SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta248-495-1df9302c/inputs/seq.fa: 1 curr_seq: _GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCGCCGAGGUCCCCGACGUCACCGCGACCCCCGCGAGGCUGCUUUUCUUCGCGCCCACCCGCCGCGCGGCGCCGCUUGAGGAGAUGGAAGCCCCGGCCGCUGACGCCAUCAUGUCGCCCGAAGAGGAGCUGGACGGGUACGAGCCGGAGCCUCUCGGGAAGCGGCCGGCUGUCCUGCCGCUGCUGGAGUUGGUCGGGGAAUCUGGUAAUAACACCAGUACGGACGGGUCACUACCCUCGACGCCGCC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 247 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1240 n_atoms_counter: 1240 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 247.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -1009.667040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.667040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.667040 (E_RNA) where: Base-Base interactions energy: -48.388 where: short stacking energy: -48.388 Base-Backbone interact. energy: -0.000 local terms energy: -961.278512 where: bonds (distance) C4'-P energy: -239.980 bonds (distance) P-C4' energy: -221.874 flat angles C4'-P-C4' energy: -181.354 flat angles P-C4'-P energy: -207.449 tors. eta vs tors. theta energy: -110.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1253.664355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.664355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.664355 (E_RNA) where: Base-Base interactions energy: -556.119 where: short stacking energy: -550.373 Base-Backbone interact. energy: -0.154 local terms energy: -697.391882 where: bonds (distance) C4'-P energy: -146.408 bonds (distance) P-C4' energy: -162.688 flat angles C4'-P-C4' energy: -169.456 flat angles P-C4'-P energy: -98.667 tors. eta vs tors. theta energy: -120.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1154.282095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.282095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.282095 (E_RNA) where: Base-Base interactions energy: -507.421 where: short stacking energy: -489.582 Base-Backbone interact. energy: -0.282 local terms energy: -646.579073 where: bonds (distance) C4'-P energy: -150.469 bonds (distance) P-C4' energy: -147.146 flat angles C4'-P-C4' energy: -148.908 flat angles P-C4'-P energy: -91.749 tors. eta vs tors. theta energy: -108.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1112.069508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.069508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1112.069508 (E_RNA) where: Base-Base interactions energy: -461.936 where: short stacking energy: -452.649 Base-Backbone interact. energy: 0.446 local terms energy: -650.579668 where: bonds (distance) C4'-P energy: -159.652 bonds (distance) P-C4' energy: -152.567 flat angles C4'-P-C4' energy: -143.510 flat angles P-C4'-P energy: -91.477 tors. eta vs tors. theta energy: -103.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1046.115660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.115660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.115660 (E_RNA) where: Base-Base interactions energy: -466.334 where: short stacking energy: -458.549 Base-Backbone interact. energy: 0.001 local terms energy: -579.782926 where: bonds (distance) C4'-P energy: -141.548 bonds (distance) P-C4' energy: -146.268 flat angles C4'-P-C4' energy: -126.357 flat angles P-C4'-P energy: -62.717 tors. eta vs tors. theta energy: -102.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1011.713394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.713394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.713394 (E_RNA) where: Base-Base interactions energy: -52.854 where: short stacking energy: -52.854 Base-Backbone interact. energy: -0.000 local terms energy: -958.858964 where: bonds (distance) C4'-P energy: -239.748 bonds (distance) P-C4' energy: -219.838 flat angles C4'-P-C4' energy: -181.093 flat angles P-C4'-P energy: -207.140 tors. eta vs tors. theta energy: -111.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1013.752819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.752819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.752819 (E_RNA) where: Base-Base interactions energy: -174.068 where: short stacking energy: -174.068 Base-Backbone interact. energy: -0.000 local terms energy: -839.684429 where: bonds (distance) C4'-P energy: -178.688 bonds (distance) P-C4' energy: -168.203 flat angles C4'-P-C4' energy: -184.510 flat angles P-C4'-P energy: -187.621 tors. eta vs tors. theta energy: -120.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -1011.218929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.218929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.218929 (E_RNA) where: Base-Base interactions energy: -52.853 where: short stacking energy: -52.853 Base-Backbone interact. energy: -0.000 local terms energy: -958.365407 where: bonds (distance) C4'-P energy: -239.748 bonds (distance) P-C4' energy: -219.838 flat angles C4'-P-C4' energy: -180.804 flat angles P-C4'-P energy: -207.093 tors. eta vs tors. theta energy: -110.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -1013.876680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1013.876680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1013.876680 (E_RNA) where: Base-Base interactions energy: -89.135 where: short stacking energy: -89.135 Base-Backbone interact. energy: -0.000 local terms energy: -924.741089 where: bonds (distance) C4'-P energy: -225.983 bonds (distance) P-C4' energy: -195.871 flat angles C4'-P-C4' energy: -184.406 flat angles P-C4'-P energy: -201.394 tors. eta vs tors. theta energy: -117.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -1018.018372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.018372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.018372 (E_RNA) where: Base-Base interactions energy: -140.147 where: short stacking energy: -140.147 Base-Backbone interact. energy: -0.000 local terms energy: -877.870769 where: bonds (distance) C4'-P energy: -199.139 bonds (distance) P-C4' energy: -182.747 flat angles C4'-P-C4' energy: -183.159 flat angles P-C4'-P energy: -193.155 tors. eta vs tors. theta energy: -119.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -1011.646491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.646491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.646491 (E_RNA) where: Base-Base interactions energy: -52.851 where: short stacking energy: -52.851 Base-Backbone interact. energy: -0.000 local terms energy: -958.794873 where: bonds (distance) C4'-P energy: -239.748 bonds (distance) P-C4' energy: -219.845 flat angles C4'-P-C4' energy: -180.999 flat angles P-C4'-P energy: -207.271 tors. eta vs tors. theta energy: -110.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1342.817290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.817290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.817290 (E_RNA) where: Base-Base interactions energy: -599.192 where: short stacking energy: -597.389 Base-Backbone interact. energy: -0.466 local terms energy: -743.159530 where: bonds (distance) C4'-P energy: -165.808 bonds (distance) P-C4' energy: -164.511 flat angles C4'-P-C4' energy: -163.286 flat angles P-C4'-P energy: -99.103 tors. eta vs tors. theta energy: -150.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1196.088346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.088346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.088346 (E_RNA) where: Base-Base interactions energy: -502.576 where: short stacking energy: -498.546 Base-Backbone interact. energy: -0.788 local terms energy: -692.725070 where: bonds (distance) C4'-P energy: -154.586 bonds (distance) P-C4' energy: -158.140 flat angles C4'-P-C4' energy: -153.137 flat angles P-C4'-P energy: -104.646 tors. eta vs tors. theta energy: -122.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1126.088578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.088578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.088578 (E_RNA) where: Base-Base interactions energy: -514.361 where: short stacking energy: -477.983 Base-Backbone interact. energy: -1.538 local terms energy: -610.189819 where: bonds (distance) C4'-P energy: -153.015 bonds (distance) P-C4' energy: -141.187 flat angles C4'-P-C4' energy: -149.341 flat angles P-C4'-P energy: -67.874 tors. eta vs tors. theta energy: -98.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1087.945300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1087.945300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1087.945300 (E_RNA) where: Base-Base interactions energy: -466.999 where: short stacking energy: -462.015 Base-Backbone interact. energy: -2.150 local terms energy: -618.795905 where: bonds (distance) C4'-P energy: -161.480 bonds (distance) P-C4' energy: -114.091 flat angles C4'-P-C4' energy: -140.749 flat angles P-C4'-P energy: -102.711 tors. eta vs tors. theta energy: -99.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -963.515153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.515153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.515153 (E_RNA) where: Base-Base interactions energy: -417.211 where: short stacking energy: -380.846 Base-Backbone interact. energy: -1.607 local terms energy: -544.697387 where: bonds (distance) C4'-P energy: -107.452 bonds (distance) P-C4' energy: -130.246 flat angles C4'-P-C4' energy: -147.642 flat angles P-C4'-P energy: -85.260 tors. eta vs tors. theta energy: -74.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -884.676840 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.676840 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.676840 (E_RNA) where: Base-Base interactions energy: -351.598 where: short stacking energy: -310.030 Base-Backbone interact. energy: 0.792 local terms energy: -533.870498 where: bonds (distance) C4'-P energy: -139.210 bonds (distance) P-C4' energy: -147.615 flat angles C4'-P-C4' energy: -114.196 flat angles P-C4'-P energy: -71.203 tors. eta vs tors. theta energy: -61.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -794.623941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.623941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.623941 (E_RNA) where: Base-Base interactions energy: -293.184 where: short stacking energy: -287.962 Base-Backbone interact. energy: 6.303 local terms energy: -507.742189 where: bonds (distance) C4'-P energy: -138.251 bonds (distance) P-C4' energy: -137.358 flat angles C4'-P-C4' energy: -133.834 flat angles P-C4'-P energy: -68.922 tors. eta vs tors. theta energy: -29.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -707.877470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -707.877470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -707.877470 (E_RNA) where: Base-Base interactions energy: -245.744 where: short stacking energy: -237.638 Base-Backbone interact. energy: -1.765 local terms energy: -460.368405 where: bonds (distance) C4'-P energy: -132.226 bonds (distance) P-C4' energy: -141.301 flat angles C4'-P-C4' energy: -119.076 flat angles P-C4'-P energy: -56.408 tors. eta vs tors. theta energy: -11.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -687.602152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.602152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.602152 (E_RNA) where: Base-Base interactions energy: -287.391 where: short stacking energy: -256.532 Base-Backbone interact. energy: -0.916 local terms energy: -399.295893 where: bonds (distance) C4'-P energy: -137.770 bonds (distance) P-C4' energy: -124.955 flat angles C4'-P-C4' energy: -81.792 flat angles P-C4'-P energy: -49.673 tors. eta vs tors. theta energy: -5.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -648.485439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -648.485439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -648.485439 (E_RNA) where: Base-Base interactions energy: -224.457 where: short stacking energy: -190.839 Base-Backbone interact. energy: 0.968 local terms energy: -424.996294 where: bonds (distance) C4'-P energy: -138.269 bonds (distance) P-C4' energy: -127.140 flat angles C4'-P-C4' energy: -109.783 flat angles P-C4'-P energy: -54.837 tors. eta vs tors. theta energy: 5.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1355.958869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.958869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.958869 (E_RNA) where: Base-Base interactions energy: -590.830 where: short stacking energy: -586.988 Base-Backbone interact. energy: -0.255 local terms energy: -764.873764 where: bonds (distance) C4'-P energy: -168.891 bonds (distance) P-C4' energy: -165.251 flat angles C4'-P-C4' energy: -152.406 flat angles P-C4'-P energy: -115.666 tors. eta vs tors. theta energy: -162.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1240.982615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1240.982615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.982615 (E_RNA) where: Base-Base interactions energy: -540.783 where: short stacking energy: -537.200 Base-Backbone interact. energy: -0.357 local terms energy: -699.842396 where: bonds (distance) C4'-P energy: -160.994 bonds (distance) P-C4' energy: -151.614 flat angles C4'-P-C4' energy: -160.150 flat angles P-C4'-P energy: -102.490 tors. eta vs tors. theta energy: -124.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1201.486136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.486136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1201.486136 (E_RNA) where: Base-Base interactions energy: -541.958 where: short stacking energy: -521.080 Base-Backbone interact. energy: 0.904 local terms energy: -660.432635 where: bonds (distance) C4'-P energy: -139.263 bonds (distance) P-C4' energy: -162.023 flat angles C4'-P-C4' energy: -137.822 flat angles P-C4'-P energy: -91.649 tors. eta vs tors. theta energy: -129.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1102.508587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.508587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.508587 (E_RNA) where: Base-Base interactions energy: -515.163 where: short stacking energy: -456.796 Base-Backbone interact. energy: 0.692 local terms energy: -588.037237 where: bonds (distance) C4'-P energy: -142.279 bonds (distance) P-C4' energy: -126.577 flat angles C4'-P-C4' energy: -132.470 flat angles P-C4'-P energy: -99.061 tors. eta vs tors. theta energy: -87.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -963.538393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.538393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.538393 (E_RNA) where: Base-Base interactions energy: -445.568 where: short stacking energy: -410.286 Base-Backbone interact. energy: -0.651 local terms energy: -517.320040 where: bonds (distance) C4'-P energy: -126.915 bonds (distance) P-C4' energy: -135.332 flat angles C4'-P-C4' energy: -122.447 flat angles P-C4'-P energy: -78.123 tors. eta vs tors. theta energy: -54.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -960.644240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.644240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.644240 (E_RNA) where: Base-Base interactions energy: -422.875 where: short stacking energy: -352.939 Base-Backbone interact. energy: -4.345 local terms energy: -533.423823 where: bonds (distance) C4'-P energy: -112.909 bonds (distance) P-C4' energy: -140.532 flat angles C4'-P-C4' energy: -122.935 flat angles P-C4'-P energy: -90.100 tors. eta vs tors. theta energy: -66.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -867.107982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.107982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.107982 (E_RNA) where: Base-Base interactions energy: -368.936 where: short stacking energy: -288.664 Base-Backbone interact. energy: -1.675 local terms energy: -496.497371 where: bonds (distance) C4'-P energy: -129.252 bonds (distance) P-C4' energy: -138.623 flat angles C4'-P-C4' energy: -133.384 flat angles P-C4'-P energy: -58.767 tors. eta vs tors. theta energy: -36.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -776.688910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.688910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.688910 (E_RNA) where: Base-Base interactions energy: -346.811 where: short stacking energy: -274.227 Base-Backbone interact. energy: 0.141 local terms energy: -430.018545 where: bonds (distance) C4'-P energy: -109.087 bonds (distance) P-C4' energy: -140.393 flat angles C4'-P-C4' energy: -99.518 flat angles P-C4'-P energy: -77.667 tors. eta vs tors. theta energy: -3.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -666.416492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.416492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.416492 (E_RNA) where: Base-Base interactions energy: -259.372 where: short stacking energy: -208.010 Base-Backbone interact. energy: 4.233 local terms energy: -411.277250 where: bonds (distance) C4'-P energy: -127.193 bonds (distance) P-C4' energy: -119.828 flat angles C4'-P-C4' energy: -118.095 flat angles P-C4'-P energy: -37.525 tors. eta vs tors. theta energy: -8.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -636.067453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.067453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.067453 (E_RNA) where: Base-Base interactions energy: -248.338 where: short stacking energy: -201.988 Base-Backbone interact. energy: 0.344 local terms energy: -388.073574 where: bonds (distance) C4'-P energy: -115.289 bonds (distance) P-C4' energy: -131.539 flat angles C4'-P-C4' energy: -121.117 flat angles P-C4'-P energy: -28.266 tors. eta vs tors. theta energy: 8.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1350.747104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.747104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.747104 (E_RNA) where: Base-Base interactions energy: -646.037 where: short stacking energy: -597.052 Base-Backbone interact. energy: -0.004 local terms energy: -704.705511 where: bonds (distance) C4'-P energy: -154.560 bonds (distance) P-C4' energy: -146.290 flat angles C4'-P-C4' energy: -150.833 flat angles P-C4'-P energy: -104.955 tors. eta vs tors. theta energy: -148.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1278.821602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.821602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.821602 (E_RNA) where: Base-Base interactions energy: -578.229 where: short stacking energy: -554.561 Base-Backbone interact. energy: 0.036 local terms energy: -700.628628 where: bonds (distance) C4'-P energy: -149.031 bonds (distance) P-C4' energy: -163.521 flat angles C4'-P-C4' energy: -164.384 flat angles P-C4'-P energy: -84.796 tors. eta vs tors. theta energy: -138.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1179.086199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1179.086199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1179.086199 (E_RNA) where: Base-Base interactions energy: -556.928 where: short stacking energy: -478.286 Base-Backbone interact. energy: -2.776 local terms energy: -619.381865 where: bonds (distance) C4'-P energy: -143.383 bonds (distance) P-C4' energy: -142.117 flat angles C4'-P-C4' energy: -143.970 flat angles P-C4'-P energy: -94.171 tors. eta vs tors. theta energy: -95.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1093.550473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.550473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1093.550473 (E_RNA) where: Base-Base interactions energy: -501.535 where: short stacking energy: -420.860 Base-Backbone interact. energy: 0.430 local terms energy: -592.445432 where: bonds (distance) C4'-P energy: -139.852 bonds (distance) P-C4' energy: -142.280 flat angles C4'-P-C4' energy: -138.939 flat angles P-C4'-P energy: -80.002 tors. eta vs tors. theta energy: -91.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1059.186602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.186602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.186602 (E_RNA) where: Base-Base interactions energy: -518.787 where: short stacking energy: -422.353 Base-Backbone interact. energy: -0.167 local terms energy: -540.233237 where: bonds (distance) C4'-P energy: -114.946 bonds (distance) P-C4' energy: -149.491 flat angles C4'-P-C4' energy: -120.315 flat angles P-C4'-P energy: -84.707 tors. eta vs tors. theta energy: -70.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1010.326249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.326249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.326249 (E_RNA) where: Base-Base interactions energy: -517.293 where: short stacking energy: -350.116 Base-Backbone interact. energy: 2.281 local terms energy: -495.314425 where: bonds (distance) C4'-P energy: -126.196 bonds (distance) P-C4' energy: -135.322 flat angles C4'-P-C4' energy: -121.503 flat angles P-C4'-P energy: -74.087 tors. eta vs tors. theta energy: -38.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -863.834728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.834728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.834728 (E_RNA) where: Base-Base interactions energy: -372.610 where: short stacking energy: -257.061 Base-Backbone interact. energy: 4.800 local terms energy: -496.024923 where: bonds (distance) C4'-P energy: -142.815 bonds (distance) P-C4' energy: -145.082 flat angles C4'-P-C4' energy: -112.086 flat angles P-C4'-P energy: -76.394 tors. eta vs tors. theta energy: -19.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -746.057551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.057551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.057551 (E_RNA) where: Base-Base interactions energy: -280.802 where: short stacking energy: -217.555 Base-Backbone interact. energy: -1.074 local terms energy: -464.180967 where: bonds (distance) C4'-P energy: -117.050 bonds (distance) P-C4' energy: -143.874 flat angles C4'-P-C4' energy: -115.633 flat angles P-C4'-P energy: -75.757 tors. eta vs tors. theta energy: -11.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -689.191079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -689.191079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -689.191079 (E_RNA) where: Base-Base interactions energy: -286.122 where: short stacking energy: -208.630 Base-Backbone interact. energy: -0.624 local terms energy: -402.445068 where: bonds (distance) C4'-P energy: -122.580 bonds (distance) P-C4' energy: -144.980 flat angles C4'-P-C4' energy: -100.688 flat angles P-C4'-P energy: -47.836 tors. eta vs tors. theta energy: 13.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -616.950106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.950106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.950106 (E_RNA) where: Base-Base interactions energy: -222.164 where: short stacking energy: -193.035 Base-Backbone interact. energy: 8.141 local terms energy: -402.927065 where: bonds (distance) C4'-P energy: -121.657 bonds (distance) P-C4' energy: -123.171 flat angles C4'-P-C4' energy: -100.289 flat angles P-C4'-P energy: -69.082 tors. eta vs tors. theta energy: 11.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1416.675387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.675387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.675387 (E_RNA) where: Base-Base interactions energy: -670.754 where: short stacking energy: -619.772 Base-Backbone interact. energy: -0.630 local terms energy: -745.291250 where: bonds (distance) C4'-P energy: -153.245 bonds (distance) P-C4' energy: -148.407 flat angles C4'-P-C4' energy: -170.365 flat angles P-C4'-P energy: -103.614 tors. eta vs tors. theta energy: -169.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1309.348625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.348625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.348625 (E_RNA) where: Base-Base interactions energy: -625.757 where: short stacking energy: -582.630 Base-Backbone interact. energy: -0.654 local terms energy: -682.937573 where: bonds (distance) C4'-P energy: -151.819 bonds (distance) P-C4' energy: -154.487 flat angles C4'-P-C4' energy: -148.530 flat angles P-C4'-P energy: -97.545 tors. eta vs tors. theta energy: -130.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1198.244117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.244117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.244117 (E_RNA) where: Base-Base interactions energy: -583.724 where: short stacking energy: -464.434 Base-Backbone interact. energy: -2.841 local terms energy: -611.679223 where: bonds (distance) C4'-P energy: -156.206 bonds (distance) P-C4' energy: -138.713 flat angles C4'-P-C4' energy: -136.980 flat angles P-C4'-P energy: -91.769 tors. eta vs tors. theta energy: -88.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1079.851565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1079.851565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1079.851565 (E_RNA) where: Base-Base interactions energy: -491.296 where: short stacking energy: -416.658 Base-Backbone interact. energy: -1.215 local terms energy: -587.341184 where: bonds (distance) C4'-P energy: -119.830 bonds (distance) P-C4' energy: -155.441 flat angles C4'-P-C4' energy: -156.166 flat angles P-C4'-P energy: -71.706 tors. eta vs tors. theta energy: -84.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1196.934799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.934799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.934799 (E_RNA) where: Base-Base interactions energy: -646.986 where: short stacking energy: -373.810 Base-Backbone interact. energy: 0.005 local terms energy: -549.953357 where: bonds (distance) C4'-P energy: -144.756 bonds (distance) P-C4' energy: -127.130 flat angles C4'-P-C4' energy: -140.757 flat angles P-C4'-P energy: -80.071 tors. eta vs tors. theta energy: -57.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -979.989239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -979.989239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -979.989239 (E_RNA) where: Base-Base interactions energy: -436.028 where: short stacking energy: -330.590 Base-Backbone interact. energy: 7.277 local terms energy: -551.238146 where: bonds (distance) C4'-P energy: -136.237 bonds (distance) P-C4' energy: -140.216 flat angles C4'-P-C4' energy: -128.583 flat angles P-C4'-P energy: -97.016 tors. eta vs tors. theta energy: -49.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -916.694365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.694365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.694365 (E_RNA) where: Base-Base interactions energy: -418.550 where: short stacking energy: -299.869 Base-Backbone interact. energy: -0.229 local terms energy: -497.915333 where: bonds (distance) C4'-P energy: -126.082 bonds (distance) P-C4' energy: -147.913 flat angles C4'-P-C4' energy: -115.999 flat angles P-C4'-P energy: -82.644 tors. eta vs tors. theta energy: -25.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -771.396425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.396425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.396425 (E_RNA) where: Base-Base interactions energy: -351.244 where: short stacking energy: -259.031 Base-Backbone interact. energy: 2.774 local terms energy: -422.926506 where: bonds (distance) C4'-P energy: -138.768 bonds (distance) P-C4' energy: -119.405 flat angles C4'-P-C4' energy: -100.733 flat angles P-C4'-P energy: -79.327 tors. eta vs tors. theta energy: 15.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -794.630407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.630407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.630407 (E_RNA) where: Base-Base interactions energy: -280.791 where: short stacking energy: -251.594 Base-Backbone interact. energy: -2.439 local terms energy: -511.400495 where: bonds (distance) C4'-P energy: -124.874 bonds (distance) P-C4' energy: -153.069 flat angles C4'-P-C4' energy: -115.820 flat angles P-C4'-P energy: -92.527 tors. eta vs tors. theta energy: -25.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -635.470392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.470392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.470392 (E_RNA) where: Base-Base interactions energy: -262.034 where: short stacking energy: -190.863 Base-Backbone interact. energy: 1.384 local terms energy: -374.820265 where: bonds (distance) C4'-P energy: -130.178 bonds (distance) P-C4' energy: -115.686 flat angles C4'-P-C4' energy: -110.031 flat angles P-C4'-P energy: -58.758 tors. eta vs tors. theta energy: 39.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1477.923315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.923315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.923315 (E_RNA) where: Base-Base interactions energy: -734.393 where: short stacking energy: -665.469 Base-Backbone interact. energy: -0.193 local terms energy: -743.337578 where: bonds (distance) C4'-P energy: -140.576 bonds (distance) P-C4' energy: -158.174 flat angles C4'-P-C4' energy: -157.395 flat angles P-C4'-P energy: -113.372 tors. eta vs tors. theta energy: -173.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1286.756817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.756817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.756817 (E_RNA) where: Base-Base interactions energy: -601.514 where: short stacking energy: -523.833 Base-Backbone interact. energy: -1.293 local terms energy: -683.950321 where: bonds (distance) C4'-P energy: -146.425 bonds (distance) P-C4' energy: -160.779 flat angles C4'-P-C4' energy: -157.331 flat angles P-C4'-P energy: -99.041 tors. eta vs tors. theta energy: -120.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1275.062118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1275.062118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1275.062118 (E_RNA) where: Base-Base interactions energy: -664.404 where: short stacking energy: -512.806 Base-Backbone interact. energy: 0.451 local terms energy: -611.109283 where: bonds (distance) C4'-P energy: -136.530 bonds (distance) P-C4' energy: -148.627 flat angles C4'-P-C4' energy: -147.177 flat angles P-C4'-P energy: -83.405 tors. eta vs tors. theta energy: -95.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1370.890621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.890621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.890621 (E_RNA) where: Base-Base interactions energy: -770.785 where: short stacking energy: -460.952 Base-Backbone interact. energy: -2.069 local terms energy: -598.036707 where: bonds (distance) C4'-P energy: -146.067 bonds (distance) P-C4' energy: -124.248 flat angles C4'-P-C4' energy: -146.039 flat angles P-C4'-P energy: -95.546 tors. eta vs tors. theta energy: -86.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1055.542107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.542107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.542107 (E_RNA) where: Base-Base interactions energy: -522.387 where: short stacking energy: -384.491 Base-Backbone interact. energy: -1.775 local terms energy: -531.380521 where: bonds (distance) C4'-P energy: -108.388 bonds (distance) P-C4' energy: -136.910 flat angles C4'-P-C4' energy: -124.756 flat angles P-C4'-P energy: -97.936 tors. eta vs tors. theta energy: -63.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1182.748085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.748085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.748085 (E_RNA) where: Base-Base interactions energy: -650.442 where: short stacking energy: -411.408 Base-Backbone interact. energy: 1.378 local terms energy: -533.683386 where: bonds (distance) C4'-P energy: -124.640 bonds (distance) P-C4' energy: -135.363 flat angles C4'-P-C4' energy: -120.296 flat angles P-C4'-P energy: -82.570 tors. eta vs tors. theta energy: -70.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -907.677858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.677858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.677858 (E_RNA) where: Base-Base interactions energy: -412.374 where: short stacking energy: -300.756 Base-Backbone interact. energy: 2.260 local terms energy: -497.563748 where: bonds (distance) C4'-P energy: -119.308 bonds (distance) P-C4' energy: -150.438 flat angles C4'-P-C4' energy: -129.150 flat angles P-C4'-P energy: -73.569 tors. eta vs tors. theta energy: -25.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -897.606077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.606077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.606077 (E_RNA) where: Base-Base interactions energy: -443.280 where: short stacking energy: -293.289 Base-Backbone interact. energy: 2.027 local terms energy: -456.352332 where: bonds (distance) C4'-P energy: -133.553 bonds (distance) P-C4' energy: -115.971 flat angles C4'-P-C4' energy: -121.862 flat angles P-C4'-P energy: -74.350 tors. eta vs tors. theta energy: -10.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -785.098202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.098202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.098202 (E_RNA) where: Base-Base interactions energy: -371.988 where: short stacking energy: -238.921 Base-Backbone interact. energy: -3.007 local terms energy: -410.103004 where: bonds (distance) C4'-P energy: -116.704 bonds (distance) P-C4' energy: -118.150 flat angles C4'-P-C4' energy: -114.839 flat angles P-C4'-P energy: -64.014 tors. eta vs tors. theta energy: 3.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -610.520117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.520117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -610.520117 (E_RNA) where: Base-Base interactions energy: -226.462 where: short stacking energy: -173.052 Base-Backbone interact. energy: 1.893 local terms energy: -385.950749 where: bonds (distance) C4'-P energy: -115.680 bonds (distance) P-C4' energy: -120.159 flat angles C4'-P-C4' energy: -91.623 flat angles P-C4'-P energy: -68.132 tors. eta vs tors. theta energy: 9.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1511.006222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.006222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.006222 (E_RNA) where: Base-Base interactions energy: -741.075 where: short stacking energy: -665.056 Base-Backbone interact. energy: 0.767 local terms energy: -770.698104 where: bonds (distance) C4'-P energy: -142.196 bonds (distance) P-C4' energy: -171.148 flat angles C4'-P-C4' energy: -176.622 flat angles P-C4'-P energy: -103.213 tors. eta vs tors. theta energy: -177.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1376.499693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.499693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.499693 (E_RNA) where: Base-Base interactions energy: -691.819 where: short stacking energy: -551.891 Base-Backbone interact. energy: -1.631 local terms energy: -683.050078 where: bonds (distance) C4'-P energy: -149.452 bonds (distance) P-C4' energy: -153.309 flat angles C4'-P-C4' energy: -154.031 flat angles P-C4'-P energy: -99.351 tors. eta vs tors. theta energy: -126.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1491.225876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.225876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.225876 (E_RNA) where: Base-Base interactions energy: -853.168 where: short stacking energy: -499.132 Base-Backbone interact. energy: -3.749 local terms energy: -634.309092 where: bonds (distance) C4'-P energy: -143.288 bonds (distance) P-C4' energy: -136.191 flat angles C4'-P-C4' energy: -155.734 flat angles P-C4'-P energy: -101.339 tors. eta vs tors. theta energy: -97.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1250.947154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.947154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.947154 (E_RNA) where: Base-Base interactions energy: -666.208 where: short stacking energy: -434.109 Base-Backbone interact. energy: -0.488 local terms energy: -584.251125 where: bonds (distance) C4'-P energy: -132.716 bonds (distance) P-C4' energy: -152.217 flat angles C4'-P-C4' energy: -143.150 flat angles P-C4'-P energy: -82.386 tors. eta vs tors. theta energy: -73.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1296.102121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.102121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.102121 (E_RNA) where: Base-Base interactions energy: -693.996 where: short stacking energy: -447.929 Base-Backbone interact. energy: -1.059 local terms energy: -601.047307 where: bonds (distance) C4'-P energy: -131.617 bonds (distance) P-C4' energy: -133.946 flat angles C4'-P-C4' energy: -162.156 flat angles P-C4'-P energy: -79.915 tors. eta vs tors. theta energy: -93.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1021.278868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.278868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.278868 (E_RNA) where: Base-Base interactions energy: -531.056 where: short stacking energy: -390.750 Base-Backbone interact. energy: -3.246 local terms energy: -486.976522 where: bonds (distance) C4'-P energy: -128.140 bonds (distance) P-C4' energy: -120.228 flat angles C4'-P-C4' energy: -116.521 flat angles P-C4'-P energy: -71.038 tors. eta vs tors. theta energy: -51.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1019.769987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.769987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.769987 (E_RNA) where: Base-Base interactions energy: -514.482 where: short stacking energy: -335.100 Base-Backbone interact. energy: 3.021 local terms energy: -508.308815 where: bonds (distance) C4'-P energy: -125.510 bonds (distance) P-C4' energy: -142.251 flat angles C4'-P-C4' energy: -136.133 flat angles P-C4'-P energy: -62.667 tors. eta vs tors. theta energy: -41.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -800.674019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.674019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.674019 (E_RNA) where: Base-Base interactions energy: -342.828 where: short stacking energy: -270.636 Base-Backbone interact. energy: 2.083 local terms energy: -459.929184 where: bonds (distance) C4'-P energy: -115.105 bonds (distance) P-C4' energy: -137.792 flat angles C4'-P-C4' energy: -105.508 flat angles P-C4'-P energy: -77.642 tors. eta vs tors. theta energy: -23.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -818.816517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.816517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.816517 (E_RNA) where: Base-Base interactions energy: -399.518 where: short stacking energy: -273.704 Base-Backbone interact. energy: 2.603 local terms energy: -421.901458 where: bonds (distance) C4'-P energy: -116.108 bonds (distance) P-C4' energy: -130.403 flat angles C4'-P-C4' energy: -94.876 flat angles P-C4'-P energy: -72.791 tors. eta vs tors. theta energy: -7.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -699.784166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -699.784166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -699.784166 (E_RNA) where: Base-Base interactions energy: -310.726 where: short stacking energy: -203.107 Base-Backbone interact. energy: 6.336 local terms energy: -395.395002 where: bonds (distance) C4'-P energy: -121.300 bonds (distance) P-C4' energy: -121.085 flat angles C4'-P-C4' energy: -110.312 flat angles P-C4'-P energy: -60.218 tors. eta vs tors. theta energy: 17.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1511.281627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.281627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.281627 (E_RNA) where: Base-Base interactions energy: -781.909 where: short stacking energy: -637.440 Base-Backbone interact. energy: -3.415 local terms energy: -725.958190 where: bonds (distance) C4'-P energy: -159.124 bonds (distance) P-C4' energy: -144.128 flat angles C4'-P-C4' energy: -171.907 flat angles P-C4'-P energy: -100.127 tors. eta vs tors. theta energy: -150.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1734.555604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.555604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.555604 (E_RNA) where: Base-Base interactions energy: -1064.050 where: short stacking energy: -564.400 Base-Backbone interact. energy: -3.075 local terms energy: -667.430346 where: bonds (distance) C4'-P energy: -142.060 bonds (distance) P-C4' energy: -161.873 flat angles C4'-P-C4' energy: -150.359 flat angles P-C4'-P energy: -92.446 tors. eta vs tors. theta energy: -120.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1282.926594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.926594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.926594 (E_RNA) where: Base-Base interactions energy: -665.433 where: short stacking energy: -494.439 Base-Backbone interact. energy: -1.070 local terms energy: -616.423414 where: bonds (distance) C4'-P energy: -133.109 bonds (distance) P-C4' energy: -149.079 flat angles C4'-P-C4' energy: -135.823 flat angles P-C4'-P energy: -97.911 tors. eta vs tors. theta energy: -100.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1354.283707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.283707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.283707 (E_RNA) where: Base-Base interactions energy: -728.419 where: short stacking energy: -455.192 Base-Backbone interact. energy: -3.877 local terms energy: -621.987537 where: bonds (distance) C4'-P energy: -144.715 bonds (distance) P-C4' energy: -154.348 flat angles C4'-P-C4' energy: -158.698 flat angles P-C4'-P energy: -77.354 tors. eta vs tors. theta energy: -86.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1336.369118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1336.369118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1336.369118 (E_RNA) where: Base-Base interactions energy: -736.318 where: short stacking energy: -420.738 Base-Backbone interact. energy: -1.142 local terms energy: -598.909439 where: bonds (distance) C4'-P energy: -144.978 bonds (distance) P-C4' energy: -139.435 flat angles C4'-P-C4' energy: -139.282 flat angles P-C4'-P energy: -101.566 tors. eta vs tors. theta energy: -73.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1274.004478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.004478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.004478 (E_RNA) where: Base-Base interactions energy: -701.435 where: short stacking energy: -384.666 Base-Backbone interact. energy: -0.916 local terms energy: -571.653498 where: bonds (distance) C4'-P energy: -152.383 bonds (distance) P-C4' energy: -153.415 flat angles C4'-P-C4' energy: -122.847 flat angles P-C4'-P energy: -80.683 tors. eta vs tors. theta energy: -62.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -942.980316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.980316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.980316 (E_RNA) where: Base-Base interactions energy: -453.692 where: short stacking energy: -301.222 Base-Backbone interact. energy: 4.056 local terms energy: -493.343502 where: bonds (distance) C4'-P energy: -144.155 bonds (distance) P-C4' energy: -131.407 flat angles C4'-P-C4' energy: -121.111 flat angles P-C4'-P energy: -65.479 tors. eta vs tors. theta energy: -31.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -841.974927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.974927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.974927 (E_RNA) where: Base-Base interactions energy: -373.644 where: short stacking energy: -281.248 Base-Backbone interact. energy: 1.329 local terms energy: -469.659786 where: bonds (distance) C4'-P energy: -118.660 bonds (distance) P-C4' energy: -134.204 flat angles C4'-P-C4' energy: -129.205 flat angles P-C4'-P energy: -71.219 tors. eta vs tors. theta energy: -16.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -765.223182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.223182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.223182 (E_RNA) where: Base-Base interactions energy: -345.322 where: short stacking energy: -232.530 Base-Backbone interact. energy: 2.232 local terms energy: -422.133131 where: bonds (distance) C4'-P energy: -113.802 bonds (distance) P-C4' energy: -139.016 flat angles C4'-P-C4' energy: -102.949 flat angles P-C4'-P energy: -72.033 tors. eta vs tors. theta energy: 5.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -637.085001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -637.085001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -637.085001 (E_RNA) where: Base-Base interactions energy: -269.996 where: short stacking energy: -203.014 Base-Backbone interact. energy: 5.475 local terms energy: -372.564180 where: bonds (distance) C4'-P energy: -107.830 bonds (distance) P-C4' energy: -119.458 flat angles C4'-P-C4' energy: -102.705 flat angles P-C4'-P energy: -75.276 tors. eta vs tors. theta energy: 32.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1858.775772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1858.775772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1858.775772 (E_RNA) where: Base-Base interactions energy: -1146.084 where: short stacking energy: -618.632 Base-Backbone interact. energy: 0.955 local terms energy: -713.647585 where: bonds (distance) C4'-P energy: -150.915 bonds (distance) P-C4' energy: -148.405 flat angles C4'-P-C4' energy: -161.003 flat angles P-C4'-P energy: -113.796 tors. eta vs tors. theta energy: -139.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1430.060998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1430.060998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1430.060998 (E_RNA) where: Base-Base interactions energy: -742.392 where: short stacking energy: -552.494 Base-Backbone interact. energy: -2.594 local terms energy: -685.074825 where: bonds (distance) C4'-P energy: -141.325 bonds (distance) P-C4' energy: -158.602 flat angles C4'-P-C4' energy: -153.670 flat angles P-C4'-P energy: -100.956 tors. eta vs tors. theta energy: -130.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1496.500794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.500794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.500794 (E_RNA) where: Base-Base interactions energy: -880.276 where: short stacking energy: -518.553 Base-Backbone interact. energy: -0.655 local terms energy: -615.570334 where: bonds (distance) C4'-P energy: -137.845 bonds (distance) P-C4' energy: -132.539 flat angles C4'-P-C4' energy: -141.412 flat angles P-C4'-P energy: -98.317 tors. eta vs tors. theta energy: -105.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1202.725306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1202.725306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1202.725306 (E_RNA) where: Base-Base interactions energy: -608.125 where: short stacking energy: -457.970 Base-Backbone interact. energy: -1.542 local terms energy: -593.057757 where: bonds (distance) C4'-P energy: -138.079 bonds (distance) P-C4' energy: -157.307 flat angles C4'-P-C4' energy: -149.367 flat angles P-C4'-P energy: -66.445 tors. eta vs tors. theta energy: -81.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1353.206594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1353.206594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1353.206594 (E_RNA) where: Base-Base interactions energy: -811.974 where: short stacking energy: -454.548 Base-Backbone interact. energy: -0.292 local terms energy: -540.940345 where: bonds (distance) C4'-P energy: -121.876 bonds (distance) P-C4' energy: -122.538 flat angles C4'-P-C4' energy: -144.932 flat angles P-C4'-P energy: -66.544 tors. eta vs tors. theta energy: -85.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1368.775832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.775832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.775832 (E_RNA) where: Base-Base interactions energy: -837.312 where: short stacking energy: -433.518 Base-Backbone interact. energy: -0.606 local terms energy: -530.857385 where: bonds (distance) C4'-P energy: -126.396 bonds (distance) P-C4' energy: -128.004 flat angles C4'-P-C4' energy: -131.449 flat angles P-C4'-P energy: -83.558 tors. eta vs tors. theta energy: -61.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -997.964805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.964805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.964805 (E_RNA) where: Base-Base interactions energy: -498.484 where: short stacking energy: -365.308 Base-Backbone interact. energy: -1.669 local terms energy: -497.811617 where: bonds (distance) C4'-P energy: -136.181 bonds (distance) P-C4' energy: -115.391 flat angles C4'-P-C4' energy: -119.018 flat angles P-C4'-P energy: -80.172 tors. eta vs tors. theta energy: -47.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -828.935345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.935345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.935345 (E_RNA) where: Base-Base interactions energy: -417.938 where: short stacking energy: -281.908 Base-Backbone interact. energy: 0.695 local terms energy: -411.692719 where: bonds (distance) C4'-P energy: -118.193 bonds (distance) P-C4' energy: -134.811 flat angles C4'-P-C4' energy: -85.285 flat angles P-C4'-P energy: -64.717 tors. eta vs tors. theta energy: -8.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -740.097188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.097188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.097188 (E_RNA) where: Base-Base interactions energy: -313.913 where: short stacking energy: -199.345 Base-Backbone interact. energy: 4.638 local terms energy: -430.822640 where: bonds (distance) C4'-P energy: -112.084 bonds (distance) P-C4' energy: -139.484 flat angles C4'-P-C4' energy: -134.724 flat angles P-C4'-P energy: -62.166 tors. eta vs tors. theta energy: 17.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -603.600325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.600325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.600325 (E_RNA) where: Base-Base interactions energy: -204.593 where: short stacking energy: -170.086 Base-Backbone interact. energy: -2.161 local terms energy: -396.846063 where: bonds (distance) C4'-P energy: -119.216 bonds (distance) P-C4' energy: -117.412 flat angles C4'-P-C4' energy: -113.585 flat angles P-C4'-P energy: -52.153 tors. eta vs tors. theta energy: 5.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1883.526479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1883.526479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1883.526479 (E_RNA) where: Base-Base interactions energy: -1151.309 where: short stacking energy: -606.950 Base-Backbone interact. energy: -2.399 local terms energy: -729.818807 where: bonds (distance) C4'-P energy: -155.085 bonds (distance) P-C4' energy: -163.402 flat angles C4'-P-C4' energy: -169.979 flat angles P-C4'-P energy: -98.404 tors. eta vs tors. theta energy: -142.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1656.498571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1656.498571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1656.498571 (E_RNA) where: Base-Base interactions energy: -974.644 where: short stacking energy: -577.687 Base-Backbone interact. energy: -3.463 local terms energy: -678.391277 where: bonds (distance) C4'-P energy: -145.864 bonds (distance) P-C4' energy: -160.362 flat angles C4'-P-C4' energy: -157.691 flat angles P-C4'-P energy: -93.790 tors. eta vs tors. theta energy: -120.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1465.398407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.398407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.398407 (E_RNA) where: Base-Base interactions energy: -807.356 where: short stacking energy: -498.282 Base-Backbone interact. energy: -5.427 local terms energy: -652.615700 where: bonds (distance) C4'-P energy: -135.311 bonds (distance) P-C4' energy: -154.603 flat angles C4'-P-C4' energy: -152.247 flat angles P-C4'-P energy: -101.734 tors. eta vs tors. theta energy: -108.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1471.220241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.220241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.220241 (E_RNA) where: Base-Base interactions energy: -857.427 where: short stacking energy: -483.918 Base-Backbone interact. energy: -6.088 local terms energy: -607.705399 where: bonds (distance) C4'-P energy: -136.664 bonds (distance) P-C4' energy: -162.181 flat angles C4'-P-C4' energy: -145.255 flat angles P-C4'-P energy: -78.161 tors. eta vs tors. theta energy: -85.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1191.886166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.886166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.886166 (E_RNA) where: Base-Base interactions energy: -597.872 where: short stacking energy: -412.610 Base-Backbone interact. energy: -3.188 local terms energy: -590.826485 where: bonds (distance) C4'-P energy: -122.659 bonds (distance) P-C4' energy: -165.137 flat angles C4'-P-C4' energy: -126.187 flat angles P-C4'-P energy: -89.385 tors. eta vs tors. theta energy: -87.458 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1443.355985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.355985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.355985 (E_RNA) where: Base-Base interactions energy: -870.174 where: short stacking energy: -457.241 Base-Backbone interact. energy: 1.180 local terms energy: -574.361692 where: bonds (distance) C4'-P energy: -130.884 bonds (distance) P-C4' energy: -134.565 flat angles C4'-P-C4' energy: -138.735 flat angles P-C4'-P energy: -82.818 tors. eta vs tors. theta energy: -87.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1027.399266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.399266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.399266 (E_RNA) where: Base-Base interactions energy: -522.782 where: short stacking energy: -304.539 Base-Backbone interact. energy: 5.374 local terms energy: -509.991686 where: bonds (distance) C4'-P energy: -135.756 bonds (distance) P-C4' energy: -149.762 flat angles C4'-P-C4' energy: -124.073 flat angles P-C4'-P energy: -79.303 tors. eta vs tors. theta energy: -21.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -828.107277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.107277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.107277 (E_RNA) where: Base-Base interactions energy: -381.416 where: short stacking energy: -285.137 Base-Backbone interact. energy: 9.941 local terms energy: -456.632198 where: bonds (distance) C4'-P energy: -122.316 bonds (distance) P-C4' energy: -134.005 flat angles C4'-P-C4' energy: -101.226 flat angles P-C4'-P energy: -68.508 tors. eta vs tors. theta energy: -30.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -797.916413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -797.916413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -797.916413 (E_RNA) where: Base-Base interactions energy: -374.554 where: short stacking energy: -263.060 Base-Backbone interact. energy: -0.494 local terms energy: -422.869059 where: bonds (distance) C4'-P energy: -111.389 bonds (distance) P-C4' energy: -130.600 flat angles C4'-P-C4' energy: -107.079 flat angles P-C4'-P energy: -51.593 tors. eta vs tors. theta energy: -22.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -623.301605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -623.301605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -623.301605 (E_RNA) where: Base-Base interactions energy: -229.937 where: short stacking energy: -175.791 Base-Backbone interact. energy: 4.796 local terms energy: -398.160620 where: bonds (distance) C4'-P energy: -120.539 bonds (distance) P-C4' energy: -123.752 flat angles C4'-P-C4' energy: -102.293 flat angles P-C4'-P energy: -74.820 tors. eta vs tors. theta energy: 23.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1932.688214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.688214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1932.688214 (E_RNA) where: Base-Base interactions energy: -1183.068 where: short stacking energy: -656.545 Base-Backbone interact. energy: -1.199 local terms energy: -748.421119 where: bonds (distance) C4'-P energy: -154.412 bonds (distance) P-C4' energy: -159.719 flat angles C4'-P-C4' energy: -172.253 flat angles P-C4'-P energy: -107.000 tors. eta vs tors. theta energy: -155.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1756.378557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1756.378557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1756.378557 (E_RNA) where: Base-Base interactions energy: -1037.721 where: short stacking energy: -606.420 Base-Backbone interact. energy: 1.224 local terms energy: -719.881625 where: bonds (distance) C4'-P energy: -155.611 bonds (distance) P-C4' energy: -156.858 flat angles C4'-P-C4' energy: -163.077 flat angles P-C4'-P energy: -99.937 tors. eta vs tors. theta energy: -144.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1697.952766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.952766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.952766 (E_RNA) where: Base-Base interactions energy: -1009.182 where: short stacking energy: -560.152 Base-Backbone interact. energy: -2.167 local terms energy: -686.603494 where: bonds (distance) C4'-P energy: -149.462 bonds (distance) P-C4' energy: -148.236 flat angles C4'-P-C4' energy: -166.453 flat angles P-C4'-P energy: -86.557 tors. eta vs tors. theta energy: -135.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1363.251592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.251592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.251592 (E_RNA) where: Base-Base interactions energy: -793.002 where: short stacking energy: -457.359 Base-Backbone interact. energy: -2.408 local terms energy: -567.841658 where: bonds (distance) C4'-P energy: -124.359 bonds (distance) P-C4' energy: -121.444 flat angles C4'-P-C4' energy: -142.593 flat angles P-C4'-P energy: -82.425 tors. eta vs tors. theta energy: -97.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1547.898565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1547.898565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1547.898565 (E_RNA) where: Base-Base interactions energy: -943.784 where: short stacking energy: -505.825 Base-Backbone interact. energy: -4.382 local terms energy: -599.732755 where: bonds (distance) C4'-P energy: -126.155 bonds (distance) P-C4' energy: -143.198 flat angles C4'-P-C4' energy: -133.324 flat angles P-C4'-P energy: -93.965 tors. eta vs tors. theta energy: -103.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1187.805561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.805561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.805561 (E_RNA) where: Base-Base interactions energy: -638.128 where: short stacking energy: -375.980 Base-Backbone interact. energy: 0.713 local terms energy: -550.390277 where: bonds (distance) C4'-P energy: -125.467 bonds (distance) P-C4' energy: -128.163 flat angles C4'-P-C4' energy: -136.829 flat angles P-C4'-P energy: -94.572 tors. eta vs tors. theta energy: -65.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1118.536171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.536171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.536171 (E_RNA) where: Base-Base interactions energy: -610.545 where: short stacking energy: -353.459 Base-Backbone interact. energy: -1.350 local terms energy: -506.640825 where: bonds (distance) C4'-P energy: -133.982 bonds (distance) P-C4' energy: -141.615 flat angles C4'-P-C4' energy: -122.166 flat angles P-C4'-P energy: -71.596 tors. eta vs tors. theta energy: -37.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -840.873625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.873625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.873625 (E_RNA) where: Base-Base interactions energy: -391.625 where: short stacking energy: -285.074 Base-Backbone interact. energy: 2.740 local terms energy: -451.989048 where: bonds (distance) C4'-P energy: -114.752 bonds (distance) P-C4' energy: -139.008 flat angles C4'-P-C4' energy: -115.180 flat angles P-C4'-P energy: -64.356 tors. eta vs tors. theta energy: -18.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -776.742509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.742509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.742509 (E_RNA) where: Base-Base interactions energy: -368.505 where: short stacking energy: -254.816 Base-Backbone interact. energy: 0.169 local terms energy: -408.406807 where: bonds (distance) C4'-P energy: -117.399 bonds (distance) P-C4' energy: -108.489 flat angles C4'-P-C4' energy: -110.218 flat angles P-C4'-P energy: -74.782 tors. eta vs tors. theta energy: 2.480 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -599.347422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.347422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.347422 (E_RNA) where: Base-Base interactions energy: -232.690 where: short stacking energy: -199.455 Base-Backbone interact. energy: 4.404 local terms energy: -371.061713 where: bonds (distance) C4'-P energy: -104.162 bonds (distance) P-C4' energy: -129.241 flat angles C4'-P-C4' energy: -74.044 flat angles P-C4'-P energy: -83.278 tors. eta vs tors. theta energy: 19.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1969.348201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1969.348201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1969.348201 (E_RNA) where: Base-Base interactions energy: -1235.872 where: short stacking energy: -658.408 Base-Backbone interact. energy: -2.798 local terms energy: -730.678135 where: bonds (distance) C4'-P energy: -137.958 bonds (distance) P-C4' energy: -152.862 flat angles C4'-P-C4' energy: -166.071 flat angles P-C4'-P energy: -105.482 tors. eta vs tors. theta energy: -168.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1770.047846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1770.047846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.047846 (E_RNA) where: Base-Base interactions energy: -1075.070 where: short stacking energy: -592.873 Base-Backbone interact. energy: 1.937 local terms energy: -696.915236 where: bonds (distance) C4'-P energy: -149.116 bonds (distance) P-C4' energy: -139.623 flat angles C4'-P-C4' energy: -162.920 flat angles P-C4'-P energy: -98.049 tors. eta vs tors. theta energy: -147.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1674.256573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.256573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.256573 (E_RNA) where: Base-Base interactions energy: -1005.523 where: short stacking energy: -530.706 Base-Backbone interact. energy: -0.292 local terms energy: -668.442463 where: bonds (distance) C4'-P energy: -125.129 bonds (distance) P-C4' energy: -149.976 flat angles C4'-P-C4' energy: -145.660 flat angles P-C4'-P energy: -106.449 tors. eta vs tors. theta energy: -141.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1579.288534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1579.288534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1579.288534 (E_RNA) where: Base-Base interactions energy: -931.271 where: short stacking energy: -512.585 Base-Backbone interact. energy: -3.873 local terms energy: -644.144430 where: bonds (distance) C4'-P energy: -142.642 bonds (distance) P-C4' energy: -149.771 flat angles C4'-P-C4' energy: -154.002 flat angles P-C4'-P energy: -96.977 tors. eta vs tors. theta energy: -100.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1282.959856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.959856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.959856 (E_RNA) where: Base-Base interactions energy: -702.892 where: short stacking energy: -422.439 Base-Backbone interact. energy: 3.223 local terms energy: -583.290760 where: bonds (distance) C4'-P energy: -138.736 bonds (distance) P-C4' energy: -146.201 flat angles C4'-P-C4' energy: -138.716 flat angles P-C4'-P energy: -76.560 tors. eta vs tors. theta energy: -83.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1212.810770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.810770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.810770 (E_RNA) where: Base-Base interactions energy: -672.869 where: short stacking energy: -380.844 Base-Backbone interact. energy: 4.035 local terms energy: -543.977295 where: bonds (distance) C4'-P energy: -131.278 bonds (distance) P-C4' energy: -125.312 flat angles C4'-P-C4' energy: -132.492 flat angles P-C4'-P energy: -70.221 tors. eta vs tors. theta energy: -84.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1164.845223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.845223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.845223 (E_RNA) where: Base-Base interactions energy: -679.943 where: short stacking energy: -376.047 Base-Backbone interact. energy: 3.310 local terms energy: -488.212060 where: bonds (distance) C4'-P energy: -123.745 bonds (distance) P-C4' energy: -123.703 flat angles C4'-P-C4' energy: -123.132 flat angles P-C4'-P energy: -67.430 tors. eta vs tors. theta energy: -50.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -850.285203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.285203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.285203 (E_RNA) where: Base-Base interactions energy: -386.092 where: short stacking energy: -247.006 Base-Backbone interact. energy: -0.972 local terms energy: -463.221472 where: bonds (distance) C4'-P energy: -151.136 bonds (distance) P-C4' energy: -129.857 flat angles C4'-P-C4' energy: -96.415 flat angles P-C4'-P energy: -83.454 tors. eta vs tors. theta energy: -2.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -747.293536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.293536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.293536 (E_RNA) where: Base-Base interactions energy: -361.135 where: short stacking energy: -279.087 Base-Backbone interact. energy: 1.688 local terms energy: -387.847219 where: bonds (distance) C4'-P energy: -120.580 bonds (distance) P-C4' energy: -124.967 flat angles C4'-P-C4' energy: -106.410 flat angles P-C4'-P energy: -51.011 tors. eta vs tors. theta energy: 15.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -655.161862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.161862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.161862 (E_RNA) where: Base-Base interactions energy: -258.111 where: short stacking energy: -210.097 Base-Backbone interact. energy: 1.538 local terms energy: -398.588772 where: bonds (distance) C4'-P energy: -116.128 bonds (distance) P-C4' energy: -116.461 flat angles C4'-P-C4' energy: -114.535 flat angles P-C4'-P energy: -65.452 tors. eta vs tors. theta energy: 13.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1959.415804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.415804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1959.415804 (E_RNA) where: Base-Base interactions energy: -1228.845 where: short stacking energy: -658.670 Base-Backbone interact. energy: -1.791 local terms energy: -728.779887 where: bonds (distance) C4'-P energy: -132.150 bonds (distance) P-C4' energy: -149.442 flat angles C4'-P-C4' energy: -170.002 flat angles P-C4'-P energy: -125.297 tors. eta vs tors. theta energy: -151.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1792.661783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1792.661783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.661783 (E_RNA) where: Base-Base interactions energy: -1132.423 where: short stacking energy: -620.917 Base-Backbone interact. energy: -2.797 local terms energy: -657.441735 where: bonds (distance) C4'-P energy: -134.093 bonds (distance) P-C4' energy: -145.935 flat angles C4'-P-C4' energy: -147.833 flat angles P-C4'-P energy: -104.218 tors. eta vs tors. theta energy: -125.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1728.614030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.614030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.614030 (E_RNA) where: Base-Base interactions energy: -1060.946 where: short stacking energy: -560.559 Base-Backbone interact. energy: 1.714 local terms energy: -669.382483 where: bonds (distance) C4'-P energy: -123.768 bonds (distance) P-C4' energy: -148.171 flat angles C4'-P-C4' energy: -158.117 flat angles P-C4'-P energy: -110.560 tors. eta vs tors. theta energy: -128.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1709.658886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.658886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.658886 (E_RNA) where: Base-Base interactions energy: -1069.873 where: short stacking energy: -526.298 Base-Backbone interact. energy: 5.134 local terms energy: -644.919546 where: bonds (distance) C4'-P energy: -132.073 bonds (distance) P-C4' energy: -139.326 flat angles C4'-P-C4' energy: -149.058 flat angles P-C4'-P energy: -99.795 tors. eta vs tors. theta energy: -124.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1301.358684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1301.358684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1301.358684 (E_RNA) where: Base-Base interactions energy: -738.442 where: short stacking energy: -426.434 Base-Backbone interact. energy: -2.975 local terms energy: -559.941042 where: bonds (distance) C4'-P energy: -121.422 bonds (distance) P-C4' energy: -133.708 flat angles C4'-P-C4' energy: -134.758 flat angles P-C4'-P energy: -97.089 tors. eta vs tors. theta energy: -72.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1180.061286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.061286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.061286 (E_RNA) where: Base-Base interactions energy: -624.269 where: short stacking energy: -366.466 Base-Backbone interact. energy: 0.696 local terms energy: -556.487731 where: bonds (distance) C4'-P energy: -142.774 bonds (distance) P-C4' energy: -141.621 flat angles C4'-P-C4' energy: -153.035 flat angles P-C4'-P energy: -68.776 tors. eta vs tors. theta energy: -50.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1290.205613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.205613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1290.205613 (E_RNA) where: Base-Base interactions energy: -768.273 where: short stacking energy: -348.573 Base-Backbone interact. energy: -4.888 local terms energy: -517.044087 where: bonds (distance) C4'-P energy: -128.242 bonds (distance) P-C4' energy: -114.487 flat angles C4'-P-C4' energy: -135.042 flat angles P-C4'-P energy: -78.079 tors. eta vs tors. theta energy: -61.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -832.141317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.141317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.141317 (E_RNA) where: Base-Base interactions energy: -393.475 where: short stacking energy: -267.544 Base-Backbone interact. energy: -0.161 local terms energy: -438.505503 where: bonds (distance) C4'-P energy: -125.424 bonds (distance) P-C4' energy: -134.786 flat angles C4'-P-C4' energy: -115.825 flat angles P-C4'-P energy: -55.478 tors. eta vs tors. theta energy: -6.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -829.760596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.760596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.760596 (E_RNA) where: Base-Base interactions energy: -422.089 where: short stacking energy: -274.526 Base-Backbone interact. energy: 3.386 local terms energy: -411.057854 where: bonds (distance) C4'-P energy: -108.084 bonds (distance) P-C4' energy: -124.876 flat angles C4'-P-C4' energy: -121.298 flat angles P-C4'-P energy: -54.001 tors. eta vs tors. theta energy: -2.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -574.012087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.012087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.012087 (E_RNA) where: Base-Base interactions energy: -224.183 where: short stacking energy: -190.119 Base-Backbone interact. energy: 0.985 local terms energy: -350.814550 where: bonds (distance) C4'-P energy: -87.146 bonds (distance) P-C4' energy: -130.700 flat angles C4'-P-C4' energy: -101.930 flat angles P-C4'-P energy: -48.572 tors. eta vs tors. theta energy: 17.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1961.704381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1961.704381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1961.704381 (E_RNA) where: Base-Base interactions energy: -1246.412 where: short stacking energy: -627.594 Base-Backbone interact. energy: -3.568 local terms energy: -711.724267 where: bonds (distance) C4'-P energy: -144.422 bonds (distance) P-C4' energy: -164.739 flat angles C4'-P-C4' energy: -147.597 flat angles P-C4'-P energy: -106.000 tors. eta vs tors. theta energy: -148.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1816.891760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1816.891760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1816.891760 (E_RNA) where: Base-Base interactions energy: -1126.452 where: short stacking energy: -612.758 Base-Backbone interact. energy: -3.198 local terms energy: -687.242551 where: bonds (distance) C4'-P energy: -147.740 bonds (distance) P-C4' energy: -156.684 flat angles C4'-P-C4' energy: -155.946 flat angles P-C4'-P energy: -98.267 tors. eta vs tors. theta energy: -128.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1786.653422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1786.653422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.653422 (E_RNA) where: Base-Base interactions energy: -1101.287 where: short stacking energy: -576.135 Base-Backbone interact. energy: -0.978 local terms energy: -684.388435 where: bonds (distance) C4'-P energy: -123.160 bonds (distance) P-C4' energy: -158.480 flat angles C4'-P-C4' energy: -166.813 flat angles P-C4'-P energy: -112.118 tors. eta vs tors. theta energy: -123.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1731.502966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1731.502966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1731.502966 (E_RNA) where: Base-Base interactions energy: -1105.015 where: short stacking energy: -537.656 Base-Backbone interact. energy: 1.487 local terms energy: -627.975199 where: bonds (distance) C4'-P energy: -133.711 bonds (distance) P-C4' energy: -135.134 flat angles C4'-P-C4' energy: -140.751 flat angles P-C4'-P energy: -101.020 tors. eta vs tors. theta energy: -117.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1288.318119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1288.318119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1288.318119 (E_RNA) where: Base-Base interactions energy: -733.256 where: short stacking energy: -418.008 Base-Backbone interact. energy: -2.743 local terms energy: -552.318527 where: bonds (distance) C4'-P energy: -136.187 bonds (distance) P-C4' energy: -130.008 flat angles C4'-P-C4' energy: -136.671 flat angles P-C4'-P energy: -78.461 tors. eta vs tors. theta energy: -70.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1410.939668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.939668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.939668 (E_RNA) where: Base-Base interactions energy: -846.214 where: short stacking energy: -444.698 Base-Backbone interact. energy: 0.783 local terms energy: -565.509082 where: bonds (distance) C4'-P energy: -139.537 bonds (distance) P-C4' energy: -122.282 flat angles C4'-P-C4' energy: -132.481 flat angles P-C4'-P energy: -74.789 tors. eta vs tors. theta energy: -96.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1167.225088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.225088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.225088 (E_RNA) where: Base-Base interactions energy: -670.916 where: short stacking energy: -364.774 Base-Backbone interact. energy: 1.734 local terms energy: -498.043143 where: bonds (distance) C4'-P energy: -128.414 bonds (distance) P-C4' energy: -137.394 flat angles C4'-P-C4' energy: -122.146 flat angles P-C4'-P energy: -72.999 tors. eta vs tors. theta energy: -37.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -872.465156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.465156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.465156 (E_RNA) where: Base-Base interactions energy: -404.502 where: short stacking energy: -243.167 Base-Backbone interact. energy: 6.489 local terms energy: -474.452260 where: bonds (distance) C4'-P energy: -130.838 bonds (distance) P-C4' energy: -135.917 flat angles C4'-P-C4' energy: -125.505 flat angles P-C4'-P energy: -70.410 tors. eta vs tors. theta energy: -11.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -811.298423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -811.298423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -811.298423 (E_RNA) where: Base-Base interactions energy: -439.764 where: short stacking energy: -236.763 Base-Backbone interact. energy: 0.795 local terms energy: -372.329289 where: bonds (distance) C4'-P energy: -105.542 bonds (distance) P-C4' energy: -127.686 flat angles C4'-P-C4' energy: -79.088 flat angles P-C4'-P energy: -60.482 tors. eta vs tors. theta energy: 0.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -677.138006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.138006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.138006 (E_RNA) where: Base-Base interactions energy: -294.332 where: short stacking energy: -197.401 Base-Backbone interact. energy: -1.734 local terms energy: -381.071244 where: bonds (distance) C4'-P energy: -127.269 bonds (distance) P-C4' energy: -125.417 flat angles C4'-P-C4' energy: -74.490 flat angles P-C4'-P energy: -67.161 tors. eta vs tors. theta energy: 13.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2012.272288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.272288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.272288 (E_RNA) where: Base-Base interactions energy: -1258.622 where: short stacking energy: -675.758 Base-Backbone interact. energy: -4.178 local terms energy: -749.471827 where: bonds (distance) C4'-P energy: -156.017 bonds (distance) P-C4' energy: -150.549 flat angles C4'-P-C4' energy: -167.824 flat angles P-C4'-P energy: -93.875 tors. eta vs tors. theta energy: -181.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1827.718879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.718879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.718879 (E_RNA) where: Base-Base interactions energy: -1145.579 where: short stacking energy: -624.890 Base-Backbone interact. energy: -1.633 local terms energy: -680.507233 where: bonds (distance) C4'-P energy: -141.246 bonds (distance) P-C4' energy: -151.917 flat angles C4'-P-C4' energy: -150.431 flat angles P-C4'-P energy: -95.434 tors. eta vs tors. theta energy: -141.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1838.522546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1838.522546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1838.522546 (E_RNA) where: Base-Base interactions energy: -1185.098 where: short stacking energy: -584.304 Base-Backbone interact. energy: -1.359 local terms energy: -652.065302 where: bonds (distance) C4'-P energy: -132.880 bonds (distance) P-C4' energy: -144.864 flat angles C4'-P-C4' energy: -163.427 flat angles P-C4'-P energy: -84.989 tors. eta vs tors. theta energy: -125.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1634.916125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.916125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.916125 (E_RNA) where: Base-Base interactions energy: -992.101 where: short stacking energy: -479.668 Base-Backbone interact. energy: -2.385 local terms energy: -640.430119 where: bonds (distance) C4'-P energy: -139.372 bonds (distance) P-C4' energy: -148.213 flat angles C4'-P-C4' energy: -146.372 flat angles P-C4'-P energy: -86.515 tors. eta vs tors. theta energy: -119.957 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1559.445008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.445008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.445008 (E_RNA) where: Base-Base interactions energy: -967.392 where: short stacking energy: -524.293 Base-Backbone interact. energy: -0.940 local terms energy: -591.112902 where: bonds (distance) C4'-P energy: -125.302 bonds (distance) P-C4' energy: -136.848 flat angles C4'-P-C4' energy: -137.243 flat angles P-C4'-P energy: -93.500 tors. eta vs tors. theta energy: -98.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1268.632776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.632776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.632776 (E_RNA) where: Base-Base interactions energy: -721.726 where: short stacking energy: -399.612 Base-Backbone interact. energy: -0.127 local terms energy: -546.779246 where: bonds (distance) C4'-P energy: -115.196 bonds (distance) P-C4' energy: -136.765 flat angles C4'-P-C4' energy: -131.818 flat angles P-C4'-P energy: -95.900 tors. eta vs tors. theta energy: -67.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1174.362585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.362585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.362585 (E_RNA) where: Base-Base interactions energy: -683.493 where: short stacking energy: -369.946 Base-Backbone interact. energy: 4.479 local terms energy: -495.348190 where: bonds (distance) C4'-P energy: -124.736 bonds (distance) P-C4' energy: -131.116 flat angles C4'-P-C4' energy: -128.409 flat angles P-C4'-P energy: -68.321 tors. eta vs tors. theta energy: -42.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -944.461294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.461294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.461294 (E_RNA) where: Base-Base interactions energy: -489.582 where: short stacking energy: -291.722 Base-Backbone interact. energy: 2.692 local terms energy: -457.571205 where: bonds (distance) C4'-P energy: -135.773 bonds (distance) P-C4' energy: -128.038 flat angles C4'-P-C4' energy: -117.717 flat angles P-C4'-P energy: -76.194 tors. eta vs tors. theta energy: 0.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -859.604390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.604390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.604390 (E_RNA) where: Base-Base interactions energy: -422.959 where: short stacking energy: -287.785 Base-Backbone interact. energy: 2.029 local terms energy: -438.674466 where: bonds (distance) C4'-P energy: -102.641 bonds (distance) P-C4' energy: -124.537 flat angles C4'-P-C4' energy: -112.752 flat angles P-C4'-P energy: -81.725 tors. eta vs tors. theta energy: -17.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -762.162116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.162116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.162116 (E_RNA) where: Base-Base interactions energy: -364.523 where: short stacking energy: -206.702 Base-Backbone interact. energy: -1.786 local terms energy: -395.853236 where: bonds (distance) C4'-P energy: -108.189 bonds (distance) P-C4' energy: -144.329 flat angles C4'-P-C4' energy: -96.208 flat angles P-C4'-P energy: -59.490 tors. eta vs tors. theta energy: 12.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2045.794514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2045.794514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2045.794514 (E_RNA) where: Base-Base interactions energy: -1290.824 where: short stacking energy: -688.820 Base-Backbone interact. energy: -0.144 local terms energy: -754.827341 where: bonds (distance) C4'-P energy: -154.782 bonds (distance) P-C4' energy: -140.146 flat angles C4'-P-C4' energy: -157.626 flat angles P-C4'-P energy: -109.703 tors. eta vs tors. theta energy: -192.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1989.703093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1989.703093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1989.703093 (E_RNA) where: Base-Base interactions energy: -1262.152 where: short stacking energy: -608.684 Base-Backbone interact. energy: -4.470 local terms energy: -723.081931 where: bonds (distance) C4'-P energy: -150.322 bonds (distance) P-C4' energy: -159.680 flat angles C4'-P-C4' energy: -156.432 flat angles P-C4'-P energy: -100.763 tors. eta vs tors. theta energy: -155.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1768.666365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1768.666365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.666365 (E_RNA) where: Base-Base interactions energy: -1110.791 where: short stacking energy: -569.356 Base-Backbone interact. energy: 3.762 local terms energy: -661.637707 where: bonds (distance) C4'-P energy: -138.580 bonds (distance) P-C4' energy: -147.072 flat angles C4'-P-C4' energy: -148.750 flat angles P-C4'-P energy: -92.115 tors. eta vs tors. theta energy: -135.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1596.813022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1596.813022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1596.813022 (E_RNA) where: Base-Base interactions energy: -970.903 where: short stacking energy: -513.034 Base-Backbone interact. energy: -0.054 local terms energy: -625.856010 where: bonds (distance) C4'-P energy: -149.455 bonds (distance) P-C4' energy: -131.536 flat angles C4'-P-C4' energy: -150.392 flat angles P-C4'-P energy: -74.352 tors. eta vs tors. theta energy: -120.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1570.056410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1570.056410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1570.056410 (E_RNA) where: Base-Base interactions energy: -964.085 where: short stacking energy: -487.596 Base-Backbone interact. energy: -0.531 local terms energy: -605.441132 where: bonds (distance) C4'-P energy: -119.006 bonds (distance) P-C4' energy: -152.531 flat angles C4'-P-C4' energy: -131.846 flat angles P-C4'-P energy: -106.693 tors. eta vs tors. theta energy: -95.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1228.158932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.158932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.158932 (E_RNA) where: Base-Base interactions energy: -687.943 where: short stacking energy: -372.674 Base-Backbone interact. energy: -0.224 local terms energy: -539.991220 where: bonds (distance) C4'-P energy: -142.678 bonds (distance) P-C4' energy: -125.643 flat angles C4'-P-C4' energy: -136.504 flat angles P-C4'-P energy: -70.498 tors. eta vs tors. theta energy: -64.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1234.695716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.695716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.695716 (E_RNA) where: Base-Base interactions energy: -731.513 where: short stacking energy: -395.861 Base-Backbone interact. energy: 4.891 local terms energy: -508.073897 where: bonds (distance) C4'-P energy: -130.914 bonds (distance) P-C4' energy: -124.017 flat angles C4'-P-C4' energy: -117.816 flat angles P-C4'-P energy: -70.478 tors. eta vs tors. theta energy: -64.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -934.611302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.611302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.611302 (E_RNA) where: Base-Base interactions energy: -491.327 where: short stacking energy: -301.016 Base-Backbone interact. energy: 2.015 local terms energy: -445.299627 where: bonds (distance) C4'-P energy: -111.294 bonds (distance) P-C4' energy: -124.470 flat angles C4'-P-C4' energy: -127.630 flat angles P-C4'-P energy: -60.506 tors. eta vs tors. theta energy: -21.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -942.718450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -942.718450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -942.718450 (E_RNA) where: Base-Base interactions energy: -521.200 where: short stacking energy: -307.169 Base-Backbone interact. energy: 2.451 local terms energy: -423.969787 where: bonds (distance) C4'-P energy: -126.653 bonds (distance) P-C4' energy: -109.767 flat angles C4'-P-C4' energy: -109.499 flat angles P-C4'-P energy: -54.775 tors. eta vs tors. theta energy: -23.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -859.206190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.206190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.206190 (E_RNA) where: Base-Base interactions energy: -434.769 where: short stacking energy: -247.972 Base-Backbone interact. energy: 3.863 local terms energy: -428.299981 where: bonds (distance) C4'-P energy: -116.849 bonds (distance) P-C4' energy: -136.106 flat angles C4'-P-C4' energy: -103.968 flat angles P-C4'-P energy: -71.042 tors. eta vs tors. theta energy: -0.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2110.459262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.459262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2110.459262 (E_RNA) where: Base-Base interactions energy: -1394.789 where: short stacking energy: -658.958 Base-Backbone interact. energy: -2.700 local terms energy: -712.969851 where: bonds (distance) C4'-P energy: -146.584 bonds (distance) P-C4' energy: -148.562 flat angles C4'-P-C4' energy: -160.112 flat angles P-C4'-P energy: -93.812 tors. eta vs tors. theta energy: -163.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1943.948291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.948291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.948291 (E_RNA) where: Base-Base interactions energy: -1215.085 where: short stacking energy: -622.492 Base-Backbone interact. energy: -0.008 local terms energy: -728.855715 where: bonds (distance) C4'-P energy: -141.733 bonds (distance) P-C4' energy: -152.760 flat angles C4'-P-C4' energy: -154.251 flat angles P-C4'-P energy: -108.363 tors. eta vs tors. theta energy: -171.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1739.026163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.026163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.026163 (E_RNA) where: Base-Base interactions energy: -1093.222 where: short stacking energy: -596.430 Base-Backbone interact. energy: 2.133 local terms energy: -647.937551 where: bonds (distance) C4'-P energy: -134.384 bonds (distance) P-C4' energy: -151.189 flat angles C4'-P-C4' energy: -141.332 flat angles P-C4'-P energy: -99.286 tors. eta vs tors. theta energy: -121.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1665.770772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.770772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.770772 (E_RNA) where: Base-Base interactions energy: -1023.215 where: short stacking energy: -551.483 Base-Backbone interact. energy: -6.685 local terms energy: -635.870394 where: bonds (distance) C4'-P energy: -135.396 bonds (distance) P-C4' energy: -129.924 flat angles C4'-P-C4' energy: -145.261 flat angles P-C4'-P energy: -93.581 tors. eta vs tors. theta energy: -131.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1609.220264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.220264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.220264 (E_RNA) where: Base-Base interactions energy: -973.390 where: short stacking energy: -485.578 Base-Backbone interact. energy: 1.557 local terms energy: -637.386592 where: bonds (distance) C4'-P energy: -139.289 bonds (distance) P-C4' energy: -150.041 flat angles C4'-P-C4' energy: -136.644 flat angles P-C4'-P energy: -91.710 tors. eta vs tors. theta energy: -119.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1238.552885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.552885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.552885 (E_RNA) where: Base-Base interactions energy: -711.856 where: short stacking energy: -373.540 Base-Backbone interact. energy: -2.418 local terms energy: -524.278781 where: bonds (distance) C4'-P energy: -125.230 bonds (distance) P-C4' energy: -133.318 flat angles C4'-P-C4' energy: -136.329 flat angles P-C4'-P energy: -76.497 tors. eta vs tors. theta energy: -52.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1208.554054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.554054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.554054 (E_RNA) where: Base-Base interactions energy: -652.941 where: short stacking energy: -346.052 Base-Backbone interact. energy: 6.262 local terms energy: -561.875665 where: bonds (distance) C4'-P energy: -115.065 bonds (distance) P-C4' energy: -157.744 flat angles C4'-P-C4' energy: -147.858 flat angles P-C4'-P energy: -82.686 tors. eta vs tors. theta energy: -58.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -921.364881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -921.364881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -921.364881 (E_RNA) where: Base-Base interactions energy: -447.846 where: short stacking energy: -311.892 Base-Backbone interact. energy: -3.259 local terms energy: -470.260635 where: bonds (distance) C4'-P energy: -136.485 bonds (distance) P-C4' energy: -142.747 flat angles C4'-P-C4' energy: -106.950 flat angles P-C4'-P energy: -74.277 tors. eta vs tors. theta energy: -9.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -912.926109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.926109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.926109 (E_RNA) where: Base-Base interactions energy: -483.426 where: short stacking energy: -301.945 Base-Backbone interact. energy: 5.377 local terms energy: -434.877652 where: bonds (distance) C4'-P energy: -100.689 bonds (distance) P-C4' energy: -125.501 flat angles C4'-P-C4' energy: -112.096 flat angles P-C4'-P energy: -66.510 tors. eta vs tors. theta energy: -30.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -853.198233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.198233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.198233 (E_RNA) where: Base-Base interactions energy: -405.355 where: short stacking energy: -242.464 Base-Backbone interact. energy: 3.567 local terms energy: -451.410257 where: bonds (distance) C4'-P energy: -127.526 bonds (distance) P-C4' energy: -131.944 flat angles C4'-P-C4' energy: -123.237 flat angles P-C4'-P energy: -63.614 tors. eta vs tors. theta energy: -5.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2195.880112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2195.880112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2195.880112 (E_RNA) where: Base-Base interactions energy: -1434.240 where: short stacking energy: -666.135 Base-Backbone interact. energy: -0.880 local terms energy: -760.759414 where: bonds (distance) C4'-P energy: -160.464 bonds (distance) P-C4' energy: -140.235 flat angles C4'-P-C4' energy: -165.351 flat angles P-C4'-P energy: -115.184 tors. eta vs tors. theta energy: -179.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1869.410875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1869.410875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1869.410875 (E_RNA) where: Base-Base interactions energy: -1193.044 where: short stacking energy: -593.569 Base-Backbone interact. energy: -2.907 local terms energy: -673.459407 where: bonds (distance) C4'-P energy: -144.123 bonds (distance) P-C4' energy: -140.713 flat angles C4'-P-C4' energy: -161.788 flat angles P-C4'-P energy: -87.546 tors. eta vs tors. theta energy: -139.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1752.076340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1752.076340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1752.076340 (E_RNA) where: Base-Base interactions energy: -1097.245 where: short stacking energy: -555.018 Base-Backbone interact. energy: -0.461 local terms energy: -654.370035 where: bonds (distance) C4'-P energy: -151.026 bonds (distance) P-C4' energy: -140.078 flat angles C4'-P-C4' energy: -137.400 flat angles P-C4'-P energy: -101.040 tors. eta vs tors. theta energy: -124.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1644.509026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1644.509026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1644.509026 (E_RNA) where: Base-Base interactions energy: -998.743 where: short stacking energy: -542.379 Base-Backbone interact. energy: -3.930 local terms energy: -641.836037 where: bonds (distance) C4'-P energy: -142.309 bonds (distance) P-C4' energy: -156.608 flat angles C4'-P-C4' energy: -138.000 flat angles P-C4'-P energy: -90.997 tors. eta vs tors. theta energy: -113.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1647.647639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1647.647639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1647.647639 (E_RNA) where: Base-Base interactions energy: -1003.757 where: short stacking energy: -478.079 Base-Backbone interact. energy: -1.674 local terms energy: -642.216795 where: bonds (distance) C4'-P energy: -146.454 bonds (distance) P-C4' energy: -148.247 flat angles C4'-P-C4' energy: -144.907 flat angles P-C4'-P energy: -100.378 tors. eta vs tors. theta energy: -102.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1335.820476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.820476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.820476 (E_RNA) where: Base-Base interactions energy: -770.492 where: short stacking energy: -409.505 Base-Backbone interact. energy: -0.470 local terms energy: -564.858659 where: bonds (distance) C4'-P energy: -127.625 bonds (distance) P-C4' energy: -129.429 flat angles C4'-P-C4' energy: -146.895 flat angles P-C4'-P energy: -79.829 tors. eta vs tors. theta energy: -81.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1245.683135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1245.683135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1245.683135 (E_RNA) where: Base-Base interactions energy: -721.752 where: short stacking energy: -364.574 Base-Backbone interact. energy: -0.419 local terms energy: -523.512228 where: bonds (distance) C4'-P energy: -125.504 bonds (distance) P-C4' energy: -147.371 flat angles C4'-P-C4' energy: -124.034 flat angles P-C4'-P energy: -65.941 tors. eta vs tors. theta energy: -60.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1026.263308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.263308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.263308 (E_RNA) where: Base-Base interactions energy: -538.725 where: short stacking energy: -312.633 Base-Backbone interact. energy: 0.815 local terms energy: -488.353446 where: bonds (distance) C4'-P energy: -124.405 bonds (distance) P-C4' energy: -137.626 flat angles C4'-P-C4' energy: -127.372 flat angles P-C4'-P energy: -71.091 tors. eta vs tors. theta energy: -27.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -813.617347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.617347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.617347 (E_RNA) where: Base-Base interactions energy: -403.181 where: short stacking energy: -227.230 Base-Backbone interact. energy: 3.625 local terms energy: -414.061117 where: bonds (distance) C4'-P energy: -108.068 bonds (distance) P-C4' energy: -136.620 flat angles C4'-P-C4' energy: -100.850 flat angles P-C4'-P energy: -71.205 tors. eta vs tors. theta energy: 2.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -818.127511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -818.127511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -818.127511 (E_RNA) where: Base-Base interactions energy: -383.122 where: short stacking energy: -200.689 Base-Backbone interact. energy: -1.042 local terms energy: -433.964240 where: bonds (distance) C4'-P energy: -112.119 bonds (distance) P-C4' energy: -131.499 flat angles C4'-P-C4' energy: -114.696 flat angles P-C4'-P energy: -68.112 tors. eta vs tors. theta energy: -7.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2185.259575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2185.259575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2185.259575 (E_RNA) where: Base-Base interactions energy: -1433.627 where: short stacking energy: -665.259 Base-Backbone interact. energy: -6.129 local terms energy: -745.503598 where: bonds (distance) C4'-P energy: -155.727 bonds (distance) P-C4' energy: -154.801 flat angles C4'-P-C4' energy: -162.359 flat angles P-C4'-P energy: -110.813 tors. eta vs tors. theta energy: -161.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1860.540481 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1860.540481 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1860.540481 (E_RNA) where: Base-Base interactions energy: -1173.216 where: short stacking energy: -590.169 Base-Backbone interact. energy: 1.415 local terms energy: -688.738519 where: bonds (distance) C4'-P energy: -149.377 bonds (distance) P-C4' energy: -151.322 flat angles C4'-P-C4' energy: -152.658 flat angles P-C4'-P energy: -110.042 tors. eta vs tors. theta energy: -125.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1748.296888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1748.296888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.296888 (E_RNA) where: Base-Base interactions energy: -1112.435 where: short stacking energy: -542.463 Base-Backbone interact. energy: -0.430 local terms energy: -635.431975 where: bonds (distance) C4'-P energy: -144.266 bonds (distance) P-C4' energy: -155.496 flat angles C4'-P-C4' energy: -134.272 flat angles P-C4'-P energy: -85.654 tors. eta vs tors. theta energy: -115.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1671.603889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1671.603889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1671.603889 (E_RNA) where: Base-Base interactions energy: -1033.691 where: short stacking energy: -561.135 Base-Backbone interact. energy: -3.564 local terms energy: -634.349610 where: bonds (distance) C4'-P energy: -140.552 bonds (distance) P-C4' energy: -145.607 flat angles C4'-P-C4' energy: -152.036 flat angles P-C4'-P energy: -84.635 tors. eta vs tors. theta energy: -111.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1769.712076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1769.712076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1769.712076 (E_RNA) where: Base-Base interactions energy: -1193.383 where: short stacking energy: -566.087 Base-Backbone interact. energy: -1.995 local terms energy: -574.333976 where: bonds (distance) C4'-P energy: -117.603 bonds (distance) P-C4' energy: -125.599 flat angles C4'-P-C4' energy: -140.111 flat angles P-C4'-P energy: -70.130 tors. eta vs tors. theta energy: -120.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1496.586653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.586653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.586653 (E_RNA) where: Base-Base interactions energy: -908.472 where: short stacking energy: -465.417 Base-Backbone interact. energy: 0.586 local terms energy: -588.700129 where: bonds (distance) C4'-P energy: -124.802 bonds (distance) P-C4' energy: -124.418 flat angles C4'-P-C4' energy: -136.929 flat angles P-C4'-P energy: -96.035 tors. eta vs tors. theta energy: -106.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1281.194155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.194155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.194155 (E_RNA) where: Base-Base interactions energy: -745.011 where: short stacking energy: -372.834 Base-Backbone interact. energy: -0.056 local terms energy: -536.126827 where: bonds (distance) C4'-P energy: -127.195 bonds (distance) P-C4' energy: -127.830 flat angles C4'-P-C4' energy: -139.167 flat angles P-C4'-P energy: -73.883 tors. eta vs tors. theta energy: -68.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1012.047308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.047308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.047308 (E_RNA) where: Base-Base interactions energy: -522.656 where: short stacking energy: -289.049 Base-Backbone interact. energy: -2.312 local terms energy: -487.079079 where: bonds (distance) C4'-P energy: -130.413 bonds (distance) P-C4' energy: -130.523 flat angles C4'-P-C4' energy: -138.227 flat angles P-C4'-P energy: -70.416 tors. eta vs tors. theta energy: -17.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -806.344514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -806.344514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -806.344514 (E_RNA) where: Base-Base interactions energy: -393.343 where: short stacking energy: -253.804 Base-Backbone interact. energy: 2.049 local terms energy: -415.050592 where: bonds (distance) C4'-P energy: -126.247 bonds (distance) P-C4' energy: -116.857 flat angles C4'-P-C4' energy: -123.971 flat angles P-C4'-P energy: -44.836 tors. eta vs tors. theta energy: -3.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -868.659572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.659572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.659572 (E_RNA) where: Base-Base interactions energy: -494.320 where: short stacking energy: -259.347 Base-Backbone interact. energy: -1.674 local terms energy: -372.666191 where: bonds (distance) C4'-P energy: -113.140 bonds (distance) P-C4' energy: -95.924 flat angles C4'-P-C4' energy: -105.568 flat angles P-C4'-P energy: -70.138 tors. eta vs tors. theta energy: 12.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2195.257736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2195.257736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2195.257736 (E_RNA) where: Base-Base interactions energy: -1474.195 where: short stacking energy: -659.401 Base-Backbone interact. energy: -5.789 local terms energy: -715.273927 where: bonds (distance) C4'-P energy: -134.742 bonds (distance) P-C4' energy: -155.131 flat angles C4'-P-C4' energy: -158.629 flat angles P-C4'-P energy: -110.564 tors. eta vs tors. theta energy: -156.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1931.139808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1931.139808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1931.139808 (E_RNA) where: Base-Base interactions energy: -1236.424 where: short stacking energy: -695.030 Base-Backbone interact. energy: 2.756 local terms energy: -697.471000 where: bonds (distance) C4'-P energy: -141.805 bonds (distance) P-C4' energy: -144.810 flat angles C4'-P-C4' energy: -137.367 flat angles P-C4'-P energy: -102.256 tors. eta vs tors. theta energy: -171.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1788.212817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1788.212817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1788.212817 (E_RNA) where: Base-Base interactions energy: -1103.937 where: short stacking energy: -574.874 Base-Backbone interact. energy: 3.288 local terms energy: -687.564722 where: bonds (distance) C4'-P energy: -150.837 bonds (distance) P-C4' energy: -157.962 flat angles C4'-P-C4' energy: -148.154 flat angles P-C4'-P energy: -96.871 tors. eta vs tors. theta energy: -133.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1928.578651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1928.578651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1928.578651 (E_RNA) where: Base-Base interactions energy: -1280.453 where: short stacking energy: -601.884 Base-Backbone interact. energy: 4.056 local terms energy: -652.181170 where: bonds (distance) C4'-P energy: -114.447 bonds (distance) P-C4' energy: -140.582 flat angles C4'-P-C4' energy: -163.370 flat angles P-C4'-P energy: -90.852 tors. eta vs tors. theta energy: -142.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1612.468736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1612.468736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1612.468736 (E_RNA) where: Base-Base interactions energy: -975.948 where: short stacking energy: -508.234 Base-Backbone interact. energy: -4.076 local terms energy: -632.445057 where: bonds (distance) C4'-P energy: -128.247 bonds (distance) P-C4' energy: -143.443 flat angles C4'-P-C4' energy: -149.851 flat angles P-C4'-P energy: -89.197 tors. eta vs tors. theta energy: -121.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1474.644352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.644352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.644352 (E_RNA) where: Base-Base interactions energy: -874.697 where: short stacking energy: -425.689 Base-Backbone interact. energy: -1.255 local terms energy: -598.691793 where: bonds (distance) C4'-P energy: -134.350 bonds (distance) P-C4' energy: -149.148 flat angles C4'-P-C4' energy: -124.292 flat angles P-C4'-P energy: -95.629 tors. eta vs tors. theta energy: -95.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1196.180204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.180204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.180204 (E_RNA) where: Base-Base interactions energy: -688.855 where: short stacking energy: -363.557 Base-Backbone interact. energy: 0.107 local terms energy: -507.432598 where: bonds (distance) C4'-P energy: -119.585 bonds (distance) P-C4' energy: -134.200 flat angles C4'-P-C4' energy: -108.140 flat angles P-C4'-P energy: -84.642 tors. eta vs tors. theta energy: -60.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1054.054374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.054374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.054374 (E_RNA) where: Base-Base interactions energy: -589.951 where: short stacking energy: -299.520 Base-Backbone interact. energy: -2.153 local terms energy: -461.950566 where: bonds (distance) C4'-P energy: -129.067 bonds (distance) P-C4' energy: -123.016 flat angles C4'-P-C4' energy: -96.406 flat angles P-C4'-P energy: -81.400 tors. eta vs tors. theta energy: -32.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -741.930455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.930455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.930455 (E_RNA) where: Base-Base interactions energy: -358.238 where: short stacking energy: -208.049 Base-Backbone interact. energy: 3.075 local terms energy: -386.767416 where: bonds (distance) C4'-P energy: -120.586 bonds (distance) P-C4' energy: -113.167 flat angles C4'-P-C4' energy: -103.254 flat angles P-C4'-P energy: -61.044 tors. eta vs tors. theta energy: 11.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -884.478224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -884.478224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -884.478224 (E_RNA) where: Base-Base interactions energy: -457.275 where: short stacking energy: -244.288 Base-Backbone interact. energy: -3.947 local terms energy: -423.256144 where: bonds (distance) C4'-P energy: -126.941 bonds (distance) P-C4' energy: -110.116 flat angles C4'-P-C4' energy: -101.196 flat angles P-C4'-P energy: -73.015 tors. eta vs tors. theta energy: -11.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2216.831853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2216.831853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2216.831853 (E_RNA) where: Base-Base interactions energy: -1464.172 where: short stacking energy: -669.172 Base-Backbone interact. energy: -4.052 local terms energy: -748.607831 where: bonds (distance) C4'-P energy: -138.189 bonds (distance) P-C4' energy: -169.627 flat angles C4'-P-C4' energy: -158.591 flat angles P-C4'-P energy: -112.264 tors. eta vs tors. theta energy: -169.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1943.027072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.027072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.027072 (E_RNA) where: Base-Base interactions energy: -1237.730 where: short stacking energy: -638.521 Base-Backbone interact. energy: -1.632 local terms energy: -703.664963 where: bonds (distance) C4'-P energy: -143.718 bonds (distance) P-C4' energy: -149.923 flat angles C4'-P-C4' energy: -164.016 flat angles P-C4'-P energy: -86.951 tors. eta vs tors. theta energy: -159.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1960.780458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1960.780458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1960.780458 (E_RNA) where: Base-Base interactions energy: -1298.079 where: short stacking energy: -591.300 Base-Backbone interact. energy: -2.460 local terms energy: -660.241308 where: bonds (distance) C4'-P energy: -144.899 bonds (distance) P-C4' energy: -141.341 flat angles C4'-P-C4' energy: -148.195 flat angles P-C4'-P energy: -98.452 tors. eta vs tors. theta energy: -127.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1800.233558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1800.233558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.233558 (E_RNA) where: Base-Base interactions energy: -1153.688 where: short stacking energy: -525.821 Base-Backbone interact. energy: 3.732 local terms energy: -650.277416 where: bonds (distance) C4'-P energy: -155.382 bonds (distance) P-C4' energy: -133.358 flat angles C4'-P-C4' energy: -146.068 flat angles P-C4'-P energy: -97.157 tors. eta vs tors. theta energy: -118.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1680.730670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1680.730670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1680.730670 (E_RNA) where: Base-Base interactions energy: -1054.270 where: short stacking energy: -548.947 Base-Backbone interact. energy: -2.611 local terms energy: -623.849910 where: bonds (distance) C4'-P energy: -120.990 bonds (distance) P-C4' energy: -141.858 flat angles C4'-P-C4' energy: -150.207 flat angles P-C4'-P energy: -96.032 tors. eta vs tors. theta energy: -114.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1479.915525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.915525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.915525 (E_RNA) where: Base-Base interactions energy: -885.992 where: short stacking energy: -454.537 Base-Backbone interact. energy: 0.397 local terms energy: -594.321003 where: bonds (distance) C4'-P energy: -157.766 bonds (distance) P-C4' energy: -131.331 flat angles C4'-P-C4' energy: -136.920 flat angles P-C4'-P energy: -91.159 tors. eta vs tors. theta energy: -77.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1162.744214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.744214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.744214 (E_RNA) where: Base-Base interactions energy: -676.247 where: short stacking energy: -337.462 Base-Backbone interact. energy: 6.985 local terms energy: -493.482657 where: bonds (distance) C4'-P energy: -119.176 bonds (distance) P-C4' energy: -130.904 flat angles C4'-P-C4' energy: -132.289 flat angles P-C4'-P energy: -69.213 tors. eta vs tors. theta energy: -41.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -995.139459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -995.139459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -995.139459 (E_RNA) where: Base-Base interactions energy: -535.780 where: short stacking energy: -299.161 Base-Backbone interact. energy: -0.013 local terms energy: -459.346068 where: bonds (distance) C4'-P energy: -122.874 bonds (distance) P-C4' energy: -131.373 flat angles C4'-P-C4' energy: -120.097 flat angles P-C4'-P energy: -67.079 tors. eta vs tors. theta energy: -17.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -982.802741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.802741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.802741 (E_RNA) where: Base-Base interactions energy: -527.722 where: short stacking energy: -298.662 Base-Backbone interact. energy: 0.476 local terms energy: -455.555817 where: bonds (distance) C4'-P energy: -104.550 bonds (distance) P-C4' energy: -130.572 flat angles C4'-P-C4' energy: -131.480 flat angles P-C4'-P energy: -64.671 tors. eta vs tors. theta energy: -24.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -669.845281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -669.845281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -669.845281 (E_RNA) where: Base-Base interactions energy: -256.839 where: short stacking energy: -173.981 Base-Backbone interact. energy: -2.673 local terms energy: -410.333858 where: bonds (distance) C4'-P energy: -110.485 bonds (distance) P-C4' energy: -139.636 flat angles C4'-P-C4' energy: -110.824 flat angles P-C4'-P energy: -59.841 tors. eta vs tors. theta energy: 10.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2244.544913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2244.544913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2244.544913 (E_RNA) where: Base-Base interactions energy: -1486.017 where: short stacking energy: -689.373 Base-Backbone interact. energy: -4.445 local terms energy: -754.082768 where: bonds (distance) C4'-P energy: -149.503 bonds (distance) P-C4' energy: -155.745 flat angles C4'-P-C4' energy: -174.162 flat angles P-C4'-P energy: -101.891 tors. eta vs tors. theta energy: -172.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -2001.789337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2001.789337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2001.789337 (E_RNA) where: Base-Base interactions energy: -1279.002 where: short stacking energy: -645.205 Base-Backbone interact. energy: -1.520 local terms energy: -721.267216 where: bonds (distance) C4'-P energy: -132.810 bonds (distance) P-C4' energy: -149.496 flat angles C4'-P-C4' energy: -158.174 flat angles P-C4'-P energy: -114.161 tors. eta vs tors. theta energy: -166.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -2029.263888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.263888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.263888 (E_RNA) where: Base-Base interactions energy: -1347.669 where: short stacking energy: -621.911 Base-Backbone interact. energy: -4.694 local terms energy: -676.900625 where: bonds (distance) C4'-P energy: -126.846 bonds (distance) P-C4' energy: -139.626 flat angles C4'-P-C4' energy: -157.531 flat angles P-C4'-P energy: -107.162 tors. eta vs tors. theta energy: -145.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1795.734945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1795.734945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1795.734945 (E_RNA) where: Base-Base interactions energy: -1159.203 where: short stacking energy: -572.446 Base-Backbone interact. energy: 3.852 local terms energy: -640.384190 where: bonds (distance) C4'-P energy: -127.780 bonds (distance) P-C4' energy: -152.138 flat angles C4'-P-C4' energy: -144.176 flat angles P-C4'-P energy: -79.847 tors. eta vs tors. theta energy: -136.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1652.351466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1652.351466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1652.351466 (E_RNA) where: Base-Base interactions energy: -1053.419 where: short stacking energy: -516.238 Base-Backbone interact. energy: -0.751 local terms energy: -598.181751 where: bonds (distance) C4'-P energy: -120.272 bonds (distance) P-C4' energy: -131.752 flat angles C4'-P-C4' energy: -152.756 flat angles P-C4'-P energy: -89.762 tors. eta vs tors. theta energy: -103.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1484.217201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.217201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.217201 (E_RNA) where: Base-Base interactions energy: -876.544 where: short stacking energy: -472.179 Base-Backbone interact. energy: -4.063 local terms energy: -603.610370 where: bonds (distance) C4'-P energy: -138.787 bonds (distance) P-C4' energy: -139.695 flat angles C4'-P-C4' energy: -151.890 flat angles P-C4'-P energy: -82.085 tors. eta vs tors. theta energy: -91.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1226.998323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.998323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.998323 (E_RNA) where: Base-Base interactions energy: -737.317 where: short stacking energy: -385.196 Base-Backbone interact. energy: 1.702 local terms energy: -491.383470 where: bonds (distance) C4'-P energy: -108.092 bonds (distance) P-C4' energy: -133.375 flat angles C4'-P-C4' energy: -128.152 flat angles P-C4'-P energy: -69.243 tors. eta vs tors. theta energy: -52.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1174.455621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.455621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.455621 (E_RNA) where: Base-Base interactions energy: -686.232 where: short stacking energy: -376.720 Base-Backbone interact. energy: 3.313 local terms energy: -491.535805 where: bonds (distance) C4'-P energy: -116.043 bonds (distance) P-C4' energy: -126.515 flat angles C4'-P-C4' energy: -113.327 flat angles P-C4'-P energy: -74.599 tors. eta vs tors. theta energy: -61.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1026.364183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.364183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.364183 (E_RNA) where: Base-Base interactions energy: -587.368 where: short stacking energy: -312.103 Base-Backbone interact. energy: 12.423 local terms energy: -451.419115 where: bonds (distance) C4'-P energy: -106.504 bonds (distance) P-C4' energy: -132.940 flat angles C4'-P-C4' energy: -118.501 flat angles P-C4'-P energy: -67.966 tors. eta vs tors. theta energy: -25.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -690.248174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.248174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.248174 (E_RNA) where: Base-Base interactions energy: -270.019 where: short stacking energy: -211.375 Base-Backbone interact. energy: -3.481 local terms energy: -416.748598 where: bonds (distance) C4'-P energy: -115.597 bonds (distance) P-C4' energy: -148.058 flat angles C4'-P-C4' energy: -79.707 flat angles P-C4'-P energy: -63.017 tors. eta vs tors. theta energy: -10.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2224.450914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2224.450914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2224.450914 (E_RNA) where: Base-Base interactions energy: -1478.914 where: short stacking energy: -702.891 Base-Backbone interact. energy: -1.846 local terms energy: -743.690713 where: bonds (distance) C4'-P energy: -144.125 bonds (distance) P-C4' energy: -152.494 flat angles C4'-P-C4' energy: -170.756 flat angles P-C4'-P energy: -107.656 tors. eta vs tors. theta energy: -168.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -2007.660513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2007.660513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2007.660513 (E_RNA) where: Base-Base interactions energy: -1283.396 where: short stacking energy: -628.620 Base-Backbone interact. energy: -5.249 local terms energy: -719.015344 where: bonds (distance) C4'-P energy: -141.433 bonds (distance) P-C4' energy: -165.015 flat angles C4'-P-C4' energy: -159.457 flat angles P-C4'-P energy: -91.223 tors. eta vs tors. theta energy: -161.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -2105.500341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2105.500341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2105.500341 (E_RNA) where: Base-Base interactions energy: -1403.041 where: short stacking energy: -644.487 Base-Backbone interact. energy: -0.569 local terms energy: -701.890693 where: bonds (distance) C4'-P energy: -144.995 bonds (distance) P-C4' energy: -155.529 flat angles C4'-P-C4' energy: -149.744 flat angles P-C4'-P energy: -100.393 tors. eta vs tors. theta energy: -151.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1708.418219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.418219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.418219 (E_RNA) where: Base-Base interactions energy: -1045.717 where: short stacking energy: -533.566 Base-Backbone interact. energy: -1.432 local terms energy: -661.269134 where: bonds (distance) C4'-P energy: -137.150 bonds (distance) P-C4' energy: -153.128 flat angles C4'-P-C4' energy: -151.408 flat angles P-C4'-P energy: -87.553 tors. eta vs tors. theta energy: -132.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1676.439038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1676.439038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1676.439038 (E_RNA) where: Base-Base interactions energy: -1044.434 where: short stacking energy: -527.545 Base-Backbone interact. energy: -1.064 local terms energy: -630.941501 where: bonds (distance) C4'-P energy: -138.798 bonds (distance) P-C4' energy: -141.659 flat angles C4'-P-C4' energy: -136.608 flat angles P-C4'-P energy: -99.892 tors. eta vs tors. theta energy: -113.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1560.352477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.352477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.352477 (E_RNA) where: Base-Base interactions energy: -969.811 where: short stacking energy: -489.372 Base-Backbone interact. energy: -0.226 local terms energy: -590.315496 where: bonds (distance) C4'-P energy: -131.203 bonds (distance) P-C4' energy: -140.543 flat angles C4'-P-C4' energy: -146.171 flat angles P-C4'-P energy: -76.127 tors. eta vs tors. theta energy: -96.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1255.655561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.655561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.655561 (E_RNA) where: Base-Base interactions energy: -717.536 where: short stacking energy: -350.543 Base-Backbone interact. energy: 0.079 local terms energy: -538.198035 where: bonds (distance) C4'-P energy: -135.884 bonds (distance) P-C4' energy: -138.591 flat angles C4'-P-C4' energy: -141.713 flat angles P-C4'-P energy: -81.146 tors. eta vs tors. theta energy: -40.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1174.843570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.843570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.843570 (E_RNA) where: Base-Base interactions energy: -703.152 where: short stacking energy: -378.081 Base-Backbone interact. energy: 4.369 local terms energy: -476.060347 where: bonds (distance) C4'-P energy: -110.487 bonds (distance) P-C4' energy: -131.556 flat angles C4'-P-C4' energy: -110.743 flat angles P-C4'-P energy: -66.385 tors. eta vs tors. theta energy: -56.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -988.450618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.450618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.450618 (E_RNA) where: Base-Base interactions energy: -551.946 where: short stacking energy: -299.922 Base-Backbone interact. energy: 6.858 local terms energy: -443.362549 where: bonds (distance) C4'-P energy: -130.334 bonds (distance) P-C4' energy: -123.974 flat angles C4'-P-C4' energy: -97.574 flat angles P-C4'-P energy: -70.189 tors. eta vs tors. theta energy: -21.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -771.092865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.092865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.092865 (E_RNA) where: Base-Base interactions energy: -347.335 where: short stacking energy: -206.913 Base-Backbone interact. energy: 0.923 local terms energy: -424.680506 where: bonds (distance) C4'-P energy: -109.122 bonds (distance) P-C4' energy: -134.783 flat angles C4'-P-C4' energy: -106.747 flat angles P-C4'-P energy: -67.074 tors. eta vs tors. theta energy: -6.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2303.260432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2303.260432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2303.260432 (E_RNA) where: Base-Base interactions energy: -1559.781 where: short stacking energy: -683.162 Base-Backbone interact. energy: -2.861 local terms energy: -740.618065 where: bonds (distance) C4'-P energy: -143.010 bonds (distance) P-C4' energy: -156.684 flat angles C4'-P-C4' energy: -159.571 flat angles P-C4'-P energy: -104.479 tors. eta vs tors. theta energy: -176.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -2197.715454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2197.715454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2197.715454 (E_RNA) where: Base-Base interactions energy: -1480.056 where: short stacking energy: -659.531 Base-Backbone interact. energy: -0.050 local terms energy: -717.609589 where: bonds (distance) C4'-P energy: -125.732 bonds (distance) P-C4' energy: -155.315 flat angles C4'-P-C4' energy: -166.839 flat angles P-C4'-P energy: -104.673 tors. eta vs tors. theta energy: -165.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1915.628406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.628406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.628406 (E_RNA) where: Base-Base interactions energy: -1231.613 where: short stacking energy: -596.970 Base-Backbone interact. energy: -3.111 local terms energy: -680.904380 where: bonds (distance) C4'-P energy: -142.502 bonds (distance) P-C4' energy: -141.058 flat angles C4'-P-C4' energy: -149.346 flat angles P-C4'-P energy: -100.715 tors. eta vs tors. theta energy: -147.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1786.936008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1786.936008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1786.936008 (E_RNA) where: Base-Base interactions energy: -1124.125 where: short stacking energy: -584.509 Base-Backbone interact. energy: -1.872 local terms energy: -660.938944 where: bonds (distance) C4'-P energy: -134.390 bonds (distance) P-C4' energy: -154.096 flat angles C4'-P-C4' energy: -147.761 flat angles P-C4'-P energy: -83.439 tors. eta vs tors. theta energy: -141.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1687.157331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1687.157331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1687.157331 (E_RNA) where: Base-Base interactions energy: -1040.387 where: short stacking energy: -555.365 Base-Backbone interact. energy: 3.069 local terms energy: -649.839580 where: bonds (distance) C4'-P energy: -142.110 bonds (distance) P-C4' energy: -124.903 flat angles C4'-P-C4' energy: -159.744 flat angles P-C4'-P energy: -100.949 tors. eta vs tors. theta energy: -122.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1517.410637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.410637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.410637 (E_RNA) where: Base-Base interactions energy: -943.797 where: short stacking energy: -481.169 Base-Backbone interact. energy: 1.623 local terms energy: -575.237398 where: bonds (distance) C4'-P energy: -126.141 bonds (distance) P-C4' energy: -131.079 flat angles C4'-P-C4' energy: -149.570 flat angles P-C4'-P energy: -91.468 tors. eta vs tors. theta energy: -76.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1365.850076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.850076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.850076 (E_RNA) where: Base-Base interactions energy: -850.585 where: short stacking energy: -395.980 Base-Backbone interact. energy: -2.129 local terms energy: -513.135644 where: bonds (distance) C4'-P energy: -130.533 bonds (distance) P-C4' energy: -120.386 flat angles C4'-P-C4' energy: -113.443 flat angles P-C4'-P energy: -73.746 tors. eta vs tors. theta energy: -75.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1210.777236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.777236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.777236 (E_RNA) where: Base-Base interactions energy: -714.381 where: short stacking energy: -432.323 Base-Backbone interact. energy: 4.144 local terms energy: -500.539526 where: bonds (distance) C4'-P energy: -126.670 bonds (distance) P-C4' energy: -110.708 flat angles C4'-P-C4' energy: -124.122 flat angles P-C4'-P energy: -57.565 tors. eta vs tors. theta energy: -81.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -959.666302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.666302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.666302 (E_RNA) where: Base-Base interactions energy: -523.238 where: short stacking energy: -310.344 Base-Backbone interact. energy: 0.206 local terms energy: -436.633961 where: bonds (distance) C4'-P energy: -119.488 bonds (distance) P-C4' energy: -119.989 flat angles C4'-P-C4' energy: -110.605 flat angles P-C4'-P energy: -60.690 tors. eta vs tors. theta energy: -25.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -736.186088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -736.186088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -736.186088 (E_RNA) where: Base-Base interactions energy: -339.034 where: short stacking energy: -231.462 Base-Backbone interact. energy: 1.838 local terms energy: -398.990566 where: bonds (distance) C4'-P energy: -117.485 bonds (distance) P-C4' energy: -118.166 flat angles C4'-P-C4' energy: -104.949 flat angles P-C4'-P energy: -55.078 tors. eta vs tors. theta energy: -3.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2314.552695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2314.552695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2314.552695 (E_RNA) where: Base-Base interactions energy: -1527.225 where: short stacking energy: -720.210 Base-Backbone interact. energy: -4.780 local terms energy: -782.547483 where: bonds (distance) C4'-P energy: -155.035 bonds (distance) P-C4' energy: -160.955 flat angles C4'-P-C4' energy: -168.907 flat angles P-C4'-P energy: -100.118 tors. eta vs tors. theta energy: -197.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2192.570947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2192.570947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2192.570947 (E_RNA) where: Base-Base interactions energy: -1470.523 where: short stacking energy: -669.817 Base-Backbone interact. energy: -3.298 local terms energy: -718.749757 where: bonds (distance) C4'-P energy: -143.990 bonds (distance) P-C4' energy: -148.705 flat angles C4'-P-C4' energy: -168.069 flat angles P-C4'-P energy: -97.898 tors. eta vs tors. theta energy: -160.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1893.092597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1893.092597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1893.092597 (E_RNA) where: Base-Base interactions energy: -1194.793 where: short stacking energy: -608.782 Base-Backbone interact. energy: -0.142 local terms energy: -698.158053 where: bonds (distance) C4'-P energy: -142.246 bonds (distance) P-C4' energy: -149.428 flat angles C4'-P-C4' energy: -153.003 flat angles P-C4'-P energy: -103.020 tors. eta vs tors. theta energy: -150.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1768.494997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1768.494997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1768.494997 (E_RNA) where: Base-Base interactions energy: -1126.869 where: short stacking energy: -562.582 Base-Backbone interact. energy: -2.717 local terms energy: -638.908765 where: bonds (distance) C4'-P energy: -133.044 bonds (distance) P-C4' energy: -133.943 flat angles C4'-P-C4' energy: -143.931 flat angles P-C4'-P energy: -86.993 tors. eta vs tors. theta energy: -140.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1660.745649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1660.745649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1660.745649 (E_RNA) where: Base-Base interactions energy: -1040.389 where: short stacking energy: -513.745 Base-Backbone interact. energy: -0.261 local terms energy: -620.095146 where: bonds (distance) C4'-P energy: -125.082 bonds (distance) P-C4' energy: -153.561 flat angles C4'-P-C4' energy: -147.872 flat angles P-C4'-P energy: -76.709 tors. eta vs tors. theta energy: -116.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1618.864536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1618.864536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1618.864536 (E_RNA) where: Base-Base interactions energy: -1001.101 where: short stacking energy: -494.567 Base-Backbone interact. energy: -0.870 local terms energy: -616.893250 where: bonds (distance) C4'-P energy: -139.602 bonds (distance) P-C4' energy: -142.754 flat angles C4'-P-C4' energy: -149.182 flat angles P-C4'-P energy: -88.280 tors. eta vs tors. theta energy: -97.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1428.462275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.462275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.462275 (E_RNA) where: Base-Base interactions energy: -893.196 where: short stacking energy: -432.256 Base-Backbone interact. energy: -7.692 local terms energy: -527.574512 where: bonds (distance) C4'-P energy: -124.858 bonds (distance) P-C4' energy: -121.317 flat angles C4'-P-C4' energy: -135.814 flat angles P-C4'-P energy: -69.928 tors. eta vs tors. theta energy: -75.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1161.377651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.377651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.377651 (E_RNA) where: Base-Base interactions energy: -679.047 where: short stacking energy: -349.791 Base-Backbone interact. energy: 2.590 local terms energy: -484.920243 where: bonds (distance) C4'-P energy: -107.425 bonds (distance) P-C4' energy: -116.120 flat angles C4'-P-C4' energy: -133.045 flat angles P-C4'-P energy: -78.484 tors. eta vs tors. theta energy: -49.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1005.140220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.140220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.140220 (E_RNA) where: Base-Base interactions energy: -579.387 where: short stacking energy: -312.293 Base-Backbone interact. energy: -1.536 local terms energy: -424.217194 where: bonds (distance) C4'-P energy: -125.324 bonds (distance) P-C4' energy: -118.182 flat angles C4'-P-C4' energy: -108.850 flat angles P-C4'-P energy: -51.856 tors. eta vs tors. theta energy: -20.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -650.625911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.625911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.625911 (E_RNA) where: Base-Base interactions energy: -244.592 where: short stacking energy: -176.384 Base-Backbone interact. energy: 3.609 local terms energy: -409.642752 where: bonds (distance) C4'-P energy: -106.420 bonds (distance) P-C4' energy: -127.556 flat angles C4'-P-C4' energy: -115.721 flat angles P-C4'-P energy: -71.610 tors. eta vs tors. theta energy: 11.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2343.785286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2343.785286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2343.785286 (E_RNA) where: Base-Base interactions energy: -1575.281 where: short stacking energy: -705.222 Base-Backbone interact. energy: -2.268 local terms energy: -766.235582 where: bonds (distance) C4'-P energy: -148.338 bonds (distance) P-C4' energy: -153.631 flat angles C4'-P-C4' energy: -177.326 flat angles P-C4'-P energy: -102.944 tors. eta vs tors. theta energy: -183.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2250.232215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2250.232215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2250.232215 (E_RNA) where: Base-Base interactions energy: -1530.323 where: short stacking energy: -687.115 Base-Backbone interact. energy: -4.070 local terms energy: -715.839200 where: bonds (distance) C4'-P energy: -137.336 bonds (distance) P-C4' energy: -153.461 flat angles C4'-P-C4' energy: -162.626 flat angles P-C4'-P energy: -104.687 tors. eta vs tors. theta energy: -157.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1914.921949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.921949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.921949 (E_RNA) where: Base-Base interactions energy: -1228.293 where: short stacking energy: -588.764 Base-Backbone interact. energy: -2.830 local terms energy: -683.799353 where: bonds (distance) C4'-P energy: -144.169 bonds (distance) P-C4' energy: -150.156 flat angles C4'-P-C4' energy: -156.930 flat angles P-C4'-P energy: -94.242 tors. eta vs tors. theta energy: -138.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1788.565321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1788.565321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1788.565321 (E_RNA) where: Base-Base interactions energy: -1179.343 where: short stacking energy: -558.680 Base-Backbone interact. energy: -1.561 local terms energy: -607.661670 where: bonds (distance) C4'-P energy: -140.190 bonds (distance) P-C4' energy: -136.705 flat angles C4'-P-C4' energy: -135.608 flat angles P-C4'-P energy: -81.785 tors. eta vs tors. theta energy: -113.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1716.184011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1716.184011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1716.184011 (E_RNA) where: Base-Base interactions energy: -1081.734 where: short stacking energy: -536.107 Base-Backbone interact. energy: -2.544 local terms energy: -631.906265 where: bonds (distance) C4'-P energy: -128.603 bonds (distance) P-C4' energy: -143.403 flat angles C4'-P-C4' energy: -140.084 flat angles P-C4'-P energy: -94.067 tors. eta vs tors. theta energy: -125.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1678.516373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1678.516373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1678.516373 (E_RNA) where: Base-Base interactions energy: -1068.668 where: short stacking energy: -486.608 Base-Backbone interact. energy: 5.158 local terms energy: -615.006618 where: bonds (distance) C4'-P energy: -145.976 bonds (distance) P-C4' energy: -133.588 flat angles C4'-P-C4' energy: -141.741 flat angles P-C4'-P energy: -91.993 tors. eta vs tors. theta energy: -101.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1434.014632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.014632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.014632 (E_RNA) where: Base-Base interactions energy: -862.592 where: short stacking energy: -395.193 Base-Backbone interact. energy: -3.090 local terms energy: -568.332280 where: bonds (distance) C4'-P energy: -159.008 bonds (distance) P-C4' energy: -143.029 flat angles C4'-P-C4' energy: -103.865 flat angles P-C4'-P energy: -80.088 tors. eta vs tors. theta energy: -82.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1287.864467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.864467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.864467 (E_RNA) where: Base-Base interactions energy: -774.610 where: short stacking energy: -394.129 Base-Backbone interact. energy: -1.278 local terms energy: -511.976669 where: bonds (distance) C4'-P energy: -125.183 bonds (distance) P-C4' energy: -112.696 flat angles C4'-P-C4' energy: -119.504 flat angles P-C4'-P energy: -90.324 tors. eta vs tors. theta energy: -64.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1006.150629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.150629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.150629 (E_RNA) where: Base-Base interactions energy: -550.821 where: short stacking energy: -321.340 Base-Backbone interact. energy: 0.387 local terms energy: -455.717000 where: bonds (distance) C4'-P energy: -103.005 bonds (distance) P-C4' energy: -119.757 flat angles C4'-P-C4' energy: -127.475 flat angles P-C4'-P energy: -59.833 tors. eta vs tors. theta energy: -45.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -638.081211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.081211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.081211 (E_RNA) where: Base-Base interactions energy: -247.014 where: short stacking energy: -194.646 Base-Backbone interact. energy: 2.449 local terms energy: -393.516444 where: bonds (distance) C4'-P energy: -128.211 bonds (distance) P-C4' energy: -129.934 flat angles C4'-P-C4' energy: -99.240 flat angles P-C4'-P energy: -65.531 tors. eta vs tors. theta energy: 29.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)