P-C4'-P energy: -128.778 tors. eta vs tors. theta energy: -230.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2754.154829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2754.154829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2754.154829 (E_RNA) where: Base-Base interactions energy: -1874.728 where: short stacking energy: -816.575 Base-Backbone interact. energy: -5.020 local terms energy: -874.406213 where: bonds (distance) C4'-P energy: -166.356 bonds (distance) P-C4' energy: -170.937 flat angles C4'-P-C4' energy: -197.795 flat angles P-C4'-P energy: -125.921 tors. eta vs tors. theta energy: -213.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -2307.617278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2307.617278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2307.617278 (E_RNA) where: Base-Base interactions energy: -1517.565 where: short stacking energy: -709.368 Base-Backbone interact. energy: -0.262 local terms energy: -789.790242 where: bonds (distance) C4'-P energy: -167.620 bonds (distance) P-C4' energy: -160.673 flat angles C4'-P-C4' energy: -172.228 flat angles P-C4'-P energy: -132.596 tors. eta vs tors. theta energy: -156.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -2155.225844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2155.225844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2155.225844 (E_RNA) where: Base-Base interactions energy: -1371.251 where: short stacking energy: -649.752 Base-Backbone interact. energy: -3.081 local terms energy: -780.893932 where: bonds (distance) C4'-P energy: -173.177 bonds (distance) P-C4' energy: -169.389 flat angles C4'-P-C4' energy: -162.139 flat angles P-C4'-P energy: -124.700 tors. eta vs tors. theta energy: -151.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -2075.162236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2075.162236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2075.162236 (E_RNA) where: Base-Base interactions energy: -1320.592 where: short stacking energy: -622.813 Base-Backbone interact. energy: -0.084 local terms energy: -754.486704 where: bonds (distance) C4'-P energy: -156.717 bonds (distance) P-C4' energy: -169.144 flat angles C4'-P-C4' energy: -179.417 flat angles P-C4'-P energy: -110.650 tors. eta vs tors. theta energy: -138.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1848.976194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1848.976194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1848.976194 (E_RNA) where: Base-Base interactions energy: -1162.493 where: short stacking energy: -543.116 Base-Backbone interact. energy: 2.095 local terms energy: -688.578938 where: bonds (distance) C4'-P energy: -157.861 bonds (distance) P-C4' energy: -144.767 flat angles C4'-P-C4' energy: -172.213 flat angles P-C4'-P energy: -110.370 tors. eta vs tors. theta energy: -103.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1832.510137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1832.510137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1832.510137 (E_RNA) where: Base-Base interactions energy: -1161.855 where: short stacking energy: -521.508 Base-Backbone interact. energy: 0.911 local terms energy: -671.566254 where: bonds (distance) C4'-P energy: -166.651 bonds (distance) P-C4' energy: -163.484 flat angles C4'-P-C4' energy: -155.022 flat angles P-C4'-P energy: -81.685 tors. eta vs tors. theta energy: -104.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1326.334904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.334904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.334904 (E_RNA) where: Base-Base interactions energy: -775.591 where: short stacking energy: -371.036 Base-Backbone interact. energy: 1.193 local terms energy: -551.937352 where: bonds (distance) C4'-P energy: -147.822 bonds (distance) P-C4' energy: -153.719 flat angles C4'-P-C4' energy: -129.547 flat angles P-C4'-P energy: -98.288 tors. eta vs tors. theta energy: -22.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -1069.932524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.932524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.932524 (E_RNA) where: Base-Base interactions energy: -607.667 where: short stacking energy: -305.974 Base-Backbone interact. energy: 4.645 local terms energy: -466.910318 where: bonds (distance) C4'-P energy: -135.806 bonds (distance) P-C4' energy: -153.085 flat angles C4'-P-C4' energy: -130.460 flat angles P-C4'-P energy: -72.373 tors. eta vs tors. theta energy: 24.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2936.001302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2936.001302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2936.001302 (E_RNA) where: Base-Base interactions energy: -1985.049 where: short stacking energy: -899.991 Base-Backbone interact. energy: -2.616 local terms energy: -948.335896 where: bonds (distance) C4'-P energy: -181.947 bonds (distance) P-C4' energy: -180.502 flat angles C4'-P-C4' energy: -211.559 flat angles P-C4'-P energy: -137.315 tors. eta vs tors. theta energy: -237.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2802.187904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2802.187904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2802.187904 (E_RNA) where: Base-Base interactions energy: -1877.247 where: short stacking energy: -842.906 Base-Backbone interact. energy: -6.192 local terms energy: -918.748956 where: bonds (distance) C4'-P energy: -176.375 bonds (distance) P-C4' energy: -192.074 flat angles C4'-P-C4' energy: -194.841 flat angles P-C4'-P energy: -133.504 tors. eta vs tors. theta energy: -221.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2722.798061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2722.798061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2722.798061 (E_RNA) where: Base-Base interactions energy: -1833.164 where: short stacking energy: -777.179 Base-Backbone interact. energy: -5.908 local terms energy: -883.726173 where: bonds (distance) C4'-P energy: -192.971 bonds (distance) P-C4' energy: -160.028 flat angles C4'-P-C4' energy: -203.660 flat angles P-C4'-P energy: -125.447 tors. eta vs tors. theta energy: -201.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -2295.988596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2295.988596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2295.988596 (E_RNA) where: Base-Base interactions energy: -1513.118 where: short stacking energy: -702.810 Base-Backbone interact. energy: -2.706 local terms energy: -780.164399 where: bonds (distance) C4'-P energy: -157.629 bonds (distance) P-C4' energy: -183.411 flat angles C4'-P-C4' energy: -174.719 flat angles P-C4'-P energy: -106.094 tors. eta vs tors. theta energy: -158.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -2113.354030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2113.354030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2113.354030 (E_RNA) where: Base-Base interactions energy: -1356.883 where: short stacking energy: -648.872 Base-Backbone interact. energy: -3.885 local terms energy: -752.586174 where: bonds (distance) C4'-P energy: -141.672 bonds (distance) P-C4' energy: -184.178 flat angles C4'-P-C4' energy: -188.279 flat angles P-C4'-P energy: -88.122 tors. eta vs tors. theta energy: -150.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -2079.339559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2079.339559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2079.339559 (E_RNA) where: Base-Base interactions energy: -1359.821 where: short stacking energy: -651.074 Base-Backbone interact. energy: -2.553 local terms energy: -716.965990 where: bonds (distance) C4'-P energy: -160.418 bonds (distance) P-C4' energy: -162.904 flat angles C4'-P-C4' energy: -157.722 flat angles P-C4'-P energy: -92.964 tors. eta vs tors. theta energy: -142.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1891.475859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1891.475859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1891.475859 (E_RNA) where: Base-Base interactions energy: -1219.985 where: short stacking energy: -547.752 Base-Backbone interact. energy: -3.527 local terms energy: -667.963851 where: bonds (distance) C4'-P energy: -156.472 bonds (distance) P-C4' energy: -177.824 flat angles C4'-P-C4' energy: -152.311 flat angles P-C4'-P energy: -76.821 tors. eta vs tors. theta energy: -104.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1628.038231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1628.038231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1628.038231 (E_RNA) where: Base-Base interactions energy: -1008.199 where: short stacking energy: -460.686 Base-Backbone interact. energy: 0.045 local terms energy: -619.884616 where: bonds (distance) C4'-P energy: -159.625 bonds (distance) P-C4' energy: -152.927 flat angles C4'-P-C4' energy: -135.336 flat angles P-C4'-P energy: -96.519 tors. eta vs tors. theta energy: -75.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1273.694534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.694534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.694534 (E_RNA) where: Base-Base interactions energy: -734.918 where: short stacking energy: -371.331 Base-Backbone interact. energy: -1.728 local terms energy: -537.048748 where: bonds (distance) C4'-P energy: -146.092 bonds (distance) P-C4' energy: -144.527 flat angles C4'-P-C4' energy: -130.087 flat angles P-C4'-P energy: -95.893 tors. eta vs tors. theta energy: -20.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1090.531389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.531389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.531389 (E_RNA) where: Base-Base interactions energy: -636.119 where: short stacking energy: -318.943 Base-Backbone interact. energy: 0.164 local terms energy: -454.576724 where: bonds (distance) C4'-P energy: -118.571 bonds (distance) P-C4' energy: -144.941 flat angles C4'-P-C4' energy: -127.035 flat angles P-C4'-P energy: -75.485 tors. eta vs tors. theta energy: 11.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -2955.336819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2955.336819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2955.336819 (E_RNA) where: Base-Base interactions energy: -1990.978 where: short stacking energy: -926.187 Base-Backbone interact. energy: -3.874 local terms energy: -960.484472 where: bonds (distance) C4'-P energy: -182.149 bonds (distance) P-C4' energy: -199.270 flat angles C4'-P-C4' energy: -201.917 flat angles P-C4'-P energy: -128.161 tors. eta vs tors. theta energy: -248.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -2855.516327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2855.516327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2855.516327 (E_RNA) where: Base-Base interactions energy: -1938.576 where: short stacking energy: -856.206 Base-Backbone interact. energy: -4.416 local terms energy: -912.523794 where: bonds (distance) C4'-P energy: -170.073 bonds (distance) P-C4' energy: -183.550 flat angles C4'-P-C4' energy: -204.696 flat angles P-C4'-P energy: -120.414 tors. eta vs tors. theta energy: -233.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -2742.449315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2742.449315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2742.449315 (E_RNA) where: Base-Base interactions energy: -1866.519 where: short stacking energy: -837.037 Base-Backbone interact. energy: -4.982 local terms energy: -870.948934 where: bonds (distance) C4'-P energy: -167.327 bonds (distance) P-C4' energy: -170.826 flat angles C4'-P-C4' energy: -194.422 flat angles P-C4'-P energy: -124.192 tors. eta vs tors. theta energy: -214.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -2348.633859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2348.633859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2348.633859 (E_RNA) where: Base-Base interactions energy: -1518.574 where: short stacking energy: -716.475 Base-Backbone interact. energy: -2.370 local terms energy: -827.689666 where: bonds (distance) C4'-P energy: -168.350 bonds (distance) P-C4' energy: -175.977 flat angles C4'-P-C4' energy: -188.600 flat angles P-C4'-P energy: -129.804 tors. eta vs tors. theta energy: -164.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -2122.782010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2122.782010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2122.782010 (E_RNA) where: Base-Base interactions energy: -1347.343 where: short stacking energy: -636.174 Base-Backbone interact. energy: 2.447 local terms energy: -777.885699 where: bonds (distance) C4'-P energy: -159.842 bonds (distance) P-C4' energy: -184.241 flat angles C4'-P-C4' energy: -176.883 flat angles P-C4'-P energy: -119.808 tors. eta vs tors. theta energy: -137.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -2039.562303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2039.562303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2039.562303 (E_RNA) where: Base-Base interactions energy: -1323.388 where: short stacking energy: -646.380 Base-Backbone interact. energy: 4.211 local terms energy: -720.385276 where: bonds (distance) C4'-P energy: -144.446 bonds (distance) P-C4' energy: -141.863 flat angles C4'-P-C4' energy: -183.400 flat angles P-C4'-P energy: -81.793 tors. eta vs tors. theta energy: -168.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -2006.364541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2006.364541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2006.364541 (E_RNA) where: Base-Base interactions energy: -1306.441 where: short stacking energy: -597.032 Base-Backbone interact. energy: -3.339 local terms energy: -696.583663 where: bonds (distance) C4'-P energy: -164.683 bonds (distance) P-C4' energy: -163.096 flat angles C4'-P-C4' energy: -167.524 flat angles P-C4'-P energy: -90.077 tors. eta vs tors. theta energy: -111.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1533.204746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1533.204746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1533.204746 (E_RNA) where: Base-Base interactions energy: -917.346 where: short stacking energy: -435.389 Base-Backbone interact. energy: -0.382 local terms energy: -615.476642 where: bonds (distance) C4'-P energy: -152.274 bonds (distance) P-C4' energy: -150.013 flat angles C4'-P-C4' energy: -141.592 flat angles P-C4'-P energy: -91.038 tors. eta vs tors. theta energy: -80.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1293.618698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.618698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.618698 (E_RNA) where: Base-Base interactions energy: -789.334 where: short stacking energy: -411.444 Base-Backbone interact. energy: 2.408 local terms energy: -506.692106 where: bonds (distance) C4'-P energy: -148.019 bonds (distance) P-C4' energy: -129.247 flat angles C4'-P-C4' energy: -119.872 flat angles P-C4'-P energy: -93.196 tors. eta vs tors. theta energy: -16.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -1175.280895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.280895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.280895 (E_RNA) where: Base-Base interactions energy: -646.649 where: short stacking energy: -341.308 Base-Backbone interact. energy: 0.226 local terms energy: -528.858143 where: bonds (distance) C4'-P energy: -135.648 bonds (distance) P-C4' energy: -158.863 flat angles C4'-P-C4' energy: -139.429 flat angles P-C4'-P energy: -80.282 tors. eta vs tors. theta energy: -14.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -2984.439528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2984.439528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2984.439528 (E_RNA) where: Base-Base interactions energy: -1991.708 where: short stacking energy: -921.926 Base-Backbone interact. energy: -2.549 local terms energy: -990.181876 where: bonds (distance) C4'-P energy: -192.901 bonds (distance) P-C4' energy: -185.711 flat angles C4'-P-C4' energy: -210.588 flat angles P-C4'-P energy: -148.430 tors. eta vs tors. theta energy: -252.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -2824.126027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2824.126027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2824.126027 (E_RNA) where: Base-Base interactions energy: -1917.238 where: short stacking energy: -859.568 Base-Backbone interact. energy: -3.769 local terms energy: -903.118732 where: bonds (distance) C4'-P energy: -168.395 bonds (distance) P-C4' energy: -171.493 flat angles C4'-P-C4' energy: -199.420 flat angles P-C4'-P energy: -130.392 tors. eta vs tors. theta energy: -233.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -2793.415740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2793.415740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2793.415740 (E_RNA) where: Base-Base interactions energy: -1931.238 where: short stacking energy: -805.768 Base-Backbone interact. energy: -2.527 local terms energy: -859.651250 where: bonds (distance) C4'-P energy: -168.896 bonds (distance) P-C4' energy: -178.151 flat angles C4'-P-C4' energy: -190.705 flat angles P-C4'-P energy: -116.068 tors. eta vs tors. theta energy: -205.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -2327.769567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2327.769567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2327.769567 (E_RNA) where: Base-Base interactions energy: -1522.959 where: short stacking energy: -696.712 Base-Backbone interact. energy: -2.242 local terms energy: -802.569009 where: bonds (distance) C4'-P energy: -175.607 bonds (distance) P-C4' energy: -189.877 flat angles C4'-P-C4' energy: -172.233 flat angles P-C4'-P energy: -106.121 tors. eta vs tors. theta energy: -158.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -2116.470643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2116.470643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2116.470643 (E_RNA) where: Base-Base interactions energy: -1368.395 where: short stacking energy: -636.370 Base-Backbone interact. energy: -4.014 local terms energy: -744.060997 where: bonds (distance) C4'-P energy: -136.233 bonds (distance) P-C4' energy: -179.017 flat angles C4'-P-C4' energy: -167.686 flat angles P-C4'-P energy: -110.566 tors. eta vs tors. theta energy: -150.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -2061.702422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2061.702422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2061.702422 (E_RNA) where: Base-Base interactions energy: -1330.233 where: short stacking energy: -595.803 Base-Backbone interact. energy: -0.240 local terms energy: -731.229448 where: bonds (distance) C4'-P energy: -148.641 bonds (distance) P-C4' energy: -165.379 flat angles C4'-P-C4' energy: -169.988 flat angles P-C4'-P energy: -121.344 tors. eta vs tors. theta energy: -125.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -2026.952995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2026.952995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2026.952995 (E_RNA) where: Base-Base interactions energy: -1357.657 where: short stacking energy: -636.130 Base-Backbone interact. energy: -2.200 local terms energy: -667.095710 where: bonds (distance) C4'-P energy: -154.383 bonds (distance) P-C4' energy: -146.808 flat angles C4'-P-C4' energy: -147.473 flat angles P-C4'-P energy: -90.043 tors. eta vs tors. theta energy: -128.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1553.441562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1553.441562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1553.441562 (E_RNA) where: Base-Base interactions energy: -941.698 where: short stacking energy: -498.062 Base-Backbone interact. energy: -0.580 local terms energy: -611.163160 where: bonds (distance) C4'-P energy: -143.281 bonds (distance) P-C4' energy: -149.845 flat angles C4'-P-C4' energy: -151.577 flat angles P-C4'-P energy: -76.267 tors. eta vs tors. theta energy: -90.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1326.841170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.841170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.841170 (E_RNA) where: Base-Base interactions energy: -772.873 where: short stacking energy: -376.514 Base-Backbone interact. energy: 4.834 local terms energy: -558.802605 where: bonds (distance) C4'-P energy: -149.577 bonds (distance) P-C4' energy: -143.889 flat angles C4'-P-C4' energy: -134.639 flat angles P-C4'-P energy: -82.187 tors. eta vs tors. theta energy: -48.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1141.610568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.610568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.610568 (E_RNA) where: Base-Base interactions energy: -627.633 where: short stacking energy: -309.551 Base-Backbone interact. energy: 3.798 local terms energy: -517.775938 where: bonds (distance) C4'-P energy: -146.258 bonds (distance) P-C4' energy: -152.071 flat angles C4'-P-C4' energy: -144.957 flat angles P-C4'-P energy: -57.100 tors. eta vs tors. theta energy: -17.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -2996.279545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2996.279545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2996.279545 (E_RNA) where: Base-Base interactions energy: -2035.216 where: short stacking energy: -906.448 Base-Backbone interact. energy: -1.940 local terms energy: -959.123415 where: bonds (distance) C4'-P energy: -184.362 bonds (distance) P-C4' energy: -182.176 flat angles C4'-P-C4' energy: -211.072 flat angles P-C4'-P energy: -141.632 tors. eta vs tors. theta energy: -239.883 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -2934.404113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2934.404113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2934.404113 (E_RNA) where: Base-Base interactions energy: -2029.556 where: short stacking energy: -887.346 Base-Backbone interact. energy: -2.128 local terms energy: -902.720722 where: bonds (distance) C4'-P energy: -172.568 bonds (distance) P-C4' energy: -190.164 flat angles C4'-P-C4' energy: -188.537 flat angles P-C4'-P energy: -130.954 tors. eta vs tors. theta energy: -220.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -2749.498361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2749.498361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2749.498361 (E_RNA) where: Base-Base interactions energy: -1880.708 where: short stacking energy: -833.140 Base-Backbone interact. energy: -1.739 local terms energy: -867.051458 where: bonds (distance) C4'-P energy: -168.446 bonds (distance) P-C4' energy: -174.251 flat angles C4'-P-C4' energy: -186.028 flat angles P-C4'-P energy: -108.737 tors. eta vs tors. theta energy: -229.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -2370.945827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2370.945827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2370.945827 (E_RNA) where: Base-Base interactions energy: -1569.457 where: short stacking energy: -724.342 Base-Backbone interact. energy: 2.119 local terms energy: -803.607934 where: bonds (distance) C4'-P energy: -170.970 bonds (distance) P-C4' energy: -159.653 flat angles C4'-P-C4' energy: -169.228 flat angles P-C4'-P energy: -127.570 tors. eta vs tors. theta energy: -176.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -2160.509707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2160.509707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2160.509707 (E_RNA) where: Base-Base interactions energy: -1373.239 where: short stacking energy: -627.475 Base-Backbone interact. energy: 0.176 local terms energy: -787.445924 where: bonds (distance) C4'-P energy: -161.824 bonds (distance) P-C4' energy: -174.503 flat angles C4'-P-C4' energy: -193.648 flat angles P-C4'-P energy: -99.937 tors. eta vs tors. theta energy: -157.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -2020.138565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2020.138565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2020.138565 (E_RNA) where: Base-Base interactions energy: -1283.094 where: short stacking energy: -588.834 Base-Backbone interact. energy: 0.086 local terms energy: -737.130829 where: bonds (distance) C4'-P energy: -166.056 bonds (distance) P-C4' energy: -164.073 flat angles C4'-P-C4' energy: -190.495 flat angles P-C4'-P energy: -81.137 tors. eta vs tors. theta energy: -135.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1992.571102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1992.571102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1992.571102 (E_RNA) where: Base-Base interactions energy: -1315.418 where: short stacking energy: -602.547 Base-Backbone interact. energy: -2.351 local terms energy: -674.802036 where: bonds (distance) C4'-P energy: -157.043 bonds (distance) P-C4' energy: -146.164 flat angles C4'-P-C4' energy: -152.328 flat angles P-C4'-P energy: -96.062 tors. eta vs tors. theta energy: -123.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1505.273449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.273449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.273449 (E_RNA) where: Base-Base interactions energy: -876.418 where: short stacking energy: -455.300 Base-Backbone interact. energy: 2.649 local terms energy: -631.504691 where: bonds (distance) C4'-P energy: -138.923 bonds (distance) P-C4' energy: -169.793 flat angles C4'-P-C4' energy: -154.051 flat angles P-C4'-P energy: -91.882 tors. eta vs tors. theta energy: -76.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1250.494850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.494850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.494850 (E_RNA) where: Base-Base interactions energy: -659.876 where: short stacking energy: -338.198 Base-Backbone interact. energy: -2.711 local terms energy: -587.907431 where: bonds (distance) C4'-P energy: -155.193 bonds (distance) P-C4' energy: -170.422 flat angles C4'-P-C4' energy: -154.850 flat angles P-C4'-P energy: -90.701 tors. eta vs tors. theta energy: -16.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1167.970025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.970025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.970025 (E_RNA) where: Base-Base interactions energy: -657.291 where: short stacking energy: -318.902 Base-Backbone interact. energy: -4.645 local terms energy: -506.033310 where: bonds (distance) C4'-P energy: -132.149 bonds (distance) P-C4' energy: -153.044 flat angles C4'-P-C4' energy: -126.422 flat angles P-C4'-P energy: -74.414 tors. eta vs tors. theta energy: -20.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -3015.814620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3015.814620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3015.814620 (E_RNA) where: Base-Base interactions energy: -2057.367 where: short stacking energy: -891.915 Base-Backbone interact. energy: -9.478 local terms energy: -948.969572 where: bonds (distance) C4'-P energy: -180.923 bonds (distance) P-C4' energy: -181.902 flat angles C4'-P-C4' energy: -220.264 flat angles P-C4'-P energy: -141.735 tors. eta vs tors. theta energy: -224.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -2895.073296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2895.073296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2895.073296 (E_RNA) where: Base-Base interactions energy: -1972.194 where: short stacking energy: -859.898 Base-Backbone interact. energy: 1.105 local terms energy: -923.984183 where: bonds (distance) C4'-P energy: -166.579 bonds (distance) P-C4' energy: -191.285 flat angles C4'-P-C4' energy: -200.977 flat angles P-C4'-P energy: -135.251 tors. eta vs tors. theta energy: -229.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -2793.989554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2793.989554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2793.989554 (E_RNA) where: Base-Base interactions energy: -1912.740 where: short stacking energy: -826.123 Base-Backbone interact. energy: 1.710 local terms energy: -882.958977 where: bonds (distance) C4'-P energy: -166.124 bonds (distance) P-C4' energy: -184.505 flat angles C4'-P-C4' energy: -189.416 flat angles P-C4'-P energy: -123.665 tors. eta vs tors. theta energy: -219.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -2348.895008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2348.895008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2348.895008 (E_RNA) where: Base-Base interactions energy: -1523.282 where: short stacking energy: -683.738 Base-Backbone interact. energy: -3.571 local terms energy: -822.042575 where: bonds (distance) C4'-P energy: -168.721 bonds (distance) P-C4' energy: -178.970 flat angles C4'-P-C4' energy: -179.614 flat angles P-C4'-P energy: -121.693 tors. eta vs tors. theta energy: -173.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -2177.072853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2177.072853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2177.072853 (E_RNA) where: Base-Base interactions energy: -1437.420 where: short stacking energy: -657.597 Base-Backbone interact. energy: 4.819 local terms energy: -744.471678 where: bonds (distance) C4'-P energy: -144.850 bonds (distance) P-C4' energy: -170.479 flat angles C4'-P-C4' energy: -166.724 flat angles P-C4'-P energy: -126.938 tors. eta vs tors. theta energy: -135.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -2048.984061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2048.984061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2048.984061 (E_RNA) where: Base-Base interactions energy: -1304.841 where: short stacking energy: -631.489 Base-Backbone interact. energy: 2.481 local terms energy: -746.624187 where: bonds (distance) C4'-P energy: -165.661 bonds (distance) P-C4' energy: -163.632 flat angles C4'-P-C4' energy: -156.451 flat angles P-C4'-P energy: -116.420 tors. eta vs tors. theta energy: -144.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -2088.642634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2088.642634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2088.642634 (E_RNA) where: Base-Base interactions energy: -1418.577 where: short stacking energy: -629.674 Base-Backbone interact. energy: -1.393 local terms energy: -668.672625 where: bonds (distance) C4'-P energy: -153.264 bonds (distance) P-C4' energy: -134.671 flat angles C4'-P-C4' energy: -160.411 flat angles P-C4'-P energy: -70.161 tors. eta vs tors. theta energy: -150.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1389.382615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.382615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.382615 (E_RNA) where: Base-Base interactions energy: -778.521 where: short stacking energy: -381.371 Base-Backbone interact. energy: 6.325 local terms energy: -617.187025 where: bonds (distance) C4'-P energy: -149.666 bonds (distance) P-C4' energy: -164.883 flat angles C4'-P-C4' energy: -153.771 flat angles P-C4'-P energy: -92.658 tors. eta vs tors. theta energy: -56.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1191.070109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.070109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.070109 (E_RNA) where: Base-Base interactions energy: -651.853 where: short stacking energy: -340.221 Base-Backbone interact. energy: 5.918 local terms energy: -545.135789 where: bonds (distance) C4'-P energy: -148.512 bonds (distance) P-C4' energy: -167.569 flat angles C4'-P-C4' energy: -141.953 flat angles P-C4'-P energy: -81.820 tors. eta vs tors. theta energy: -5.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -1167.615428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.615428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.615428 (E_RNA) where: Base-Base interactions energy: -668.508 where: short stacking energy: -362.084 Base-Backbone interact. energy: 1.967 local terms energy: -501.074547 where: bonds (distance) C4'-P energy: -133.329 bonds (distance) P-C4' energy: -143.925 flat angles C4'-P-C4' energy: -132.164 flat angles P-C4'-P energy: -73.785 tors. eta vs tors. theta energy: -17.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -3032.465643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3032.465643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3032.465643 (E_RNA) where: Base-Base interactions energy: -2093.660 where: short stacking energy: -916.777 Base-Backbone interact. energy: -4.045 local terms energy: -934.760762 where: bonds (distance) C4'-P energy: -180.379 bonds (distance) P-C4' energy: -181.585 flat angles C4'-P-C4' energy: -210.657 flat angles P-C4'-P energy: -135.377 tors. eta vs tors. theta energy: -226.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -2877.613696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2877.613696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2877.613696 (E_RNA) where: Base-Base interactions energy: -1961.672 where: short stacking energy: -858.853 Base-Backbone interact. energy: -3.388 local terms energy: -912.553454 where: bonds (distance) C4'-P energy: -188.868 bonds (distance) P-C4' energy: -176.007 flat angles C4'-P-C4' energy: -209.651 flat angles P-C4'-P energy: -110.183 tors. eta vs tors. theta energy: -227.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -2769.121635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2769.121635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2769.121635 (E_RNA) where: Base-Base interactions energy: -1887.807 where: short stacking energy: -841.513 Base-Backbone interact. energy: -5.299 local terms energy: -876.015533 where: bonds (distance) C4'-P energy: -164.683 bonds (distance) P-C4' energy: -183.689 flat angles C4'-P-C4' energy: -185.963 flat angles P-C4'-P energy: -123.823 tors. eta vs tors. theta energy: -217.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -2437.051468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2437.051468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2437.051468 (E_RNA) where: Base-Base interactions energy: -1596.804 where: short stacking energy: -770.858 Base-Backbone interact. energy: -2.607 local terms energy: -837.639922 where: bonds (distance) C4'-P energy: -168.263 bonds (distance) P-C4' energy: -171.565 flat angles C4'-P-C4' energy: -198.942 flat angles P-C4'-P energy: -117.493 tors. eta vs tors. theta energy: -181.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -2262.854990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2262.854990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.854990 (E_RNA) where: Base-Base interactions energy: -1467.890 where: short stacking energy: -702.464 Base-Backbone interact. energy: -3.448 local terms energy: -791.516908 where: bonds (distance) C4'-P energy: -164.746 bonds (distance) P-C4' energy: -169.649 flat angles C4'-P-C4' energy: -182.044 flat angles P-C4'-P energy: -98.533 tors. eta vs tors. theta energy: -176.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -2258.691901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2258.691901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2258.691901 (E_RNA) where: Base-Base interactions energy: -1490.314 where: short stacking energy: -694.047 Base-Backbone interact. energy: -4.970 local terms energy: -763.407417 where: bonds (distance) C4'-P energy: -176.727 bonds (distance) P-C4' energy: -148.426 flat angles C4'-P-C4' energy: -167.868 flat angles P-C4'-P energy: -93.724 tors. eta vs tors. theta energy: -176.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1943.059293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.059293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.059293 (E_RNA) where: Base-Base interactions energy: -1248.834 where: short stacking energy: -583.877 Base-Backbone interact. energy: 3.045 local terms energy: -697.270582 where: bonds (distance) C4'-P energy: -145.992 bonds (distance) P-C4' energy: -157.798 flat angles C4'-P-C4' energy: -138.638 flat angles P-C4'-P energy: -112.089 tors. eta vs tors. theta energy: -142.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1392.858774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.858774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.858774 (E_RNA) where: Base-Base interactions energy: -787.666 where: short stacking energy: -416.872 Base-Backbone interact. energy: -2.866 local terms energy: -602.326597 where: bonds (distance) C4'-P energy: -160.491 bonds (distance) P-C4' energy: -140.756 flat angles C4'-P-C4' energy: -151.799 flat angles P-C4'-P energy: -88.954 tors. eta vs tors. theta energy: -60.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1176.437329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.437329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.437329 (E_RNA) where: Base-Base interactions energy: -641.516 where: short stacking energy: -351.726 Base-Backbone interact. energy: -2.433 local terms energy: -532.488421 where: bonds (distance) C4'-P energy: -159.211 bonds (distance) P-C4' energy: -158.355 flat angles C4'-P-C4' energy: -126.418 flat angles P-C4'-P energy: -63.749 tors. eta vs tors. theta energy: -24.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1238.881756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.881756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.881756 (E_RNA) where: Base-Base interactions energy: -735.903 where: short stacking energy: -343.282 Base-Backbone interact. energy: -0.634 local terms energy: -502.343986 where: bonds (distance) C4'-P energy: -125.616 bonds (distance) P-C4' energy: -140.783 flat angles C4'-P-C4' energy: -121.687 flat angles P-C4'-P energy: -90.229 tors. eta vs tors. theta energy: -24.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -3053.680313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3053.680313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3053.680313 (E_RNA) where: Base-Base interactions energy: -2131.077 where: short stacking energy: -920.697 Base-Backbone interact. energy: -2.384 local terms energy: -920.219490 where: bonds (distance) C4'-P energy: -172.450 bonds (distance) P-C4' energy: -194.085 flat angles C4'-P-C4' energy: -199.000 flat angles P-C4'-P energy: -123.526 tors. eta vs tors. theta energy: -231.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -2907.839201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2907.839201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2907.839201 (E_RNA) where: Base-Base interactions energy: -2005.286 where: short stacking energy: -887.887 Base-Backbone interact. energy: -3.211 local terms energy: -899.342207 where: bonds (distance) C4'-P energy: -165.684 bonds (distance) P-C4' energy: -175.587 flat angles C4'-P-C4' energy: -211.136 flat angles P-C4'-P energy: -123.485 tors. eta vs tors. theta energy: -223.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -2808.196972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2808.196972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2808.196972 (E_RNA) where: Base-Base interactions energy: -1956.677 where: short stacking energy: -843.795 Base-Backbone interact. energy: -3.725 local terms energy: -847.795352 where: bonds (distance) C4'-P energy: -170.499 bonds (distance) P-C4' energy: -169.945 flat angles C4'-P-C4' energy: -185.423 flat angles P-C4'-P energy: -121.386 tors. eta vs tors. theta energy: -200.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -2390.077604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2390.077604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2390.077604 (E_RNA) where: Base-Base interactions energy: -1547.547 where: short stacking energy: -716.462 Base-Backbone interact. energy: -5.549 local terms energy: -836.982090 where: bonds (distance) C4'-P energy: -166.123 bonds (distance) P-C4' energy: -178.709 flat angles C4'-P-C4' energy: -200.861 flat angles P-C4'-P energy: -113.899 tors. eta vs tors. theta energy: -177.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -2335.572192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2335.572192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2335.572192 (E_RNA) where: Base-Base interactions energy: -1515.533 where: short stacking energy: -731.371 Base-Backbone interact. energy: 2.679 local terms energy: -822.717597 where: bonds (distance) C4'-P energy: -180.480 bonds (distance) P-C4' energy: -164.670 flat angles C4'-P-C4' energy: -182.327 flat angles P-C4'-P energy: -109.584 tors. eta vs tors. theta energy: -185.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -2189.428783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2189.428783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2189.428783 (E_RNA) where: Base-Base interactions energy: -1411.647 where: short stacking energy: -659.016 Base-Backbone interact. energy: -1.505 local terms energy: -776.276838 where: bonds (distance) C4'-P energy: -161.012 bonds (distance) P-C4' energy: -160.572 flat angles C4'-P-C4' energy: -178.351 flat angles P-C4'-P energy: -123.398 tors. eta vs tors. theta energy: -152.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1880.804253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1880.804253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1880.804253 (E_RNA) where: Base-Base interactions energy: -1221.835 where: short stacking energy: -552.746 Base-Backbone interact. energy: -6.348 local terms energy: -652.621688 where: bonds (distance) C4'-P energy: -142.242 bonds (distance) P-C4' energy: -141.368 flat angles C4'-P-C4' energy: -161.804 flat angles P-C4'-P energy: -88.102 tors. eta vs tors. theta energy: -119.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1490.720940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1490.720940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.720940 (E_RNA) where: Base-Base interactions energy: -857.272 where: short stacking energy: -447.915 Base-Backbone interact. energy: -2.165 local terms energy: -631.284013 where: bonds (distance) C4'-P energy: -154.363 bonds (distance) P-C4' energy: -142.313 flat angles C4'-P-C4' energy: -160.882 flat angles P-C4'-P energy: -104.960 tors. eta vs tors. theta energy: -68.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1287.585937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.585937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.585937 (E_RNA) where: Base-Base interactions energy: -744.446 where: short stacking energy: -384.968 Base-Backbone interact. energy: -1.321 local terms energy: -541.818396 where: bonds (distance) C4'-P energy: -130.965 bonds (distance) P-C4' energy: -140.912 flat angles C4'-P-C4' energy: -161.923 flat angles P-C4'-P energy: -79.808 tors. eta vs tors. theta energy: -28.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1143.501179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.501179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.501179 (E_RNA) where: Base-Base interactions energy: -631.465 where: short stacking energy: -330.720 Base-Backbone interact. energy: 6.649 local terms energy: -518.684816 where: bonds (distance) C4'-P energy: -138.390 bonds (distance) P-C4' energy: -132.368 flat angles C4'-P-C4' energy: -155.005 flat angles P-C4'-P energy: -68.895 tors. eta vs tors. theta energy: -24.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -3080.352320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3080.352320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3080.352320 (E_RNA) where: Base-Base interactions energy: -2141.014 where: short stacking energy: -901.927 Base-Backbone interact. energy: -4.386 local terms energy: -934.952380 where: bonds (distance) C4'-P energy: -180.729 bonds (distance) P-C4' energy: -174.542 flat angles C4'-P-C4' energy: -205.314 flat angles P-C4'-P energy: -142.166 tors. eta vs tors. theta energy: -232.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -2866.017462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2866.017462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2866.017462 (E_RNA) where: Base-Base interactions energy: -1954.653 where: short stacking energy: -867.964 Base-Backbone interact. energy: -5.502 local terms energy: -905.863190 where: bonds (distance) C4'-P energy: -175.787 bonds (distance) P-C4' energy: -183.806 flat angles C4'-P-C4' energy: -193.160 flat angles P-C4'-P energy: -133.113 tors. eta vs tors. theta energy: -219.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -2800.281885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2800.281885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2800.281885 (E_RNA) where: Base-Base interactions energy: -1914.630 where: short stacking energy: -845.514 Base-Backbone interact. energy: -3.071 local terms energy: -882.580369 where: bonds (distance) C4'-P energy: -156.240 bonds (distance) P-C4' energy: -189.915 flat angles C4'-P-C4' energy: -181.445 flat angles P-C4'-P energy: -125.674 tors. eta vs tors. theta energy: -229.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -2398.793276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2398.793276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2398.793276 (E_RNA) where: Base-Base interactions energy: -1594.380 where: short stacking energy: -723.958 Base-Backbone interact. energy: 0.082 local terms energy: -804.495425 where: bonds (distance) C4'-P energy: -160.877 bonds (distance) P-C4' energy: -175.663 flat angles C4'-P-C4' energy: -188.624 flat angles P-C4'-P energy: -119.663 tors. eta vs tors. theta energy: -159.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -2415.219398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2415.219398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2415.219398 (E_RNA) where: Base-Base interactions energy: -1594.541 where: short stacking energy: -717.358 Base-Backbone interact. energy: -2.301 local terms energy: -818.377943 where: bonds (distance) C4'-P energy: -163.004 bonds (distance) P-C4' energy: -170.654 flat angles C4'-P-C4' energy: -203.900 flat angles P-C4'-P energy: -108.672 tors. eta vs tors. theta energy: -172.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -2194.807912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2194.807912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2194.807912 (E_RNA) where: Base-Base interactions energy: -1456.897 where: short stacking energy: -625.410 Base-Backbone interact. energy: -6.194 local terms energy: -731.717282 where: bonds (distance) C4'-P energy: -150.131 bonds (distance) P-C4' energy: -149.443 flat angles C4'-P-C4' energy: -174.455 flat angles P-C4'-P energy: -107.220 tors. eta vs tors. theta energy: -150.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1885.654189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.654189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.654189 (E_RNA) where: Base-Base interactions energy: -1178.881 where: short stacking energy: -551.372 Base-Backbone interact. energy: -1.347 local terms energy: -705.425972 where: bonds (distance) C4'-P energy: -166.580 bonds (distance) P-C4' energy: -154.951 flat angles C4'-P-C4' energy: -171.008 flat angles P-C4'-P energy: -97.691 tors. eta vs tors. theta energy: -115.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1440.232890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.232890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.232890 (E_RNA) where: Base-Base interactions energy: -851.043 where: short stacking energy: -448.287 Base-Backbone interact. energy: 1.870 local terms energy: -591.060784 where: bonds (distance) C4'-P energy: -148.792 bonds (distance) P-C4' energy: -143.495 flat angles C4'-P-C4' energy: -144.586 flat angles P-C4'-P energy: -85.785 tors. eta vs tors. theta energy: -68.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1286.067805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.067805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.067805 (E_RNA) where: Base-Base interactions energy: -750.836 where: short stacking energy: -367.590 Base-Backbone interact. energy: 2.483 local terms energy: -537.714793 where: bonds (distance) C4'-P energy: -147.991 bonds (distance) P-C4' energy: -145.135 flat angles C4'-P-C4' energy: -124.780 flat angles P-C4'-P energy: -99.784 tors. eta vs tors. theta energy: -20.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -1099.999399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.999399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.999399 (E_RNA) where: Base-Base interactions energy: -620.154 where: short stacking energy: -336.459 Base-Backbone interact. energy: -1.288 local terms energy: -478.556945 where: bonds (distance) C4'-P energy: -125.960 bonds (distance) P-C4' energy: -152.551 flat angles C4'-P-C4' energy: -126.021 flat angles P-C4'-P energy: -69.602 tors. eta vs tors. theta energy: -4.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -3027.529732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3027.529732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3027.529732 (E_RNA) where: Base-Base interactions energy: -2080.806 where: short stacking energy: -889.138 Base-Backbone interact. energy: -5.069 local terms energy: -941.654527 where: bonds (distance) C4'-P energy: -195.813 bonds (distance) P-C4' energy: -189.152 flat angles C4'-P-C4' energy: -204.268 flat angles P-C4'-P energy: -133.903 tors. eta vs tors. theta energy: -218.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -2924.877047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2924.877047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2924.877047 (E_RNA) where: Base-Base interactions energy: -2009.658 where: short stacking energy: -915.183 Base-Backbone interact. energy: -2.509 local terms energy: -912.709444 where: bonds (distance) C4'-P energy: -169.849 bonds (distance) P-C4' energy: -177.309 flat angles C4'-P-C4' energy: -207.952 flat angles P-C4'-P energy: -122.717 tors. eta vs tors. theta energy: -234.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -2777.211519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2777.211519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2777.211519 (E_RNA) where: Base-Base interactions energy: -1904.652 where: short stacking energy: -807.680 Base-Backbone interact. energy: -4.801 local terms energy: -867.758892 where: bonds (distance) C4'-P energy: -158.328 bonds (distance) P-C4' energy: -173.270 flat angles C4'-P-C4' energy: -197.485 flat angles P-C4'-P energy: -120.637 tors. eta vs tors. theta energy: -218.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -2432.351918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2432.351918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2432.351918 (E_RNA) where: Base-Base interactions energy: -1630.449 where: short stacking energy: -742.371 Base-Backbone interact. energy: -3.709 local terms energy: -798.193495 where: bonds (distance) C4'-P energy: -145.497 bonds (distance) P-C4' energy: -171.856 flat angles C4'-P-C4' energy: -177.602 flat angles P-C4'-P energy: -115.608 tors. eta vs tors. theta energy: -187.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -2516.577144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2516.577144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2516.577144 (E_RNA) where: Base-Base interactions energy: -1699.014 where: short stacking energy: -777.612 Base-Backbone interact. energy: -2.740 local terms energy: -814.822374 where: bonds (distance) C4'-P energy: -164.835 bonds (distance) P-C4' energy: -181.858 flat angles C4'-P-C4' energy: -174.736 flat angles P-C4'-P energy: -110.402 tors. eta vs tors. theta energy: -182.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -2187.107998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2187.107998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2187.107998 (E_RNA) where: Base-Base interactions energy: -1437.714 where: short stacking energy: -646.866 Base-Backbone interact. energy: -0.375 local terms energy: -749.018819 where: bonds (distance) C4'-P energy: -157.860 bonds (distance) P-C4' energy: -182.108 flat angles C4'-P-C4' energy: -171.025 flat angles P-C4'-P energy: -103.677 tors. eta vs tors. theta energy: -134.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1899.339609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.339609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.339609 (E_RNA) where: Base-Base interactions energy: -1216.157 where: short stacking energy: -582.208 Base-Backbone interact. energy: -0.038 local terms energy: -683.144872 where: bonds (distance) C4'-P energy: -149.887 bonds (distance) P-C4' energy: -134.524 flat angles C4'-P-C4' energy: -168.578 flat angles P-C4'-P energy: -92.674 tors. eta vs tors. theta energy: -137.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1435.238956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.238956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.238956 (E_RNA) where: Base-Base interactions energy: -859.456 where: short stacking energy: -412.237 Base-Backbone interact. energy: 5.292 local terms energy: -581.074943 where: bonds (distance) C4'-P energy: -143.280 bonds (distance) P-C4' energy: -146.052 flat angles C4'-P-C4' energy: -138.533 flat angles P-C4'-P energy: -92.562 tors. eta vs tors. theta energy: -60.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1285.831444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.831444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.831444 (E_RNA) where: Base-Base interactions energy: -710.596 where: short stacking energy: -355.063 Base-Backbone interact. energy: 4.062 local terms energy: -579.297585 where: bonds (distance) C4'-P energy: -151.466 bonds (distance) P-C4' energy: -146.935 flat angles C4'-P-C4' energy: -155.411 flat angles P-C4'-P energy: -95.164 tors. eta vs tors. theta energy: -30.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -1060.224628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.224628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.224628 (E_RNA) where: Base-Base interactions energy: -545.288 where: short stacking energy: -298.429 Base-Backbone interact. energy: -4.463 local terms energy: -510.473097 where: bonds (distance) C4'-P energy: -165.277 bonds (distance) P-C4' energy: -145.074 flat angles C4'-P-C4' energy: -131.370 flat angles P-C4'-P energy: -74.804 tors. eta vs tors. theta energy: 6.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -3051.278190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3051.278190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3051.278190 (E_RNA) where: Base-Base interactions energy: -2109.611 where: short stacking energy: -922.691 Base-Backbone interact. energy: -8.064 local terms energy: -933.603870 where: bonds (distance) C4'-P energy: -185.425 bonds (distance) P-C4' energy: -170.372 flat angles C4'-P-C4' energy: -212.455 flat angles P-C4'-P energy: -130.274 tors. eta vs tors. theta energy: -235.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -2842.900823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2842.900823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2842.900823 (E_RNA) where: Base-Base interactions energy: -1937.048 where: short stacking energy: -848.248 Base-Backbone interact. energy: -1.110 local terms energy: -904.742333 where: bonds (distance) C4'-P energy: -181.088 bonds (distance) P-C4' energy: -174.955 flat angles C4'-P-C4' energy: -195.521 flat angles P-C4'-P energy: -121.355 tors. eta vs tors. theta energy: -231.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -2760.335564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2760.335564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2760.335564 (E_RNA) where: Base-Base interactions energy: -1857.849 where: short stacking energy: -806.979 Base-Backbone interact. energy: 0.432 local terms energy: -902.918262 where: bonds (distance) C4'-P energy: -184.407 bonds (distance) P-C4' energy: -182.022 flat angles C4'-P-C4' energy: -198.500 flat angles P-C4'-P energy: -119.848 tors. eta vs tors. theta energy: -218.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -2585.721735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2585.721735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2585.721735 (E_RNA) where: Base-Base interactions energy: -1728.689 where: short stacking energy: -797.506 Base-Backbone interact. energy: -3.088 local terms energy: -853.944147 where: bonds (distance) C4'-P energy: -163.046 bonds (distance) P-C4' energy: -171.722 flat angles C4'-P-C4' energy: -184.372 flat angles P-C4'-P energy: -126.650 tors. eta vs tors. theta energy: -208.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -2292.454262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2292.454262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2292.454262 (E_RNA) where: Base-Base interactions energy: -1568.887 where: short stacking energy: -675.135 Base-Backbone interact. energy: 2.402 local terms energy: -725.969050 where: bonds (distance) C4'-P energy: -147.449 bonds (distance) P-C4' energy: -155.977 flat angles C4'-P-C4' energy: -167.343 flat angles P-C4'-P energy: -106.106 tors. eta vs tors. theta energy: -149.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -2167.532315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2167.532315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2167.532315 (E_RNA) where: Base-Base interactions energy: -1459.513 where: short stacking energy: -633.101 Base-Backbone interact. energy: -1.133 local terms energy: -706.886578 where: bonds (distance) C4'-P energy: -144.321 bonds (distance) P-C4' energy: -138.633 flat angles C4'-P-C4' energy: -172.879 flat angles P-C4'-P energy: -103.790 tors. eta vs tors. theta energy: -147.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1907.767632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1907.767632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1907.767632 (E_RNA) where: Base-Base interactions energy: -1221.955 where: short stacking energy: -567.817 Base-Backbone interact. energy: -1.515 local terms energy: -684.298026 where: bonds (distance) C4'-P energy: -145.497 bonds (distance) P-C4' energy: -159.223 flat angles C4'-P-C4' energy: -162.204 flat angles P-C4'-P energy: -92.571 tors. eta vs tors. theta energy: -124.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1432.870196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.870196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.870196 (E_RNA) where: Base-Base interactions energy: -840.928 where: short stacking energy: -430.227 Base-Backbone interact. energy: -0.486 local terms energy: -591.456462 where: bonds (distance) C4'-P energy: -155.710 bonds (distance) P-C4' energy: -155.888 flat angles C4'-P-C4' energy: -144.859 flat angles P-C4'-P energy: -87.245 tors. eta vs tors. theta energy: -47.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1296.917530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.917530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.917530 (E_RNA) where: Base-Base interactions energy: -709.516 where: short stacking energy: -365.706 Base-Backbone interact. energy: 1.482 local terms energy: -588.883570 where: bonds (distance) C4'-P energy: -151.093 bonds (distance) P-C4' energy: -161.178 flat angles C4'-P-C4' energy: -163.598 flat angles P-C4'-P energy: -91.147 tors. eta vs tors. theta energy: -21.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -1095.043714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.043714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.043714 (E_RNA) where: Base-Base interactions energy: -572.979 where: short stacking energy: -356.504 Base-Backbone interact. energy: -1.012 local terms energy: -521.052082 where: bonds (distance) C4'-P energy: -122.857 bonds (distance) P-C4' energy: -150.014 flat angles C4'-P-C4' energy: -130.037 flat angles P-C4'-P energy: -69.273 tors. eta vs tors. theta energy: -48.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -3066.725395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3066.725395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3066.725395 (E_RNA) where: Base-Base interactions energy: -2133.557 where: short stacking energy: -921.722 Base-Backbone interact. energy: -3.893 local terms energy: -929.275217 where: bonds (distance) C4'-P energy: -184.641 bonds (distance) P-C4' energy: -182.468 flat angles C4'-P-C4' energy: -199.022 flat angles P-C4'-P energy: -129.537 tors. eta vs tors. theta energy: -233.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -2868.029007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2868.029007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2868.029007 (E_RNA) where: Base-Base interactions energy: -1925.109 where: short stacking energy: -889.922 Base-Backbone interact. energy: 0.692 local terms energy: -943.612503 where: bonds (distance) C4'-P energy: -188.337 bonds (distance) P-C4' energy: -183.324 flat angles C4'-P-C4' energy: -201.759 flat angles P-C4'-P energy: -132.019 tors. eta vs tors. theta energy: -238.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -2745.813469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2745.813469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2745.813469 (E_RNA) where: Base-Base interactions energy: -1871.348 where: short stacking energy: -793.643 Base-Backbone interact. energy: -3.258 local terms energy: -871.206969 where: bonds (distance) C4'-P energy: -171.895 bonds (distance) P-C4' energy: -169.164 flat angles C4'-P-C4' energy: -195.727 flat angles P-C4'-P energy: -126.010 tors. eta vs tors. theta energy: -208.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -2597.808825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2597.808825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2597.808825 (E_RNA) where: Base-Base interactions energy: -1757.763 where: short stacking energy: -795.384 Base-Backbone interact. energy: -0.784 local terms energy: -839.261518 where: bonds (distance) C4'-P energy: -172.395 bonds (distance) P-C4' energy: -171.444 flat angles C4'-P-C4' energy: -179.243 flat angles P-C4'-P energy: -125.377 tors. eta vs tors. theta energy: -190.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -2311.778636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2311.778636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.778636 (E_RNA) where: Base-Base interactions energy: -1535.283 where: short stacking energy: -686.390 Base-Backbone interact. energy: 3.081 local terms energy: -779.576329 where: bonds (distance) C4'-P energy: -162.738 bonds (distance) P-C4' energy: -156.505 flat angles C4'-P-C4' energy: -189.360 flat angles P-C4'-P energy: -101.612 tors. eta vs tors. theta energy: -169.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -2272.887172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2272.887172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2272.887172 (E_RNA) where: Base-Base interactions energy: -1494.391 where: short stacking energy: -680.672 Base-Backbone interact. energy: -1.401 local terms energy: -777.094905 where: bonds (distance) C4'-P energy: -160.957 bonds (distance) P-C4' energy: -168.808 flat angles C4'-P-C4' energy: -170.541 flat angles P-C4'-P energy: -106.289 tors. eta vs tors. theta energy: -170.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1890.742349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1890.742349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1890.742349 (E_RNA) where: Base-Base interactions energy: -1230.305 where: short stacking energy: -582.949 Base-Backbone interact. energy: -0.743 local terms energy: -659.694147 where: bonds (distance) C4'-P energy: -149.607 bonds (distance) P-C4' energy: -139.451 flat angles C4'-P-C4' energy: -155.967 flat angles P-C4'-P energy: -90.636 tors. eta vs tors. theta energy: -124.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1356.033230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.033230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.033230 (E_RNA) where: Base-Base interactions energy: -831.525 where: short stacking energy: -403.773 Base-Backbone interact. energy: 1.183 local terms energy: -525.691446 where: bonds (distance) C4'-P energy: -131.871 bonds (distance) P-C4' energy: -159.418 flat angles C4'-P-C4' energy: -122.148 flat angles P-C4'-P energy: -65.185 tors. eta vs tors. theta energy: -47.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1334.066370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.066370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.066370 (E_RNA) where: Base-Base interactions energy: -794.389 where: short stacking energy: -406.564 Base-Backbone interact. energy: 0.063 local terms energy: -539.740161 where: bonds (distance) C4'-P energy: -140.581 bonds (distance) P-C4' energy: -139.353 flat angles C4'-P-C4' energy: -139.349 flat angles P-C4'-P energy: -78.145 tors. eta vs tors. theta energy: -42.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -1199.757388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.757388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.757388 (E_RNA) where: Base-Base interactions energy: -736.782 where: short stacking energy: -347.030 Base-Backbone interact. energy: 1.440 local terms energy: -464.415661 where: bonds (distance) C4'-P energy: -151.885 bonds (distance) P-C4' energy: -127.162 flat angles C4'-P-C4' energy: -104.193 flat angles P-C4'-P energy: -68.819 tors. eta vs tors. theta energy: -12.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -3018.516622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3018.516622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3018.516622 (E_RNA) where: Base-Base interactions energy: -2085.524 where: short stacking energy: -871.840 Base-Backbone interact. energy: -6.887 local terms energy: -926.105610 where: bonds (distance) C4'-P energy: -184.286 bonds (distance) P-C4' energy: -171.944 flat angles C4'-P-C4' energy: -191.581 flat angles P-C4'-P energy: -147.677 tors. eta vs tors. theta energy: -230.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -2851.042628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2851.042628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2851.042628 (E_RNA) where: Base-Base interactions energy: -1927.331 where: short stacking energy: -857.124 Base-Backbone interact. energy: -1.298 local terms energy: -922.413614 where: bonds (distance) C4'-P energy: -159.652 bonds (distance) P-C4' energy: -193.485 flat angles C4'-P-C4' energy: -209.057 flat angles P-C4'-P energy: -135.470 tors. eta vs tors. theta energy: -224.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -2790.022346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2790.022346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2790.022346 (E_RNA) where: Base-Base interactions energy: -1959.921 where: short stacking energy: -825.909 Base-Backbone interact. energy: -4.208 local terms energy: -825.893498 where: bonds (distance) C4'-P energy: -178.584 bonds (distance) P-C4' energy: -139.498 flat angles C4'-P-C4' energy: -182.392 flat angles P-C4'-P energy: -106.697 tors. eta vs tors. theta energy: -218.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -2671.265125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2671.265125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2671.265125 (E_RNA) where: Base-Base interactions energy: -1809.778 where: short stacking energy: -827.517 Base-Backbone interact. energy: -1.844 local terms energy: -859.642455 where: bonds (distance) C4'-P energy: -168.337 bonds (distance) P-C4' energy: -153.908 flat angles C4'-P-C4' energy: -186.602 flat angles P-C4'-P energy: -121.806 tors. eta vs tors. theta energy: -228.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -2306.067758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.067758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.067758 (E_RNA) where: Base-Base interactions energy: -1531.165 where: short stacking energy: -688.851 Base-Backbone interact. energy: -3.416 local terms energy: -771.486440 where: bonds (distance) C4'-P energy: -155.405 bonds (distance) P-C4' energy: -185.754 flat angles C4'-P-C4' energy: -154.664 flat angles P-C4'-P energy: -100.192 tors. eta vs tors. theta energy: -175.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -2208.329082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2208.329082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2208.329082 (E_RNA) where: Base-Base interactions energy: -1485.442 where: short stacking energy: -644.365 Base-Backbone interact. energy: -1.125 local terms energy: -721.762044 where: bonds (distance) C4'-P energy: -139.798 bonds (distance) P-C4' energy: -164.609 flat angles C4'-P-C4' energy: -186.075 flat angles P-C4'-P energy: -84.829 tors. eta vs tors. theta energy: -146.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1909.146081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1909.146081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1909.146081 (E_RNA) where: Base-Base interactions energy: -1220.782 where: short stacking energy: -571.472 Base-Backbone interact. energy: 0.168 local terms energy: -688.531784 where: bonds (distance) C4'-P energy: -147.561 bonds (distance) P-C4' energy: -163.132 flat angles C4'-P-C4' energy: -171.616 flat angles P-C4'-P energy: -97.360 tors. eta vs tors. theta energy: -108.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1371.064242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.064242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.064242 (E_RNA) where: Base-Base interactions energy: -758.741 where: short stacking energy: -393.445 Base-Backbone interact. energy: -1.458 local terms energy: -610.865919 where: bonds (distance) C4'-P energy: -158.344 bonds (distance) P-C4' energy: -179.415 flat angles C4'-P-C4' energy: -157.060 flat angles P-C4'-P energy: -89.094 tors. eta vs tors. theta energy: -26.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1302.006617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.006617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.006617 (E_RNA) where: Base-Base interactions energy: -735.229 where: short stacking energy: -360.454 Base-Backbone interact. energy: -0.268 local terms energy: -566.509734 where: bonds (distance) C4'-P energy: -148.780 bonds (distance) P-C4' energy: -146.859 flat angles C4'-P-C4' energy: -139.776 flat angles P-C4'-P energy: -76.502 tors. eta vs tors. theta energy: -54.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -1243.746197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.746197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.746197 (E_RNA) where: Base-Base interactions energy: -729.937 where: short stacking energy: -357.749 Base-Backbone interact. energy: 7.390 local terms energy: -521.199598 where: bonds (distance) C4'-P energy: -137.215 bonds (distance) P-C4' energy: -137.407 flat angles C4'-P-C4' energy: -132.507 flat angles P-C4'-P energy: -84.220 tors. eta vs tors. theta energy: -29.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -3028.827777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3028.827777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3028.827777 (E_RNA) where: Base-Base interactions energy: -2094.360 where: short stacking energy: -912.543 Base-Backbone interact. energy: -8.514 local terms energy: -925.953874 where: bonds (distance) C4'-P energy: -179.289 bonds (distance) P-C4' energy: -174.975 flat angles C4'-P-C4' energy: -198.874 flat angles P-C4'-P energy: -144.154 tors. eta vs tors. theta energy: -228.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -2858.902085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2858.902085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2858.902085 (E_RNA) where: Base-Base interactions energy: -1945.487 where: short stacking energy: -885.052 Base-Backbone interact. energy: -10.505 local terms energy: -902.909545 where: bonds (distance) C4'-P energy: -169.984 bonds (distance) P-C4' energy: -173.011 flat angles C4'-P-C4' energy: -204.231 flat angles P-C4'-P energy: -110.588 tors. eta vs tors. theta energy: -245.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -2777.951645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2777.951645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2777.951645 (E_RNA) where: Base-Base interactions energy: -1942.615 where: short stacking energy: -836.273 Base-Backbone interact. energy: -1.213 local terms energy: -834.123257 where: bonds (distance) C4'-P energy: -170.454 bonds (distance) P-C4' energy: -159.904 flat angles C4'-P-C4' energy: -177.362 flat angles P-C4'-P energy: -106.417 tors. eta vs tors. theta energy: -219.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -2664.345168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2664.345168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2664.345168 (E_RNA) where: Base-Base interactions energy: -1799.928 where: short stacking energy: -818.774 Base-Backbone interact. energy: -1.413 local terms energy: -863.004027 where: bonds (distance) C4'-P energy: -168.460 bonds (distance) P-C4' energy: -160.349 flat angles C4'-P-C4' energy: -194.963 flat angles P-C4'-P energy: -124.607 tors. eta vs tors. theta energy: -214.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -2379.161751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.161751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.161751 (E_RNA) where: Base-Base interactions energy: -1583.151 where: short stacking energy: -746.708 Base-Backbone interact. energy: -2.418 local terms energy: -793.592744 where: bonds (distance) C4'-P energy: -172.604 bonds (distance) P-C4' energy: -156.322 flat angles C4'-P-C4' energy: -181.301 flat angles P-C4'-P energy: -91.944 tors. eta vs tors. theta energy: -191.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -2262.437681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2262.437681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.437681 (E_RNA) where: Base-Base interactions energy: -1483.912 where: short stacking energy: -644.061 Base-Backbone interact. energy: 1.642 local terms energy: -780.167939 where: bonds (distance) C4'-P energy: -160.674 bonds (distance) P-C4' energy: -164.977 flat angles C4'-P-C4' energy: -191.053 flat angles P-C4'-P energy: -115.993 tors. eta vs tors. theta energy: -147.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1987.559973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1987.559973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1987.559973 (E_RNA) where: Base-Base interactions energy: -1259.759 where: short stacking energy: -592.873 Base-Backbone interact. energy: 4.968 local terms energy: -732.769462 where: bonds (distance) C4'-P energy: -144.735 bonds (distance) P-C4' energy: -162.232 flat angles C4'-P-C4' energy: -178.052 flat angles P-C4'-P energy: -111.860 tors. eta vs tors. theta energy: -135.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1412.727742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.727742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.727742 (E_RNA) where: Base-Base interactions energy: -851.532 where: short stacking energy: -460.726 Base-Backbone interact. energy: -1.197 local terms energy: -559.999129 where: bonds (distance) C4'-P energy: -149.721 bonds (distance) P-C4' energy: -161.281 flat angles C4'-P-C4' energy: -125.883 flat angles P-C4'-P energy: -83.153 tors. eta vs tors. theta energy: -39.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1410.452506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.452506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.452506 (E_RNA) where: Base-Base interactions energy: -856.537 where: short stacking energy: -399.122 Base-Backbone interact. energy: -0.279 local terms energy: -553.636124 where: bonds (distance) C4'-P energy: -136.617 bonds (distance) P-C4' energy: -156.791 flat angles C4'-P-C4' energy: -140.441 flat angles P-C4'-P energy: -87.483 tors. eta vs tors. theta energy: -32.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -1250.254155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.254155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.254155 (E_RNA) where: Base-Base interactions energy: -680.381 where: short stacking energy: -329.437 Base-Backbone interact. energy: -3.112 local terms energy: -566.761982 where: bonds (distance) C4'-P energy: -141.944 bonds (distance) P-C4' energy: -156.344 flat angles C4'-P-C4' energy: -149.689 flat angles P-C4'-P energy: -76.024 tors. eta vs tors. theta energy: -42.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -3032.270129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3032.270129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3032.270129 (E_RNA) where: Base-Base interactions energy: -2093.417 where: short stacking energy: -909.204 Base-Backbone interact. energy: -6.733 local terms energy: -932.119648 where: bonds (distance) C4'-P energy: -168.816 bonds (distance) P-C4' energy: -190.062 flat angles C4'-P-C4' energy: -201.457 flat angles P-C4'-P energy: -137.664 tors. eta vs tors. theta energy: -234.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -2866.294301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2866.294301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2866.294301 (E_RNA) where: Base-Base interactions energy: -1943.754 where: short stacking energy: -869.902 Base-Backbone interact. energy: -3.547 local terms energy: -918.993362 where: bonds (distance) C4'-P energy: -173.048 bonds (distance) P-C4' energy: -179.252 flat angles C4'-P-C4' energy: -204.313 flat angles P-C4'-P energy: -113.994 tors. eta vs tors. theta energy: -248.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -2788.747266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2788.747266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2788.747266 (E_RNA) where: Base-Base interactions energy: -1894.080 where: short stacking energy: -793.406 Base-Backbone interact. energy: -5.893 local terms energy: -888.774633 where: bonds (distance) C4'-P energy: -180.878 bonds (distance) P-C4' energy: -184.605 flat angles C4'-P-C4' energy: -178.452 flat angles P-C4'-P energy: -123.799 tors. eta vs tors. theta energy: -221.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -2676.118169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2676.118169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2676.118169 (E_RNA) where: Base-Base interactions energy: -1801.540 where: short stacking energy: -844.916 Base-Backbone interact. energy: 2.558 local terms energy: -877.135602 where: bonds (distance) C4'-P energy: -177.439 bonds (distance) P-C4' energy: -165.089 flat angles C4'-P-C4' energy: -186.718 flat angles P-C4'-P energy: -121.790 tors. eta vs tors. theta energy: -226.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -2318.611454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2318.611454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2318.611454 (E_RNA) where: Base-Base interactions energy: -1532.060 where: short stacking energy: -722.435 Base-Backbone interact. energy: -2.697 local terms energy: -783.854963 where: bonds (distance) C4'-P energy: -154.018 bonds (distance) P-C4' energy: -153.645 flat angles C4'-P-C4' energy: -172.439 flat angles P-C4'-P energy: -127.081 tors. eta vs tors. theta energy: -176.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -2208.833243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2208.833243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2208.833243 (E_RNA) where: Base-Base interactions energy: -1464.374 where: short stacking energy: -627.148 Base-Backbone interact. energy: -5.316 local terms energy: -739.143275 where: bonds (distance) C4'-P energy: -166.881 bonds (distance) P-C4' energy: -159.663 flat angles C4'-P-C4' energy: -162.122 flat angles P-C4'-P energy: -103.727 tors. eta vs tors. theta energy: -146.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1944.054801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1944.054801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1944.054801 (E_RNA) where: Base-Base interactions energy: -1258.621 where: short stacking energy: -585.067 Base-Backbone interact. energy: 2.784 local terms energy: -688.217608 where: bonds (distance) C4'-P energy: -136.265 bonds (distance) P-C4' energy: -155.560 flat angles C4'-P-C4' energy: -171.607 flat angles P-C4'-P energy: -80.079 tors. eta vs tors. theta energy: -144.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1559.792533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.792533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.792533 (E_RNA) where: Base-Base interactions energy: -932.499 where: short stacking energy: -459.925 Base-Backbone interact. energy: 3.323 local terms energy: -630.616975 where: bonds (distance) C4'-P energy: -141.138 bonds (distance) P-C4' energy: -157.605 flat angles C4'-P-C4' energy: -162.102 flat angles P-C4'-P energy: -102.420 tors. eta vs tors. theta energy: -67.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1402.828404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.828404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.828404 (E_RNA) where: Base-Base interactions energy: -812.773 where: short stacking energy: -386.429 Base-Backbone interact. energy: 2.376 local terms energy: -592.431631 where: bonds (distance) C4'-P energy: -150.663 bonds (distance) P-C4' energy: -163.463 flat angles C4'-P-C4' energy: -150.341 flat angles P-C4'-P energy: -66.303 tors. eta vs tors. theta energy: -61.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -1254.936215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.936215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.936215 (E_RNA) where: Base-Base interactions energy: -763.174 where: short stacking energy: -345.790 Base-Backbone interact. energy: 7.576 local terms energy: -499.338536 where: bonds (distance) C4'-P energy: -148.668 bonds (distance) P-C4' energy: -129.976 flat angles C4'-P-C4' energy: -136.116 flat angles P-C4'-P energy: -77.443 tors. eta vs tors. theta energy: -7.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -3067.549997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3067.549997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3067.549997 (E_RNA) where: Base-Base interactions energy: -2112.333 where: short stacking energy: -897.483 Base-Backbone interact. energy: -2.493 local terms energy: -952.724236 where: bonds (distance) C4'-P energy: -189.397 bonds (distance) P-C4' energy: -177.110 flat angles C4'-P-C4' energy: -209.180 flat angles P-C4'-P energy: -139.107 tors. eta vs tors. theta energy: -237.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -2849.271642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2849.271642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2849.271642 (E_RNA) where: Base-Base interactions energy: -1930.116 where: short stacking energy: -867.606 Base-Backbone interact. energy: -1.008 local terms energy: -918.147582 where: bonds (distance) C4'-P energy: -172.687 bonds (distance) P-C4' energy: -193.462 flat angles C4'-P-C4' energy: -193.635 flat angles P-C4'-P energy: -117.574 tors. eta vs tors. theta energy: -240.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -2885.362931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2885.362931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2885.362931 (E_RNA) where: Base-Base interactions energy: -1951.857 where: short stacking energy: -851.454 Base-Backbone interact. energy: -3.433 local terms energy: -930.072978 where: bonds (distance) C4'-P energy: -179.783 bonds (distance) P-C4' energy: -180.518 flat angles C4'-P-C4' energy: -192.652 flat angles P-C4'-P energy: -140.451 tors. eta vs tors. theta energy: -236.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -2620.513384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2620.513384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2620.513384 (E_RNA) where: Base-Base interactions energy: -1781.086 where: short stacking energy: -794.112 Base-Backbone interact. energy: 4.684 local terms energy: -844.111679 where: bonds (distance) C4'-P energy: -155.371 bonds (distance) P-C4' energy: -174.475 flat angles C4'-P-C4' energy: -206.561 flat angles P-C4'-P energy: -119.790 tors. eta vs tors. theta energy: -187.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -2338.496602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2338.496602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2338.496602 (E_RNA) where: Base-Base interactions energy: -1518.267 where: short stacking energy: -693.590 Base-Backbone interact. energy: -3.647 local terms energy: -816.582126 where: bonds (distance) C4'-P energy: -167.051 bonds (distance) P-C4' energy: -196.009 flat angles C4'-P-C4' energy: -178.207 flat angles P-C4'-P energy: -112.331 tors. eta vs tors. theta energy: -162.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -2212.410268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2212.410268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2212.410268 (E_RNA) where: Base-Base interactions energy: -1455.178 where: short stacking energy: -614.734 Base-Backbone interact. energy: -1.067 local terms energy: -756.164981 where: bonds (distance) C4'-P energy: -153.002 bonds (distance) P-C4' energy: -160.710 flat angles C4'-P-C4' energy: -185.225 flat angles P-C4'-P energy: -99.590 tors. eta vs tors. theta energy: -157.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -2011.178576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2011.178576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2011.178576 (E_RNA) where: Base-Base interactions energy: -1297.352 where: short stacking energy: -591.518 Base-Backbone interact. energy: -4.957 local terms energy: -708.869303 where: bonds (distance) C4'-P energy: -160.330 bonds (distance) P-C4' energy: -170.116 flat angles C4'-P-C4' energy: -166.194 flat angles P-C4'-P energy: -83.592 tors. eta vs tors. theta energy: -128.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1633.369271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.369271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1633.369271 (E_RNA) where: Base-Base interactions energy: -1057.542 where: short stacking energy: -523.522 Base-Backbone interact. energy: 4.422 local terms energy: -580.248688 where: bonds (distance) C4'-P energy: -135.922 bonds (distance) P-C4' energy: -151.110 flat angles C4'-P-C4' energy: -141.626 flat angles P-C4'-P energy: -62.779 tors. eta vs tors. theta energy: -88.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1415.925746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.925746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.925746 (E_RNA) where: Base-Base interactions energy: -846.480 where: short stacking energy: -419.988 Base-Backbone interact. energy: 6.532 local terms energy: -575.977606 where: bonds (distance) C4'-P energy: -150.517 bonds (distance) P-C4' energy: -156.498 flat angles C4'-P-C4' energy: -126.597 flat angles P-C4'-P energy: -82.799 tors. eta vs tors. theta energy: -59.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -1084.685277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.685277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.685277 (E_RNA) where: Base-Base interactions energy: -639.210 where: short stacking energy: -322.987 Base-Backbone interact. energy: 1.633 local terms energy: -447.107358 where: bonds (distance) C4'-P energy: -142.033 bonds (distance) P-C4' energy: -123.730 flat angles C4'-P-C4' energy: -102.521 flat angles P-C4'-P energy: -76.728 tors. eta vs tors. theta energy: -2.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -3043.082598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3043.082598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3043.082598 (E_RNA) where: Base-Base interactions energy: -2092.872 where: short stacking energy: -887.618 Base-Backbone interact. energy: -7.913 local terms energy: -942.297531 where: bonds (distance) C4'-P energy: -181.134 bonds (distance) P-C4' energy: -176.398 flat angles C4'-P-C4' energy: -201.713 flat angles P-C4'-P energy: -150.117 tors. eta vs tors. theta energy: -232.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -3007.818417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3007.818417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3007.818417 (E_RNA) where: Base-Base interactions energy: -2080.611 where: short stacking energy: -898.469 Base-Backbone interact. energy: -3.176 local terms energy: -924.031702 where: bonds (distance) C4'-P energy: -160.090 bonds (distance) P-C4' energy: -185.257 flat angles C4'-P-C4' energy: -203.119 flat angles P-C4'-P energy: -127.539 tors. eta vs tors. theta energy: -248.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -2823.305940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2823.305940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2823.305940 (E_RNA) where: Base-Base interactions energy: -1958.624 where: short stacking energy: -867.837 Base-Backbone interact. energy: 1.596 local terms energy: -866.277647 where: bonds (distance) C4'-P energy: -160.538 bonds (distance) P-C4' energy: -159.864 flat angles C4'-P-C4' energy: -196.866 flat angles P-C4'-P energy: -119.089 tors. eta vs tors. theta energy: -229.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -2627.850570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2627.850570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2627.850570 (E_RNA) where: Base-Base interactions energy: -1781.910 where: short stacking energy: -804.599 Base-Backbone interact. energy: -0.152 local terms energy: -845.789064 where: bonds (distance) C4'-P energy: -153.503 bonds (distance) P-C4' energy: -177.231 flat angles C4'-P-C4' energy: -198.322 flat angles P-C4'-P energy: -109.162 tors. eta vs tors. theta energy: -207.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -2274.783121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2274.783121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2274.783121 (E_RNA) where: Base-Base interactions energy: -1504.060 where: short stacking energy: -668.989 Base-Backbone interact. energy: -2.079 local terms energy: -768.644176 where: bonds (distance) C4'-P energy: -157.605 bonds (distance) P-C4' energy: -156.400 flat angles C4'-P-C4' energy: -175.414 flat angles P-C4'-P energy: -111.889 tors. eta vs tors. theta energy: -167.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -2208.685544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2208.685544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2208.685544 (E_RNA) where: Base-Base interactions energy: -1467.203 where: short stacking energy: -641.399 Base-Backbone interact. energy: -3.661 local terms energy: -737.821696 where: bonds (distance) C4'-P energy: -155.607 bonds (distance) P-C4' energy: -169.923 flat angles C4'-P-C4' energy: -153.669 flat angles P-C4'-P energy: -104.000 tors. eta vs tors. theta energy: -154.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -2006.452217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2006.452217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2006.452217 (E_RNA) where: Base-Base interactions energy: -1321.142 where: short stacking energy: -584.883 Base-Backbone interact. energy: 2.171 local terms energy: -687.480593 where: bonds (distance) C4'-P energy: -144.690 bonds (distance) P-C4' energy: -158.433 flat angles C4'-P-C4' energy: -158.771 flat angles P-C4'-P energy: -82.530 tors. eta vs tors. theta energy: -143.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1590.193402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1590.193402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1590.193402 (E_RNA) where: Base-Base interactions energy: -993.597 where: short stacking energy: -462.091 Base-Backbone interact. energy: -0.904 local terms energy: -595.691781 where: bonds (distance) C4'-P energy: -126.601 bonds (distance) P-C4' energy: -142.082 flat angles C4'-P-C4' energy: -158.952 flat angles P-C4'-P energy: -106.159 tors. eta vs tors. theta energy: -61.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1314.775228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.775228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.775228 (E_RNA) where: Base-Base interactions energy: -760.075 where: short stacking energy: -373.905 Base-Backbone interact. energy: 12.120 local terms energy: -566.820340 where: bonds (distance) C4'-P energy: -143.843 bonds (distance) P-C4' energy: -166.209 flat angles C4'-P-C4' energy: -143.855 flat angles P-C4'-P energy: -77.837 tors. eta vs tors. theta energy: -35.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -1133.695692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1133.695692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1133.695692 (E_RNA) where: Base-Base interactions energy: -595.336 where: short stacking energy: -322.483 Base-Backbone interact. energy: 7.848 local terms energy: -546.208053 where: bonds (distance) C4'-P energy: -164.562 bonds (distance) P-C4' energy: -172.880 flat angles C4'-P-C4' energy: -132.285 flat angles P-C4'-P energy: -50.983 tors. eta vs tors. theta energy: -25.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -2996.634097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2996.634097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2996.634097 (E_RNA) where: Base-Base interactions energy: -2079.351 where: short stacking energy: -891.436 Base-Backbone interact. energy: -2.356 local terms energy: -914.926740 where: bonds (distance) C4'-P energy: -179.556 bonds (distance) P-C4' energy: -180.967 flat angles C4'-P-C4' energy: -184.339 flat angles P-C4'-P energy: -131.693 tors. eta vs tors. theta energy: -238.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -3024.786318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3024.786318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3024.786318 (E_RNA) where: Base-Base interactions energy: -2072.333 where: short stacking energy: -879.883 Base-Backbone interact. energy: -7.292 local terms energy: -945.161255 where: bonds (distance) C4'-P energy: -199.140 bonds (distance) P-C4' energy: -169.062 flat angles C4'-P-C4' energy: -196.652 flat angles P-C4'-P energy: -133.765 tors. eta vs tors. theta energy: -246.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -2879.504643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2879.504643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2879.504643 (E_RNA) where: Base-Base interactions energy: -1967.504 where: short stacking energy: -902.738 Base-Backbone interact. energy: -5.253 local terms energy: -906.748017 where: bonds (distance) C4'-P energy: -157.912 bonds (distance) P-C4' energy: -177.693 flat angles C4'-P-C4' energy: -200.036 flat angles P-C4'-P energy: -118.983 tors. eta vs tors. theta energy: -252.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -2713.411703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2713.411703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2713.411703 (E_RNA) where: Base-Base interactions energy: -1839.883 where: short stacking energy: -792.700 Base-Backbone interact. energy: 1.689 local terms energy: -875.217904 where: bonds (distance) C4'-P energy: -161.107 bonds (distance) P-C4' energy: -170.226 flat angles C4'-P-C4' energy: -194.907 flat angles P-C4'-P energy: -147.476 tors. eta vs tors. theta energy: -201.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -2325.224167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2325.224167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2325.224167 (E_RNA) where: Base-Base interactions energy: -1548.767 where: short stacking energy: -726.942 Base-Backbone interact. energy: -5.482 local terms energy: -770.975910 where: bonds (distance) C4'-P energy: -161.320 bonds (distance) P-C4' energy: -158.069 flat angles C4'-P-C4' energy: -172.738 flat angles P-C4'-P energy: -106.213 tors. eta vs tors. theta energy: -172.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -2219.363714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2219.363714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2219.363714 (E_RNA) where: Base-Base interactions energy: -1493.573 where: short stacking energy: -667.658 Base-Backbone interact. energy: -1.430 local terms energy: -724.360911 where: bonds (distance) C4'-P energy: -140.403 bonds (distance) P-C4' energy: -159.491 flat angles C4'-P-C4' energy: -159.760 flat angles P-C4'-P energy: -117.549 tors. eta vs tors. theta energy: -147.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -2046.376122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2046.376122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2046.376122 (E_RNA) where: Base-Base interactions energy: -1325.478 where: short stacking energy: -608.578 Base-Backbone interact. energy: 3.280 local terms energy: -724.177827 where: bonds (distance) C4'-P energy: -169.863 bonds (distance) P-C4' energy: -167.070 flat angles C4'-P-C4' energy: -149.176 flat angles P-C4'-P energy: -99.216 tors. eta vs tors. theta energy: -138.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1566.761190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.761190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.761190 (E_RNA) where: Base-Base interactions energy: -977.526 where: short stacking energy: -453.579 Base-Backbone interact. energy: -2.696 local terms energy: -586.539180 where: bonds (distance) C4'-P energy: -154.976 bonds (distance) P-C4' energy: -160.852 flat angles C4'-P-C4' energy: -121.305 flat angles P-C4'-P energy: -93.882 tors. eta vs tors. theta energy: -55.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1309.044621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.044621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.044621 (E_RNA) where: Base-Base interactions energy: -719.577 where: short stacking energy: -354.181 Base-Backbone interact. energy: 5.355 local terms energy: -594.822627 where: bonds (distance) C4'-P energy: -149.610 bonds (distance) P-C4' energy: -147.584 flat angles C4'-P-C4' energy: -168.046 flat angles P-C4'-P energy: -93.795 tors. eta vs tors. theta energy: -35.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -1033.573563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1033.573563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1033.573563 (E_RNA) where: Base-Base interactions energy: -565.893 where: short stacking energy: -284.996 Base-Backbone interact. energy: -0.318 local terms energy: -467.363103 where: bonds (distance) C4'-P energy: -142.999 bonds (distance) P-C4' energy: -140.464 flat angles C4'-P-C4' energy: -118.459 flat angles P-C4'-P energy: -81.976 tors. eta vs tors. theta energy: 16.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -3042.227902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3042.227902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3042.227902 (E_RNA) where: Base-Base interactions energy: -2097.088 where: short stacking energy: -916.809 Base-Backbone interact. energy: -0.946 local terms energy: -944.193546 where: bonds (distance) C4'-P energy: -176.842 bonds (distance) P-C4' energy: -172.146 flat angles C4'-P-C4' energy: -209.297 flat angles P-C4'-P energy: -142.575 tors. eta vs tors. theta energy: -243.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -2998.727226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2998.727226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2998.727226 (E_RNA) where: Base-Base interactions energy: -2060.653 where: short stacking energy: -878.448 Base-Backbone interact. energy: -1.730 local terms energy: -936.345021 where: bonds (distance) C4'-P energy: -181.076 bonds (distance) P-C4' energy: -166.855 flat angles C4'-P-C4' energy: -217.069 flat angles P-C4'-P energy: -128.030 tors. eta vs tors. theta energy: -243.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -2885.420426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2885.420426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2885.420426 (E_RNA) where: Base-Base interactions energy: -1981.751 where: short stacking energy: -895.238 Base-Backbone interact. energy: -0.771 local terms energy: -902.898466 where: bonds (distance) C4'-P energy: -174.902 bonds (distance) P-C4' energy: -164.724 flat angles C4'-P-C4' energy: -201.134 flat angles P-C4'-P energy: -130.407 tors. eta vs tors. theta energy: -231.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -2632.760567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2632.760567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2632.760567 (E_RNA) where: Base-Base interactions energy: -1772.881 where: short stacking energy: -802.877 Base-Backbone interact. energy: -3.968 local terms energy: -855.911454 where: bonds (distance) C4'-P energy: -164.202 bonds (distance) P-C4' energy: -170.634 flat angles C4'-P-C4' energy: -184.493 flat angles P-C4'-P energy: -116.685 tors. eta vs tors. theta energy: -219.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -2285.019191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2285.019191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2285.019191 (E_RNA) where: Base-Base interactions energy: -1468.610 where: short stacking energy: -699.245 Base-Backbone interact. energy: -2.678 local terms energy: -813.731167 where: bonds (distance) C4'-P energy: -163.621 bonds (distance) P-C4' energy: -168.056 flat angles C4'-P-C4' energy: -189.462 flat angles P-C4'-P energy: -103.454 tors. eta vs tors. theta energy: -189.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -2204.815518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2204.815518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2204.815518 (E_RNA) where: Base-Base interactions energy: -1472.691 where: short stacking energy: -607.322 Base-Backbone interact. energy: -2.768 local terms energy: -729.357033 where: bonds (distance) C4'-P energy: -165.204 bonds (distance) P-C4' energy: -172.137 flat angles C4'-P-C4' energy: -175.251 flat angles P-C4'-P energy: -102.535 tors. eta vs tors. theta energy: -114.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -2042.967824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2042.967824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2042.967824 (E_RNA) where: Base-Base interactions energy: -1336.820 where: short stacking energy: -572.987 Base-Backbone interact. energy: -1.441 local terms energy: -704.706194 where: bonds (distance) C4'-P energy: -160.190 bonds (distance) P-C4' energy: -158.108 flat angles C4'-P-C4' energy: -164.829 flat angles P-C4'-P energy: -104.813 tors. eta vs tors. theta energy: -116.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1550.001900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1550.001900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1550.001900 (E_RNA) where: Base-Base interactions energy: -954.092 where: short stacking energy: -443.649 Base-Backbone interact. energy: -1.491 local terms energy: -594.418648 where: bonds (distance) C4'-P energy: -134.186 bonds (distance) P-C4' energy: -168.060 flat angles C4'-P-C4' energy: -142.851 flat angles P-C4'-P energy: -93.074 tors. eta vs tors. theta energy: -56.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1314.687845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.687845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.687845 (E_RNA) where: Base-Base interactions energy: -753.874 where: short stacking energy: -388.890 Base-Backbone interact. energy: 1.654 local terms energy: -562.468411 where: bonds (distance) C4'-P energy: -149.283 bonds (distance) P-C4' energy: -132.327 flat angles C4'-P-C4' energy: -159.086 flat angles P-C4'-P energy: -78.280 tors. eta vs tors. theta energy: -43.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -1121.019357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.019357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.019357 (E_RNA) where: Base-Base interactions energy: -598.452 where: short stacking energy: -335.342 Base-Backbone interact. energy: 2.253 local terms energy: -524.820351 where: bonds (distance) C4'-P energy: -146.239 bonds (distance) P-C4' energy: -175.169 flat angles C4'-P-C4' energy: -118.577 flat angles P-C4'-P energy: -76.862 tors. eta vs tors. theta energy: -7.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -3042.128238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3042.128238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3042.128238 (E_RNA) where: Base-Base interactions energy: -2115.749 where: short stacking energy: -879.103 Base-Backbone interact. energy: -4.220 local terms energy: -922.159263 where: bonds (distance) C4'-P energy: -169.423 bonds (distance) P-C4' energy: -175.497 flat angles C4'-P-C4' energy: -206.558 flat angles P-C4'-P energy: -126.841 tors. eta vs tors. theta energy: -243.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -2961.702607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2961.702607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2961.702607 (E_RNA) where: Base-Base interactions energy: -2036.142 where: short stacking energy: -876.647 Base-Backbone interact. energy: -2.406 local terms energy: -923.154247 where: bonds (distance) C4'-P energy: -180.207 bonds (distance) P-C4' energy: -171.799 flat angles C4'-P-C4' energy: -209.055 flat angles P-C4'-P energy: -131.654 tors. eta vs tors. theta energy: -230.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -2836.125074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2836.125074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2836.125074 (E_RNA) where: Base-Base interactions energy: -1968.561 where: short stacking energy: -881.815 Base-Backbone interact. energy: 3.031 local terms energy: -870.594833 where: bonds (distance) C4'-P energy: -157.110 bonds (distance) P-C4' energy: -163.553 flat angles C4'-P-C4' energy: -192.467 flat angles P-C4'-P energy: -122.496 tors. eta vs tors. theta energy: -234.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -2678.267464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2678.267464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2678.267464 (E_RNA) where: Base-Base interactions energy: -1806.674 where: short stacking energy: -792.782 Base-Backbone interact. energy: -0.549 local terms energy: -871.044992 where: bonds (distance) C4'-P energy: -187.639 bonds (distance) P-C4' energy: -173.169 flat angles C4'-P-C4' energy: -176.360 flat angles P-C4'-P energy: -125.790 tors. eta vs tors. theta energy: -208.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -2301.259839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.259839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.259839 (E_RNA) where: Base-Base interactions energy: -1497.573 where: short stacking energy: -682.006 Base-Backbone interact. energy: -5.653 local terms energy: -798.034176 where: bonds (distance) C4'-P energy: -153.440 bonds (distance) P-C4' energy: -191.379 flat angles C4'-P-C4' energy: -175.809 flat angles P-C4'-P energy: -113.181 tors. eta vs tors. theta energy: -164.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -2251.504064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.504064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.504064 (E_RNA) where: Base-Base interactions energy: -1512.204 where: short stacking energy: -642.370 Base-Backbone interact. energy: -3.802 local terms energy: -735.497933 where: bonds (distance) C4'-P energy: -153.977 bonds (distance) P-C4' energy: -153.472 flat angles C4'-P-C4' energy: -186.160 flat angles P-C4'-P energy: -104.306 tors. eta vs tors. theta energy: -137.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -2104.940259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2104.940259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2104.940259 (E_RNA) where: Base-Base interactions energy: -1369.162 where: short stacking energy: -615.456 Base-Backbone interact. energy: -1.291 local terms energy: -734.486765 where: bonds (distance) C4'-P energy: -152.655 bonds (distance) P-C4' energy: -159.671 flat angles C4'-P-C4' energy: -170.486 flat angles P-C4'-P energy: -104.445 tors. eta vs tors. theta energy: -147.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1593.913822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.913822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.913822 (E_RNA) where: Base-Base interactions energy: -973.530 where: short stacking energy: -474.688 Base-Backbone interact. energy: -1.927 local terms energy: -618.457482 where: bonds (distance) C4'-P energy: -128.635 bonds (distance) P-C4' energy: -158.202 flat angles C4'-P-C4' energy: -146.717 flat angles P-C4'-P energy: -105.161 tors. eta vs tors. theta energy: -79.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1244.868632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.868632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.868632 (E_RNA) where: Base-Base interactions energy: -675.238 where: short stacking energy: -364.533 Base-Backbone interact. energy: 0.866 local terms energy: -570.497211 where: bonds (distance) C4'-P energy: -122.767 bonds (distance) P-C4' energy: -175.666 flat angles C4'-P-C4' energy: -134.713 flat angles P-C4'-P energy: -83.898 tors. eta vs tors. theta energy: -53.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -1072.456890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.456890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.456890 (E_RNA) where: Base-Base interactions energy: -590.148 where: short stacking energy: -319.904 Base-Backbone interact. energy: 4.663 local terms energy: -486.971915 where: bonds (distance) C4'-P energy: -141.334 bonds (distance) P-C4' energy: -153.904 flat angles C4'-P-C4' energy: -134.899 flat angles P-C4'-P energy: -46.769 tors. eta vs tors. theta energy: -10.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -3084.667150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3084.667150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3084.667150 (E_RNA) where: Base-Base interactions energy: -2136.800 where: short stacking energy: -920.026 Base-Backbone interact. energy: -5.105 local terms energy: -942.762453 where: bonds (distance) C4'-P energy: -186.978 bonds (distance) P-C4' energy: -194.570 flat angles C4'-P-C4' energy: -201.073 flat angles P-C4'-P energy: -116.017 tors. eta vs tors. theta energy: -244.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -2962.672553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2962.672553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2962.672553 (E_RNA) where: Base-Base interactions energy: -2035.792 where: short stacking energy: -887.055 Base-Backbone interact. energy: -4.642 local terms energy: -922.238254 where: bonds (distance) C4'-P energy: -170.770 bonds (distance) P-C4' energy: -170.431 flat angles C4'-P-C4' energy: -200.936 flat angles P-C4'-P energy: -139.774 tors. eta vs tors. theta energy: -240.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -2759.224271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2759.224271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2759.224271 (E_RNA) where: Base-Base interactions energy: -1891.509 where: short stacking energy: -819.081 Base-Backbone interact. energy: -2.435 local terms energy: -865.279403 where: bonds (distance) C4'-P energy: -180.572 bonds (distance) P-C4' energy: -159.358 flat angles C4'-P-C4' energy: -195.005 flat angles P-C4'-P energy: -106.438 tors. eta vs tors. theta energy: -223.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -2731.081548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2731.081548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2731.081548 (E_RNA) where: Base-Base interactions energy: -1843.381 where: short stacking energy: -820.906 Base-Backbone interact. energy: -4.415 local terms energy: -883.285406 where: bonds (distance) C4'-P energy: -160.714 bonds (distance) P-C4' energy: -178.055 flat angles C4'-P-C4' energy: -202.444 flat angles P-C4'-P energy: -119.170 tors. eta vs tors. theta energy: -222.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -2304.096764 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2304.096764 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2304.096764 (E_RNA) where: Base-Base interactions energy: -1522.678 where: short stacking energy: -649.371 Base-Backbone interact. energy: -5.074 local terms energy: -776.344732 where: bonds (distance) C4'-P energy: -161.406 bonds (distance) P-C4' energy: -185.372 flat angles C4'-P-C4' energy: -164.656 flat angles P-C4'-P energy: -111.606 tors. eta vs tors. theta energy: -153.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -2133.233649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.233649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.233649 (E_RNA) where: Base-Base interactions energy: -1399.867 where: short stacking energy: -596.421 Base-Backbone interact. energy: 1.067 local terms energy: -734.433175 where: bonds (distance) C4'-P energy: -167.539 bonds (distance) P-C4' energy: -156.697 flat angles C4'-P-C4' energy: -173.256 flat angles P-C4'-P energy: -101.576 tors. eta vs tors. theta energy: -135.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -2110.940062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.940062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2110.940062 (E_RNA) where: Base-Base interactions energy: -1396.938 where: short stacking energy: -606.450 Base-Backbone interact. energy: -3.593 local terms energy: -710.409111 where: bonds (distance) C4'-P energy: -146.477 bonds (distance) P-C4' energy: -176.231 flat angles C4'-P-C4' energy: -150.500 flat angles P-C4'-P energy: -100.146 tors. eta vs tors. theta energy: -137.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1662.440844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.440844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.440844 (E_RNA) where: Base-Base interactions energy: -1043.081 where: short stacking energy: -467.027 Base-Backbone interact. energy: -4.352 local terms energy: -615.007623 where: bonds (distance) C4'-P energy: -135.959 bonds (distance) P-C4' energy: -153.558 flat angles C4'-P-C4' energy: -163.270 flat angles P-C4'-P energy: -81.983 tors. eta vs tors. theta energy: -80.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1175.178167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.178167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.178167 (E_RNA) where: Base-Base interactions energy: -630.980 where: short stacking energy: -345.159 Base-Backbone interact. energy: 3.005 local terms energy: -547.203144 where: bonds (distance) C4'-P energy: -158.539 bonds (distance) P-C4' energy: -145.864 flat angles C4'-P-C4' energy: -114.622 flat angles P-C4'-P energy: -86.002 tors. eta vs tors. theta energy: -42.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -1101.632991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.632991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.632991 (E_RNA) where: Base-Base interactions energy: -628.195 where: short stacking energy: -335.578 Base-Backbone interact. energy: 1.856 local terms energy: -475.294546 where: bonds (distance) C4'-P energy: -137.737 bonds (distance) P-C4' energy: -142.619 flat angles C4'-P-C4' energy: -132.336 flat angles P-C4'-P energy: -65.649 tors. eta vs tors. theta energy: 3.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -3099.744312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3099.744312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3099.744312 (E_RNA) where: Base-Base interactions energy: -2156.595 where: short stacking energy: -930.888 Base-Backbone interact. energy: -5.002 local terms energy: -938.148215 where: bonds (distance) C4'-P energy: -180.232 bonds (distance) P-C4' energy: -170.720 flat angles C4'-P-C4' energy: -212.749 flat angles P-C4'-P energy: -137.311 tors. eta vs tors. theta energy: -237.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -2963.355743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2963.355743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2963.355743 (E_RNA) where: Base-Base interactions energy: -2057.207 where: short stacking energy: -898.247 Base-Backbone interact. energy: -5.803 local terms energy: -900.345239 where: bonds (distance) C4'-P energy: -153.089 bonds (distance) P-C4' energy: -176.840 flat angles C4'-P-C4' energy: -194.394 flat angles P-C4'-P energy: -128.959 tors. eta vs tors. theta energy: -247.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -2744.174442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2744.174442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2744.174442 (E_RNA) where: Base-Base interactions energy: -1875.569 where: short stacking energy: -843.104 Base-Backbone interact. energy: -6.333 local terms energy: -862.272049 where: bonds (distance) C4'-P energy: -171.999 bonds (distance) P-C4' energy: -165.863 flat angles C4'-P-C4' energy: -186.273 flat angles P-C4'-P energy: -112.317 tors. eta vs tors. theta energy: -225.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -2722.223165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2722.223165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2722.223165 (E_RNA) where: Base-Base interactions energy: -1854.365 where: short stacking energy: -831.763 Base-Backbone interact. energy: -2.674 local terms energy: -865.183398 where: bonds (distance) C4'-P energy: -173.740 bonds (distance) P-C4' energy: -170.108 flat angles C4'-P-C4' energy: -197.512 flat angles P-C4'-P energy: -93.181 tors. eta vs tors. theta energy: -230.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -2288.527703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2288.527703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2288.527703 (E_RNA) where: Base-Base interactions energy: -1524.813 where: short stacking energy: -711.415 Base-Backbone interact. energy: -2.247 local terms energy: -761.468528 where: bonds (distance) C4'-P energy: -169.658 bonds (distance) P-C4' energy: -171.688 flat angles C4'-P-C4' energy: -161.947 flat angles P-C4'-P energy: -95.985 tors. eta vs tors. theta energy: -162.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -2069.316496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2069.316496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2069.316496 (E_RNA) where: Base-Base interactions energy: -1426.817 where: short stacking energy: -624.470 Base-Backbone interact. energy: -3.446 local terms energy: -639.054167 where: bonds (distance) C4'-P energy: -131.183 bonds (distance) P-C4' energy: -158.461 flat angles C4'-P-C4' energy: -156.557 flat angles P-C4'-P energy: -77.336 tors. eta vs tors. theta energy: -115.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -2113.844831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2113.844831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2113.844831 (E_RNA) where: Base-Base interactions energy: -1427.938 where: short stacking energy: -637.689 Base-Backbone interact. energy: -0.473 local terms energy: -685.433441 where: bonds (distance) C4'-P energy: -138.555 bonds (distance) P-C4' energy: -145.252 flat angles C4'-P-C4' energy: -164.894 flat angles P-C4'-P energy: -96.074 tors. eta vs tors. theta energy: -140.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1626.496990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.496990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.496990 (E_RNA) where: Base-Base interactions energy: -1060.588 where: short stacking energy: -473.579 Base-Backbone interact. energy: 4.728 local terms energy: -570.636674 where: bonds (distance) C4'-P energy: -146.231 bonds (distance) P-C4' energy: -144.907 flat angles C4'-P-C4' energy: -135.151 flat angles P-C4'-P energy: -88.792 tors. eta vs tors. theta energy: -55.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1204.449031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.449031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.449031 (E_RNA) where: Base-Base interactions energy: -670.686 where: short stacking energy: -336.755 Base-Backbone interact. energy: 2.632 local terms energy: -536.395090 where: bonds (distance) C4'-P energy: -128.377 bonds (distance) P-C4' energy: -158.198 flat angles C4'-P-C4' energy: -160.502 flat angles P-C4'-P energy: -86.003 tors. eta vs tors. theta energy: -3.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -1037.221399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.221399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.221399 (E_RNA) where: Base-Base interactions energy: -553.126 where: short stacking energy: -280.074 Base-Backbone interact. energy: 0.010 local terms energy: -484.105112 where: bonds (distance) C4'-P energy: -138.556 bonds (distance) P-C4' energy: -142.490 flat angles C4'-P-C4' energy: -120.090 flat angles P-C4'-P energy: -91.865 tors. eta vs tors. theta energy: 8.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -3070.208080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3070.208080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3070.208080 (E_RNA) where: Base-Base interactions energy: -2093.295 where: short stacking energy: -905.750 Base-Backbone interact. energy: -0.045 local terms energy: -976.867653 where: bonds (distance) C4'-P energy: -191.092 bonds (distance) P-C4' energy: -194.937 flat angles C4'-P-C4' energy: -216.259 flat angles P-C4'-P energy: -138.733 tors. eta vs tors. theta energy: -235.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -2971.234151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2971.234151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2971.234151 (E_RNA) where: Base-Base interactions energy: -2053.886 where: short stacking energy: -876.367 Base-Backbone interact. energy: -5.352 local terms energy: -911.996309 where: bonds (distance) C4'-P energy: -178.865 bonds (distance) P-C4' energy: -178.556 flat angles C4'-P-C4' energy: -206.030 flat angles P-C4'-P energy: -124.635 tors. eta vs tors. theta energy: -223.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -2743.329863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2743.329863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2743.329863 (E_RNA) where: Base-Base interactions energy: -1851.439 where: short stacking energy: -836.496 Base-Backbone interact. energy: -5.716 local terms energy: -886.175718 where: bonds (distance) C4'-P energy: -161.507 bonds (distance) P-C4' energy: -168.728 flat angles C4'-P-C4' energy: -198.423 flat angles P-C4'-P energy: -128.909 tors. eta vs tors. theta energy: -228.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -2748.671926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2748.671926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2748.671926 (E_RNA) where: Base-Base interactions energy: -1874.498 where: short stacking energy: -832.120 Base-Backbone interact. energy: -1.648 local terms energy: -872.525725 where: bonds (distance) C4'-P energy: -157.396 bonds (distance) P-C4' energy: -160.207 flat angles C4'-P-C4' energy: -200.410 flat angles P-C4'-P energy: -121.436 tors. eta vs tors. theta energy: -233.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -2327.346767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2327.346767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2327.346767 (E_RNA) where: Base-Base interactions energy: -1528.712 where: short stacking energy: -689.985 Base-Backbone interact. energy: -5.811 local terms energy: -792.823158 where: bonds (distance) C4'-P energy: -151.287 bonds (distance) P-C4' energy: -167.881 flat angles C4'-P-C4' energy: -178.866 flat angles P-C4'-P energy: -132.949 tors. eta vs tors. theta energy: -161.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -2145.075345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2145.075345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2145.075345 (E_RNA) where: Base-Base interactions energy: -1402.062 where: short stacking energy: -623.919 Base-Backbone interact. energy: -0.861 local terms energy: -742.152938 where: bonds (distance) C4'-P energy: -155.111 bonds (distance) P-C4' energy: -169.630 flat angles C4'-P-C4' energy: -174.193 flat angles P-C4'-P energy: -114.331 tors. eta vs tors. theta energy: -128.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -2086.815440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2086.815440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2086.815440 (E_RNA) where: Base-Base interactions energy: -1400.610 where: short stacking energy: -605.891 Base-Backbone interact. energy: -3.117 local terms energy: -683.088922 where: bonds (distance) C4'-P energy: -129.122 bonds (distance) P-C4' energy: -144.121 flat angles C4'-P-C4' energy: -166.911 flat angles P-C4'-P energy: -114.737 tors. eta vs tors. theta energy: -128.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1709.931592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.931592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.931592 (E_RNA) where: Base-Base interactions energy: -1110.522 where: short stacking energy: -535.469 Base-Backbone interact. energy: -1.335 local terms energy: -598.074747 where: bonds (distance) C4'-P energy: -148.093 bonds (distance) P-C4' energy: -142.983 flat angles C4'-P-C4' energy: -145.108 flat angles P-C4'-P energy: -81.745 tors. eta vs tors. theta energy: -80.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1200.535321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.535321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.535321 (E_RNA) where: Base-Base interactions energy: -681.479 where: short stacking energy: -367.534 Base-Backbone interact. energy: -2.611 local terms energy: -516.446081 where: bonds (distance) C4'-P energy: -147.030 bonds (distance) P-C4' energy: -131.419 flat angles C4'-P-C4' energy: -130.876 flat angles P-C4'-P energy: -87.150 tors. eta vs tors. theta energy: -19.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -1018.601605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.601605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.601605 (E_RNA) where: Base-Base interactions energy: -539.828 where: short stacking energy: -309.999 Base-Backbone interact. energy: 3.833 local terms energy: -482.606974 where: bonds (distance) C4'-P energy: -140.712 bonds (distance) P-C4' energy: -128.492 flat angles C4'-P-C4' energy: -132.672 flat angles P-C4'-P energy: -64.274 tors. eta vs tors. theta energy: -16.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -3082.062453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3082.062453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3082.062453 (E_RNA) where: Base-Base interactions energy: -2126.331 where: short stacking energy: -883.023 Base-Backbone interact. energy: -9.568 local terms energy: -946.164312 where: bonds (distance) C4'-P energy: -186.741 bonds (distance) P-C4' energy: -190.396 flat angles C4'-P-C4' energy: -204.711 flat angles P-C4'-P energy: -126.866 tors. eta vs tors. theta energy: -237.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -2955.824689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2955.824689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2955.824689 (E_RNA) where: Base-Base interactions energy: -2042.510 where: short stacking energy: -880.000 Base-Backbone interact. energy: -3.307 local terms energy: -910.007304 where: bonds (distance) C4'-P energy: -182.432 bonds (distance) P-C4' energy: -165.667 flat angles C4'-P-C4' energy: -205.012 flat angles P-C4'-P energy: -129.742 tors. eta vs tors. theta energy: -227.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -2755.644894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2755.644894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2755.644894 (E_RNA) where: Base-Base interactions energy: -1875.033 where: short stacking energy: -843.695 Base-Backbone interact. energy: -1.136 local terms energy: -879.475169 where: bonds (distance) C4'-P energy: -144.475 bonds (distance) P-C4' energy: -180.730 flat angles C4'-P-C4' energy: -194.217 flat angles P-C4'-P energy: -138.852 tors. eta vs tors. theta energy: -221.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -2738.559183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2738.559183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2738.559183 (E_RNA) where: Base-Base interactions energy: -1887.987 where: short stacking energy: -819.480 Base-Backbone interact. energy: -2.805 local terms energy: -847.766750 where: bonds (distance) C4'-P energy: -175.741 bonds (distance) P-C4' energy: -166.948 flat angles C4'-P-C4' energy: -185.369 flat angles P-C4'-P energy: -113.501 tors. eta vs tors. theta energy: -206.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -2312.507474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2312.507474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2312.507474 (E_RNA) where: Base-Base interactions energy: -1557.103 where: short stacking energy: -692.889 Base-Backbone interact. energy: -3.813 local terms energy: -751.591907 where: bonds (distance) C4'-P energy: -145.024 bonds (distance) P-C4' energy: -164.151 flat angles C4'-P-C4' energy: -188.930 flat angles P-C4'-P energy: -97.956 tors. eta vs tors. theta energy: -155.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -2123.342521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2123.342521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2123.342521 (E_RNA) where: Base-Base interactions energy: -1393.886 where: short stacking energy: -630.411 Base-Backbone interact. energy: -2.560 local terms energy: -726.896175 where: bonds (distance) C4'-P energy: -151.323 bonds (distance) P-C4' energy: -163.073 flat angles C4'-P-C4' energy: -175.208 flat angles P-C4'-P energy: -97.193 tors. eta vs tors. theta energy: -140.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -2109.855274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2109.855274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2109.855274 (E_RNA) where: Base-Base interactions energy: -1400.373 where: short stacking energy: -628.855 Base-Backbone interact. energy: -2.745 local terms energy: -706.737591 where: bonds (distance) C4'-P energy: -143.734 bonds (distance) P-C4' energy: -181.062 flat angles C4'-P-C4' energy: -151.781 flat angles P-C4'-P energy: -81.665 tors. eta vs tors. theta energy: -148.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1836.819291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1836.819291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1836.819291 (E_RNA) where: Base-Base interactions energy: -1176.259 where: short stacking energy: -532.522 Base-Backbone interact. energy: 0.145 local terms energy: -660.704963 where: bonds (distance) C4'-P energy: -155.158 bonds (distance) P-C4' energy: -156.133 flat angles C4'-P-C4' energy: -152.297 flat angles P-C4'-P energy: -100.104 tors. eta vs tors. theta energy: -97.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1284.121399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.121399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.121399 (E_RNA) where: Base-Base interactions energy: -724.270 where: short stacking energy: -392.708 Base-Backbone interact. energy: 5.495 local terms energy: -565.345944 where: bonds (distance) C4'-P energy: -158.880 bonds (distance) P-C4' energy: -151.930 flat angles C4'-P-C4' energy: -123.083 flat angles P-C4'-P energy: -83.092 tors. eta vs tors. theta energy: -48.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -1059.654823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.654823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.654823 (E_RNA) where: Base-Base interactions energy: -534.684 where: short stacking energy: -282.808 Base-Backbone interact. energy: -0.420 local terms energy: -524.550964 where: bonds (distance) C4'-P energy: -164.309 bonds (distance) P-C4' energy: -134.680 flat angles C4'-P-C4' energy: -134.683 flat angles P-C4'-P energy: -96.131 tors. eta vs tors. theta energy: 5.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -3100.187282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3100.187282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3100.187282 (E_RNA) where: Base-Base interactions energy: -2154.430 where: short stacking energy: -906.092 Base-Backbone interact. energy: -3.241 local terms energy: -942.516305 where: bonds (distance) C4'-P energy: -177.426 bonds (distance) P-C4' energy: -181.706 flat angles C4'-P-C4' energy: -208.402 flat angles P-C4'-P energy: -128.186 tors. eta vs tors. theta energy: -246.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -2971.893811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2971.893811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2971.893811 (E_RNA) where: Base-Base interactions energy: -2065.618 where: short stacking energy: -896.055 Base-Backbone interact. energy: 1.858 local terms energy: -908.134040 where: bonds (distance) C4'-P energy: -165.932 bonds (distance) P-C4' energy: -170.977 flat angles C4'-P-C4' energy: -207.780 flat angles P-C4'-P energy: -128.033 tors. eta vs tors. theta energy: -235.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -2758.769096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2758.769096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2758.769096 (E_RNA) where: Base-Base interactions energy: -1893.541 where: short stacking energy: -851.300 Base-Backbone interact. energy: 0.485 local terms energy: -865.712566 where: bonds (distance) C4'-P energy: -167.001 bonds (distance) P-C4' energy: -179.287 flat angles C4'-P-C4' energy: -197.144 flat angles P-C4'-P energy: -113.814 tors. eta vs tors. theta energy: -208.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -2691.363877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2691.363877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2691.363877 (E_RNA) where: Base-Base interactions energy: -1816.801 where: short stacking energy: -804.361 Base-Backbone interact. energy: -2.259 local terms energy: -872.303926 where: bonds (distance) C4'-P energy: -149.763 bonds (distance) P-C4' energy: -183.409 flat angles C4'-P-C4' energy: -204.586 flat angles P-C4'-P energy: -116.974 tors. eta vs tors. theta energy: -217.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -2306.659960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.659960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.659960 (E_RNA) where: Base-Base interactions energy: -1530.366 where: short stacking energy: -683.659 Base-Backbone interact. energy: -2.863 local terms energy: -773.430756 where: bonds (distance) C4'-P energy: -160.020 bonds (distance) P-C4' energy: -156.060 flat angles C4'-P-C4' energy: -182.230 flat angles P-C4'-P energy: -124.315 tors. eta vs tors. theta energy: -150.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -2202.804235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2202.804235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2202.804235 (E_RNA) where: Base-Base interactions energy: -1462.890 where: short stacking energy: -647.768 Base-Backbone interact. energy: -2.895 local terms energy: -737.019328 where: bonds (distance) C4'-P energy: -149.731 bonds (distance) P-C4' energy: -160.062 flat angles C4'-P-C4' energy: -168.387 flat angles P-C4'-P energy: -115.792 tors. eta vs tors. theta energy: -143.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -2102.503776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2102.503776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2102.503776 (E_RNA) where: Base-Base interactions energy: -1365.648 where: short stacking energy: -578.711 Base-Backbone interact. energy: 0.337 local terms energy: -737.192885 where: bonds (distance) C4'-P energy: -166.060 bonds (distance) P-C4' energy: -165.173 flat angles C4'-P-C4' energy: -177.723 flat angles P-C4'-P energy: -94.301 tors. eta vs tors. theta energy: -133.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1843.678953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1843.678953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1843.678953 (E_RNA) where: Base-Base interactions energy: -1194.151 where: short stacking energy: -566.311 Base-Backbone interact. energy: -4.307 local terms energy: -645.221371 where: bonds (distance) C4'-P energy: -154.845 bonds (distance) P-C4' energy: -142.851 flat angles C4'-P-C4' energy: -145.820 flat angles P-C4'-P energy: -107.087 tors. eta vs tors. theta energy: -94.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1280.417250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.417250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.417250 (E_RNA) where: Base-Base interactions energy: -700.064 where: short stacking energy: -346.513 Base-Backbone interact. energy: -2.472 local terms energy: -577.881341 where: bonds (distance) C4'-P energy: -133.448 bonds (distance) P-C4' energy: -175.239 flat angles C4'-P-C4' energy: -147.301 flat angles P-C4'-P energy: -75.415 tors. eta vs tors. theta energy: -46.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -1027.124253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.124253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.124253 (E_RNA) where: Base-Base interactions energy: -528.636 where: short stacking energy: -296.277 Base-Backbone interact. energy: 1.136 local terms energy: -499.624372 where: bonds (distance) C4'-P energy: -141.359 bonds (distance) P-C4' energy: -153.953 flat angles C4'-P-C4' energy: -122.866 flat angles P-C4'-P energy: -86.878 tors. eta vs tors. theta energy: 5.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -3096.850625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3096.850625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3096.850625 (E_RNA) where: Base-Base interactions energy: -2139.200 where: short stacking energy: -927.018 Base-Backbone interact. energy: -2.107 local terms energy: -955.543138 where: bonds (distance) C4'-P energy: -183.615 bonds (distance) P-C4' energy: -185.533 flat angles C4'-P-C4' energy: -207.262 flat angles P-C4'-P energy: -136.722 tors. eta vs tors. theta energy: -242.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -2959.691876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2959.691876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2959.691876 (E_RNA) where: Base-Base interactions energy: -2050.436 where: short stacking energy: -889.036 Base-Backbone interact. energy: -0.016 local terms energy: -909.239458 where: bonds (distance) C4'-P energy: -174.513 bonds (distance) P-C4' energy: -189.766 flat angles C4'-P-C4' energy: -188.714 flat angles P-C4'-P energy: -119.662 tors. eta vs tors. theta energy: -236.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -2739.812907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2739.812907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2739.812907 (E_RNA) where: Base-Base interactions energy: -1855.093 where: short stacking energy: -789.022 Base-Backbone interact. energy: -2.785 local terms energy: -881.934155 where: bonds (distance) C4'-P energy: -158.410 bonds (distance) P-C4' energy: -194.474 flat angles C4'-P-C4' energy: -194.756 flat angles P-C4'-P energy: -126.059 tors. eta vs tors. theta energy: -208.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -2662.294436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2662.294436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2662.294436 (E_RNA) where: Base-Base interactions energy: -1794.500 where: short stacking energy: -792.950 Base-Backbone interact. energy: 1.341 local terms energy: -869.135433 where: bonds (distance) C4'-P energy: -177.834 bonds (distance) P-C4' energy: -171.468 flat angles C4'-P-C4' energy: -191.243 flat angles P-C4'-P energy: -124.849 tors. eta vs tors. theta energy: -203.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -2275.496733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.496733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.496733 (E_RNA) where: Base-Base interactions energy: -1479.394 where: short stacking energy: -650.653 Base-Backbone interact. energy: -3.295 local terms energy: -792.807698 where: bonds (distance) C4'-P energy: -166.125 bonds (distance) P-C4' energy: -181.611 flat angles C4'-P-C4' energy: -179.437 flat angles P-C4'-P energy: -114.089 tors. eta vs tors. theta energy: -151.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -2208.145129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2208.145129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2208.145129 (E_RNA) where: Base-Base interactions energy: -1478.149 where: short stacking energy: -646.147 Base-Backbone interact. energy: -2.906 local terms energy: -727.089907 where: bonds (distance) C4'-P energy: -152.145 bonds (distance) P-C4' energy: -155.078 flat angles C4'-P-C4' energy: -183.417 flat angles P-C4'-P energy: -93.010 tors. eta vs tors. theta energy: -143.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -2120.402919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2120.402919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2120.402919 (E_RNA) where: Base-Base interactions energy: -1388.746 where: short stacking energy: -638.810 Base-Backbone interact. energy: 1.189 local terms energy: -732.846078 where: bonds (distance) C4'-P energy: -135.484 bonds (distance) P-C4' energy: -164.283 flat angles C4'-P-C4' energy: -168.823 flat angles P-C4'-P energy: -112.715 tors. eta vs tors. theta energy: -151.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1821.844051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1821.844051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1821.844051 (E_RNA) where: Base-Base interactions energy: -1215.168 where: short stacking energy: -550.433 Base-Backbone interact. energy: 1.773 local terms energy: -608.448260 where: bonds (distance) C4'-P energy: -131.236 bonds (distance) P-C4' energy: -165.438 flat angles C4'-P-C4' energy: -144.032 flat angles P-C4'-P energy: -62.739 tors. eta vs tors. theta energy: -105.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1347.239617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1347.239617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1347.239617 (E_RNA) where: Base-Base interactions energy: -775.395 where: short stacking energy: -408.924 Base-Backbone interact. energy: -0.252 local terms energy: -571.592652 where: bonds (distance) C4'-P energy: -148.480 bonds (distance) P-C4' energy: -136.422 flat angles C4'-P-C4' energy: -152.577 flat angles P-C4'-P energy: -92.178 tors. eta vs tors. theta energy: -41.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -1010.576455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.576455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.576455 (E_RNA) where: Base-Base interactions energy: -522.408 where: short stacking energy: -324.255 Base-Backbone interact. energy: -1.173 local terms energy: -486.996192 where: bonds (distance) C4'-P energy: -110.160 bonds (distance) P-C4' energy: -148.204 flat angles C4'-P-C4' energy: -119.921 flat angles P-C4'-P energy: -86.974 tors. eta vs tors. theta energy: -21.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -3097.180897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3097.180897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3097.180897 (E_RNA) where: Base-Base interactions energy: -2158.185 where: short stacking energy: -885.192 Base-Backbone interact. energy: -5.116 local terms energy: -933.880456 where: bonds (distance) C4'-P energy: -184.153 bonds (distance) P-C4' energy: -175.225 flat angles C4'-P-C4' energy: -204.990 flat angles P-C4'-P energy: -132.027 tors. eta vs tors. theta energy: -237.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -2999.925435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2999.925435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2999.925435 (E_RNA) where: Base-Base interactions energy: -2068.883 where: short stacking energy: -867.886 Base-Backbone interact. energy: -3.487 local terms energy: -927.555397 where: bonds (distance) C4'-P energy: -170.392 bonds (distance) P-C4' energy: -191.317 flat angles C4'-P-C4' energy: -203.170 flat angles P-C4'-P energy: -138.918 tors. eta vs tors. theta energy: -223.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -2768.333322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2768.333322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2768.333322 (E_RNA) where: Base-Base interactions energy: -1904.113 where: short stacking energy: -853.304 Base-Backbone interact. energy: -4.842 local terms energy: -859.378648 where: bonds (distance) C4'-P energy: -175.863 bonds (distance) P-C4' energy: -150.902 flat angles C4'-P-C4' energy: -197.468 flat angles P-C4'-P energy: -124.532 tors. eta vs tors. theta energy: -210.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -2695.992422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2695.992422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2695.992422 (E_RNA) where: Base-Base interactions energy: -1827.605 where: short stacking energy: -815.842 Base-Backbone interact. energy: -2.292 local terms energy: -866.095324 where: bonds (distance) C4'-P energy: -162.529 bonds (distance) P-C4' energy: -185.174 flat angles C4'-P-C4' energy: -191.154 flat angles P-C4'-P energy: -115.518 tors. eta vs tors. theta energy: -211.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -2267.461744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2267.461744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2267.461744 (E_RNA) where: Base-Base interactions energy: -1515.319 where: short stacking energy: -691.482 Base-Backbone interact. energy: -4.293 local terms energy: -747.849396 where: bonds (distance) C4'-P energy: -162.017 bonds (distance) P-C4' energy: -164.310 flat angles C4'-P-C4' energy: -171.128 flat angles P-C4'-P energy: -91.332 tors. eta vs tors. theta energy: -159.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -2181.455238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2181.455238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.455238 (E_RNA) where: Base-Base interactions energy: -1433.041 where: short stacking energy: -649.948 Base-Backbone interact. energy: -0.974 local terms energy: -747.440417 where: bonds (distance) C4'-P energy: -147.892 bonds (distance) P-C4' energy: -166.671 flat angles C4'-P-C4' energy: -180.151 flat angles P-C4'-P energy: -96.915 tors. eta vs tors. theta energy: -155.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -2235.416673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2235.416673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2235.416673 (E_RNA) where: Base-Base interactions energy: -1538.081 where: short stacking energy: -647.574 Base-Backbone interact. energy: 6.026 local terms energy: -703.362036 where: bonds (distance) C4'-P energy: -141.046 bonds (distance) P-C4' energy: -144.908 flat angles C4'-P-C4' energy: -180.203 flat angles P-C4'-P energy: -93.519 tors. eta vs tors. theta energy: -143.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1772.201667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1772.201667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.201667 (E_RNA) where: Base-Base interactions energy: -1140.072 where: short stacking energy: -519.979 Base-Backbone interact. energy: 0.780 local terms energy: -632.909949 where: bonds (distance) C4'-P energy: -146.966 bonds (distance) P-C4' energy: -147.203 flat angles C4'-P-C4' energy: -146.007 flat angles P-C4'-P energy: -106.692 tors. eta vs tors. theta energy: -86.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1338.459619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.459619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.459619 (E_RNA) where: Base-Base interactions energy: -766.958 where: short stacking energy: -372.603 Base-Backbone interact. energy: 1.740 local terms energy: -573.241809 where: bonds (distance) C4'-P energy: -141.690 bonds (distance) P-C4' energy: -158.958 flat angles C4'-P-C4' energy: -160.241 flat angles P-C4'-P energy: -70.221 tors. eta vs tors. theta energy: -42.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -972.725226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -972.725226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -972.725226 (E_RNA) where: Base-Base interactions energy: -438.926 where: short stacking energy: -258.731 Base-Backbone interact. energy: -0.972 local terms energy: -532.827284 where: bonds (distance) C4'-P energy: -146.598 bonds (distance) P-C4' energy: -149.205 flat angles C4'-P-C4' energy: -137.589 flat angles P-C4'-P energy: -97.925 tors. eta vs tors. theta energy: -1.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -3159.085316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3159.085316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3159.085316 (E_RNA) where: Base-Base interactions energy: -2225.143 where: short stacking energy: -942.810 Base-Backbone interact. energy: -4.563 local terms energy: -929.379187 where: bonds (distance) C4'-P energy: -167.989 bonds (distance) P-C4' energy: -186.990 flat angles C4'-P-C4' energy: -206.242 flat angles P-C4'-P energy: -126.571 tors. eta vs tors. theta energy: -241.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -2999.482138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2999.482138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2999.482138 (E_RNA) where: Base-Base interactions energy: -2079.210 where: short stacking energy: -879.681 Base-Backbone interact. energy: -5.091 local terms energy: -915.181294 where: bonds (distance) C4'-P energy: -187.485 bonds (distance) P-C4' energy: -184.701 flat angles C4'-P-C4' energy: -198.933 flat angles P-C4'-P energy: -107.720 tors. eta vs tors. theta energy: -236.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -2780.955280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2780.955280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2780.955280 (E_RNA) where: Base-Base interactions energy: -1886.687 where: short stacking energy: -842.875 Base-Backbone interact. energy: -0.836 local terms energy: -893.431693 where: bonds (distance) C4'-P energy: -173.501 bonds (distance) P-C4' energy: -169.793 flat angles C4'-P-C4' energy: -196.388 flat angles P-C4'-P energy: -131.827 tors. eta vs tors. theta energy: -221.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -2802.789534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2802.789534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2802.789534 (E_RNA) where: Base-Base interactions energy: -1905.506 where: short stacking energy: -826.623 Base-Backbone interact. energy: -4.174 local terms energy: -893.108756 where: bonds (distance) C4'-P energy: -183.169 bonds (distance) P-C4' energy: -173.286 flat angles C4'-P-C4' energy: -204.941 flat angles P-C4'-P energy: -116.407 tors. eta vs tors. theta energy: -215.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -2281.961014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2281.961014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2281.961014 (E_RNA) where: Base-Base interactions energy: -1490.677 where: short stacking energy: -678.124 Base-Backbone interact. energy: 1.335 local terms energy: -792.619028 where: bonds (distance) C4'-P energy: -157.520 bonds (distance) P-C4' energy: -172.096 flat angles C4'-P-C4' energy: -189.088 flat angles P-C4'-P energy: -106.781 tors. eta vs tors. theta energy: -167.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -2251.787086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.787086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.787086 (E_RNA) where: Base-Base interactions energy: -1420.020 where: short stacking energy: -648.695 Base-Backbone interact. energy: -3.984 local terms energy: -827.782212 where: bonds (distance) C4'-P energy: -174.000 bonds (distance) P-C4' energy: -167.934 flat angles C4'-P-C4' energy: -200.404 flat angles P-C4'-P energy: -116.527 tors. eta vs tors. theta energy: -168.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -2193.819585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.819585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.819585 (E_RNA) where: Base-Base interactions energy: -1494.134 where: short stacking energy: -667.802 Base-Backbone interact. energy: 4.715 local terms energy: -704.400316 where: bonds (distance) C4'-P energy: -156.465 bonds (distance) P-C4' energy: -144.113 flat angles C4'-P-C4' energy: -169.760 flat angles P-C4'-P energy: -97.217 tors. eta vs tors. theta energy: -136.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1865.497910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1865.497910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1865.497910 (E_RNA) where: Base-Base interactions energy: -1226.275 where: short stacking energy: -558.341 Base-Backbone interact. energy: 1.188 local terms energy: -640.411344 where: bonds (distance) C4'-P energy: -142.866 bonds (distance) P-C4' energy: -138.546 flat angles C4'-P-C4' energy: -153.589 flat angles P-C4'-P energy: -110.222 tors. eta vs tors. theta energy: -95.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1259.651920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.651920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.651920 (E_RNA) where: Base-Base interactions energy: -739.511 where: short stacking energy: -377.987 Base-Backbone interact. energy: 7.248 local terms energy: -527.388953 where: bonds (distance) C4'-P energy: -127.513 bonds (distance) P-C4' energy: -136.673 flat angles C4'-P-C4' energy: -117.503 flat angles P-C4'-P energy: -93.990 tors. eta vs tors. theta energy: -51.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -875.595377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.595377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.595377 (E_RNA) where: Base-Base interactions energy: -448.391 where: short stacking energy: -264.867 Base-Backbone interact. energy: 4.561 local terms energy: -431.765603 where: bonds (distance) C4'-P energy: -131.878 bonds (distance) P-C4' energy: -141.185 flat angles C4'-P-C4' energy: -128.003 flat angles P-C4'-P energy: -54.461 tors. eta vs tors. theta energy: 23.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -3099.174651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3099.174651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3099.174651 (E_RNA) where: Base-Base interactions energy: -2160.764 where: short stacking energy: -930.957 Base-Backbone interact. energy: -7.279 local terms energy: -931.131899 where: bonds (distance) C4'-P energy: -155.697 bonds (distance) P-C4' energy: -184.994 flat angles C4'-P-C4' energy: -205.560 flat angles P-C4'-P energy: -132.459 tors. eta vs tors. theta energy: -252.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -3010.754025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3010.754025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3010.754025 (E_RNA) where: Base-Base interactions energy: -2116.987 where: short stacking energy: -888.126 Base-Backbone interact. energy: -2.331 local terms energy: -891.435819 where: bonds (distance) C4'-P energy: -175.116 bonds (distance) P-C4' energy: -166.955 flat angles C4'-P-C4' energy: -187.906 flat angles P-C4'-P energy: -124.657 tors. eta vs tors. theta energy: -236.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -2742.170581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2742.170581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2742.170581 (E_RNA) where: Base-Base interactions energy: -1851.385 where: short stacking energy: -847.163 Base-Backbone interact. energy: -3.243 local terms energy: -887.542601 where: bonds (distance) C4'-P energy: -173.171 bonds (distance) P-C4' energy: -158.022 flat angles C4'-P-C4' energy: -204.682 flat angles P-C4'-P energy: -121.724 tors. eta vs tors. theta energy: -229.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -2844.702523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2844.702523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2844.702523 (E_RNA) where: Base-Base interactions energy: -1974.278 where: short stacking energy: -849.884 Base-Backbone interact. energy: -5.457 local terms energy: -864.966957 where: bonds (distance) C4'-P energy: -147.538 bonds (distance) P-C4' energy: -163.796 flat angles C4'-P-C4' energy: -194.471 flat angles P-C4'-P energy: -125.438 tors. eta vs tors. theta energy: -233.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -2280.646054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.646054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.646054 (E_RNA) where: Base-Base interactions energy: -1506.502 where: short stacking energy: -687.664 Base-Backbone interact. energy: -2.994 local terms energy: -771.150720 where: bonds (distance) C4'-P energy: -127.586 bonds (distance) P-C4' energy: -165.301 flat angles C4'-P-C4' energy: -186.200 flat angles P-C4'-P energy: -118.583 tors. eta vs tors. theta energy: -173.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -2296.509797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2296.509797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2296.509797 (E_RNA) where: Base-Base interactions energy: -1526.050 where: short stacking energy: -705.693 Base-Backbone interact. energy: -0.305 local terms energy: -770.155221 where: bonds (distance) C4'-P energy: -144.002 bonds (distance) P-C4' energy: -167.004 flat angles C4'-P-C4' energy: -192.320 flat angles P-C4'-P energy: -96.908 tors. eta vs tors. theta energy: -169.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -2191.522382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2191.522382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2191.522382 (E_RNA) where: Base-Base interactions energy: -1469.705 where: short stacking energy: -630.711 Base-Backbone interact. energy: 5.303 local terms energy: -727.120502 where: bonds (distance) C4'-P energy: -156.901 bonds (distance) P-C4' energy: -161.901 flat angles C4'-P-C4' energy: -173.570 flat angles P-C4'-P energy: -101.431 tors. eta vs tors. theta energy: -133.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1935.883519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.883519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1935.883519 (E_RNA) where: Base-Base interactions energy: -1319.216 where: short stacking energy: -588.384 Base-Backbone interact. energy: -0.239 local terms energy: -616.428464 where: bonds (distance) C4'-P energy: -126.324 bonds (distance) P-C4' energy: -153.996 flat angles C4'-P-C4' energy: -150.543 flat angles P-C4'-P energy: -83.870 tors. eta vs tors. theta energy: -101.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1270.443054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.443054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.443054 (E_RNA) where: Base-Base interactions energy: -710.176 where: short stacking energy: -389.648 Base-Backbone interact. energy: -2.315 local terms energy: -557.952042 where: bonds (distance) C4'-P energy: -135.326 bonds (distance) P-C4' energy: -141.505 flat angles C4'-P-C4' energy: -151.100 flat angles P-C4'-P energy: -96.453 tors. eta vs tors. theta energy: -33.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -859.439610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.439610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.439610 (E_RNA) where: Base-Base interactions energy: -389.629 where: short stacking energy: -241.986 Base-Backbone interact. energy: 2.585 local terms energy: -472.396041 where: bonds (distance) C4'-P energy: -149.316 bonds (distance) P-C4' energy: -145.136 flat angles C4'-P-C4' energy: -137.054 flat angles P-C4'-P energy: -61.624 tors. eta vs tors. theta energy: 20.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -3162.653664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3162.653664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3162.653664 (E_RNA) where: Base-Base interactions energy: -2208.696 where: short stacking energy: -948.147 Base-Backbone interact. energy: -3.270 local terms energy: -950.688544 where: bonds (distance) C4'-P energy: -189.854 bonds (distance) P-C4' energy: -187.234 flat angles C4'-P-C4' energy: -192.376 flat angles P-C4'-P energy: -126.990 tors. eta vs tors. theta energy: -254.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -2977.483663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2977.483663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2977.483663 (E_RNA) where: Base-Base interactions energy: -2029.949 where: short stacking energy: -895.778 Base-Backbone interact. energy: -8.563 local terms energy: -938.971187 where: bonds (distance) C4'-P energy: -182.292 bonds (distance) P-C4' energy: -175.328 flat angles C4'-P-C4' energy: -195.246 flat angles P-C4'-P energy: -140.994 tors. eta vs tors. theta energy: -245.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -2886.576285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2886.576285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2886.576285 (E_RNA) where: Base-Base interactions energy: -1977.649 where: short stacking energy: -854.822 Base-Backbone interact. energy: -5.402 local terms energy: -903.525428 where: bonds (distance) C4'-P energy: -164.919 bonds (distance) P-C4' energy: -184.593 flat angles C4'-P-C4' energy: -205.251 flat angles P-C4'-P energy: -129.458 tors. eta vs tors. theta energy: -219.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -2642.952099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2642.952099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2642.952099 (E_RNA) where: Base-Base interactions energy: -1790.123 where: short stacking energy: -769.422 Base-Backbone interact. energy: -1.581 local terms energy: -851.248219 where: bonds (distance) C4'-P energy: -172.173 bonds (distance) P-C4' energy: -185.742 flat angles C4'-P-C4' energy: -192.531 flat angles P-C4'-P energy: -105.014 tors. eta vs tors. theta energy: -195.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -2313.231819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2313.231819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2313.231819 (E_RNA) where: Base-Base interactions energy: -1542.026 where: short stacking energy: -717.644 Base-Backbone interact. energy: -5.398 local terms energy: -765.808182 where: bonds (distance) C4'-P energy: -160.463 bonds (distance) P-C4' energy: -168.822 flat angles C4'-P-C4' energy: -163.381 flat angles P-C4'-P energy: -99.832 tors. eta vs tors. theta energy: -173.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -2184.854676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2184.854676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2184.854676 (E_RNA) where: Base-Base interactions energy: -1443.877 where: short stacking energy: -652.184 Base-Backbone interact. energy: 3.293 local terms energy: -744.270696 where: bonds (distance) C4'-P energy: -142.544 bonds (distance) P-C4' energy: -169.874 flat angles C4'-P-C4' energy: -155.256 flat angles P-C4'-P energy: -127.578 tors. eta vs tors. theta energy: -149.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -2163.631010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2163.631010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2163.631010 (E_RNA) where: Base-Base interactions energy: -1425.509 where: short stacking energy: -614.022 Base-Backbone interact. energy: -1.789 local terms energy: -736.333539 where: bonds (distance) C4'-P energy: -175.344 bonds (distance) P-C4' energy: -148.912 flat angles C4'-P-C4' energy: -164.292 flat angles P-C4'-P energy: -94.275 tors. eta vs tors. theta energy: -153.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -2011.407097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2011.407097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2011.407097 (E_RNA) where: Base-Base interactions energy: -1309.345 where: short stacking energy: -573.682 Base-Backbone interact. energy: -4.484 local terms energy: -697.578351 where: bonds (distance) C4'-P energy: -139.391 bonds (distance) P-C4' energy: -149.016 flat angles C4'-P-C4' energy: -170.264 flat angles P-C4'-P energy: -120.927 tors. eta vs tors. theta energy: -117.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1231.579967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.579967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.579967 (E_RNA) where: Base-Base interactions energy: -708.447 where: short stacking energy: -360.638 Base-Backbone interact. energy: 1.937 local terms energy: -525.069796 where: bonds (distance) C4'-P energy: -146.319 bonds (distance) P-C4' energy: -132.913 flat angles C4'-P-C4' energy: -137.588 flat angles P-C4'-P energy: -92.354 tors. eta vs tors. theta energy: -15.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -896.048035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.048035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.048035 (E_RNA) where: Base-Base interactions energy: -414.738 where: short stacking energy: -278.675 Base-Backbone interact. energy: 3.640 local terms energy: -484.949781 where: bonds (distance) C4'-P energy: -139.513 bonds (distance) P-C4' energy: -151.726 flat angles C4'-P-C4' energy: -134.414 flat angles P-C4'-P energy: -65.669 tors. eta vs tors. theta energy: 6.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -3091.697186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3091.697186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3091.697186 (E_RNA) where: Base-Base interactions energy: -2165.589 where: short stacking energy: -951.254 Base-Backbone interact. energy: -5.228 local terms energy: -920.879980 where: bonds (distance) C4'-P energy: -163.591 bonds (distance) P-C4' energy: -176.521 flat angles C4'-P-C4' energy: -201.264 flat angles P-C4'-P energy: -125.919 tors. eta vs tors. theta energy: -253.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -3014.430425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3014.430425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3014.430425 (E_RNA) where: Base-Base interactions energy: -2096.172 where: short stacking energy: -948.282 Base-Backbone interact. energy: -3.413 local terms energy: -914.846080 where: bonds (distance) C4'-P energy: -165.768 bonds (distance) P-C4' energy: -179.824 flat angles C4'-P-C4' energy: -202.611 flat angles P-C4'-P energy: -130.369 tors. eta vs tors. theta energy: -236.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -2902.156908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2902.156908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2902.156908 (E_RNA) where: Base-Base interactions energy: -1990.982 where: short stacking energy: -838.368 Base-Backbone interact. energy: -1.351 local terms energy: -909.824016 where: bonds (distance) C4'-P energy: -173.737 bonds (distance) P-C4' energy: -192.404 flat angles C4'-P-C4' energy: -194.525 flat angles P-C4'-P energy: -119.548 tors. eta vs tors. theta energy: -229.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -2672.243022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2672.243022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2672.243022 (E_RNA) where: Base-Base interactions energy: -1835.553 where: short stacking energy: -763.688 Base-Backbone interact. energy: -4.580 local terms energy: -832.110870 where: bonds (distance) C4'-P energy: -153.919 bonds (distance) P-C4' energy: -170.878 flat angles C4'-P-C4' energy: -207.691 flat angles P-C4'-P energy: -105.418 tors. eta vs tors. theta energy: -194.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -2371.073925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2371.073925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2371.073925 (E_RNA) where: Base-Base interactions energy: -1568.577 where: short stacking energy: -690.417 Base-Backbone interact. energy: -4.397 local terms energy: -798.099921 where: bonds (distance) C4'-P energy: -172.566 bonds (distance) P-C4' energy: -168.687 flat angles C4'-P-C4' energy: -165.350 flat angles P-C4'-P energy: -119.792 tors. eta vs tors. theta energy: -171.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -2248.821910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2248.821910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2248.821910 (E_RNA) where: Base-Base interactions energy: -1490.348 where: short stacking energy: -652.136 Base-Backbone interact. energy: -5.942 local terms energy: -752.531656 where: bonds (distance) C4'-P energy: -156.580 bonds (distance) P-C4' energy: -163.339 flat angles C4'-P-C4' energy: -184.672 flat angles P-C4'-P energy: -100.388 tors. eta vs tors. theta energy: -147.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -2080.415261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2080.415261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2080.415261 (E_RNA) where: Base-Base interactions energy: -1379.625 where: short stacking energy: -623.672 Base-Backbone interact. energy: 0.778 local terms energy: -701.567340 where: bonds (distance) C4'-P energy: -142.507 bonds (distance) P-C4' energy: -164.850 flat angles C4'-P-C4' energy: -170.612 flat angles P-C4'-P energy: -100.833 tors. eta vs tors. theta energy: -122.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -2011.289569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2011.289569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2011.289569 (E_RNA) where: Base-Base interactions energy: -1333.014 where: short stacking energy: -609.000 Base-Backbone interact. energy: -1.501 local terms energy: -676.774730 where: bonds (distance) C4'-P energy: -151.412 bonds (distance) P-C4' energy: -123.725 flat angles C4'-P-C4' energy: -173.157 flat angles P-C4'-P energy: -86.526 tors. eta vs tors. theta energy: -141.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1239.998147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1239.998147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.998147 (E_RNA) where: Base-Base interactions energy: -728.481 where: short stacking energy: -356.771 Base-Backbone interact. energy: -0.671 local terms energy: -510.846224 where: bonds (distance) C4'-P energy: -148.761 bonds (distance) P-C4' energy: -146.916 flat angles C4'-P-C4' energy: -114.784 flat angles P-C4'-P energy: -75.707 tors. eta vs tors. theta energy: -24.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -853.173719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.173719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.173719 (E_RNA) where: Base-Base interactions energy: -399.875 where: short stacking energy: -265.915 Base-Backbone interact. energy: -1.196 local terms energy: -452.102970 where: bonds (distance) C4'-P energy: -130.119 bonds (distance) P-C4' energy: -139.745 flat angles C4'-P-C4' energy: -123.500 flat angles P-C4'-P energy: -69.545 tors. eta vs tors. theta energy: 10.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -3081.245291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3081.245291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3081.245291 (E_RNA) where: Base-Base interactions energy: -2124.092 where: short stacking energy: -871.309 Base-Backbone interact. energy: -0.422 local terms energy: -956.731818 where: bonds (distance) C4'-P energy: -185.381 bonds (distance) P-C4' energy: -187.129 flat angles C4'-P-C4' energy: -211.295 flat angles P-C4'-P energy: -137.440 tors. eta vs tors. theta energy: -235.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -3010.239547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3010.239547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3010.239547 (E_RNA) where: Base-Base interactions energy: -2073.038 where: short stacking energy: -908.140 Base-Backbone interact. energy: 2.505 local terms energy: -939.706143 where: bonds (distance) C4'-P energy: -173.847 bonds (distance) P-C4' energy: -181.718 flat angles C4'-P-C4' energy: -214.324 flat angles P-C4'-P energy: -124.551 tors. eta vs tors. theta energy: -245.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -2908.040508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2908.040508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2908.040508 (E_RNA) where: Base-Base interactions energy: -2008.583 where: short stacking energy: -844.769 Base-Backbone interact. energy: -6.130 local terms energy: -893.327694 where: bonds (distance) C4'-P energy: -177.751 bonds (distance) P-C4' energy: -168.888 flat angles C4'-P-C4' energy: -208.142 flat angles P-C4'-P energy: -111.362 tors. eta vs tors. theta energy: -227.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -2685.569206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2685.569206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2685.569206 (E_RNA) where: Base-Base interactions energy: -1859.213 where: short stacking energy: -780.260 Base-Backbone interact. energy: -2.517 local terms energy: -823.838912 where: bonds (distance) C4'-P energy: -164.694 bonds (distance) P-C4' energy: -157.318 flat angles C4'-P-C4' energy: -187.424 flat angles P-C4'-P energy: -114.003 tors. eta vs tors. theta energy: -200.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -2389.952438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2389.952438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2389.952438 (E_RNA) where: Base-Base interactions energy: -1581.818 where: short stacking energy: -717.062 Base-Backbone interact. energy: -1.957 local terms energy: -806.177360 where: bonds (distance) C4'-P energy: -168.230 bonds (distance) P-C4' energy: -166.565 flat angles C4'-P-C4' energy: -175.253 flat angles P-C4'-P energy: -102.712 tors. eta vs tors. theta energy: -193.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -2303.065183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2303.065183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2303.065183 (E_RNA) where: Base-Base interactions energy: -1568.945 where: short stacking energy: -683.457 Base-Backbone interact. energy: -0.798 local terms energy: -733.321890 where: bonds (distance) C4'-P energy: -165.002 bonds (distance) P-C4' energy: -140.050 flat angles C4'-P-C4' energy: -173.640 flat angles P-C4'-P energy: -100.298 tors. eta vs tors. theta energy: -154.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -2056.832572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2056.832572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2056.832572 (E_RNA) where: Base-Base interactions energy: -1356.825 where: short stacking energy: -612.278 Base-Backbone interact. energy: 2.877 local terms energy: -702.884496 where: bonds (distance) C4'-P energy: -156.029 bonds (distance) P-C4' energy: -161.606 flat angles C4'-P-C4' energy: -153.787 flat angles P-C4'-P energy: -96.156 tors. eta vs tors. theta energy: -135.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1949.275516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1949.275516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1949.275516 (E_RNA) where: Base-Base interactions energy: -1266.140 where: short stacking energy: -579.508 Base-Backbone interact. energy: -0.236 local terms energy: -682.899604 where: bonds (distance) C4'-P energy: -129.901 bonds (distance) P-C4' energy: -140.122 flat angles C4'-P-C4' energy: -150.873 flat angles P-C4'-P energy: -112.367 tors. eta vs tors. theta energy: -149.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1253.579277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.579277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.579277 (E_RNA) where: Base-Base interactions energy: -684.471 where: short stacking energy: -347.375 Base-Backbone interact. energy: -1.670 local terms energy: -567.438939 where: bonds (distance) C4'-P energy: -153.089 bonds (distance) P-C4' energy: -171.390 flat angles C4'-P-C4' energy: -140.286 flat angles P-C4'-P energy: -78.152 tors. eta vs tors. theta energy: -24.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -935.556085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.556085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.556085 (E_RNA) where: Base-Base interactions energy: -484.186 where: short stacking energy: -285.872 Base-Backbone interact. energy: 2.891 local terms energy: -454.260718 where: bonds (distance) C4'-P energy: -137.314 bonds (distance) P-C4' energy: -150.972 flat angles C4'-P-C4' energy: -116.523 flat angles P-C4'-P energy: -86.837 tors. eta vs tors. theta energy: 37.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -3138.019397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3138.019397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3138.019397 (E_RNA) where: Base-Base interactions energy: -2187.031 where: short stacking energy: -938.681 Base-Backbone interact. energy: -1.253 local terms energy: -949.734627 where: bonds (distance) C4'-P energy: -175.900 bonds (distance) P-C4' energy: -176.292 flat angles C4'-P-C4' energy: -208.756 flat angles P-C4'-P energy: -146.089 tors. eta vs tors. theta energy: -242.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -3011.818898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3011.818898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3011.818898 (E_RNA) where: Base-Base interactions energy: -2085.644 where: short stacking energy: -923.982 Base-Backbone interact. energy: -3.691 local terms energy: -922.483357 where: bonds (distance) C4'-P energy: -172.249 bonds (distance) P-C4' energy: -189.139 flat angles C4'-P-C4' energy: -204.423 flat angles P-C4'-P energy: -119.848 tors. eta vs tors. theta energy: -236.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -2872.347719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2872.347719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2872.347719 (E_RNA) where: Base-Base interactions energy: -2003.402 where: short stacking energy: -832.365 Base-Backbone interact. energy: -1.620 local terms energy: -867.325772 where: bonds (distance) C4'-P energy: -170.722 bonds (distance) P-C4' energy: -154.325 flat angles C4'-P-C4' energy: -185.427 flat angles P-C4'-P energy: -136.870 tors. eta vs tors. theta energy: -219.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -2665.673071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2665.673071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2665.673071 (E_RNA) where: Base-Base interactions energy: -1793.344 where: short stacking energy: -790.283 Base-Backbone interact. energy: -0.938 local terms energy: -871.391061 where: bonds (distance) C4'-P energy: -177.777 bonds (distance) P-C4' energy: -172.630 flat angles C4'-P-C4' energy: -205.270 flat angles P-C4'-P energy: -117.657 tors. eta vs tors. theta energy: -198.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -2353.086172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2353.086172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2353.086172 (E_RNA) where: Base-Base interactions energy: -1563.904 where: short stacking energy: -690.455 Base-Backbone interact. energy: -5.737 local terms energy: -783.445417 where: bonds (distance) C4'-P energy: -151.864 bonds (distance) P-C4' energy: -166.107 flat angles C4'-P-C4' energy: -177.067 flat angles P-C4'-P energy: -128.969 tors. eta vs tors. theta energy: -159.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -2336.826302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2336.826302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2336.826302 (E_RNA) where: Base-Base interactions energy: -1572.895 where: short stacking energy: -658.378 Base-Backbone interact. energy: -1.624 local terms energy: -762.307282 where: bonds (distance) C4'-P energy: -148.605 bonds (distance) P-C4' energy: -180.048 flat angles C4'-P-C4' energy: -168.222 flat angles P-C4'-P energy: -106.684 tors. eta vs tors. theta energy: -158.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -2056.130136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2056.130136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2056.130136 (E_RNA) where: Base-Base interactions energy: -1373.612 where: short stacking energy: -610.862 Base-Backbone interact. energy: 10.751 local terms energy: -693.269604 where: bonds (distance) C4'-P energy: -148.984 bonds (distance) P-C4' energy: -178.948 flat angles C4'-P-C4' energy: -159.862 flat angles P-C4'-P energy: -96.830 tors. eta vs tors. theta energy: -108.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1883.847187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.847187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.847187 (E_RNA) where: Base-Base interactions energy: -1217.549 where: short stacking energy: -529.325 Base-Backbone interact. energy: -1.164 local terms energy: -665.134015 where: bonds (distance) C4'-P energy: -152.846 bonds (distance) P-C4' energy: -159.676 flat angles C4'-P-C4' energy: -178.488 flat angles P-C4'-P energy: -77.987 tors. eta vs tors. theta energy: -96.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1293.190375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.190375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.190375 (E_RNA) where: Base-Base interactions energy: -738.165 where: short stacking energy: -393.229 Base-Backbone interact. energy: 2.846 local terms energy: -557.872227 where: bonds (distance) C4'-P energy: -132.540 bonds (distance) P-C4' energy: -159.983 flat angles C4'-P-C4' energy: -145.731 flat angles P-C4'-P energy: -76.322 tors. eta vs tors. theta energy: -43.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -1040.308132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.308132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.308132 (E_RNA) where: Base-Base interactions energy: -514.237 where: short stacking energy: -306.723 Base-Backbone interact. energy: 6.089 local terms energy: -532.160858 where: bonds (distance) C4'-P energy: -135.546 bonds (distance) P-C4' energy: -140.920 flat angles C4'-P-C4' energy: -147.199 flat angles P-C4'-P energy: -97.099 tors. eta vs tors. theta energy: -11.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -3114.911418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3114.911418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3114.911418 (E_RNA) where: Base-Base interactions energy: -2155.829 where: short stacking energy: -918.012 Base-Backbone interact. energy: -6.518 local terms energy: -952.564215 where: bonds (distance) C4'-P energy: -172.460 bonds (distance) P-C4' energy: -197.096 flat angles C4'-P-C4' energy: -210.288 flat angles P-C4'-P energy: -135.297 tors. eta vs tors. theta energy: -237.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -2989.333813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2989.333813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2989.333813 (E_RNA) where: Base-Base interactions energy: -2068.004 where: short stacking energy: -890.237 Base-Backbone interact. energy: -2.884 local terms energy: -918.445483 where: bonds (distance) C4'-P energy: -163.770 bonds (distance) P-C4' energy: -190.924 flat angles C4'-P-C4' energy: -210.640 flat angles P-C4'-P energy: -121.822 tors. eta vs tors. theta energy: -231.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -2883.025797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2883.025797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2883.025797 (E_RNA) where: Base-Base interactions energy: -1972.408 where: short stacking energy: -823.684 Base-Backbone interact. energy: -4.012 local terms energy: -906.606659 where: bonds (distance) C4'-P energy: -176.433 bonds (distance) P-C4' energy: -184.739 flat angles C4'-P-C4' energy: -201.233 flat angles P-C4'-P energy: -123.425 tors. eta vs tors. theta energy: -220.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -2662.551417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2662.551417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2662.551417 (E_RNA) where: Base-Base interactions energy: -1813.818 where: short stacking energy: -798.649 Base-Backbone interact. energy: 0.123 local terms energy: -848.856243 where: bonds (distance) C4'-P energy: -148.577 bonds (distance) P-C4' energy: -170.790 flat angles C4'-P-C4' energy: -195.137 flat angles P-C4'-P energy: -127.043 tors. eta vs tors. theta energy: -207.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -2427.337201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2427.337201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2427.337201 (E_RNA) where: Base-Base interactions energy: -1632.867 where: short stacking energy: -724.051 Base-Backbone interact. energy: 3.085 local terms energy: -797.555841 where: bonds (distance) C4'-P energy: -153.650 bonds (distance) P-C4' energy: -160.370 flat angles C4'-P-C4' energy: -176.279 flat angles P-C4'-P energy: -113.835 tors. eta vs tors. theta energy: -193.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -2335.262029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2335.262029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2335.262029 (E_RNA) where: Base-Base interactions energy: -1574.643 where: short stacking energy: -681.962 Base-Backbone interact. energy: 4.466 local terms energy: -765.085561 where: bonds (distance) C4'-P energy: -131.707 bonds (distance) P-C4' energy: -181.837 flat angles C4'-P-C4' energy: -181.234 flat angles P-C4'-P energy: -101.948 tors. eta vs tors. theta energy: -168.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -2009.622139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2009.622139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2009.622139 (E_RNA) where: Base-Base interactions energy: -1312.009 where: short stacking energy: -595.648 Base-Backbone interact. energy: -3.873 local terms energy: -693.740202 where: bonds (distance) C4'-P energy: -132.924 bonds (distance) P-C4' energy: -163.515 flat angles C4'-P-C4' energy: -156.868 flat angles P-C4'-P energy: -120.839 tors. eta vs tors. theta energy: -119.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1769.904082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1769.904082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.904082 (E_RNA) where: Base-Base interactions energy: -1118.128 where: short stacking energy: -501.665 Base-Backbone interact. energy: -2.303 local terms energy: -649.472516 where: bonds (distance) C4'-P energy: -157.198 bonds (distance) P-C4' energy: -161.058 flat angles C4'-P-C4' energy: -152.554 flat angles P-C4'-P energy: -89.073 tors. eta vs tors. theta energy: -89.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1253.117124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.117124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.117124 (E_RNA) where: Base-Base interactions energy: -722.596 where: short stacking energy: -354.639 Base-Backbone interact. energy: 1.117 local terms energy: -531.638377 where: bonds (distance) C4'-P energy: -128.957 bonds (distance) P-C4' energy: -152.425 flat angles C4'-P-C4' energy: -127.634 flat angles P-C4'-P energy: -92.541 tors. eta vs tors. theta energy: -30.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -1102.331783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.331783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.331783 (E_RNA) where: Base-Base interactions energy: -610.952 where: short stacking energy: -331.094 Base-Backbone interact. energy: -2.061 local terms energy: -489.318519 where: bonds (distance) C4'-P energy: -142.277 bonds (distance) P-C4' energy: -147.584 flat angles C4'-P-C4' energy: -125.755 flat angles P-C4'-P energy: -65.702 tors. eta vs tors. theta energy: -8.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -3096.912376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3096.912376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3096.912376 (E_RNA) where: Base-Base interactions energy: -2166.164 where: short stacking energy: -947.896 Base-Backbone interact. energy: -0.507 local terms energy: -930.241902 where: bonds (distance) C4'-P energy: -184.610 bonds (distance) P-C4' energy: -163.897 flat angles C4'-P-C4' energy: -211.706 flat angles P-C4'-P energy: -137.243 tors. eta vs tors. theta energy: -232.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -3007.987166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3007.987166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3007.987166 (E_RNA) where: Base-Base interactions energy: -2104.532 where: short stacking energy: -901.261 Base-Backbone interact. energy: -1.065 local terms energy: -902.390224 where: bonds (distance) C4'-P energy: -177.903 bonds (distance) P-C4' energy: -180.644 flat angles C4'-P-C4' energy: -209.725 flat angles P-C4'-P energy: -112.470 tors. eta vs tors. theta energy: -221.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -2851.290515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2851.290515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2851.290515 (E_RNA) where: Base-Base interactions energy: -1982.849 where: short stacking energy: -866.676 Base-Backbone interact. energy: -2.477 local terms energy: -865.964580 where: bonds (distance) C4'-P energy: -153.585 bonds (distance) P-C4' energy: -164.022 flat angles C4'-P-C4' energy: -182.375 flat angles P-C4'-P energy: -122.702 tors. eta vs tors. theta energy: -243.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -2667.400000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2667.400000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2667.400000 (E_RNA) where: Base-Base interactions energy: -1822.520 where: short stacking energy: -784.363 Base-Backbone interact. energy: -1.045 local terms energy: -843.834912 where: bonds (distance) C4'-P energy: -169.652 bonds (distance) P-C4' energy: -176.432 flat angles C4'-P-C4' energy: -187.948 flat angles P-C4'-P energy: -112.201 tors. eta vs tors. theta energy: -197.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -2366.952384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.952384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2366.952384 (E_RNA) where: Base-Base interactions energy: -1585.526 where: short stacking energy: -738.171 Base-Backbone interact. energy: -1.380 local terms energy: -780.046736 where: bonds (distance) C4'-P energy: -153.763 bonds (distance) P-C4' energy: -168.737 flat angles C4'-P-C4' energy: -179.082 flat angles P-C4'-P energy: -106.639 tors. eta vs tors. theta energy: -171.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -2360.463858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2360.463858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2360.463858 (E_RNA) where: Base-Base interactions energy: -1582.816 where: short stacking energy: -705.647 Base-Backbone interact. energy: 3.557 local terms energy: -781.205149 where: bonds (distance) C4'-P energy: -137.761 bonds (distance) P-C4' energy: -190.668 flat angles C4'-P-C4' energy: -175.605 flat angles P-C4'-P energy: -115.721 tors. eta vs tors. theta energy: -161.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -2075.551614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2075.551614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2075.551614 (E_RNA) where: Base-Base interactions energy: -1364.186 where: short stacking energy: -652.266 Base-Backbone interact. energy: -3.040 local terms energy: -708.325330 where: bonds (distance) C4'-P energy: -143.645 bonds (distance) P-C4' energy: -152.760 flat angles C4'-P-C4' energy: -170.814 flat angles P-C4'-P energy: -112.470 tors. eta vs tors. theta energy: -128.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1652.158708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.158708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.158708 (E_RNA) where: Base-Base interactions energy: -1028.125 where: short stacking energy: -537.365 Base-Backbone interact. energy: -1.997 local terms energy: -622.036361 where: bonds (distance) C4'-P energy: -143.849 bonds (distance) P-C4' energy: -148.725 flat angles C4'-P-C4' energy: -151.720 flat angles P-C4'-P energy: -88.946 tors. eta vs tors. theta energy: -88.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1301.726186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.726186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.726186 (E_RNA) where: Base-Base interactions energy: -751.910 where: short stacking energy: -397.319 Base-Backbone interact. energy: -0.723 local terms energy: -549.093267 where: bonds (distance) C4'-P energy: -122.930 bonds (distance) P-C4' energy: -147.295 flat angles C4'-P-C4' energy: -150.277 flat angles P-C4'-P energy: -81.800 tors. eta vs tors. theta energy: -46.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -1046.532543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.532543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.532543 (E_RNA) where: Base-Base interactions energy: -545.509 where: short stacking energy: -283.059 Base-Backbone interact. energy: 2.438 local terms energy: -503.461620 where: bonds (distance) C4'-P energy: -134.601 bonds (distance) P-C4' energy: -137.646 flat angles C4'-P-C4' energy: -146.633 flat angles P-C4'-P energy: -90.364 tors. eta vs tors. theta energy: 5.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -3096.902975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3096.902975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3096.902975 (E_RNA) where: Base-Base interactions energy: -2157.214 where: short stacking energy: -904.664 Base-Backbone interact. energy: -5.929 local terms energy: -933.759768 where: bonds (distance) C4'-P energy: -177.186 bonds (distance) P-C4' energy: -189.470 flat angles C4'-P-C4' energy: -199.519 flat angles P-C4'-P energy: -126.659 tors. eta vs tors. theta energy: -240.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -3033.443163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3033.443163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3033.443163 (E_RNA) where: Base-Base interactions energy: -2103.828 where: short stacking energy: -901.932 Base-Backbone interact. energy: -1.559 local terms energy: -928.056278 where: bonds (distance) C4'-P energy: -172.932 bonds (distance) P-C4' energy: -186.215 flat angles C4'-P-C4' energy: -201.597 flat angles P-C4'-P energy: -128.677 tors. eta vs tors. theta energy: -238.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -2840.255382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2840.255382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2840.255382 (E_RNA) where: Base-Base interactions energy: -1997.856 where: short stacking energy: -817.562 Base-Backbone interact. energy: -2.795 local terms energy: -839.604536 where: bonds (distance) C4'-P energy: -165.135 bonds (distance) P-C4' energy: -155.473 flat angles C4'-P-C4' energy: -191.283 flat angles P-C4'-P energy: -105.639 tors. eta vs tors. theta energy: -222.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -2702.381289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2702.381289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2702.381289 (E_RNA) where: Base-Base interactions energy: -1868.859 where: short stacking energy: -828.027 Base-Backbone interact. energy: 5.966 local terms energy: -839.488500 where: bonds (distance) C4'-P energy: -156.512 bonds (distance) P-C4' energy: -158.246 flat angles C4'-P-C4' energy: -186.235 flat angles P-C4'-P energy: -117.715 tors. eta vs tors. theta energy: -220.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -2415.473784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2415.473784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2415.473784 (E_RNA) where: Base-Base interactions energy: -1611.297 where: short stacking energy: -713.467 Base-Backbone interact. energy: 2.032 local terms energy: -806.208216 where: bonds (distance) C4'-P energy: -162.514 bonds (distance) P-C4' energy: -171.957 flat angles C4'-P-C4' energy: -173.125 flat angles P-C4'-P energy: -117.294 tors. eta vs tors. theta energy: -181.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -2332.273201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2332.273201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2332.273201 (E_RNA) where: Base-Base interactions energy: -1571.222 where: short stacking energy: -661.204 Base-Backbone interact. energy: 0.531 local terms energy: -761.581593 where: bonds (distance) C4'-P energy: -146.012 bonds (distance) P-C4' energy: -162.041 flat angles C4'-P-C4' energy: -168.941 flat angles P-C4'-P energy: -122.869 tors. eta vs tors. theta energy: -161.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -2033.669308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.669308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.669308 (E_RNA) where: Base-Base interactions energy: -1350.468 where: short stacking energy: -605.386 Base-Backbone interact. energy: -1.668 local terms energy: -681.533833 where: bonds (distance) C4'-P energy: -143.802 bonds (distance) P-C4' energy: -160.930 flat angles C4'-P-C4' energy: -156.842 flat angles P-C4'-P energy: -90.632 tors. eta vs tors. theta energy: -129.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1619.755193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.755193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1619.755193 (E_RNA) where: Base-Base interactions energy: -1019.141 where: short stacking energy: -467.743 Base-Backbone interact. energy: 0.538 local terms energy: -601.152180 where: bonds (distance) C4'-P energy: -162.642 bonds (distance) P-C4' energy: -133.551 flat angles C4'-P-C4' energy: -140.727 flat angles P-C4'-P energy: -88.370 tors. eta vs tors. theta energy: -75.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1248.270414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.270414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.270414 (E_RNA) where: Base-Base interactions energy: -726.635 where: short stacking energy: -363.067 Base-Backbone interact. energy: 0.427 local terms energy: -522.062401 where: bonds (distance) C4'-P energy: -140.443 bonds (distance) P-C4' energy: -142.173 flat angles C4'-P-C4' energy: -150.795 flat angles P-C4'-P energy: -82.854 tors. eta vs tors. theta energy: -5.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -1091.466691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.466691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.466691 (E_RNA) where: Base-Base interactions energy: -576.002 where: short stacking energy: -303.225 Base-Backbone interact. energy: 2.471 local terms energy: -517.935696 where: bonds (distance) C4'-P energy: -128.965 bonds (distance) P-C4' energy: -162.015 flat angles C4'-P-C4' energy: -161.262 flat angles P-C4'-P energy: -65.247 tors. eta vs tors. theta energy: -0.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -3087.087299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3087.087299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3087.087299 (E_RNA) where: Base-Base interactions energy: -2124.971 where: short stacking energy: -882.763 Base-Backbone interact. energy: -3.985 local terms energy: -958.131263 where: bonds (distance) C4'-P energy: -189.832 bonds (distance) P-C4' energy: -196.126 flat angles C4'-P-C4' energy: -205.096 flat angles P-C4'-P energy: -129.673 tors. eta vs tors. theta energy: -237.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -3052.095692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3052.095692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3052.095692 (E_RNA) where: Base-Base interactions energy: -2129.465 where: short stacking energy: -909.279 Base-Backbone interact. energy: -3.590 local terms energy: -919.041392 where: bonds (distance) C4'-P energy: -171.572 bonds (distance) P-C4' energy: -178.633 flat angles C4'-P-C4' energy: -200.341 flat angles P-C4'-P energy: -128.550 tors. eta vs tors. theta energy: -239.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -2824.617316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2824.617316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2824.617316 (E_RNA) where: Base-Base interactions energy: -1930.580 where: short stacking energy: -811.938 Base-Backbone interact. energy: -5.235 local terms energy: -888.802516 where: bonds (distance) C4'-P energy: -162.953 bonds (distance) P-C4' energy: -176.136 flat angles C4'-P-C4' energy: -191.293 flat angles P-C4'-P energy: -124.110 tors. eta vs tors. theta energy: -234.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -2705.540103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2705.540103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2705.540103 (E_RNA) where: Base-Base interactions energy: -1851.044 where: short stacking energy: -811.431 Base-Backbone interact. energy: 6.637 local terms energy: -861.132690 where: bonds (distance) C4'-P energy: -158.585 bonds (distance) P-C4' energy: -179.170 flat angles C4'-P-C4' energy: -187.494 flat angles P-C4'-P energy: -114.690 tors. eta vs tors. theta energy: -221.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -2504.512036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2504.512036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2504.512036 (E_RNA) where: Base-Base interactions energy: -1690.773 where: short stacking energy: -764.783 Base-Backbone interact. energy: -0.752 local terms energy: -812.986275 where: bonds (distance) C4'-P energy: -172.689 bonds (distance) P-C4' energy: -149.603 flat angles C4'-P-C4' energy: -181.150 flat angles P-C4'-P energy: -115.789 tors. eta vs tors. theta energy: -193.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -2346.665928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2346.665928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2346.665928 (E_RNA) where: Base-Base interactions energy: -1579.401 where: short stacking energy: -679.457 Base-Backbone interact. energy: -0.377 local terms energy: -766.887317 where: bonds (distance) C4'-P energy: -150.828 bonds (distance) P-C4' energy: -166.021 flat angles C4'-P-C4' energy: -176.346 flat angles P-C4'-P energy: -119.225 tors. eta vs tors. theta energy: -154.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1996.241228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1996.241228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1996.241228 (E_RNA) where: Base-Base interactions energy: -1304.976 where: short stacking energy: -577.498 Base-Backbone interact. energy: -2.434 local terms energy: -688.830637 where: bonds (distance) C4'-P energy: -133.559 bonds (distance) P-C4' energy: -163.065 flat angles C4'-P-C4' energy: -170.198 flat angles P-C4'-P energy: -108.204 tors. eta vs tors. theta energy: -113.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1526.163855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1526.163855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1526.163855 (E_RNA) where: Base-Base interactions energy: -937.865 where: short stacking energy: -452.824 Base-Backbone interact. energy: -0.471 local terms energy: -587.828249 where: bonds (distance) C4'-P energy: -132.325 bonds (distance) P-C4' energy: -144.281 flat angles C4'-P-C4' energy: -156.652 flat angles P-C4'-P energy: -82.027 tors. eta vs tors. theta energy: -72.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1289.223355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.223355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.223355 (E_RNA) where: Base-Base interactions energy: -759.779 where: short stacking energy: -352.454 Base-Backbone interact. energy: -3.642 local terms energy: -525.802854 where: bonds (distance) C4'-P energy: -136.034 bonds (distance) P-C4' energy: -134.417 flat angles C4'-P-C4' energy: -140.302 flat angles P-C4'-P energy: -86.354 tors. eta vs tors. theta energy: -28.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -1053.270858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.270858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.270858 (E_RNA) where: Base-Base interactions energy: -581.169 where: short stacking energy: -308.132 Base-Backbone interact. energy: -1.320 local terms energy: -470.780981 where: bonds (distance) C4'-P energy: -131.117 bonds (distance) P-C4' energy: -148.341 flat angles C4'-P-C4' energy: -127.648 flat angles P-C4'-P energy: -50.027 tors. eta vs tors. theta energy: -13.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -3092.160470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3092.160470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3092.160470 (E_RNA) where: Base-Base interactions energy: -2158.772 where: short stacking energy: -935.045 Base-Backbone interact. energy: 5.396 local terms energy: -938.784382 where: bonds (distance) C4'-P energy: -181.998 bonds (distance) P-C4' energy: -166.592 flat angles C4'-P-C4' energy: -210.354 flat angles P-C4'-P energy: -132.897 tors. eta vs tors. theta energy: -246.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -3010.507399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3010.507399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3010.507399 (E_RNA) where: Base-Base interactions energy: -2073.205 where: short stacking energy: -896.409 Base-Backbone interact. energy: -3.095 local terms energy: -934.206892 where: bonds (distance) C4'-P energy: -171.601 bonds (distance) P-C4' energy: -176.822 flat angles C4'-P-C4' energy: -209.071 flat angles P-C4'-P energy: -139.917 tors. eta vs tors. theta energy: -236.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -2848.064379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2848.064379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2848.064379 (E_RNA) where: Base-Base interactions energy: -1935.028 where: short stacking energy: -851.537 Base-Backbone interact. energy: -5.263 local terms energy: -907.773605 where: bonds (distance) C4'-P energy: -170.785 bonds (distance) P-C4' energy: -180.711 flat angles C4'-P-C4' energy: -203.561 flat angles P-C4'-P energy: -119.073 tors. eta vs tors. theta energy: -233.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -2667.060999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2667.060999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2667.060999 (E_RNA) where: Base-Base interactions energy: -1829.001 where: short stacking energy: -766.010 Base-Backbone interact. energy: -6.749 local terms energy: -831.311037 where: bonds (distance) C4'-P energy: -153.734 bonds (distance) P-C4' energy: -172.090 flat angles C4'-P-C4' energy: -196.916 flat angles P-C4'-P energy: -121.657 tors. eta vs tors. theta energy: -186.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -2553.515854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2553.515854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2553.515854 (E_RNA) where: Base-Base interactions energy: -1721.446 where: short stacking energy: -733.798 Base-Backbone interact. energy: -5.485 local terms energy: -826.584586 where: bonds (distance) C4'-P energy: -161.462 bonds (distance) P-C4' energy: -189.712 flat angles C4'-P-C4' energy: -185.107 flat angles P-C4'-P energy: -102.571 tors. eta vs tors. theta energy: -187.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -2316.006428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2316.006428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2316.006428 (E_RNA) where: Base-Base interactions energy: -1577.820 where: short stacking energy: -656.570 Base-Backbone interact. energy: -0.716 local terms energy: -737.470788 where: bonds (distance) C4'-P energy: -140.862 bonds (distance) P-C4' energy: -176.311 flat angles C4'-P-C4' energy: -169.326 flat angles P-C4'-P energy: -115.723 tors. eta vs tors. theta energy: -135.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -2079.691453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2079.691453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2079.691453 (E_RNA) where: Base-Base interactions energy: -1375.667 where: short stacking energy: -645.566 Base-Backbone interact. energy: 0.183 local terms energy: -704.207809 where: bonds (distance) C4'-P energy: -148.804 bonds (distance) P-C4' energy: -162.614 flat angles C4'-P-C4' energy: -162.389 flat angles P-C4'-P energy: -86.519 tors. eta vs tors. theta energy: -143.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -1558.111001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.111001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.111001 (E_RNA) where: Base-Base interactions energy: -932.196 where: short stacking energy: -443.522 Base-Backbone interact. energy: 0.769 local terms energy: -626.683777 where: bonds (distance) C4'-P energy: -157.807 bonds (distance) P-C4' energy: -174.542 flat angles C4'-P-C4' energy: -136.912 flat angles P-C4'-P energy: -87.706 tors. eta vs tors. theta energy: -69.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1308.705731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.705731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.705731 (E_RNA) where: Base-Base interactions energy: -746.103 where: short stacking energy: -388.144 Base-Backbone interact. energy: -2.390 local terms energy: -560.212671 where: bonds (distance) C4'-P energy: -166.297 bonds (distance) P-C4' energy: -158.917 flat angles C4'-P-C4' energy: -125.473 flat angles P-C4'-P energy: -73.376 tors. eta vs tors. theta energy: -36.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -1050.194167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.194167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.194167 (E_RNA) where: Base-Base interactions energy: -578.823 where: short stacking energy: -321.807 Base-Backbone interact. energy: 3.760 local terms energy: -475.131301 where: bonds (distance) C4'-P energy: -129.898 bonds (distance) P-C4' energy: -134.159 flat angles C4'-P-C4' energy: -127.648 flat angles P-C4'-P energy: -69.193 tors. eta vs tors. theta energy: -14.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -3119.166282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3119.166282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3119.166282 (E_RNA) where: Base-Base interactions energy: -2157.624 where: short stacking energy: -946.723 Base-Backbone interact. energy: -2.686 local terms energy: -958.856057 where: bonds (distance) C4'-P energy: -184.901 bonds (distance) P-C4' energy: -189.889 flat angles C4'-P-C4' energy: -201.257 flat angles P-C4'-P energy: -134.808 tors. eta vs tors. theta energy: -248.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -3007.056070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3007.056070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3007.056070 (E_RNA) where: Base-Base interactions energy: -2051.213 where: short stacking energy: -880.713 Base-Backbone interact. energy: 0.151 local terms energy: -955.994403 where: bonds (distance) C4'-P energy: -200.844 bonds (distance) P-C4' energy: -189.493 flat angles C4'-P-C4' energy: -210.832 flat angles P-C4'-P energy: -138.047 tors. eta vs tors. theta energy: -216.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -2835.413674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2835.413674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2835.413674 (E_RNA) where: Base-Base interactions energy: -1955.052 where: short stacking energy: -807.806 Base-Backbone interact. energy: -3.872 local terms energy: -876.489966 where: bonds (distance) C4'-P energy: -165.884 bonds (distance) P-C4' energy: -186.391 flat angles C4'-P-C4' energy: -195.511 flat angles P-C4'-P energy: -120.872 tors. eta vs tors. theta energy: -207.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -2740.933195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2740.933195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2740.933195 (E_RNA) where: Base-Base interactions energy: -1874.140 where: short stacking energy: -790.770 Base-Backbone interact. energy: -5.644 local terms energy: -861.148805 where: bonds (distance) C4'-P energy: -164.881 bonds (distance) P-C4' energy: -177.561 flat angles C4'-P-C4' energy: -188.233 flat angles P-C4'-P energy: -114.731 tors. eta vs tors. theta energy: -215.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -2456.110820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2456.110820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2456.110820 (E_RNA) where: Base-Base interactions energy: -1663.940 where: short stacking energy: -718.627 Base-Backbone interact. energy: 1.936 local terms energy: -794.106751 where: bonds (distance) C4'-P energy: -177.902 bonds (distance) P-C4' energy: -172.893 flat angles C4'-P-C4' energy: -188.759 flat angles P-C4'-P energy: -97.478 tors. eta vs tors. theta energy: -157.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -2286.153261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2286.153261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2286.153261 (E_RNA) where: Base-Base interactions energy: -1533.926 where: short stacking energy: -648.114 Base-Backbone interact. energy: -1.973 local terms energy: -750.254112 where: bonds (distance) C4'-P energy: -161.748 bonds (distance) P-C4' energy: -169.118 flat angles C4'-P-C4' energy: -168.516 flat angles P-C4'-P energy: -95.647 tors. eta vs tors. theta energy: -155.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -2068.907836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2068.907836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2068.907836 (E_RNA) where: Base-Base interactions energy: -1367.511 where: short stacking energy: -633.472 Base-Backbone interact. energy: -2.285 local terms energy: -699.111840 where: bonds (distance) C4'-P energy: -149.620 bonds (distance) P-C4' energy: -145.902 flat angles C4'-P-C4' energy: -163.749 flat angles P-C4'-P energy: -118.576 tors. eta vs tors. theta energy: -121.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1584.686213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.686213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.686213 (E_RNA) where: Base-Base interactions energy: -955.478 where: short stacking energy: -435.503 Base-Backbone interact. energy: -0.053 local terms energy: -629.154961 where: bonds (distance) C4'-P energy: -143.271 bonds (distance) P-C4' energy: -148.430 flat angles C4'-P-C4' energy: -159.804 flat angles P-C4'-P energy: -83.914 tors. eta vs tors. theta energy: -93.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1359.861885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.861885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.861885 (E_RNA) where: Base-Base interactions energy: -780.210 where: short stacking energy: -439.430 Base-Backbone interact. energy: -2.456 local terms energy: -577.195626 where: bonds (distance) C4'-P energy: -149.452 bonds (distance) P-C4' energy: -148.044 flat angles C4'-P-C4' energy: -141.534 flat angles P-C4'-P energy: -97.645 tors. eta vs tors. theta energy: -40.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -1048.627060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1048.627060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1048.627060 (E_RNA) where: Base-Base interactions energy: -557.696 where: short stacking energy: -294.140 Base-Backbone interact. energy: -0.924 local terms energy: -490.007353 where: bonds (distance) C4'-P energy: -127.668 bonds (distance) P-C4' energy: -144.970 flat angles C4'-P-C4' energy: -144.312 flat angles P-C4'-P energy: -86.527 tors. eta vs tors. theta energy: 13.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -3077.478996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3077.478996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3077.478996 (E_RNA) where: Base-Base interactions energy: -2138.707 where: short stacking energy: -922.087 Base-Backbone interact. energy: 2.150 local terms energy: -940.921845 where: bonds (distance) C4'-P energy: -177.425 bonds (distance) P-C4' energy: -185.954 flat angles C4'-P-C4' energy: -201.024 flat angles P-C4'-P energy: -143.730 tors. eta vs tors. theta energy: -232.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -3043.862369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3043.862369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3043.862369 (E_RNA) where: Base-Base interactions energy: -2142.765 where: short stacking energy: -924.873 Base-Backbone interact. energy: 3.631 local terms energy: -904.728515 where: bonds (distance) C4'-P energy: -173.192 bonds (distance) P-C4' energy: -164.239 flat angles C4'-P-C4' energy: -209.253 flat angles P-C4'-P energy: -112.097 tors. eta vs tors. theta energy: -245.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -2785.993794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2785.993794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2785.993794 (E_RNA) where: Base-Base interactions energy: -1907.668 where: short stacking energy: -805.955 Base-Backbone interact. energy: -5.983 local terms energy: -872.342446 where: bonds (distance) C4'-P energy: -175.642 bonds (distance) P-C4' energy: -166.807 flat angles C4'-P-C4' energy: -191.967 flat angles P-C4'-P energy: -135.048 tors. eta vs tors. theta energy: -202.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -2716.978444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2716.978444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2716.978444 (E_RNA) where: Base-Base interactions energy: -1857.293 where: short stacking energy: -772.088 Base-Backbone interact. energy: -6.852 local terms energy: -852.833546 where: bonds (distance) C4'-P energy: -170.333 bonds (distance) P-C4' energy: -168.206 flat angles C4'-P-C4' energy: -172.637 flat angles P-C4'-P energy: -132.812 tors. eta vs tors. theta energy: -208.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -2405.633637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2405.633637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2405.633637 (E_RNA) where: Base-Base interactions energy: -1608.440 where: short stacking energy: -709.668 Base-Backbone interact. energy: -2.659 local terms energy: -794.534906 where: bonds (distance) C4'-P energy: -151.051 bonds (distance) P-C4' energy: -163.288 flat angles C4'-P-C4' energy: -184.992 flat angles P-C4'-P energy: -111.933 tors. eta vs tors. theta energy: -183.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -2358.355950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2358.355950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2358.355950 (E_RNA) where: Base-Base interactions energy: -1592.336 where: short stacking energy: -680.121 Base-Backbone interact. energy: 0.498 local terms energy: -766.517957 where: bonds (distance) C4'-P energy: -157.631 bonds (distance) P-C4' energy: -159.482 flat angles C4'-P-C4' energy: -186.516 flat angles P-C4'-P energy: -103.703 tors. eta vs tors. theta energy: -159.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -2057.868315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2057.868315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2057.868315 (E_RNA) where: Base-Base interactions energy: -1372.047 where: short stacking energy: -606.526 Base-Backbone interact. energy: -3.802 local terms energy: -682.019072 where: bonds (distance) C4'-P energy: -130.272 bonds (distance) P-C4' energy: -161.457 flat angles C4'-P-C4' energy: -157.146 flat angles P-C4'-P energy: -113.824 tors. eta vs tors. theta energy: -119.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1519.544362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1519.544362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1519.544362 (E_RNA) where: Base-Base interactions energy: -895.795 where: short stacking energy: -449.225 Base-Backbone interact. energy: 1.998 local terms energy: -625.747371 where: bonds (distance) C4'-P energy: -163.102 bonds (distance) P-C4' energy: -158.632 flat angles C4'-P-C4' energy: -154.729 flat angles P-C4'-P energy: -80.553 tors. eta vs tors. theta energy: -68.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1355.185206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.185206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.185206 (E_RNA) where: Base-Base interactions energy: -805.947 where: short stacking energy: -396.806 Base-Backbone interact. energy: 3.559 local terms energy: -552.797075 where: bonds (distance) C4'-P energy: -147.569 bonds (distance) P-C4' energy: -164.624 flat angles C4'-P-C4' energy: -141.958 flat angles P-C4'-P energy: -64.159 tors. eta vs tors. theta energy: -34.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -1041.837134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1041.837134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1041.837134 (E_RNA) where: Base-Base interactions energy: -550.749 where: short stacking energy: -288.652 Base-Backbone interact. energy: -3.855 local terms energy: -487.233433 where: bonds (distance) C4'-P energy: -124.095 bonds (distance) P-C4' energy: -150.543 flat angles C4'-P-C4' energy: -119.387 flat angles P-C4'-P energy: -81.806 tors. eta vs tors. theta energy: -11.402 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -3126.964116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3126.964116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3126.964116 (E_RNA) where: Base-Base interactions energy: -2167.849 where: short stacking energy: -916.060 Base-Backbone interact. energy: -2.340 local terms energy: -956.775000 where: bonds (distance) C4'-P energy: -195.452 bonds (distance) P-C4' energy: -190.432 flat angles C4'-P-C4' energy: -205.684 flat angles P-C4'-P energy: -135.319 tors. eta vs tors. theta energy: -229.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -3010.252076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3010.252076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3010.252076 (E_RNA) where: Base-Base interactions energy: -2067.099 where: short stacking energy: -878.382 Base-Backbone interact. energy: 0.324 local terms energy: -943.477038 where: bonds (distance) C4'-P energy: -176.600 bonds (distance) P-C4' energy: -178.425 flat angles C4'-P-C4' energy: -212.081 flat angles P-C4'-P energy: -128.061 tors. eta vs tors. theta energy: -248.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -2817.480864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2817.480864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2817.480864 (E_RNA) where: Base-Base interactions energy: -1962.619 where: short stacking energy: -860.830 Base-Backbone interact. energy: -4.278 local terms energy: -850.584777 where: bonds (distance) C4'-P energy: -148.947 bonds (distance) P-C4' energy: -185.349 flat angles C4'-P-C4' energy: -184.750 flat angles P-C4'-P energy: -121.050 tors. eta vs tors. theta energy: -210.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -2717.194320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2717.194320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2717.194320 (E_RNA) where: Base-Base interactions energy: -1851.239 where: short stacking energy: -745.301 Base-Backbone interact. energy: -4.771 local terms energy: -861.183859 where: bonds (distance) C4'-P energy: -156.473 bonds (distance) P-C4' energy: -173.602 flat angles C4'-P-C4' energy: -195.740 flat angles P-C4'-P energy: -122.456 tors. eta vs tors. theta energy: -212.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -2429.783972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2429.783972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2429.783972 (E_RNA) where: Base-Base interactions energy: -1598.295 where: short stacking energy: -714.262 Base-Backbone interact. energy: 0.601 local terms energy: -832.089769 where: bonds (distance) C4'-P energy: -175.213 bonds (distance) P-C4' energy: -175.603 flat angles C4'-P-C4' energy: -186.074 flat angles P-C4'-P energy: -121.813 tors. eta vs tors. theta energy: -173.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -2293.131781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2293.131781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2293.131781 (E_RNA) where: Base-Base interactions energy: -1572.781 where: short stacking energy: -628.754 Base-Backbone interact. energy: -4.796 local terms energy: -715.555192 where: bonds (distance) C4'-P energy: -158.852 bonds (distance) P-C4' energy: -145.653 flat angles C4'-P-C4' energy: -172.549 flat angles P-C4'-P energy: -95.296 tors. eta vs tors. theta energy: -143.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -2116.595021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2116.595021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2116.595021 (E_RNA) where: Base-Base interactions energy: -1381.234 where: short stacking energy: -651.437 Base-Backbone interact. energy: -3.815 local terms energy: -731.546770 where: bonds (distance) C4'-P energy: -146.114 bonds (distance) P-C4' energy: -152.895 flat angles C4'-P-C4' energy: -182.161 flat angles P-C4'-P energy: -97.728 tors. eta vs tors. theta energy: -152.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1477.489547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.489547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.489547 (E_RNA) where: Base-Base interactions energy: -869.761 where: short stacking energy: -448.205 Base-Backbone interact. energy: 3.642 local terms energy: -611.370546 where: bonds (distance) C4'-P energy: -145.795 bonds (distance) P-C4' energy: -157.849 flat angles C4'-P-C4' energy: -151.654 flat angles P-C4'-P energy: -85.335 tors. eta vs tors. theta energy: -70.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1427.540696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.540696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.540696 (E_RNA) where: Base-Base interactions energy: -845.302 where: short stacking energy: -434.155 Base-Backbone interact. energy: 3.274 local terms energy: -585.512477 where: bonds (distance) C4'-P energy: -139.186 bonds (distance) P-C4' energy: -143.488 flat angles C4'-P-C4' energy: -144.537 flat angles P-C4'-P energy: -93.568 tors. eta vs tors. theta energy: -64.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -1007.218758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.218758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.218758 (E_RNA) where: Base-Base interactions energy: -515.269 where: short stacking energy: -281.529 Base-Backbone interact. energy: 4.902 local terms energy: -496.851826 where: bonds (distance) C4'-P energy: -140.919 bonds (distance) P-C4' energy: -138.210 flat angles C4'-P-C4' energy: -135.545 flat angles P-C4'-P energy: -84.184 tors. eta vs tors. theta energy: 2.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -3126.337001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3126.337001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3126.337001 (E_RNA) where: Base-Base interactions energy: -2162.134 where: short stacking energy: -920.177 Base-Backbone interact. energy: 1.777 local terms energy: -965.980777 where: bonds (distance) C4'-P energy: -179.536 bonds (distance) P-C4' energy: -184.468 flat angles C4'-P-C4' energy: -221.030 flat angles P-C4'-P energy: -144.395 tors. eta vs tors. theta energy: -236.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -2957.458844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2957.458844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2957.458844 (E_RNA) where: Base-Base interactions energy: -2040.283 where: short stacking energy: -873.680 Base-Backbone interact. energy: 0.095 local terms energy: -917.270834 where: bonds (distance) C4'-P energy: -179.351 bonds (distance) P-C4' energy: -182.677 flat angles C4'-P-C4' energy: -193.702 flat angles P-C4'-P energy: -119.455 tors. eta vs tors. theta energy: -242.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -2822.224324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2822.224324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2822.224324 (E_RNA) where: Base-Base interactions energy: -1944.202 where: short stacking energy: -831.868 Base-Backbone interact. energy: 1.845 local terms energy: -879.866909 where: bonds (distance) C4'-P energy: -177.919 bonds (distance) P-C4' energy: -175.254 flat angles C4'-P-C4' energy: -196.263 flat angles P-C4'-P energy: -112.003 tors. eta vs tors. theta energy: -218.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -2780.459608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2780.459608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2780.459608 (E_RNA) where: Base-Base interactions energy: -1908.901 where: short stacking energy: -808.434 Base-Backbone interact. energy: -3.075 local terms energy: -868.483531 where: bonds (distance) C4'-P energy: -155.038 bonds (distance) P-C4' energy: -169.129 flat angles C4'-P-C4' energy: -188.288 flat angles P-C4'-P energy: -129.675 tors. eta vs tors. theta energy: -226.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -2406.026465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2406.026465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2406.026465 (E_RNA) where: Base-Base interactions energy: -1579.445 where: short stacking energy: -718.875 Base-Backbone interact. energy: -0.318 local terms energy: -826.263181 where: bonds (distance) C4'-P energy: -168.547 bonds (distance) P-C4' energy: -165.914 flat angles C4'-P-C4' energy: -181.953 flat angles P-C4'-P energy: -120.559 tors. eta vs tors. theta energy: -189.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -2306.068771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2306.068771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2306.068771 (E_RNA) where: Base-Base interactions energy: -1579.233 where: short stacking energy: -671.809 Base-Backbone interact. energy: 3.279 local terms energy: -730.114826 where: bonds (distance) C4'-P energy: -159.961 bonds (distance) P-C4' energy: -156.233 flat angles C4'-P-C4' energy: -168.030 flat angles P-C4'-P energy: -85.875 tors. eta vs tors. theta energy: -160.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -2116.414293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2116.414293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2116.414293 (E_RNA) where: Base-Base interactions energy: -1410.137 where: short stacking energy: -628.885 Base-Backbone interact. energy: -4.680 local terms energy: -701.597591 where: bonds (distance) C4'-P energy: -169.967 bonds (distance) P-C4' energy: -137.841 flat angles C4'-P-C4' energy: -166.863 flat angles P-C4'-P energy: -112.425 tors. eta vs tors. theta energy: -114.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1454.214544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.214544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.214544 (E_RNA) where: Base-Base interactions energy: -837.716 where: short stacking energy: -419.106 Base-Backbone interact. energy: 0.046 local terms energy: -616.544335 where: bonds (distance) C4'-P energy: -141.192 bonds (distance) P-C4' energy: -161.318 flat angles C4'-P-C4' energy: -157.271 flat angles P-C4'-P energy: -97.856 tors. eta vs tors. theta energy: -58.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -1267.407510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.407510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.407510 (E_RNA) where: Base-Base interactions energy: -726.595 where: short stacking energy: -374.537 Base-Backbone interact. energy: 2.598 local terms energy: -543.409755 where: bonds (distance) C4'-P energy: -136.053 bonds (distance) P-C4' energy: -151.392 flat angles C4'-P-C4' energy: -129.039 flat angles P-C4'-P energy: -91.273 tors. eta vs tors. theta energy: -35.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -963.297392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.297392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.297392 (E_RNA) where: Base-Base interactions energy: -493.654 where: short stacking energy: -298.778 Base-Backbone interact. energy: -3.085 local terms energy: -466.558360 where: bonds (distance) C4'-P energy: -121.649 bonds (distance) P-C4' energy: -165.323 flat angles C4'-P-C4' energy: -127.423 flat angles P-C4'-P energy: -62.730 tors. eta vs tors. theta energy: 10.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -3148.332781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3148.332781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3148.332781 (E_RNA) where: Base-Base interactions energy: -2190.034 where: short stacking energy: -952.882 Base-Backbone interact. energy: -2.518 local terms energy: -955.781286 where: bonds (distance) C4'-P energy: -186.753 bonds (distance) P-C4' energy: -175.627 flat angles C4'-P-C4' energy: -215.508 flat angles P-C4'-P energy: -138.423 tors. eta vs tors. theta energy: -239.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -2953.576421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2953.576421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2953.576421 (E_RNA) where: Base-Base interactions energy: -2061.559 where: short stacking energy: -855.624 Base-Backbone interact. energy: -3.413 local terms energy: -888.605044 where: bonds (distance) C4'-P energy: -178.203 bonds (distance) P-C4' energy: -163.048 flat angles C4'-P-C4' energy: -202.221 flat angles P-C4'-P energy: -118.563 tors. eta vs tors. theta energy: -226.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -2828.537722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2828.537722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2828.537722 (E_RNA) where: Base-Base interactions energy: -1950.631 where: short stacking energy: -829.341 Base-Backbone interact. energy: -1.253 local terms energy: -876.654043 where: bonds (distance) C4'-P energy: -165.557 bonds (distance) P-C4' energy: -171.520 flat angles C4'-P-C4' energy: -188.628 flat angles P-C4'-P energy: -132.020 tors. eta vs tors. theta energy: -218.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -2778.985558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2778.985558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2778.985558 (E_RNA) where: Base-Base interactions energy: -1909.937 where: short stacking energy: -791.220 Base-Backbone interact. energy: 7.148 local terms energy: -876.196589 where: bonds (distance) C4'-P energy: -164.071 bonds (distance) P-C4' energy: -172.800 flat angles C4'-P-C4' energy: -207.148 flat angles P-C4'-P energy: -109.473 tors. eta vs tors. theta energy: -222.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -2481.613427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2481.613427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2481.613427 (E_RNA) where: Base-Base interactions energy: -1686.098 where: short stacking energy: -771.233 Base-Backbone interact. energy: -1.696 local terms energy: -793.819571 where: bonds (distance) C4'-P energy: -158.087 bonds (distance) P-C4' energy: -163.570 flat angles C4'-P-C4' energy: -165.451 flat angles P-C4'-P energy: -117.179 tors. eta vs tors. theta energy: -189.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -2300.338237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2300.338237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2300.338237 (E_RNA) where: Base-Base interactions energy: -1566.334 where: short stacking energy: -673.199 Base-Backbone interact. energy: -0.074 local terms energy: -733.930111 where: bonds (distance) C4'-P energy: -146.985 bonds (distance) P-C4' energy: -177.924 flat angles C4'-P-C4' energy: -171.891 flat angles P-C4'-P energy: -81.429 tors. eta vs tors. theta energy: -155.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -2106.705024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.705024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2106.705024 (E_RNA) where: Base-Base interactions energy: -1356.392 where: short stacking energy: -633.689 Base-Backbone interact. energy: -1.029 local terms energy: -749.283031 where: bonds (distance) C4'-P energy: -170.170 bonds (distance) P-C4' energy: -151.989 flat angles C4'-P-C4' energy: -177.206 flat angles P-C4'-P energy: -97.776 tors. eta vs tors. theta energy: -152.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -1489.052122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.052122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.052122 (E_RNA) where: Base-Base interactions energy: -891.887 where: short stacking energy: -460.535 Base-Backbone interact. energy: -3.252 local terms energy: -593.913750 where: bonds (distance) C4'-P energy: -140.077 bonds (distance) P-C4' energy: -135.702 flat angles C4'-P-C4' energy: -182.691 flat angles P-C4'-P energy: -80.520 tors. eta vs tors. theta energy: -54.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -1271.001054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.001054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.001054 (E_RNA) where: Base-Base interactions energy: -688.286 where: short stacking energy: -340.208 Base-Backbone interact. energy: 1.196 local terms energy: -583.911126 where: bonds (distance) C4'-P energy: -160.929 bonds (distance) P-C4' energy: -163.666 flat angles C4'-P-C4' energy: -139.573 flat angles P-C4'-P energy: -92.825 tors. eta vs tors. theta energy: -26.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -1024.215643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.215643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.215643 (E_RNA) where: Base-Base interactions energy: -513.419 where: short stacking energy: -293.533 Base-Backbone interact. energy: -0.382 local terms energy: -510.414274 where: bonds (distance) C4'-P energy: -141.608 bonds (distance) P-C4' energy: -168.363 flat angles C4'-P-C4' energy: -116.383 flat angles P-C4'-P energy: -72.504 tors. eta vs tors. theta energy: -11.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -3148.632202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3148.632202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3148.632202 (E_RNA) where: Base-Base interactions energy: -2184.172 where: short stacking energy: -957.696 Base-Backbone interact. energy: -2.034 local terms energy: -962.427087 where: bonds (distance) C4'-P energy: -175.022 bonds (distance) P-C4' energy: -181.942 flat angles C4'-P-C4' energy: -213.828 flat angles P-C4'-P energy: -140.939 tors. eta vs tors. theta energy: -250.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -2997.554307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2997.554307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2997.554307 (E_RNA) where: Base-Base interactions energy: -2060.943 where: short stacking energy: -858.689 Base-Backbone interact. energy: 1.683 local terms energy: -938.295112 where: bonds (distance) C4'-P energy: -182.872 bonds (distance) P-C4' energy: -194.808 flat angles C4'-P-C4' energy: -184.204 flat angles P-C4'-P energy: -144.358 tors. eta vs tors. theta energy: -232.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -2849.714024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2849.714024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2849.714024 (E_RNA) where: Base-Base interactions energy: -1954.626 where: short stacking energy: -840.238 Base-Backbone interact. energy: -1.620 local terms energy: -893.468267 where: bonds (distance) C4'-P energy: -166.263 bonds (distance) P-C4' energy: -183.053 flat angles C4'-P-C4' energy: -199.831 flat angles P-C4'-P energy: -118.459 tors. eta vs tors. theta energy: -225.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -2811.368068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2811.368068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2811.368068 (E_RNA) where: Base-Base interactions energy: -1928.887 where: short stacking energy: -815.871 Base-Backbone interact. energy: -0.839 local terms energy: -881.641269 where: bonds (distance) C4'-P energy: -161.959 bonds (distance) P-C4' energy: -185.397 flat angles C4'-P-C4' energy: -192.229 flat angles P-C4'-P energy: -112.268 tors. eta vs tors. theta energy: -229.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -2445.436301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2445.436301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2445.436301 (E_RNA) where: Base-Base interactions energy: -1681.327 where: short stacking energy: -738.209 Base-Backbone interact. energy: -2.281 local terms energy: -761.828366 where: bonds (distance) C4'-P energy: -139.467 bonds (distance) P-C4' energy: -160.507 flat angles C4'-P-C4' energy: -176.838 flat angles P-C4'-P energy: -105.459 tors. eta vs tors. theta energy: -179.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -2298.761100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2298.761100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2298.761100 (E_RNA) where: Base-Base interactions energy: -1521.826 where: short stacking energy: -686.151 Base-Backbone interact. energy: -4.746 local terms energy: -772.189024 where: bonds (distance) C4'-P energy: -145.066 bonds (distance) P-C4' energy: -166.475 flat angles C4'-P-C4' energy: -187.475 flat angles P-C4'-P energy: -110.488 tors. eta vs tors. theta energy: -162.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -2153.142660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2153.142660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2153.142660 (E_RNA) where: Base-Base interactions energy: -1476.709 where: short stacking energy: -672.694 Base-Backbone interact. energy: -2.126 local terms energy: -674.307443 where: bonds (distance) C4'-P energy: -142.252 bonds (distance) P-C4' energy: -166.214 flat angles C4'-P-C4' energy: -156.207 flat angles P-C4'-P energy: -62.833 tors. eta vs tors. theta energy: -146.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -1459.146720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.146720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.146720 (E_RNA) where: Base-Base interactions energy: -841.342 where: short stacking energy: -448.460 Base-Backbone interact. energy: -2.619 local terms energy: -615.185687 where: bonds (distance) C4'-P energy: -153.590 bonds (distance) P-C4' energy: -153.552 flat angles C4'-P-C4' energy: -141.130 flat angles P-C4'-P energy: -94.080 tors. eta vs tors. theta energy: -72.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -1237.955218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.955218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.955218 (E_RNA) where: Base-Base interactions energy: -677.823 where: short stacking energy: -346.543 Base-Backbone interact. energy: 1.406 local terms energy: -561.538084 where: bonds (distance) C4'-P energy: -155.093 bonds (distance) P-C4' energy: -150.973 flat angles C4'-P-C4' energy: -135.032 flat angles P-C4'-P energy: -85.387 tors. eta vs tors. theta energy: -35.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -986.510138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.510138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.510138 (E_RNA) where: Base-Base interactions energy: -519.036 where: short stacking energy: -294.559 Base-Backbone interact. energy: 7.457 local terms energy: -474.930492 where: bonds (distance) C4'-P energy: -155.037 bonds (distance) P-C4' energy: -144.976 flat angles C4'-P-C4' energy: -91.038 flat angles P-C4'-P energy: -73.215 tors. eta vs tors. theta energy: -10.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -3162.326656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3162.326656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3162.326656 (E_RNA) where: Base-Base interactions energy: -2213.366 where: short stacking energy: -940.325 Base-Backbone interact. energy: -4.833 local terms energy: -944.127023 where: bonds (distance) C4'-P energy: -169.619 bonds (distance) P-C4' energy: -185.182 flat angles C4'-P-C4' energy: -214.351 flat angles P-C4'-P energy: -138.604 tors. eta vs tors. theta energy: -236.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -2995.078295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2995.078295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2995.078295 (E_RNA) where: Base-Base interactions energy: -2063.230 where: short stacking energy: -899.345 Base-Backbone interact. energy: -1.649 local terms energy: -930.198839 where: bonds (distance) C4'-P energy: -177.294 bonds (distance) P-C4' energy: -191.151 flat angles C4'-P-C4' energy: -192.389 flat angles P-C4'-P energy: -125.466 tors. eta vs tors. theta energy: -243.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -2899.306373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2899.306373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2899.306373 (E_RNA) where: Base-Base interactions energy: -2002.487 where: short stacking energy: -850.894 Base-Backbone interact. energy: -2.083 local terms energy: -894.735983 where: bonds (distance) C4'-P energy: -178.497 bonds (distance) P-C4' energy: -180.463 flat angles C4'-P-C4' energy: -194.968 flat angles P-C4'-P energy: -110.972 tors. eta vs tors. theta energy: -229.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -2822.519684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2822.519684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2822.519684 (E_RNA) where: Base-Base interactions energy: -1962.815 where: short stacking energy: -835.793 Base-Backbone interact. energy: -3.546 local terms energy: -856.159210 where: bonds (distance) C4'-P energy: -140.804 bonds (distance) P-C4' energy: -164.623 flat angles C4'-P-C4' energy: -197.529 flat angles P-C4'-P energy: -111.315 tors. eta vs tors. theta energy: -241.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -2502.978614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2502.978614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2502.978614 (E_RNA) where: Base-Base interactions energy: -1695.894 where: short stacking energy: -783.762 Base-Backbone interact. energy: 0.236 local terms energy: -807.320715 where: bonds (distance) C4'-P energy: -169.344 bonds (distance) P-C4' energy: -171.820 flat angles C4'-P-C4' energy: -165.949 flat angles P-C4'-P energy: -98.277 tors. eta vs tors. theta energy: -201.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -2271.169934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2271.169934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2271.169934 (E_RNA) where: Base-Base interactions energy: -1521.156 where: short stacking energy: -656.523 Base-Backbone interact. energy: -0.078 local terms energy: -749.936305 where: bonds (distance) C4'-P energy: -167.265 bonds (distance) P-C4' energy: -163.295 flat angles C4'-P-C4' energy: -175.332 flat angles P-C4'-P energy: -95.850 tors. eta vs tors. theta energy: -148.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -2177.890769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2177.890769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2177.890769 (E_RNA) where: Base-Base interactions energy: -1413.833 where: short stacking energy: -632.890 Base-Backbone interact. energy: -2.917 local terms energy: -761.140894 where: bonds (distance) C4'-P energy: -148.679 bonds (distance) P-C4' energy: -165.125 flat angles C4'-P-C4' energy: -192.595 flat angles P-C4'-P energy: -112.279 tors. eta vs tors. theta energy: -142.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -1466.072062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.072062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.072062 (E_RNA) where: Base-Base interactions energy: -835.265 where: short stacking energy: -443.255 Base-Backbone interact. energy: -4.483 local terms energy: -626.324746 where: bonds (distance) C4'-P energy: -144.404 bonds (distance) P-C4' energy: -175.564 flat angles C4'-P-C4' energy: -157.668 flat angles P-C4'-P energy: -93.603 tors. eta vs tors. theta energy: -55.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -1215.589493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.589493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.589493 (E_RNA) where: Base-Base interactions energy: -690.071 where: short stacking energy: -366.489 Base-Backbone interact. energy: 2.166 local terms energy: -527.684562 where: bonds (distance) C4'-P energy: -135.134 bonds (distance) P-C4' energy: -164.088 flat angles C4'-P-C4' energy: -136.622 flat angles P-C4'-P energy: -81.655 tors. eta vs tors. theta energy: -10.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -997.357745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.357745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.357745 (E_RNA) where: Base-Base interactions energy: -517.602 where: short stacking energy: -289.203 Base-Backbone interact. energy: -0.409 local terms energy: -479.346271 where: bonds (distance) C4'-P energy: -121.021 bonds (distance) P-C4' energy: -167.088 flat angles C4'-P-C4' energy: -115.475 flat angles P-C4'-P energy: -72.492 tors. eta vs tors. theta energy: -3.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -3140.657238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3140.657238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3140.657238 (E_RNA) where: Base-Base interactions energy: -2178.557 where: short stacking energy: -906.358 Base-Backbone interact. energy: -3.857 local terms energy: -958.242628 where: bonds (distance) C4'-P energy: -184.585 bonds (distance) P-C4' energy: -186.965 flat angles C4'-P-C4' energy: -214.847 flat angles P-C4'-P energy: -138.457 tors. eta vs tors. theta energy: -233.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -3028.313981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3028.313981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3028.313981 (E_RNA) where: Base-Base interactions energy: -2095.113 where: short stacking energy: -884.624 Base-Backbone interact. energy: -2.330 local terms energy: -930.870830 where: bonds (distance) C4'-P energy: -174.443 bonds (distance) P-C4' energy: -179.304 flat angles C4'-P-C4' energy: -200.485 flat angles P-C4'-P energy: -134.079 tors. eta vs tors. theta energy: -242.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -2881.263443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2881.263443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2881.263443 (E_RNA) where: Base-Base interactions energy: -1978.501 where: short stacking energy: -856.842 Base-Backbone interact. energy: -6.832 local terms energy: -895.931128 where: bonds (distance) C4'-P energy: -165.254 bonds (distance) P-C4' energy: -181.357 flat angles C4'-P-C4' energy: -195.655 flat angles P-C4'-P energy: -133.262 tors. eta vs tors. theta energy: -220.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -2816.541083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2816.541083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2816.541083 (E_RNA) where: Base-Base interactions energy: -1952.680 where: short stacking energy: -818.927 Base-Backbone interact. energy: -2.299 local terms energy: -861.562037 where: bonds (distance) C4'-P energy: -151.617 bonds (distance) P-C4' energy: -176.122 flat angles C4'-P-C4' energy: -187.786 flat angles P-C4'-P energy: -111.858 tors. eta vs tors. theta energy: -234.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -2483.845602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2483.845602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2483.845602 (E_RNA) where: Base-Base interactions energy: -1733.288 where: short stacking energy: -733.558 Base-Backbone interact. energy: 5.326 local terms energy: -755.884239 where: bonds (distance) C4'-P energy: -144.242 bonds (distance) P-C4' energy: -161.018 flat angles C4'-P-C4' energy: -168.293 flat angles P-C4'-P energy: -88.806 tors. eta vs tors. theta energy: -193.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -2293.176740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2293.176740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2293.176740 (E_RNA) where: Base-Base interactions energy: -1545.519 where: short stacking energy: -676.910 Base-Backbone interact. energy: -4.557 local terms energy: -743.101400 where: bonds (distance) C4'-P energy: -149.590 bonds (distance) P-C4' energy: -166.083 flat angles C4'-P-C4' energy: -163.601 flat angles P-C4'-P energy: -107.412 tors. eta vs tors. theta energy: -156.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -2131.517554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2131.517554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2131.517554 (E_RNA) where: Base-Base interactions energy: -1418.953 where: short stacking energy: -637.998 Base-Backbone interact. energy: 6.118 local terms energy: -718.682596 where: bonds (distance) C4'-P energy: -153.551 bonds (distance) P-C4' energy: -149.086 flat angles C4'-P-C4' energy: -169.042 flat angles P-C4'-P energy: -108.749 tors. eta vs tors. theta energy: -138.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -1512.189675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1512.189675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1512.189675 (E_RNA) where: Base-Base interactions energy: -885.070 where: short stacking energy: -463.064 Base-Backbone interact. energy: -1.322 local terms energy: -625.797979 where: bonds (distance) C4'-P energy: -154.312 bonds (distance) P-C4' energy: -151.117 flat angles C4'-P-C4' energy: -135.720 flat angles P-C4'-P energy: -82.678 tors. eta vs tors. theta energy: -101.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -1263.356106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.356106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.356106 (E_RNA) where: Base-Base interactions energy: -721.788 where: short stacking energy: -403.357 Base-Backbone interact. energy: -0.718 local terms energy: -540.851005 where: bonds (distance) C4'-P energy: -143.770 bonds (distance) P-C4' energy: -140.489 flat angles C4'-P-C4' energy: -146.641 flat angles P-C4'-P energy: -70.978 tors. eta vs tors. theta energy: -38.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -1023.780996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.780996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.780996 (E_RNA) where: Base-Base interactions energy: -504.802 where: short stacking energy: -262.757 Base-Backbone interact. energy: 0.606 local terms energy: -519.584771 where: bonds (distance) C4'-P energy: -159.746 bonds (distance) P-C4' energy: -158.957 flat angles C4'-P-C4' energy: -119.151 flat angles P-C4'-P energy: -93.166 tors. eta vs tors. theta energy: 11.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -3165.732581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3165.732581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3165.732581 (E_RNA) where: Base-Base interactions energy: -2174.970 where: short stacking energy: -936.390 Base-Backbone interact. energy: -4.301 local terms energy: -986.462149 where: bonds (distance) C4'-P energy: -186.348 bonds (distance) P-C4' energy: -187.341 flat angles C4'-P-C4' energy: -217.581 flat angles P-C4'-P energy: -144.194 tors. eta vs tors. theta energy: -250.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -3000.835519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3000.835519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3000.835519 (E_RNA) where: Base-Base interactions energy: -2080.406 where: short stacking energy: -856.784 Base-Backbone interact. energy: -1.485 local terms energy: -918.944562 where: bonds (distance) C4'-P energy: -182.702 bonds (distance) P-C4' energy: -188.636 flat angles C4'-P-C4' energy: -190.245 flat angles P-C4'-P energy: -126.015 tors. eta vs tors. theta energy: -231.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -2852.054975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2852.054975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2852.054975 (E_RNA) where: Base-Base interactions energy: -1983.613 where: short stacking energy: -843.183 Base-Backbone interact. energy: -2.237 local terms energy: -866.205405 where: bonds (distance) C4'-P energy: -157.890 bonds (distance) P-C4' energy: -174.618 flat angles C4'-P-C4' energy: -182.171 flat angles P-C4'-P energy: -129.359 tors. eta vs tors. theta energy: -222.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -2742.879720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2742.879720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2742.879720 (E_RNA) where: Base-Base interactions energy: -1891.196 where: short stacking energy: -782.052 Base-Backbone interact. energy: -2.807 local terms energy: -848.876338 where: bonds (distance) C4'-P energy: -169.213 bonds (distance) P-C4' energy: -174.224 flat angles C4'-P-C4' energy: -189.179 flat angles P-C4'-P energy: -115.059 tors. eta vs tors. theta energy: -201.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -2485.864424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2485.864424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2485.864424 (E_RNA) where: Base-Base interactions energy: -1678.503 where: short stacking energy: -713.810 Base-Backbone interact. energy: -0.467 local terms energy: -806.893785 where: bonds (distance) C4'-P energy: -166.040 bonds (distance) P-C4' energy: -168.249 flat angles C4'-P-C4' energy: -166.210 flat angles P-C4'-P energy: -123.301 tors. eta vs tors. theta energy: -183.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -2287.243909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2287.243909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2287.243909 (E_RNA) where: Base-Base interactions energy: -1533.055 where: short stacking energy: -671.828 Base-Backbone interact. energy: -0.179 local terms energy: -754.009094 where: bonds (distance) C4'-P energy: -164.778 bonds (distance) P-C4' energy: -170.743 flat angles C4'-P-C4' energy: -173.008 flat angles P-C4'-P energy: -95.006 tors. eta vs tors. theta energy: -150.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -2176.330767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2176.330767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.330767 (E_RNA) where: Base-Base interactions energy: -1433.914 where: short stacking energy: -655.333 Base-Backbone interact. energy: -4.296 local terms energy: -738.121381 where: bonds (distance) C4'-P energy: -140.374 bonds (distance) P-C4' energy: -161.077 flat angles C4'-P-C4' energy: -184.279 flat angles P-C4'-P energy: -102.904 tors. eta vs tors. theta energy: -149.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -1580.603327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1580.603327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1580.603327 (E_RNA) where: Base-Base interactions energy: -927.669 where: short stacking energy: -473.087 Base-Backbone interact. energy: -1.564 local terms energy: -651.370967 where: bonds (distance) C4'-P energy: -142.359 bonds (distance) P-C4' energy: -174.135 flat angles C4'-P-C4' energy: -159.546 flat angles P-C4'-P energy: -88.830 tors. eta vs tors. theta energy: -86.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -1352.787261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.787261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.787261 (E_RNA) where: Base-Base interactions energy: -768.185 where: short stacking energy: -372.957 Base-Backbone interact. energy: -2.277 local terms energy: -582.325254 where: bonds (distance) C4'-P energy: -159.994 bonds (distance) P-C4' energy: -156.520 flat angles C4'-P-C4' energy: -157.365 flat angles P-C4'-P energy: -88.081 tors. eta vs tors. theta energy: -20.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -998.666624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.666624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.666624 (E_RNA) where: Base-Base interactions energy: -510.739 where: short stacking energy: -300.764 Base-Backbone interact. energy: 0.426 local terms energy: -488.354031 where: bonds (distance) C4'-P energy: -125.194 bonds (distance) P-C4' energy: -136.338 flat angles C4'-P-C4' energy: -135.772 flat angles P-C4'-P energy: -93.938 tors. eta vs tors. theta energy: 2.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 7 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 48575463 moves confirmed later: 57331753 all moves confirmed: 105907216 percent of confirmed moves: 66.192010 current total energy: -3038.570311 recalc. total energy: -3038.570311 replica 1 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 38632452 moves confirmed later: 43569431 all moves confirmed: 82201883 percent of confirmed moves: 51.376177 current total energy: -2834.190250 recalc. total energy: -2834.190250 replica 8 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 37828224 moves confirmed later: 42958709 all moves confirmed: 80786933 percent of confirmed moves: 50.491833 current total energy: -2717.297492 recalc. total energy: -2717.297492 replica 3 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 38383885 moves confirmed later: 43378659 all moves confirmed: 81762544 percent of confirmed moves: 51.101590 current total energy: -2510.335425 recalc. total energy: -2510.335425 replica 9 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 50393539 moves confirmed later: 59763595 all moves confirmed: 110157134 percent of confirmed moves: 68.848209 current total energy: -2375.459951 recalc. total energy: -2375.459951 replica 5 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 40606345 moves confirmed later: 46472329 all moves confirmed: 87078674 percent of confirmed moves: 54.424171 current total energy: -2103.509504 recalc. total energy: -2103.509504 replica 10 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 61314973 moves confirmed later: 73943577 all moves confirmed: 135258550 percent of confirmed moves: 84.536594 current total energy: -1945.746904 recalc. total energy: -1945.746904 replica 2 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 43359871 moves confirmed later: 49863759 all moves confirmed: 93223630 percent of confirmed moves: 58.264769 current total energy: -1338.195857 recalc. total energy: -1338.195857 replica 4 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 53693456 moves confirmed later: 63627188 all moves confirmed: 117320644 percent of confirmed moves: 73.325402 current total energy: -1179.944233 recalc. total energy: -1179.944233 replica 6 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 62297727 moves confirmed later: 75189938 all moves confirmed: 137487665 percent of confirmed moves: 85.929791 current total energy: -749.440907 recalc. total energy: -749.440907 out arg RESULTS//1/MCL-1-delta301-601-61bb83c1_01 Time of doing 1600000 iterations: 7955.725 seconds