SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-delta1-300-79d74bda/inputs/seq.fa: 1 curr_seq: _UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UACAAACCGGAGUUUUCUUUGCGCCAUUAGCCUGAGUUGGAGAUGACACCCCCCCGGCCGAACCCCCGGCCGUCGCCGCCGCGGUGGGCGGGCCCUCCCGCUGAAAACCGAUGCCUCUUCCUCCGGAGCCGGGCCGCUCUCUAUCCCCCUCCCCUCCGGCCGCGCCACUAACCGCCUUCGCGGCCGCGUUCGGGGGGCAGGUGGGAGUGCGGUCUGAGGGCCUCCCAGCGCGCCGGCGGCGGGUAACCGCGGCUCCAGGGGCUGCAGUGGCGCUGGGGGCGCUCCGACGAAAAGAAGCGC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 300 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1505 n_atoms_counter: 1505 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 300.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -1226.482832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.482832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.482832 (E_RNA) where: Base-Base interactions energy: -59.033 where: short stacking energy: -59.033 Base-Backbone interact. energy: -0.000 local terms energy: -1167.449273 where: bonds (distance) C4'-P energy: -291.473 bonds (distance) P-C4' energy: -269.290 flat angles C4'-P-C4' energy: -220.267 flat angles P-C4'-P energy: -251.962 tors. eta vs tors. theta energy: -134.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1477.677965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.677965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.677965 (E_RNA) where: Base-Base interactions energy: -619.415 where: short stacking energy: -619.030 Base-Backbone interact. energy: -0.027 local terms energy: -858.235735 where: bonds (distance) C4'-P energy: -198.830 bonds (distance) P-C4' energy: -185.982 flat angles C4'-P-C4' energy: -208.585 flat angles P-C4'-P energy: -104.856 tors. eta vs tors. theta energy: -159.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1440.492563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1440.492563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1440.492563 (E_RNA) where: Base-Base interactions energy: -608.514 where: short stacking energy: -607.809 Base-Backbone interact. energy: -0.075 local terms energy: -831.903731 where: bonds (distance) C4'-P energy: -194.256 bonds (distance) P-C4' energy: -192.380 flat angles C4'-P-C4' energy: -183.213 flat angles P-C4'-P energy: -111.864 tors. eta vs tors. theta energy: -150.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1383.177515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.177515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.177515 (E_RNA) where: Base-Base interactions energy: -578.849 where: short stacking energy: -571.288 Base-Backbone interact. energy: -0.212 local terms energy: -804.116176 where: bonds (distance) C4'-P energy: -185.578 bonds (distance) P-C4' energy: -189.677 flat angles C4'-P-C4' energy: -176.128 flat angles P-C4'-P energy: -116.201 tors. eta vs tors. theta energy: -136.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1295.204250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.204250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.204250 (E_RNA) where: Base-Base interactions energy: -543.419 where: short stacking energy: -538.274 Base-Backbone interact. energy: -0.538 local terms energy: -751.247703 where: bonds (distance) C4'-P energy: -167.846 bonds (distance) P-C4' energy: -181.548 flat angles C4'-P-C4' energy: -176.946 flat angles P-C4'-P energy: -100.961 tors. eta vs tors. theta energy: -123.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1235.978568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.978568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1235.978568 (E_RNA) where: Base-Base interactions energy: -86.797 where: short stacking energy: -86.797 Base-Backbone interact. energy: -0.000 local terms energy: -1149.181012 where: bonds (distance) C4'-P energy: -282.278 bonds (distance) P-C4' energy: -259.439 flat angles C4'-P-C4' energy: -220.717 flat angles P-C4'-P energy: -249.971 tors. eta vs tors. theta energy: -136.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1253.628559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.628559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.628559 (E_RNA) where: Base-Base interactions energy: -135.062 where: short stacking energy: -135.062 Base-Backbone interact. energy: -0.000 local terms energy: -1118.566444 where: bonds (distance) C4'-P energy: -267.091 bonds (distance) P-C4' energy: -243.604 flat angles C4'-P-C4' energy: -218.838 flat angles P-C4'-P energy: -244.392 tors. eta vs tors. theta energy: -144.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -1250.278175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.278175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.278175 (E_RNA) where: Base-Base interactions energy: -193.262 where: short stacking energy: -193.262 Base-Backbone interact. energy: -0.000 local terms energy: -1057.015531 where: bonds (distance) C4'-P energy: -234.707 bonds (distance) P-C4' energy: -220.172 flat angles C4'-P-C4' energy: -219.235 flat angles P-C4'-P energy: -234.283 tors. eta vs tors. theta energy: -148.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -1241.257413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1241.257413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1241.257413 (E_RNA) where: Base-Base interactions energy: -109.206 where: short stacking energy: -109.206 Base-Backbone interact. energy: -0.000 local terms energy: -1132.051336 where: bonds (distance) C4'-P energy: -274.450 bonds (distance) P-C4' energy: -251.039 flat angles C4'-P-C4' energy: -218.833 flat angles P-C4'-P energy: -246.883 tors. eta vs tors. theta energy: -140.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -1234.062081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.062081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1234.062081 (E_RNA) where: Base-Base interactions energy: -81.022 where: short stacking energy: -81.022 Base-Backbone interact. energy: -0.000 local terms energy: -1153.039689 where: bonds (distance) C4'-P energy: -286.477 bonds (distance) P-C4' energy: -262.582 flat angles C4'-P-C4' energy: -218.362 flat angles P-C4'-P energy: -249.008 tors. eta vs tors. theta energy: -136.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -1244.396815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.396815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.396815 (E_RNA) where: Base-Base interactions energy: -159.328 where: short stacking energy: -159.328 Base-Backbone interact. energy: -0.000 local terms energy: -1085.068596 where: bonds (distance) C4'-P energy: -257.646 bonds (distance) P-C4' energy: -218.498 flat angles C4'-P-C4' energy: -221.031 flat angles P-C4'-P energy: -239.806 tors. eta vs tors. theta energy: -148.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1554.047845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1554.047845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1554.047845 (E_RNA) where: Base-Base interactions energy: -715.612 where: short stacking energy: -715.612 Base-Backbone interact. energy: 0.127 local terms energy: -838.562333 where: bonds (distance) C4'-P energy: -188.009 bonds (distance) P-C4' energy: -176.625 flat angles C4'-P-C4' energy: -195.450 flat angles P-C4'-P energy: -124.284 tors. eta vs tors. theta energy: -154.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1434.838601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.838601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.838601 (E_RNA) where: Base-Base interactions energy: -626.523 where: short stacking energy: -622.352 Base-Backbone interact. energy: -0.422 local terms energy: -807.893723 where: bonds (distance) C4'-P energy: -175.402 bonds (distance) P-C4' energy: -196.406 flat angles C4'-P-C4' energy: -192.940 flat angles P-C4'-P energy: -103.071 tors. eta vs tors. theta energy: -140.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1391.614113 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.614113 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.614113 (E_RNA) where: Base-Base interactions energy: -626.695 where: short stacking energy: -619.654 Base-Backbone interact. energy: 0.101 local terms energy: -765.020225 where: bonds (distance) C4'-P energy: -160.652 bonds (distance) P-C4' energy: -180.969 flat angles C4'-P-C4' energy: -192.307 flat angles P-C4'-P energy: -112.177 tors. eta vs tors. theta energy: -118.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1285.223782 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.223782 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.223782 (E_RNA) where: Base-Base interactions energy: -525.556 where: short stacking energy: -520.171 Base-Backbone interact. energy: -0.339 local terms energy: -759.328906 where: bonds (distance) C4'-P energy: -186.356 bonds (distance) P-C4' energy: -170.683 flat angles C4'-P-C4' energy: -177.288 flat angles P-C4'-P energy: -103.729 tors. eta vs tors. theta energy: -121.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1163.868216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.868216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.868216 (E_RNA) where: Base-Base interactions energy: -485.797 where: short stacking energy: -471.577 Base-Backbone interact. energy: 0.735 local terms energy: -678.806334 where: bonds (distance) C4'-P energy: -156.526 bonds (distance) P-C4' energy: -169.593 flat angles C4'-P-C4' energy: -177.079 flat angles P-C4'-P energy: -89.784 tors. eta vs tors. theta energy: -85.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1072.721016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.721016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.721016 (E_RNA) where: Base-Base interactions energy: -449.526 where: short stacking energy: -440.237 Base-Backbone interact. energy: 1.956 local terms energy: -625.151310 where: bonds (distance) C4'-P energy: -161.256 bonds (distance) P-C4' energy: -161.299 flat angles C4'-P-C4' energy: -147.582 flat angles P-C4'-P energy: -80.597 tors. eta vs tors. theta energy: -74.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -997.822426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -997.822426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -997.822426 (E_RNA) where: Base-Base interactions energy: -413.786 where: short stacking energy: -398.343 Base-Backbone interact. energy: -0.672 local terms energy: -583.364329 where: bonds (distance) C4'-P energy: -121.509 bonds (distance) P-C4' energy: -169.454 flat angles C4'-P-C4' energy: -150.648 flat angles P-C4'-P energy: -83.716 tors. eta vs tors. theta energy: -58.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -937.690770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.690770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.690770 (E_RNA) where: Base-Base interactions energy: -385.047 where: short stacking energy: -355.664 Base-Backbone interact. energy: 4.746 local terms energy: -557.389543 where: bonds (distance) C4'-P energy: -136.139 bonds (distance) P-C4' energy: -166.905 flat angles C4'-P-C4' energy: -136.390 flat angles P-C4'-P energy: -67.935 tors. eta vs tors. theta energy: -50.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -814.168690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.168690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.168690 (E_RNA) where: Base-Base interactions energy: -301.028 where: short stacking energy: -278.081 Base-Backbone interact. energy: 2.441 local terms energy: -515.581551 where: bonds (distance) C4'-P energy: -128.352 bonds (distance) P-C4' energy: -172.863 flat angles C4'-P-C4' energy: -118.995 flat angles P-C4'-P energy: -74.847 tors. eta vs tors. theta energy: -20.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -772.722126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.722126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.722126 (E_RNA) where: Base-Base interactions energy: -280.427 where: short stacking energy: -270.118 Base-Backbone interact. energy: -0.392 local terms energy: -491.903656 where: bonds (distance) C4'-P energy: -156.669 bonds (distance) P-C4' energy: -146.198 flat angles C4'-P-C4' energy: -103.086 flat angles P-C4'-P energy: -76.764 tors. eta vs tors. theta energy: -9.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1595.799301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.799301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.799301 (E_RNA) where: Base-Base interactions energy: -714.824 where: short stacking energy: -701.998 Base-Backbone interact. energy: -0.702 local terms energy: -880.272926 where: bonds (distance) C4'-P energy: -184.751 bonds (distance) P-C4' energy: -198.902 flat angles C4'-P-C4' energy: -202.211 flat angles P-C4'-P energy: -119.162 tors. eta vs tors. theta energy: -175.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1488.813970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.813970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.813970 (E_RNA) where: Base-Base interactions energy: -667.996 where: short stacking energy: -644.669 Base-Backbone interact. energy: -0.159 local terms energy: -820.659054 where: bonds (distance) C4'-P energy: -171.837 bonds (distance) P-C4' energy: -185.688 flat angles C4'-P-C4' energy: -183.545 flat angles P-C4'-P energy: -128.926 tors. eta vs tors. theta energy: -150.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1408.883132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.883132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.883132 (E_RNA) where: Base-Base interactions energy: -608.589 where: short stacking energy: -591.908 Base-Backbone interact. energy: -0.461 local terms energy: -799.832476 where: bonds (distance) C4'-P energy: -184.626 bonds (distance) P-C4' energy: -182.809 flat angles C4'-P-C4' energy: -186.666 flat angles P-C4'-P energy: -98.337 tors. eta vs tors. theta energy: -147.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1271.222935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.222935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.222935 (E_RNA) where: Base-Base interactions energy: -561.116 where: short stacking energy: -536.668 Base-Backbone interact. energy: -1.221 local terms energy: -708.886415 where: bonds (distance) C4'-P energy: -140.705 bonds (distance) P-C4' energy: -180.794 flat angles C4'-P-C4' energy: -164.069 flat angles P-C4'-P energy: -126.964 tors. eta vs tors. theta energy: -96.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1159.906492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.906492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.906492 (E_RNA) where: Base-Base interactions energy: -499.978 where: short stacking energy: -476.806 Base-Backbone interact. energy: 4.353 local terms energy: -664.280624 where: bonds (distance) C4'-P energy: -167.846 bonds (distance) P-C4' energy: -170.290 flat angles C4'-P-C4' energy: -160.847 flat angles P-C4'-P energy: -96.399 tors. eta vs tors. theta energy: -68.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -1066.979906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.979906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.979906 (E_RNA) where: Base-Base interactions energy: -430.061 where: short stacking energy: -419.003 Base-Backbone interact. energy: -0.051 local terms energy: -636.867543 where: bonds (distance) C4'-P energy: -165.369 bonds (distance) P-C4' energy: -176.613 flat angles C4'-P-C4' energy: -135.052 flat angles P-C4'-P energy: -90.503 tors. eta vs tors. theta energy: -69.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -1040.536834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.536834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.536834 (E_RNA) where: Base-Base interactions energy: -466.688 where: short stacking energy: -377.599 Base-Backbone interact. energy: 1.902 local terms energy: -575.750702 where: bonds (distance) C4'-P energy: -147.304 bonds (distance) P-C4' energy: -171.207 flat angles C4'-P-C4' energy: -139.561 flat angles P-C4'-P energy: -77.380 tors. eta vs tors. theta energy: -40.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -901.586846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.586846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.586846 (E_RNA) where: Base-Base interactions energy: -364.302 where: short stacking energy: -309.964 Base-Backbone interact. energy: 1.775 local terms energy: -539.060197 where: bonds (distance) C4'-P energy: -152.814 bonds (distance) P-C4' energy: -144.916 flat angles C4'-P-C4' energy: -148.880 flat angles P-C4'-P energy: -61.511 tors. eta vs tors. theta energy: -30.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -852.792872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.792872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.792872 (E_RNA) where: Base-Base interactions energy: -369.375 where: short stacking energy: -274.065 Base-Backbone interact. energy: 2.922 local terms energy: -486.340358 where: bonds (distance) C4'-P energy: -147.991 bonds (distance) P-C4' energy: -159.213 flat angles C4'-P-C4' energy: -118.604 flat angles P-C4'-P energy: -76.433 tors. eta vs tors. theta energy: 15.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -740.240296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.240296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.240296 (E_RNA) where: Base-Base interactions energy: -272.330 where: short stacking energy: -221.901 Base-Backbone interact. energy: -1.423 local terms energy: -466.487212 where: bonds (distance) C4'-P energy: -145.099 bonds (distance) P-C4' energy: -157.903 flat angles C4'-P-C4' energy: -126.613 flat angles P-C4'-P energy: -65.418 tors. eta vs tors. theta energy: 28.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1665.284766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.284766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.284766 (E_RNA) where: Base-Base interactions energy: -788.419 where: short stacking energy: -779.274 Base-Backbone interact. energy: -0.411 local terms energy: -876.453974 where: bonds (distance) C4'-P energy: -166.006 bonds (distance) P-C4' energy: -205.083 flat angles C4'-P-C4' energy: -187.627 flat angles P-C4'-P energy: -123.314 tors. eta vs tors. theta energy: -194.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1537.173803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.173803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.173803 (E_RNA) where: Base-Base interactions energy: -709.867 where: short stacking energy: -691.336 Base-Backbone interact. energy: 1.201 local terms energy: -828.507829 where: bonds (distance) C4'-P energy: -180.263 bonds (distance) P-C4' energy: -182.157 flat angles C4'-P-C4' energy: -197.881 flat angles P-C4'-P energy: -100.240 tors. eta vs tors. theta energy: -167.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1392.142517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.142517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.142517 (E_RNA) where: Base-Base interactions energy: -601.570 where: short stacking energy: -559.781 Base-Backbone interact. energy: -2.657 local terms energy: -787.915051 where: bonds (distance) C4'-P energy: -179.550 bonds (distance) P-C4' energy: -181.392 flat angles C4'-P-C4' energy: -191.629 flat angles P-C4'-P energy: -122.352 tors. eta vs tors. theta energy: -112.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1370.998281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.998281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.998281 (E_RNA) where: Base-Base interactions energy: -648.960 where: short stacking energy: -572.934 Base-Backbone interact. energy: -0.860 local terms energy: -721.178100 where: bonds (distance) C4'-P energy: -154.294 bonds (distance) P-C4' energy: -170.990 flat angles C4'-P-C4' energy: -182.634 flat angles P-C4'-P energy: -103.361 tors. eta vs tors. theta energy: -109.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1229.484974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.484974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.484974 (E_RNA) where: Base-Base interactions energy: -543.964 where: short stacking energy: -511.671 Base-Backbone interact. energy: -2.136 local terms energy: -683.384809 where: bonds (distance) C4'-P energy: -171.761 bonds (distance) P-C4' energy: -169.026 flat angles C4'-P-C4' energy: -143.134 flat angles P-C4'-P energy: -100.943 tors. eta vs tors. theta energy: -98.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -1138.387988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.387988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.387988 (E_RNA) where: Base-Base interactions energy: -519.458 where: short stacking energy: -435.186 Base-Backbone interact. energy: 0.136 local terms energy: -619.066477 where: bonds (distance) C4'-P energy: -156.589 bonds (distance) P-C4' energy: -157.674 flat angles C4'-P-C4' energy: -150.699 flat angles P-C4'-P energy: -80.321 tors. eta vs tors. theta energy: -73.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -1034.329854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1034.329854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1034.329854 (E_RNA) where: Base-Base interactions energy: -473.865 where: short stacking energy: -399.275 Base-Backbone interact. energy: 5.621 local terms energy: -566.085665 where: bonds (distance) C4'-P energy: -138.871 bonds (distance) P-C4' energy: -152.136 flat angles C4'-P-C4' energy: -136.666 flat angles P-C4'-P energy: -85.963 tors. eta vs tors. theta energy: -52.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -937.751816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -937.751816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -937.751816 (E_RNA) where: Base-Base interactions energy: -402.236 where: short stacking energy: -316.817 Base-Backbone interact. energy: 0.677 local terms energy: -536.193520 where: bonds (distance) C4'-P energy: -150.143 bonds (distance) P-C4' energy: -152.655 flat angles C4'-P-C4' energy: -143.710 flat angles P-C4'-P energy: -68.153 tors. eta vs tors. theta energy: -21.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -827.132688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.132688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.132688 (E_RNA) where: Base-Base interactions energy: -300.180 where: short stacking energy: -257.303 Base-Backbone interact. energy: 2.388 local terms energy: -529.340599 where: bonds (distance) C4'-P energy: -160.127 bonds (distance) P-C4' energy: -144.488 flat angles C4'-P-C4' energy: -139.947 flat angles P-C4'-P energy: -72.880 tors. eta vs tors. theta energy: -11.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -772.421593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.421593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.421593 (E_RNA) where: Base-Base interactions energy: -311.474 where: short stacking energy: -251.501 Base-Backbone interact. energy: 4.811 local terms energy: -465.758897 where: bonds (distance) C4'-P energy: -128.295 bonds (distance) P-C4' energy: -151.460 flat angles C4'-P-C4' energy: -128.435 flat angles P-C4'-P energy: -80.612 tors. eta vs tors. theta energy: 23.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1697.301085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1697.301085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1697.301085 (E_RNA) where: Base-Base interactions energy: -818.303 where: short stacking energy: -772.107 Base-Backbone interact. energy: -0.634 local terms energy: -878.364181 where: bonds (distance) C4'-P energy: -185.558 bonds (distance) P-C4' energy: -184.022 flat angles C4'-P-C4' energy: -197.846 flat angles P-C4'-P energy: -122.121 tors. eta vs tors. theta energy: -188.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1566.736255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.736255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.736255 (E_RNA) where: Base-Base interactions energy: -720.354 where: short stacking energy: -673.901 Base-Backbone interact. energy: 0.193 local terms energy: -846.574718 where: bonds (distance) C4'-P energy: -200.463 bonds (distance) P-C4' energy: -167.029 flat angles C4'-P-C4' energy: -184.112 flat angles P-C4'-P energy: -117.678 tors. eta vs tors. theta energy: -177.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1426.771964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.771964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.771964 (E_RNA) where: Base-Base interactions energy: -690.452 where: short stacking energy: -569.071 Base-Backbone interact. energy: 3.659 local terms energy: -739.978562 where: bonds (distance) C4'-P energy: -168.344 bonds (distance) P-C4' energy: -174.613 flat angles C4'-P-C4' energy: -191.161 flat angles P-C4'-P energy: -90.083 tors. eta vs tors. theta energy: -115.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1385.775177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.775177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.775177 (E_RNA) where: Base-Base interactions energy: -649.631 where: short stacking energy: -575.240 Base-Backbone interact. energy: -4.258 local terms energy: -731.885408 where: bonds (distance) C4'-P energy: -155.271 bonds (distance) P-C4' energy: -173.791 flat angles C4'-P-C4' energy: -187.144 flat angles P-C4'-P energy: -100.952 tors. eta vs tors. theta energy: -114.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1238.276668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.276668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.276668 (E_RNA) where: Base-Base interactions energy: -545.359 where: short stacking energy: -460.725 Base-Backbone interact. energy: 1.348 local terms energy: -694.265333 where: bonds (distance) C4'-P energy: -171.385 bonds (distance) P-C4' energy: -173.770 flat angles C4'-P-C4' energy: -176.173 flat angles P-C4'-P energy: -80.605 tors. eta vs tors. theta energy: -92.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1167.969471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.969471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.969471 (E_RNA) where: Base-Base interactions energy: -545.470 where: short stacking energy: -385.940 Base-Backbone interact. energy: -6.022 local terms energy: -616.477587 where: bonds (distance) C4'-P energy: -151.295 bonds (distance) P-C4' energy: -168.444 flat angles C4'-P-C4' energy: -153.449 flat angles P-C4'-P energy: -97.521 tors. eta vs tors. theta energy: -45.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -1088.989015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.989015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.989015 (E_RNA) where: Base-Base interactions energy: -511.308 where: short stacking energy: -404.010 Base-Backbone interact. energy: 1.409 local terms energy: -579.089394 where: bonds (distance) C4'-P energy: -130.888 bonds (distance) P-C4' energy: -154.082 flat angles C4'-P-C4' energy: -141.257 flat angles P-C4'-P energy: -106.133 tors. eta vs tors. theta energy: -46.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -897.303905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.303905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.303905 (E_RNA) where: Base-Base interactions energy: -359.178 where: short stacking energy: -298.198 Base-Backbone interact. energy: 1.912 local terms energy: -540.037906 where: bonds (distance) C4'-P energy: -155.829 bonds (distance) P-C4' energy: -163.137 flat angles C4'-P-C4' energy: -137.710 flat angles P-C4'-P energy: -70.782 tors. eta vs tors. theta energy: -12.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -770.162036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.162036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.162036 (E_RNA) where: Base-Base interactions energy: -314.671 where: short stacking energy: -258.805 Base-Backbone interact. energy: 3.776 local terms energy: -459.267456 where: bonds (distance) C4'-P energy: -141.854 bonds (distance) P-C4' energy: -174.737 flat angles C4'-P-C4' energy: -117.890 flat angles P-C4'-P energy: -61.648 tors. eta vs tors. theta energy: 36.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -794.024691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.024691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.024691 (E_RNA) where: Base-Base interactions energy: -333.647 where: short stacking energy: -245.991 Base-Backbone interact. energy: 4.848 local terms energy: -465.225653 where: bonds (distance) C4'-P energy: -142.373 bonds (distance) P-C4' energy: -137.047 flat angles C4'-P-C4' energy: -117.150 flat angles P-C4'-P energy: -67.738 tors. eta vs tors. theta energy: -0.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1689.597925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.597925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.597925 (E_RNA) where: Base-Base interactions energy: -810.992 where: short stacking energy: -746.853 Base-Backbone interact. energy: -0.155 local terms energy: -878.451429 where: bonds (distance) C4'-P energy: -177.824 bonds (distance) P-C4' energy: -184.905 flat angles C4'-P-C4' energy: -210.856 flat angles P-C4'-P energy: -120.245 tors. eta vs tors. theta energy: -184.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1565.491992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.491992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.491992 (E_RNA) where: Base-Base interactions energy: -712.698 where: short stacking energy: -660.033 Base-Backbone interact. energy: 1.269 local terms energy: -854.063002 where: bonds (distance) C4'-P energy: -182.778 bonds (distance) P-C4' energy: -195.450 flat angles C4'-P-C4' energy: -188.166 flat angles P-C4'-P energy: -120.866 tors. eta vs tors. theta energy: -166.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1463.683831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.683831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.683831 (E_RNA) where: Base-Base interactions energy: -700.007 where: short stacking energy: -593.843 Base-Backbone interact. energy: -1.789 local terms energy: -761.888007 where: bonds (distance) C4'-P energy: -177.155 bonds (distance) P-C4' energy: -190.580 flat angles C4'-P-C4' energy: -178.214 flat angles P-C4'-P energy: -96.366 tors. eta vs tors. theta energy: -119.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1410.173372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1410.173372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1410.173372 (E_RNA) where: Base-Base interactions energy: -682.765 where: short stacking energy: -545.679 Base-Backbone interact. energy: 0.970 local terms energy: -728.378633 where: bonds (distance) C4'-P energy: -159.899 bonds (distance) P-C4' energy: -173.283 flat angles C4'-P-C4' energy: -181.050 flat angles P-C4'-P energy: -112.327 tors. eta vs tors. theta energy: -101.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1212.556756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.556756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.556756 (E_RNA) where: Base-Base interactions energy: -562.176 where: short stacking energy: -441.902 Base-Backbone interact. energy: 3.113 local terms energy: -653.494096 where: bonds (distance) C4'-P energy: -169.297 bonds (distance) P-C4' energy: -163.002 flat angles C4'-P-C4' energy: -153.637 flat angles P-C4'-P energy: -93.196 tors. eta vs tors. theta energy: -74.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1210.921300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.921300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.921300 (E_RNA) where: Base-Base interactions energy: -544.195 where: short stacking energy: -449.751 Base-Backbone interact. energy: 4.979 local terms energy: -671.705790 where: bonds (distance) C4'-P energy: -153.956 bonds (distance) P-C4' energy: -187.524 flat angles C4'-P-C4' energy: -165.182 flat angles P-C4'-P energy: -90.156 tors. eta vs tors. theta energy: -74.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -1101.085320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.085320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.085320 (E_RNA) where: Base-Base interactions energy: -514.412 where: short stacking energy: -363.124 Base-Backbone interact. energy: -1.125 local terms energy: -585.547534 where: bonds (distance) C4'-P energy: -155.299 bonds (distance) P-C4' energy: -160.800 flat angles C4'-P-C4' energy: -144.616 flat angles P-C4'-P energy: -94.266 tors. eta vs tors. theta energy: -30.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -913.642745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -913.642745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -913.642745 (E_RNA) where: Base-Base interactions energy: -407.368 where: short stacking energy: -319.205 Base-Backbone interact. energy: 1.135 local terms energy: -507.410314 where: bonds (distance) C4'-P energy: -147.984 bonds (distance) P-C4' energy: -139.064 flat angles C4'-P-C4' energy: -124.377 flat angles P-C4'-P energy: -90.723 tors. eta vs tors. theta energy: -5.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -836.289316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.289316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.289316 (E_RNA) where: Base-Base interactions energy: -346.002 where: short stacking energy: -296.620 Base-Backbone interact. energy: -3.642 local terms energy: -486.645193 where: bonds (distance) C4'-P energy: -140.328 bonds (distance) P-C4' energy: -161.765 flat angles C4'-P-C4' energy: -119.210 flat angles P-C4'-P energy: -63.025 tors. eta vs tors. theta energy: -2.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -741.438535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.438535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.438535 (E_RNA) where: Base-Base interactions energy: -285.727 where: short stacking energy: -239.258 Base-Backbone interact. energy: 2.810 local terms energy: -458.521646 where: bonds (distance) C4'-P energy: -129.401 bonds (distance) P-C4' energy: -148.494 flat angles C4'-P-C4' energy: -125.767 flat angles P-C4'-P energy: -87.197 tors. eta vs tors. theta energy: 32.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1736.572506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1736.572506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.572506 (E_RNA) where: Base-Base interactions energy: -858.657 where: short stacking energy: -769.512 Base-Backbone interact. energy: 0.577 local terms energy: -878.492937 where: bonds (distance) C4'-P energy: -174.805 bonds (distance) P-C4' energy: -194.197 flat angles C4'-P-C4' energy: -205.102 flat angles P-C4'-P energy: -123.678 tors. eta vs tors. theta energy: -180.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1594.683222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1594.683222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1594.683222 (E_RNA) where: Base-Base interactions energy: -777.775 where: short stacking energy: -692.489 Base-Backbone interact. energy: -1.186 local terms energy: -815.721403 where: bonds (distance) C4'-P energy: -188.329 bonds (distance) P-C4' energy: -174.339 flat angles C4'-P-C4' energy: -191.250 flat angles P-C4'-P energy: -112.158 tors. eta vs tors. theta energy: -149.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1543.465692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.465692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.465692 (E_RNA) where: Base-Base interactions energy: -741.314 where: short stacking energy: -587.308 Base-Backbone interact. energy: -0.140 local terms energy: -802.011323 where: bonds (distance) C4'-P energy: -186.252 bonds (distance) P-C4' energy: -179.808 flat angles C4'-P-C4' energy: -186.980 flat angles P-C4'-P energy: -127.374 tors. eta vs tors. theta energy: -121.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1524.386525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1524.386525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1524.386525 (E_RNA) where: Base-Base interactions energy: -800.879 where: short stacking energy: -552.378 Base-Backbone interact. energy: -2.766 local terms energy: -720.742274 where: bonds (distance) C4'-P energy: -161.411 bonds (distance) P-C4' energy: -174.822 flat angles C4'-P-C4' energy: -169.122 flat angles P-C4'-P energy: -94.113 tors. eta vs tors. theta energy: -121.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1270.389956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.389956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.389956 (E_RNA) where: Base-Base interactions energy: -607.151 where: short stacking energy: -487.122 Base-Backbone interact. energy: -1.105 local terms energy: -662.134123 where: bonds (distance) C4'-P energy: -167.382 bonds (distance) P-C4' energy: -159.832 flat angles C4'-P-C4' energy: -164.312 flat angles P-C4'-P energy: -94.548 tors. eta vs tors. theta energy: -76.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1190.880355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.880355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.880355 (E_RNA) where: Base-Base interactions energy: -531.275 where: short stacking energy: -427.445 Base-Backbone interact. energy: 1.361 local terms energy: -660.966194 where: bonds (distance) C4'-P energy: -147.624 bonds (distance) P-C4' energy: -186.641 flat angles C4'-P-C4' energy: -157.717 flat angles P-C4'-P energy: -104.554 tors. eta vs tors. theta energy: -64.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1168.656558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.656558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.656558 (E_RNA) where: Base-Base interactions energy: -595.515 where: short stacking energy: -402.145 Base-Backbone interact. energy: -1.464 local terms energy: -571.677389 where: bonds (distance) C4'-P energy: -141.449 bonds (distance) P-C4' energy: -152.613 flat angles C4'-P-C4' energy: -148.037 flat angles P-C4'-P energy: -88.554 tors. eta vs tors. theta energy: -41.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -1002.070475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1002.070475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1002.070475 (E_RNA) where: Base-Base interactions energy: -484.982 where: short stacking energy: -337.489 Base-Backbone interact. energy: -2.646 local terms energy: -514.442073 where: bonds (distance) C4'-P energy: -141.212 bonds (distance) P-C4' energy: -137.877 flat angles C4'-P-C4' energy: -138.778 flat angles P-C4'-P energy: -90.446 tors. eta vs tors. theta energy: -6.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -867.579415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -867.579415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.579415 (E_RNA) where: Base-Base interactions energy: -357.409 where: short stacking energy: -298.104 Base-Backbone interact. energy: 1.245 local terms energy: -511.415578 where: bonds (distance) C4'-P energy: -152.193 bonds (distance) P-C4' energy: -153.529 flat angles C4'-P-C4' energy: -135.232 flat angles P-C4'-P energy: -58.648 tors. eta vs tors. theta energy: -11.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -815.829630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.829630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.829630 (E_RNA) where: Base-Base interactions energy: -343.948 where: short stacking energy: -259.350 Base-Backbone interact. energy: 10.435 local terms energy: -482.317055 where: bonds (distance) C4'-P energy: -132.093 bonds (distance) P-C4' energy: -156.331 flat angles C4'-P-C4' energy: -131.341 flat angles P-C4'-P energy: -71.577 tors. eta vs tors. theta energy: 9.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1787.145495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.145495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.145495 (E_RNA) where: Base-Base interactions energy: -928.287 where: short stacking energy: -739.974 Base-Backbone interact. energy: 1.535 local terms energy: -860.392949 where: bonds (distance) C4'-P energy: -182.451 bonds (distance) P-C4' energy: -187.259 flat angles C4'-P-C4' energy: -201.926 flat angles P-C4'-P energy: -113.798 tors. eta vs tors. theta energy: -174.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1606.120789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1606.120789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1606.120789 (E_RNA) where: Base-Base interactions energy: -785.420 where: short stacking energy: -710.432 Base-Backbone interact. energy: -1.819 local terms energy: -818.882252 where: bonds (distance) C4'-P energy: -169.466 bonds (distance) P-C4' energy: -174.171 flat angles C4'-P-C4' energy: -187.847 flat angles P-C4'-P energy: -110.371 tors. eta vs tors. theta energy: -177.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1681.449766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.449766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.449766 (E_RNA) where: Base-Base interactions energy: -882.165 where: short stacking energy: -670.999 Base-Backbone interact. energy: 1.461 local terms energy: -800.745257 where: bonds (distance) C4'-P energy: -159.590 bonds (distance) P-C4' energy: -186.375 flat angles C4'-P-C4' energy: -191.502 flat angles P-C4'-P energy: -122.102 tors. eta vs tors. theta energy: -141.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1599.913156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.913156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.913156 (E_RNA) where: Base-Base interactions energy: -859.038 where: short stacking energy: -588.520 Base-Backbone interact. energy: -2.482 local terms energy: -738.393525 where: bonds (distance) C4'-P energy: -172.219 bonds (distance) P-C4' energy: -169.732 flat angles C4'-P-C4' energy: -160.817 flat angles P-C4'-P energy: -104.056 tors. eta vs tors. theta energy: -131.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1303.868019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.868019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.868019 (E_RNA) where: Base-Base interactions energy: -620.293 where: short stacking energy: -487.957 Base-Backbone interact. energy: 2.107 local terms energy: -685.681978 where: bonds (distance) C4'-P energy: -161.799 bonds (distance) P-C4' energy: -170.330 flat angles C4'-P-C4' energy: -167.436 flat angles P-C4'-P energy: -107.087 tors. eta vs tors. theta energy: -79.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1305.365466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.365466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.365466 (E_RNA) where: Base-Base interactions energy: -646.779 where: short stacking energy: -408.309 Base-Backbone interact. energy: 5.432 local terms energy: -664.017778 where: bonds (distance) C4'-P energy: -160.821 bonds (distance) P-C4' energy: -179.945 flat angles C4'-P-C4' energy: -148.402 flat angles P-C4'-P energy: -119.658 tors. eta vs tors. theta energy: -55.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -1038.521822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.521822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.521822 (E_RNA) where: Base-Base interactions energy: -459.774 where: short stacking energy: -398.312 Base-Backbone interact. energy: 1.467 local terms energy: -580.214106 where: bonds (distance) C4'-P energy: -153.191 bonds (distance) P-C4' energy: -154.684 flat angles C4'-P-C4' energy: -147.063 flat angles P-C4'-P energy: -94.279 tors. eta vs tors. theta energy: -30.998 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -1076.454528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.454528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.454528 (E_RNA) where: Base-Base interactions energy: -556.628 where: short stacking energy: -360.438 Base-Backbone interact. energy: -3.102 local terms energy: -516.724691 where: bonds (distance) C4'-P energy: -138.680 bonds (distance) P-C4' energy: -141.307 flat angles C4'-P-C4' energy: -131.992 flat angles P-C4'-P energy: -84.684 tors. eta vs tors. theta energy: -20.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -800.160612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -800.160612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -800.160612 (E_RNA) where: Base-Base interactions energy: -298.353 where: short stacking energy: -245.608 Base-Backbone interact. energy: 2.879 local terms energy: -504.686749 where: bonds (distance) C4'-P energy: -149.051 bonds (distance) P-C4' energy: -151.268 flat angles C4'-P-C4' energy: -147.295 flat angles P-C4'-P energy: -68.616 tors. eta vs tors. theta energy: 11.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -922.180430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.180430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.180430 (E_RNA) where: Base-Base interactions energy: -429.138 where: short stacking energy: -308.215 Base-Backbone interact. energy: 12.088 local terms energy: -505.131054 where: bonds (distance) C4'-P energy: -142.845 bonds (distance) P-C4' energy: -156.803 flat angles C4'-P-C4' energy: -134.913 flat angles P-C4'-P energy: -65.100 tors. eta vs tors. theta energy: -5.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1876.187738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1876.187738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1876.187738 (E_RNA) where: Base-Base interactions energy: -1014.335 where: short stacking energy: -798.710 Base-Backbone interact. energy: 0.872 local terms energy: -862.724697 where: bonds (distance) C4'-P energy: -174.772 bonds (distance) P-C4' energy: -193.585 flat angles C4'-P-C4' energy: -198.635 flat angles P-C4'-P energy: -114.484 tors. eta vs tors. theta energy: -181.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1640.349176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1640.349176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1640.349176 (E_RNA) where: Base-Base interactions energy: -804.579 where: short stacking energy: -700.245 Base-Backbone interact. energy: 1.515 local terms energy: -837.285046 where: bonds (distance) C4'-P energy: -178.795 bonds (distance) P-C4' energy: -192.483 flat angles C4'-P-C4' energy: -188.664 flat angles P-C4'-P energy: -118.252 tors. eta vs tors. theta energy: -159.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1797.431726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1797.431726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.431726 (E_RNA) where: Base-Base interactions energy: -1023.258 where: short stacking energy: -661.347 Base-Backbone interact. energy: 8.822 local terms energy: -782.995990 where: bonds (distance) C4'-P energy: -133.836 bonds (distance) P-C4' energy: -187.829 flat angles C4'-P-C4' energy: -176.180 flat angles P-C4'-P energy: -114.285 tors. eta vs tors. theta energy: -170.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1549.661930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1549.661930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1549.661930 (E_RNA) where: Base-Base interactions energy: -804.555 where: short stacking energy: -511.654 Base-Backbone interact. energy: -4.734 local terms energy: -740.373356 where: bonds (distance) C4'-P energy: -175.535 bonds (distance) P-C4' energy: -179.189 flat angles C4'-P-C4' energy: -179.286 flat angles P-C4'-P energy: -100.506 tors. eta vs tors. theta energy: -105.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1287.814663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1287.814663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.814663 (E_RNA) where: Base-Base interactions energy: -635.066 where: short stacking energy: -448.932 Base-Backbone interact. energy: 5.823 local terms energy: -658.572190 where: bonds (distance) C4'-P energy: -160.168 bonds (distance) P-C4' energy: -187.639 flat angles C4'-P-C4' energy: -154.267 flat angles P-C4'-P energy: -75.630 tors. eta vs tors. theta energy: -80.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1416.848261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.848261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.848261 (E_RNA) where: Base-Base interactions energy: -763.660 where: short stacking energy: -490.540 Base-Backbone interact. energy: 0.605 local terms energy: -653.793073 where: bonds (distance) C4'-P energy: -170.334 bonds (distance) P-C4' energy: -153.492 flat angles C4'-P-C4' energy: -162.453 flat angles P-C4'-P energy: -83.932 tors. eta vs tors. theta energy: -83.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1317.807422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.807422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.807422 (E_RNA) where: Base-Base interactions energy: -705.171 where: short stacking energy: -419.031 Base-Backbone interact. energy: 0.472 local terms energy: -613.109327 where: bonds (distance) C4'-P energy: -176.056 bonds (distance) P-C4' energy: -172.511 flat angles C4'-P-C4' energy: -135.415 flat angles P-C4'-P energy: -74.023 tors. eta vs tors. theta energy: -55.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -992.897232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -992.897232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -992.897232 (E_RNA) where: Base-Base interactions energy: -426.771 where: short stacking energy: -316.935 Base-Backbone interact. energy: -1.762 local terms energy: -564.363854 where: bonds (distance) C4'-P energy: -172.578 bonds (distance) P-C4' energy: -167.452 flat angles C4'-P-C4' energy: -149.318 flat angles P-C4'-P energy: -69.135 tors. eta vs tors. theta energy: -5.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -1021.848087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1021.848087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.848087 (E_RNA) where: Base-Base interactions energy: -524.230 where: short stacking energy: -334.323 Base-Backbone interact. energy: 0.434 local terms energy: -498.052825 where: bonds (distance) C4'-P energy: -159.760 bonds (distance) P-C4' energy: -135.674 flat angles C4'-P-C4' energy: -134.879 flat angles P-C4'-P energy: -61.210 tors. eta vs tors. theta energy: -6.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -836.349552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.349552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.349552 (E_RNA) where: Base-Base interactions energy: -359.701 where: short stacking energy: -239.224 Base-Backbone interact. energy: 7.693 local terms energy: -484.342178 where: bonds (distance) C4'-P energy: -153.618 bonds (distance) P-C4' energy: -143.657 flat angles C4'-P-C4' energy: -134.028 flat angles P-C4'-P energy: -66.951 tors. eta vs tors. theta energy: 13.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1934.366236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1934.366236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1934.366236 (E_RNA) where: Base-Base interactions energy: -1022.804 where: short stacking energy: -785.993 Base-Backbone interact. energy: 2.612 local terms energy: -914.173961 where: bonds (distance) C4'-P energy: -206.589 bonds (distance) P-C4' energy: -172.201 flat angles C4'-P-C4' energy: -202.316 flat angles P-C4'-P energy: -139.536 tors. eta vs tors. theta energy: -193.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -2033.092419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.092419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.092419 (E_RNA) where: Base-Base interactions energy: -1185.761 where: short stacking energy: -706.578 Base-Backbone interact. energy: 3.120 local terms energy: -850.451477 where: bonds (distance) C4'-P energy: -177.355 bonds (distance) P-C4' energy: -192.069 flat angles C4'-P-C4' energy: -187.171 flat angles P-C4'-P energy: -126.423 tors. eta vs tors. theta energy: -167.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1463.671256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.671256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.671256 (E_RNA) where: Base-Base interactions energy: -685.145 where: short stacking energy: -572.520 Base-Backbone interact. energy: 1.300 local terms energy: -779.826189 where: bonds (distance) C4'-P energy: -177.189 bonds (distance) P-C4' energy: -180.207 flat angles C4'-P-C4' energy: -168.591 flat angles P-C4'-P energy: -133.160 tors. eta vs tors. theta energy: -120.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1609.279210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1609.279210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1609.279210 (E_RNA) where: Base-Base interactions energy: -879.676 where: short stacking energy: -533.731 Base-Backbone interact. energy: -2.411 local terms energy: -727.192671 where: bonds (distance) C4'-P energy: -165.600 bonds (distance) P-C4' energy: -174.918 flat angles C4'-P-C4' energy: -184.211 flat angles P-C4'-P energy: -105.215 tors. eta vs tors. theta energy: -97.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1395.570486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1395.570486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1395.570486 (E_RNA) where: Base-Base interactions energy: -680.894 where: short stacking energy: -527.403 Base-Backbone interact. energy: -1.552 local terms energy: -713.124501 where: bonds (distance) C4'-P energy: -170.809 bonds (distance) P-C4' energy: -173.149 flat angles C4'-P-C4' energy: -183.349 flat angles P-C4'-P energy: -84.101 tors. eta vs tors. theta energy: -101.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1573.838288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.838288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.838288 (E_RNA) where: Base-Base interactions energy: -946.669 where: short stacking energy: -511.897 Base-Backbone interact. energy: -1.264 local terms energy: -625.904699 where: bonds (distance) C4'-P energy: -123.537 bonds (distance) P-C4' energy: -151.503 flat angles C4'-P-C4' energy: -167.834 flat angles P-C4'-P energy: -95.503 tors. eta vs tors. theta energy: -87.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1342.255624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.255624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.255624 (E_RNA) where: Base-Base interactions energy: -713.755 where: short stacking energy: -413.079 Base-Backbone interact. energy: 1.600 local terms energy: -630.100517 where: bonds (distance) C4'-P energy: -166.177 bonds (distance) P-C4' energy: -157.818 flat angles C4'-P-C4' energy: -166.760 flat angles P-C4'-P energy: -91.422 tors. eta vs tors. theta energy: -47.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -1233.809186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.809186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.809186 (E_RNA) where: Base-Base interactions energy: -662.638 where: short stacking energy: -403.742 Base-Backbone interact. energy: 7.138 local terms energy: -578.309146 where: bonds (distance) C4'-P energy: -142.822 bonds (distance) P-C4' energy: -155.618 flat angles C4'-P-C4' energy: -163.221 flat angles P-C4'-P energy: -73.812 tors. eta vs tors. theta energy: -42.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -944.349792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.349792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.349792 (E_RNA) where: Base-Base interactions energy: -438.950 where: short stacking energy: -311.038 Base-Backbone interact. energy: 1.198 local terms energy: -506.597080 where: bonds (distance) C4'-P energy: -142.676 bonds (distance) P-C4' energy: -146.363 flat angles C4'-P-C4' energy: -136.833 flat angles P-C4'-P energy: -70.049 tors. eta vs tors. theta energy: -10.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -819.689606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.689606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.689606 (E_RNA) where: Base-Base interactions energy: -339.179 where: short stacking energy: -244.546 Base-Backbone interact. energy: 7.194 local terms energy: -487.703880 where: bonds (distance) C4'-P energy: -146.586 bonds (distance) P-C4' energy: -155.557 flat angles C4'-P-C4' energy: -140.182 flat angles P-C4'-P energy: -77.920 tors. eta vs tors. theta energy: 32.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -2206.033918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2206.033918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2206.033918 (E_RNA) where: Base-Base interactions energy: -1314.207 where: short stacking energy: -799.524 Base-Backbone interact. energy: 0.268 local terms energy: -892.095034 where: bonds (distance) C4'-P energy: -182.357 bonds (distance) P-C4' energy: -189.037 flat angles C4'-P-C4' energy: -195.055 flat angles P-C4'-P energy: -128.210 tors. eta vs tors. theta energy: -197.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1887.962311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1887.962311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1887.962311 (E_RNA) where: Base-Base interactions energy: -990.150 where: short stacking energy: -754.748 Base-Backbone interact. energy: -0.561 local terms energy: -897.251598 where: bonds (distance) C4'-P energy: -173.217 bonds (distance) P-C4' energy: -196.521 flat angles C4'-P-C4' energy: -189.727 flat angles P-C4'-P energy: -127.043 tors. eta vs tors. theta energy: -210.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1892.957174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1892.957174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1892.957174 (E_RNA) where: Base-Base interactions energy: -1106.870 where: short stacking energy: -660.738 Base-Backbone interact. energy: -2.496 local terms energy: -783.591107 where: bonds (distance) C4'-P energy: -176.964 bonds (distance) P-C4' energy: -175.367 flat angles C4'-P-C4' energy: -180.172 flat angles P-C4'-P energy: -105.850 tors. eta vs tors. theta energy: -145.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1376.113583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.113583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.113583 (E_RNA) where: Base-Base interactions energy: -677.839 where: short stacking energy: -578.528 Base-Backbone interact. energy: -1.133 local terms energy: -697.141443 where: bonds (distance) C4'-P energy: -145.453 bonds (distance) P-C4' energy: -183.761 flat angles C4'-P-C4' energy: -167.111 flat angles P-C4'-P energy: -83.144 tors. eta vs tors. theta energy: -117.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1774.971976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1774.971976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1774.971976 (E_RNA) where: Base-Base interactions energy: -1079.439 where: short stacking energy: -613.601 Base-Backbone interact. energy: 2.652 local terms energy: -698.185474 where: bonds (distance) C4'-P energy: -175.846 bonds (distance) P-C4' energy: -168.911 flat angles C4'-P-C4' energy: -147.514 flat angles P-C4'-P energy: -100.518 tors. eta vs tors. theta energy: -105.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1216.042379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.042379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.042379 (E_RNA) where: Base-Base interactions energy: -595.397 where: short stacking energy: -403.240 Base-Backbone interact. energy: 13.104 local terms energy: -633.749533 where: bonds (distance) C4'-P energy: -153.662 bonds (distance) P-C4' energy: -197.379 flat angles C4'-P-C4' energy: -144.631 flat angles P-C4'-P energy: -99.357 tors. eta vs tors. theta energy: -38.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1384.261909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.261909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.261909 (E_RNA) where: Base-Base interactions energy: -743.678 where: short stacking energy: -434.546 Base-Backbone interact. energy: -1.331 local terms energy: -639.252251 where: bonds (distance) C4'-P energy: -155.278 bonds (distance) P-C4' energy: -173.372 flat angles C4'-P-C4' energy: -154.517 flat angles P-C4'-P energy: -83.739 tors. eta vs tors. theta energy: -72.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -1363.700753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.700753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.700753 (E_RNA) where: Base-Base interactions energy: -782.101 where: short stacking energy: -441.794 Base-Backbone interact. energy: 2.166 local terms energy: -583.765369 where: bonds (distance) C4'-P energy: -136.122 bonds (distance) P-C4' energy: -141.274 flat angles C4'-P-C4' energy: -146.075 flat angles P-C4'-P energy: -85.602 tors. eta vs tors. theta energy: -74.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -977.774224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.774224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.774224 (E_RNA) where: Base-Base interactions energy: -460.325 where: short stacking energy: -300.076 Base-Backbone interact. energy: 2.875 local terms energy: -520.324279 where: bonds (distance) C4'-P energy: -163.152 bonds (distance) P-C4' energy: -166.487 flat angles C4'-P-C4' energy: -118.654 flat angles P-C4'-P energy: -61.674 tors. eta vs tors. theta energy: -10.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -856.397210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.397210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.397210 (E_RNA) where: Base-Base interactions energy: -384.849 where: short stacking energy: -291.183 Base-Backbone interact. energy: -2.148 local terms energy: -469.399976 where: bonds (distance) C4'-P energy: -131.279 bonds (distance) P-C4' energy: -149.549 flat angles C4'-P-C4' energy: -142.549 flat angles P-C4'-P energy: -56.908 tors. eta vs tors. theta energy: 10.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -2269.384914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2269.384914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2269.384914 (E_RNA) where: Base-Base interactions energy: -1328.848 where: short stacking energy: -821.577 Base-Backbone interact. energy: -1.032 local terms energy: -939.504714 where: bonds (distance) C4'-P energy: -193.008 bonds (distance) P-C4' energy: -204.910 flat angles C4'-P-C4' energy: -210.865 flat angles P-C4'-P energy: -127.999 tors. eta vs tors. theta energy: -202.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -2101.263152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.263152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.263152 (E_RNA) where: Base-Base interactions energy: -1259.125 where: short stacking energy: -733.922 Base-Backbone interact. energy: -3.228 local terms energy: -838.910181 where: bonds (distance) C4'-P energy: -179.070 bonds (distance) P-C4' energy: -168.088 flat angles C4'-P-C4' energy: -202.752 flat angles P-C4'-P energy: -121.395 tors. eta vs tors. theta energy: -167.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1773.742068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1773.742068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1773.742068 (E_RNA) where: Base-Base interactions energy: -924.133 where: short stacking energy: -706.760 Base-Backbone interact. energy: -2.378 local terms energy: -847.230983 where: bonds (distance) C4'-P energy: -190.496 bonds (distance) P-C4' energy: -177.347 flat angles C4'-P-C4' energy: -182.169 flat angles P-C4'-P energy: -108.342 tors. eta vs tors. theta energy: -188.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -2018.039888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2018.039888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2018.039888 (E_RNA) where: Base-Base interactions energy: -1236.559 where: short stacking energy: -652.817 Base-Backbone interact. energy: -1.053 local terms energy: -780.427363 where: bonds (distance) C4'-P energy: -181.352 bonds (distance) P-C4' energy: -164.347 flat angles C4'-P-C4' energy: -195.681 flat angles P-C4'-P energy: -92.687 tors. eta vs tors. theta energy: -146.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1346.019687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1346.019687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1346.019687 (E_RNA) where: Base-Base interactions energy: -667.130 where: short stacking energy: -477.390 Base-Backbone interact. energy: 1.428 local terms energy: -680.317028 where: bonds (distance) C4'-P energy: -159.127 bonds (distance) P-C4' energy: -170.573 flat angles C4'-P-C4' energy: -174.371 flat angles P-C4'-P energy: -90.322 tors. eta vs tors. theta energy: -85.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1237.732543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1237.732543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1237.732543 (E_RNA) where: Base-Base interactions energy: -610.770 where: short stacking energy: -403.428 Base-Backbone interact. energy: -0.516 local terms energy: -626.446498 where: bonds (distance) C4'-P energy: -168.036 bonds (distance) P-C4' energy: -161.408 flat angles C4'-P-C4' energy: -149.847 flat angles P-C4'-P energy: -110.498 tors. eta vs tors. theta energy: -36.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -1325.353045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.353045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.353045 (E_RNA) where: Base-Base interactions energy: -712.933 where: short stacking energy: -410.246 Base-Backbone interact. energy: -1.279 local terms energy: -611.141503 where: bonds (distance) C4'-P energy: -148.205 bonds (distance) P-C4' energy: -184.784 flat angles C4'-P-C4' energy: -130.308 flat angles P-C4'-P energy: -83.468 tors. eta vs tors. theta energy: -64.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -1411.033455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.033455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.033455 (E_RNA) where: Base-Base interactions energy: -791.381 where: short stacking energy: -417.385 Base-Backbone interact. energy: 4.917 local terms energy: -624.568850 where: bonds (distance) C4'-P energy: -152.825 bonds (distance) P-C4' energy: -154.626 flat angles C4'-P-C4' energy: -158.523 flat angles P-C4'-P energy: -99.027 tors. eta vs tors. theta energy: -59.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -1047.502883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.502883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.502883 (E_RNA) where: Base-Base interactions energy: -511.132 where: short stacking energy: -339.143 Base-Backbone interact. energy: -2.429 local terms energy: -533.942050 where: bonds (distance) C4'-P energy: -145.736 bonds (distance) P-C4' energy: -159.852 flat angles C4'-P-C4' energy: -133.459 flat angles P-C4'-P energy: -86.731 tors. eta vs tors. theta energy: -8.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -763.880094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.880094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.880094 (E_RNA) where: Base-Base interactions energy: -323.075 where: short stacking energy: -255.275 Base-Backbone interact. energy: 0.411 local terms energy: -441.215725 where: bonds (distance) C4'-P energy: -129.101 bonds (distance) P-C4' energy: -154.218 flat angles C4'-P-C4' energy: -119.738 flat angles P-C4'-P energy: -65.207 tors. eta vs tors. theta energy: 27.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -2241.275957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2241.275957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.275957 (E_RNA) where: Base-Base interactions energy: -1336.027 where: short stacking energy: -808.244 Base-Backbone interact. energy: 3.029 local terms energy: -908.278065 where: bonds (distance) C4'-P energy: -183.601 bonds (distance) P-C4' energy: -175.023 flat angles C4'-P-C4' energy: -209.964 flat angles P-C4'-P energy: -128.816 tors. eta vs tors. theta energy: -210.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -2144.418885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2144.418885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2144.418885 (E_RNA) where: Base-Base interactions energy: -1321.437 where: short stacking energy: -771.444 Base-Backbone interact. energy: -0.043 local terms energy: -822.939003 where: bonds (distance) C4'-P energy: -157.744 bonds (distance) P-C4' energy: -178.835 flat angles C4'-P-C4' energy: -191.398 flat angles P-C4'-P energy: -126.070 tors. eta vs tors. theta energy: -168.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -2236.699404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.699404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2236.699404 (E_RNA) where: Base-Base interactions energy: -1434.655 where: short stacking energy: -744.802 Base-Backbone interact. energy: -0.691 local terms energy: -801.353282 where: bonds (distance) C4'-P energy: -148.091 bonds (distance) P-C4' energy: -168.724 flat angles C4'-P-C4' energy: -190.682 flat angles P-C4'-P energy: -104.846 tors. eta vs tors. theta energy: -189.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1572.749544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.749544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.749544 (E_RNA) where: Base-Base interactions energy: -832.089 where: short stacking energy: -595.687 Base-Backbone interact. energy: -3.707 local terms energy: -736.954464 where: bonds (distance) C4'-P energy: -171.544 bonds (distance) P-C4' energy: -169.060 flat angles C4'-P-C4' energy: -170.375 flat angles P-C4'-P energy: -112.881 tors. eta vs tors. theta energy: -113.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1368.646747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.646747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.646747 (E_RNA) where: Base-Base interactions energy: -694.060 where: short stacking energy: -502.867 Base-Backbone interact. energy: 2.626 local terms energy: -677.212750 where: bonds (distance) C4'-P energy: -163.615 bonds (distance) P-C4' energy: -157.535 flat angles C4'-P-C4' energy: -179.837 flat angles P-C4'-P energy: -90.512 tors. eta vs tors. theta energy: -85.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1433.183693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.183693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.183693 (E_RNA) where: Base-Base interactions energy: -781.002 where: short stacking energy: -498.786 Base-Backbone interact. energy: -3.851 local terms energy: -648.331041 where: bonds (distance) C4'-P energy: -137.470 bonds (distance) P-C4' energy: -187.317 flat angles C4'-P-C4' energy: -149.192 flat angles P-C4'-P energy: -89.662 tors. eta vs tors. theta energy: -84.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1505.980364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.980364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.980364 (E_RNA) where: Base-Base interactions energy: -897.862 where: short stacking energy: -476.814 Base-Backbone interact. energy: -3.949 local terms energy: -604.168690 where: bonds (distance) C4'-P energy: -148.628 bonds (distance) P-C4' energy: -157.066 flat angles C4'-P-C4' energy: -140.109 flat angles P-C4'-P energy: -83.958 tors. eta vs tors. theta energy: -74.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -1373.286670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.286670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.286670 (E_RNA) where: Base-Base interactions energy: -780.734 where: short stacking energy: -417.772 Base-Backbone interact. energy: -4.260 local terms energy: -588.292226 where: bonds (distance) C4'-P energy: -133.660 bonds (distance) P-C4' energy: -160.545 flat angles C4'-P-C4' energy: -142.598 flat angles P-C4'-P energy: -104.094 tors. eta vs tors. theta energy: -47.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -1006.984118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.984118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.984118 (E_RNA) where: Base-Base interactions energy: -496.251 where: short stacking energy: -318.459 Base-Backbone interact. energy: 0.672 local terms energy: -511.405105 where: bonds (distance) C4'-P energy: -144.814 bonds (distance) P-C4' energy: -127.185 flat angles C4'-P-C4' energy: -160.253 flat angles P-C4'-P energy: -81.761 tors. eta vs tors. theta energy: 2.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -782.998545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -782.998545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -782.998545 (E_RNA) where: Base-Base interactions energy: -349.350 where: short stacking energy: -241.919 Base-Backbone interact. energy: 9.162 local terms energy: -442.810102 where: bonds (distance) C4'-P energy: -137.252 bonds (distance) P-C4' energy: -169.013 flat angles C4'-P-C4' energy: -103.785 flat angles P-C4'-P energy: -51.999 tors. eta vs tors. theta energy: 19.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -2258.513805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2258.513805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2258.513805 (E_RNA) where: Base-Base interactions energy: -1373.155 where: short stacking energy: -806.279 Base-Backbone interact. energy: -1.490 local terms energy: -883.868384 where: bonds (distance) C4'-P energy: -180.597 bonds (distance) P-C4' energy: -192.610 flat angles C4'-P-C4' energy: -193.748 flat angles P-C4'-P energy: -121.339 tors. eta vs tors. theta energy: -195.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -2383.372233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2383.372233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2383.372233 (E_RNA) where: Base-Base interactions energy: -1524.649 where: short stacking energy: -780.801 Base-Backbone interact. energy: 6.406 local terms energy: -865.128908 where: bonds (distance) C4'-P energy: -161.397 bonds (distance) P-C4' energy: -191.977 flat angles C4'-P-C4' energy: -207.191 flat angles P-C4'-P energy: -133.731 tors. eta vs tors. theta energy: -170.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -2106.383836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.383836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2106.383836 (E_RNA) where: Base-Base interactions energy: -1302.606 where: short stacking energy: -735.071 Base-Backbone interact. energy: 3.683 local terms energy: -807.460424 where: bonds (distance) C4'-P energy: -172.587 bonds (distance) P-C4' energy: -167.333 flat angles C4'-P-C4' energy: -190.656 flat angles P-C4'-P energy: -107.205 tors. eta vs tors. theta energy: -169.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1651.390954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.390954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.390954 (E_RNA) where: Base-Base interactions energy: -885.781 where: short stacking energy: -595.169 Base-Backbone interact. energy: -2.296 local terms energy: -763.314189 where: bonds (distance) C4'-P energy: -178.323 bonds (distance) P-C4' energy: -176.789 flat angles C4'-P-C4' energy: -185.005 flat angles P-C4'-P energy: -111.339 tors. eta vs tors. theta energy: -111.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1474.004897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.004897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1474.004897 (E_RNA) where: Base-Base interactions energy: -786.696 where: short stacking energy: -486.189 Base-Backbone interact. energy: -2.877 local terms energy: -684.431239 where: bonds (distance) C4'-P energy: -173.499 bonds (distance) P-C4' energy: -181.858 flat angles C4'-P-C4' energy: -168.019 flat angles P-C4'-P energy: -90.080 tors. eta vs tors. theta energy: -70.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1683.296878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.296878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.296878 (E_RNA) where: Base-Base interactions energy: -1023.905 where: short stacking energy: -542.790 Base-Backbone interact. energy: 0.331 local terms energy: -659.723576 where: bonds (distance) C4'-P energy: -156.320 bonds (distance) P-C4' energy: -163.882 flat angles C4'-P-C4' energy: -139.849 flat angles P-C4'-P energy: -89.268 tors. eta vs tors. theta energy: -110.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1365.215491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1365.215491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1365.215491 (E_RNA) where: Base-Base interactions energy: -757.847 where: short stacking energy: -497.980 Base-Backbone interact. energy: 5.341 local terms energy: -612.708818 where: bonds (distance) C4'-P energy: -150.585 bonds (distance) P-C4' energy: -150.794 flat angles C4'-P-C4' energy: -154.407 flat angles P-C4'-P energy: -83.681 tors. eta vs tors. theta energy: -73.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1483.281839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1483.281839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1483.281839 (E_RNA) where: Base-Base interactions energy: -892.252 where: short stacking energy: -436.447 Base-Backbone interact. energy: -4.803 local terms energy: -586.226890 where: bonds (distance) C4'-P energy: -143.424 bonds (distance) P-C4' energy: -157.854 flat angles C4'-P-C4' energy: -128.443 flat angles P-C4'-P energy: -86.452 tors. eta vs tors. theta energy: -70.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -1016.890366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.890366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.890366 (E_RNA) where: Base-Base interactions energy: -486.958 where: short stacking energy: -321.606 Base-Backbone interact. energy: 0.510 local terms energy: -530.442172 where: bonds (distance) C4'-P energy: -142.545 bonds (distance) P-C4' energy: -148.013 flat angles C4'-P-C4' energy: -135.985 flat angles P-C4'-P energy: -78.693 tors. eta vs tors. theta energy: -25.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -843.546934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.546934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.546934 (E_RNA) where: Base-Base interactions energy: -373.852 where: short stacking energy: -250.046 Base-Backbone interact. energy: 2.534 local terms energy: -472.228710 where: bonds (distance) C4'-P energy: -125.589 bonds (distance) P-C4' energy: -168.655 flat angles C4'-P-C4' energy: -132.504 flat angles P-C4'-P energy: -66.592 tors. eta vs tors. theta energy: 21.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2599.981522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2599.981522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2599.981522 (E_RNA) where: Base-Base interactions energy: -1735.561 where: short stacking energy: -826.499 Base-Backbone interact. energy: 0.125 local terms energy: -864.545503 where: bonds (distance) C4'-P energy: -168.653 bonds (distance) P-C4' energy: -180.756 flat angles C4'-P-C4' energy: -199.554 flat angles P-C4'-P energy: -117.357 tors. eta vs tors. theta energy: -198.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -2186.847348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.847348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2186.847348 (E_RNA) where: Base-Base interactions energy: -1344.593 where: short stacking energy: -779.415 Base-Backbone interact. energy: 0.898 local terms energy: -843.151672 where: bonds (distance) C4'-P energy: -179.433 bonds (distance) P-C4' energy: -170.755 flat angles C4'-P-C4' energy: -201.915 flat angles P-C4'-P energy: -101.653 tors. eta vs tors. theta energy: -189.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -2091.476983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2091.476983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2091.476983 (E_RNA) where: Base-Base interactions energy: -1303.563 where: short stacking energy: -734.456 Base-Backbone interact. energy: 1.446 local terms energy: -789.360480 where: bonds (distance) C4'-P energy: -174.116 bonds (distance) P-C4' energy: -170.201 flat angles C4'-P-C4' energy: -166.477 flat angles P-C4'-P energy: -114.112 tors. eta vs tors. theta energy: -164.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1610.210267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1610.210267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1610.210267 (E_RNA) where: Base-Base interactions energy: -872.451 where: short stacking energy: -569.804 Base-Backbone interact. energy: 3.257 local terms energy: -741.016244 where: bonds (distance) C4'-P energy: -175.933 bonds (distance) P-C4' energy: -158.287 flat angles C4'-P-C4' energy: -161.261 flat angles P-C4'-P energy: -110.486 tors. eta vs tors. theta energy: -135.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1903.238954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1903.238954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1903.238954 (E_RNA) where: Base-Base interactions energy: -1142.647 where: short stacking energy: -665.749 Base-Backbone interact. energy: 2.533 local terms energy: -763.124964 where: bonds (distance) C4'-P energy: -175.420 bonds (distance) P-C4' energy: -159.745 flat angles C4'-P-C4' energy: -166.890 flat angles P-C4'-P energy: -114.006 tors. eta vs tors. theta energy: -147.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1322.779787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.779787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.779787 (E_RNA) where: Base-Base interactions energy: -683.436 where: short stacking energy: -459.332 Base-Backbone interact. energy: 2.696 local terms energy: -642.040118 where: bonds (distance) C4'-P energy: -150.321 bonds (distance) P-C4' energy: -172.201 flat angles C4'-P-C4' energy: -149.170 flat angles P-C4'-P energy: -104.262 tors. eta vs tors. theta energy: -66.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1638.043989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.043989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.043989 (E_RNA) where: Base-Base interactions energy: -1028.026 where: short stacking energy: -513.227 Base-Backbone interact. energy: 0.339 local terms energy: -610.357049 where: bonds (distance) C4'-P energy: -159.829 bonds (distance) P-C4' energy: -155.971 flat angles C4'-P-C4' energy: -145.183 flat angles P-C4'-P energy: -80.275 tors. eta vs tors. theta energy: -69.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1300.806299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.806299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.806299 (E_RNA) where: Base-Base interactions energy: -706.457 where: short stacking energy: -424.349 Base-Backbone interact. energy: -0.487 local terms energy: -593.861847 where: bonds (distance) C4'-P energy: -151.575 bonds (distance) P-C4' energy: -151.575 flat angles C4'-P-C4' energy: -150.811 flat angles P-C4'-P energy: -89.329 tors. eta vs tors. theta energy: -50.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -1095.143985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1095.143985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.143985 (E_RNA) where: Base-Base interactions energy: -581.200 where: short stacking energy: -346.072 Base-Backbone interact. energy: 1.984 local terms energy: -515.927632 where: bonds (distance) C4'-P energy: -138.185 bonds (distance) P-C4' energy: -180.918 flat angles C4'-P-C4' energy: -120.481 flat angles P-C4'-P energy: -62.992 tors. eta vs tors. theta energy: -13.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -833.544570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.544570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.544570 (E_RNA) where: Base-Base interactions energy: -353.751 where: short stacking energy: -242.792 Base-Backbone interact. energy: -0.639 local terms energy: -479.154343 where: bonds (distance) C4'-P energy: -135.378 bonds (distance) P-C4' energy: -163.482 flat angles C4'-P-C4' energy: -125.351 flat angles P-C4'-P energy: -77.320 tors. eta vs tors. theta energy: 22.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2649.183235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2649.183235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2649.183235 (E_RNA) where: Base-Base interactions energy: -1731.607 where: short stacking energy: -865.225 Base-Backbone interact. energy: -1.900 local terms energy: -915.675861 where: bonds (distance) C4'-P energy: -189.372 bonds (distance) P-C4' energy: -191.031 flat angles C4'-P-C4' energy: -203.033 flat angles P-C4'-P energy: -117.913 tors. eta vs tors. theta energy: -214.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -2165.110729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2165.110729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2165.110729 (E_RNA) where: Base-Base interactions energy: -1328.954 where: short stacking energy: -716.524 Base-Backbone interact. energy: 0.545 local terms energy: -836.702094 where: bonds (distance) C4'-P energy: -178.929 bonds (distance) P-C4' energy: -178.466 flat angles C4'-P-C4' energy: -197.833 flat angles P-C4'-P energy: -123.097 tors. eta vs tors. theta energy: -158.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -2140.194478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2140.194478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2140.194478 (E_RNA) where: Base-Base interactions energy: -1316.610 where: short stacking energy: -716.216 Base-Backbone interact. energy: -1.421 local terms energy: -822.163367 where: bonds (distance) C4'-P energy: -175.154 bonds (distance) P-C4' energy: -175.559 flat angles C4'-P-C4' energy: -198.676 flat angles P-C4'-P energy: -108.593 tors. eta vs tors. theta energy: -164.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -2109.996580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2109.996580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2109.996580 (E_RNA) where: Base-Base interactions energy: -1313.669 where: short stacking energy: -650.430 Base-Backbone interact. energy: 2.601 local terms energy: -798.929111 where: bonds (distance) C4'-P energy: -173.373 bonds (distance) P-C4' energy: -168.450 flat angles C4'-P-C4' energy: -183.607 flat angles P-C4'-P energy: -114.758 tors. eta vs tors. theta energy: -158.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1565.871619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1565.871619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1565.871619 (E_RNA) where: Base-Base interactions energy: -876.102 where: short stacking energy: -533.925 Base-Backbone interact. energy: -4.118 local terms energy: -685.651500 where: bonds (distance) C4'-P energy: -137.153 bonds (distance) P-C4' energy: -165.903 flat angles C4'-P-C4' energy: -173.534 flat angles P-C4'-P energy: -103.875 tors. eta vs tors. theta energy: -105.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1796.598802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1796.598802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1796.598802 (E_RNA) where: Base-Base interactions energy: -1102.700 where: short stacking energy: -564.169 Base-Backbone interact. energy: -0.399 local terms energy: -693.500173 where: bonds (distance) C4'-P energy: -175.175 bonds (distance) P-C4' energy: -142.569 flat angles C4'-P-C4' energy: -160.850 flat angles P-C4'-P energy: -124.856 tors. eta vs tors. theta energy: -90.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1249.517641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.517641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.517641 (E_RNA) where: Base-Base interactions energy: -629.829 where: short stacking energy: -429.205 Base-Backbone interact. energy: 1.029 local terms energy: -620.717439 where: bonds (distance) C4'-P energy: -140.261 bonds (distance) P-C4' energy: -170.577 flat angles C4'-P-C4' energy: -166.771 flat angles P-C4'-P energy: -86.700 tors. eta vs tors. theta energy: -56.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -1302.199703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.199703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.199703 (E_RNA) where: Base-Base interactions energy: -736.157 where: short stacking energy: -398.853 Base-Backbone interact. energy: -2.684 local terms energy: -563.358542 where: bonds (distance) C4'-P energy: -150.670 bonds (distance) P-C4' energy: -154.302 flat angles C4'-P-C4' energy: -153.891 flat angles P-C4'-P energy: -56.443 tors. eta vs tors. theta energy: -48.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -1068.215085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.215085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.215085 (E_RNA) where: Base-Base interactions energy: -565.394 where: short stacking energy: -316.974 Base-Backbone interact. energy: 0.664 local terms energy: -503.484791 where: bonds (distance) C4'-P energy: -153.818 bonds (distance) P-C4' energy: -153.350 flat angles C4'-P-C4' energy: -136.827 flat angles P-C4'-P energy: -45.876 tors. eta vs tors. theta energy: -13.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -849.341282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.341282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.341282 (E_RNA) where: Base-Base interactions energy: -391.085 where: short stacking energy: -260.543 Base-Backbone interact. energy: 6.259 local terms energy: -464.514370 where: bonds (distance) C4'-P energy: -141.752 bonds (distance) P-C4' energy: -137.624 flat angles C4'-P-C4' energy: -122.757 flat angles P-C4'-P energy: -58.387 tors. eta vs tors. theta energy: -3.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2630.697189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2630.697189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2630.697189 (E_RNA) where: Base-Base interactions energy: -1712.492 where: short stacking energy: -850.984 Base-Backbone interact. energy: -2.925 local terms energy: -915.280029 where: bonds (distance) C4'-P energy: -187.762 bonds (distance) P-C4' energy: -177.928 flat angles C4'-P-C4' energy: -206.031 flat angles P-C4'-P energy: -117.255 tors. eta vs tors. theta energy: -226.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -2194.752705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2194.752705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2194.752705 (E_RNA) where: Base-Base interactions energy: -1333.953 where: short stacking energy: -759.220 Base-Backbone interact. energy: -2.346 local terms energy: -858.453041 where: bonds (distance) C4'-P energy: -179.392 bonds (distance) P-C4' energy: -182.538 flat angles C4'-P-C4' energy: -196.520 flat angles P-C4'-P energy: -122.278 tors. eta vs tors. theta energy: -177.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -2239.891473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2239.891473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2239.891473 (E_RNA) where: Base-Base interactions energy: -1380.817 where: short stacking energy: -717.799 Base-Backbone interact. energy: -5.721 local terms energy: -853.353137 where: bonds (distance) C4'-P energy: -179.314 bonds (distance) P-C4' energy: -191.961 flat angles C4'-P-C4' energy: -198.776 flat angles P-C4'-P energy: -119.116 tors. eta vs tors. theta energy: -164.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1999.061444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1999.061444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1999.061444 (E_RNA) where: Base-Base interactions energy: -1245.864 where: short stacking energy: -622.881 Base-Backbone interact. energy: -1.385 local terms energy: -751.812109 where: bonds (distance) C4'-P energy: -178.254 bonds (distance) P-C4' energy: -185.782 flat angles C4'-P-C4' energy: -161.964 flat angles P-C4'-P energy: -102.243 tors. eta vs tors. theta energy: -123.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1875.285065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.285065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.285065 (E_RNA) where: Base-Base interactions energy: -1145.755 where: short stacking energy: -575.224 Base-Backbone interact. energy: -8.761 local terms energy: -720.769040 where: bonds (distance) C4'-P energy: -162.330 bonds (distance) P-C4' energy: -161.705 flat angles C4'-P-C4' energy: -162.600 flat angles P-C4'-P energy: -112.767 tors. eta vs tors. theta energy: -121.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1517.671372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1517.671372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1517.671372 (E_RNA) where: Base-Base interactions energy: -865.515 where: short stacking energy: -499.355 Base-Backbone interact. energy: -1.683 local terms energy: -650.473220 where: bonds (distance) C4'-P energy: -168.621 bonds (distance) P-C4' energy: -159.139 flat angles C4'-P-C4' energy: -151.243 flat angles P-C4'-P energy: -98.573 tors. eta vs tors. theta energy: -72.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1295.686508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.686508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.686508 (E_RNA) where: Base-Base interactions energy: -686.480 where: short stacking energy: -448.699 Base-Backbone interact. energy: 1.960 local terms energy: -611.166642 where: bonds (distance) C4'-P energy: -164.261 bonds (distance) P-C4' energy: -139.046 flat angles C4'-P-C4' energy: -147.477 flat angles P-C4'-P energy: -93.095 tors. eta vs tors. theta energy: -67.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1306.778029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1306.778029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1306.778029 (E_RNA) where: Base-Base interactions energy: -716.600 where: short stacking energy: -412.907 Base-Backbone interact. energy: -1.224 local terms energy: -588.953907 where: bonds (distance) C4'-P energy: -149.447 bonds (distance) P-C4' energy: -158.034 flat angles C4'-P-C4' energy: -118.349 flat angles P-C4'-P energy: -99.924 tors. eta vs tors. theta energy: -63.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -1078.790239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1078.790239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1078.790239 (E_RNA) where: Base-Base interactions energy: -573.673 where: short stacking energy: -307.505 Base-Backbone interact. energy: 1.840 local terms energy: -506.957087 where: bonds (distance) C4'-P energy: -141.862 bonds (distance) P-C4' energy: -170.682 flat angles C4'-P-C4' energy: -125.065 flat angles P-C4'-P energy: -71.754 tors. eta vs tors. theta energy: 2.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -876.228983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.228983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.228983 (E_RNA) where: Base-Base interactions energy: -438.231 where: short stacking energy: -271.978 Base-Backbone interact. energy: 8.308 local terms energy: -446.306026 where: bonds (distance) C4'-P energy: -139.808 bonds (distance) P-C4' energy: -152.929 flat angles C4'-P-C4' energy: -128.119 flat angles P-C4'-P energy: -51.044 tors. eta vs tors. theta energy: 25.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2686.964186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2686.964186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2686.964186 (E_RNA) where: Base-Base interactions energy: -1759.011 where: short stacking energy: -881.336 Base-Backbone interact. energy: -3.477 local terms energy: -924.475743 where: bonds (distance) C4'-P energy: -179.218 bonds (distance) P-C4' energy: -179.698 flat angles C4'-P-C4' energy: -203.579 flat angles P-C4'-P energy: -136.162 tors. eta vs tors. theta energy: -225.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -2454.383286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2454.383286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2454.383286 (E_RNA) where: Base-Base interactions energy: -1570.299 where: short stacking energy: -773.349 Base-Backbone interact. energy: -4.167 local terms energy: -879.916697 where: bonds (distance) C4'-P energy: -178.765 bonds (distance) P-C4' energy: -180.394 flat angles C4'-P-C4' energy: -212.356 flat angles P-C4'-P energy: -121.827 tors. eta vs tors. theta energy: -186.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -2132.808502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2132.808502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2132.808502 (E_RNA) where: Base-Base interactions energy: -1307.816 where: short stacking energy: -714.451 Base-Backbone interact. energy: 1.279 local terms energy: -826.272229 where: bonds (distance) C4'-P energy: -178.886 bonds (distance) P-C4' energy: -184.909 flat angles C4'-P-C4' energy: -183.643 flat angles P-C4'-P energy: -116.346 tors. eta vs tors. theta energy: -162.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -2026.183640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2026.183640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2026.183640 (E_RNA) where: Base-Base interactions energy: -1271.289 where: short stacking energy: -665.136 Base-Backbone interact. energy: -2.969 local terms energy: -751.926395 where: bonds (distance) C4'-P energy: -161.353 bonds (distance) P-C4' energy: -167.128 flat angles C4'-P-C4' energy: -181.840 flat angles P-C4'-P energy: -98.515 tors. eta vs tors. theta energy: -143.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1888.941318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1888.941318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1888.941318 (E_RNA) where: Base-Base interactions energy: -1132.186 where: short stacking energy: -580.025 Base-Backbone interact. energy: -3.415 local terms energy: -753.340495 where: bonds (distance) C4'-P energy: -171.747 bonds (distance) P-C4' energy: -189.075 flat angles C4'-P-C4' energy: -172.892 flat angles P-C4'-P energy: -103.401 tors. eta vs tors. theta energy: -116.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1625.660898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1625.660898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1625.660898 (E_RNA) where: Base-Base interactions energy: -970.570 where: short stacking energy: -528.575 Base-Backbone interact. energy: -0.701 local terms energy: -654.389504 where: bonds (distance) C4'-P energy: -135.223 bonds (distance) P-C4' energy: -162.078 flat angles C4'-P-C4' energy: -167.974 flat angles P-C4'-P energy: -88.427 tors. eta vs tors. theta energy: -100.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1276.718391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.718391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.718391 (E_RNA) where: Base-Base interactions energy: -678.063 where: short stacking energy: -409.801 Base-Backbone interact. energy: -1.636 local terms energy: -597.019516 where: bonds (distance) C4'-P energy: -161.043 bonds (distance) P-C4' energy: -150.953 flat angles C4'-P-C4' energy: -148.519 flat angles P-C4'-P energy: -81.761 tors. eta vs tors. theta energy: -54.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1270.476520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.476520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.476520 (E_RNA) where: Base-Base interactions energy: -692.330 where: short stacking energy: -423.778 Base-Backbone interact. energy: 1.291 local terms energy: -579.437581 where: bonds (distance) C4'-P energy: -142.161 bonds (distance) P-C4' energy: -159.382 flat angles C4'-P-C4' energy: -149.922 flat angles P-C4'-P energy: -87.867 tors. eta vs tors. theta energy: -40.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -1229.557851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1229.557851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1229.557851 (E_RNA) where: Base-Base interactions energy: -651.983 where: short stacking energy: -366.338 Base-Backbone interact. energy: -2.571 local terms energy: -575.003805 where: bonds (distance) C4'-P energy: -153.960 bonds (distance) P-C4' energy: -154.941 flat angles C4'-P-C4' energy: -159.220 flat angles P-C4'-P energy: -76.253 tors. eta vs tors. theta energy: -30.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -856.774187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.774187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -856.774187 (E_RNA) where: Base-Base interactions energy: -373.789 where: short stacking energy: -268.097 Base-Backbone interact. energy: 4.674 local terms energy: -487.659200 where: bonds (distance) C4'-P energy: -144.282 bonds (distance) P-C4' energy: -176.160 flat angles C4'-P-C4' energy: -129.024 flat angles P-C4'-P energy: -75.088 tors. eta vs tors. theta energy: 36.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2752.020423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2752.020423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2752.020423 (E_RNA) where: Base-Base interactions energy: -1849.726 where: short stacking energy: -890.545 Base-Backbone interact. energy: -2.975 local terms energy: -899.319938 where: bonds (distance) C4'-P energy: -176.045 bonds (distance) P-C4' energy: -192.187 flat angles C4'-P-C4' energy: -197.832 flat angles P-C4'-P energy: -111.648 tors. eta vs tors. theta energy: -221.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -2532.869073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2532.869073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2532.869073 (E_RNA) where: Base-Base interactions energy: -1657.811 where: short stacking energy: -844.500 Base-Backbone interact. energy: -3.446 local terms energy: -871.612723 where: bonds (distance) C4'-P energy: -165.811 bonds (distance) P-C4' energy: -182.528 flat angles C4'-P-C4' energy: -202.575 flat angles P-C4'-P energy: -122.151 tors. eta vs tors. theta energy: -198.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -2107.908883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2107.908883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2107.908883 (E_RNA) where: Base-Base interactions energy: -1321.797 where: short stacking energy: -671.989 Base-Backbone interact. energy: -1.974 local terms energy: -784.137471 where: bonds (distance) C4'-P energy: -161.068 bonds (distance) P-C4' energy: -184.900 flat angles C4'-P-C4' energy: -177.328 flat angles P-C4'-P energy: -119.280 tors. eta vs tors. theta energy: -141.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -2117.336139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2117.336139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2117.336139 (E_RNA) where: Base-Base interactions energy: -1318.229 where: short stacking energy: -657.661 Base-Backbone interact. energy: -1.337 local terms energy: -797.770448 where: bonds (distance) C4'-P energy: -168.511 bonds (distance) P-C4' energy: -188.492 flat angles C4'-P-C4' energy: -179.582 flat angles P-C4'-P energy: -111.258 tors. eta vs tors. theta energy: -149.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1948.810718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1948.810718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1948.810718 (E_RNA) where: Base-Base interactions energy: -1222.220 where: short stacking energy: -583.341 Base-Backbone interact. energy: -0.825 local terms energy: -725.765935 where: bonds (distance) C4'-P energy: -175.213 bonds (distance) P-C4' energy: -159.353 flat angles C4'-P-C4' energy: -178.420 flat angles P-C4'-P energy: -112.966 tors. eta vs tors. theta energy: -99.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1722.912884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1722.912884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1722.912884 (E_RNA) where: Base-Base interactions energy: -1040.663 where: short stacking energy: -539.643 Base-Backbone interact. energy: -1.675 local terms energy: -680.575032 where: bonds (distance) C4'-P energy: -150.756 bonds (distance) P-C4' energy: -161.658 flat angles C4'-P-C4' energy: -184.630 flat angles P-C4'-P energy: -87.878 tors. eta vs tors. theta energy: -95.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1281.935599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1281.935599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1281.935599 (E_RNA) where: Base-Base interactions energy: -711.626 where: short stacking energy: -422.474 Base-Backbone interact. energy: 0.508 local terms energy: -570.817860 where: bonds (distance) C4'-P energy: -150.210 bonds (distance) P-C4' energy: -150.327 flat angles C4'-P-C4' energy: -152.914 flat angles P-C4'-P energy: -76.132 tors. eta vs tors. theta energy: -41.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1188.047938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1188.047938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.047938 (E_RNA) where: Base-Base interactions energy: -643.435 where: short stacking energy: -359.864 Base-Backbone interact. energy: 8.134 local terms energy: -552.747171 where: bonds (distance) C4'-P energy: -166.886 bonds (distance) P-C4' energy: -147.632 flat angles C4'-P-C4' energy: -110.889 flat angles P-C4'-P energy: -91.576 tors. eta vs tors. theta energy: -35.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -1126.730097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.730097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1126.730097 (E_RNA) where: Base-Base interactions energy: -578.547 where: short stacking energy: -348.383 Base-Backbone interact. energy: 1.844 local terms energy: -550.027349 where: bonds (distance) C4'-P energy: -125.847 bonds (distance) P-C4' energy: -161.712 flat angles C4'-P-C4' energy: -160.891 flat angles P-C4'-P energy: -93.627 tors. eta vs tors. theta energy: -7.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -848.071431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.071431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.071431 (E_RNA) where: Base-Base interactions energy: -406.084 where: short stacking energy: -243.303 Base-Backbone interact. energy: 0.090 local terms energy: -442.078097 where: bonds (distance) C4'-P energy: -131.763 bonds (distance) P-C4' energy: -156.785 flat angles C4'-P-C4' energy: -121.884 flat angles P-C4'-P energy: -61.564 tors. eta vs tors. theta energy: 29.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2710.399436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2710.399436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2710.399436 (E_RNA) where: Base-Base interactions energy: -1811.192 where: short stacking energy: -868.717 Base-Backbone interact. energy: -5.304 local terms energy: -893.903557 where: bonds (distance) C4'-P energy: -176.921 bonds (distance) P-C4' energy: -183.031 flat angles C4'-P-C4' energy: -197.395 flat angles P-C4'-P energy: -116.203 tors. eta vs tors. theta energy: -220.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -2526.323458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.323458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.323458 (E_RNA) where: Base-Base interactions energy: -1649.794 where: short stacking energy: -812.196 Base-Backbone interact. energy: -2.846 local terms energy: -873.683670 where: bonds (distance) C4'-P energy: -180.952 bonds (distance) P-C4' energy: -163.607 flat angles C4'-P-C4' energy: -197.218 flat angles P-C4'-P energy: -128.727 tors. eta vs tors. theta energy: -203.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -2158.135493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2158.135493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2158.135493 (E_RNA) where: Base-Base interactions energy: -1344.739 where: short stacking energy: -744.454 Base-Backbone interact. energy: -0.662 local terms energy: -812.733882 where: bonds (distance) C4'-P energy: -171.771 bonds (distance) P-C4' energy: -171.232 flat angles C4'-P-C4' energy: -182.830 flat angles P-C4'-P energy: -114.484 tors. eta vs tors. theta energy: -172.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -2115.219661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2115.219661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.219661 (E_RNA) where: Base-Base interactions energy: -1373.679 where: short stacking energy: -665.738 Base-Backbone interact. energy: -1.652 local terms energy: -739.888522 where: bonds (distance) C4'-P energy: -164.642 bonds (distance) P-C4' energy: -163.594 flat angles C4'-P-C4' energy: -178.938 flat angles P-C4'-P energy: -113.665 tors. eta vs tors. theta energy: -119.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1959.869387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.869387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1959.869387 (E_RNA) where: Base-Base interactions energy: -1219.668 where: short stacking energy: -625.646 Base-Backbone interact. energy: -1.163 local terms energy: -739.038105 where: bonds (distance) C4'-P energy: -167.357 bonds (distance) P-C4' energy: -171.938 flat angles C4'-P-C4' energy: -180.412 flat angles P-C4'-P energy: -88.843 tors. eta vs tors. theta energy: -130.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1776.394379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.394379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.394379 (E_RNA) where: Base-Base interactions energy: -1096.345 where: short stacking energy: -570.051 Base-Backbone interact. energy: 0.660 local terms energy: -680.709233 where: bonds (distance) C4'-P energy: -162.659 bonds (distance) P-C4' energy: -163.610 flat angles C4'-P-C4' energy: -157.748 flat angles P-C4'-P energy: -93.683 tors. eta vs tors. theta energy: -103.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1406.075792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.075792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.075792 (E_RNA) where: Base-Base interactions energy: -829.767 where: short stacking energy: -405.129 Base-Backbone interact. energy: -0.070 local terms energy: -576.238517 where: bonds (distance) C4'-P energy: -149.983 bonds (distance) P-C4' energy: -151.244 flat angles C4'-P-C4' energy: -148.522 flat angles P-C4'-P energy: -74.492 tors. eta vs tors. theta energy: -51.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1170.066952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1170.066952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.066952 (E_RNA) where: Base-Base interactions energy: -615.046 where: short stacking energy: -345.950 Base-Backbone interact. energy: 0.152 local terms energy: -555.173315 where: bonds (distance) C4'-P energy: -149.296 bonds (distance) P-C4' energy: -149.222 flat angles C4'-P-C4' energy: -148.729 flat angles P-C4'-P energy: -88.745 tors. eta vs tors. theta energy: -19.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -1107.238565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1107.238565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1107.238565 (E_RNA) where: Base-Base interactions energy: -587.321 where: short stacking energy: -349.566 Base-Backbone interact. energy: -1.098 local terms energy: -518.819879 where: bonds (distance) C4'-P energy: -156.894 bonds (distance) P-C4' energy: -159.176 flat angles C4'-P-C4' energy: -117.665 flat angles P-C4'-P energy: -60.932 tors. eta vs tors. theta energy: -24.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -949.035503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.035503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.035503 (E_RNA) where: Base-Base interactions energy: -459.715 where: short stacking energy: -279.081 Base-Backbone interact. energy: 3.842 local terms energy: -493.162364 where: bonds (distance) C4'-P energy: -129.444 bonds (distance) P-C4' energy: -142.029 flat angles C4'-P-C4' energy: -129.767 flat angles P-C4'-P energy: -82.453 tors. eta vs tors. theta energy: -9.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2730.112565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2730.112565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2730.112565 (E_RNA) where: Base-Base interactions energy: -1826.267 where: short stacking energy: -849.784 Base-Backbone interact. energy: -1.969 local terms energy: -901.876877 where: bonds (distance) C4'-P energy: -181.109 bonds (distance) P-C4' energy: -178.388 flat angles C4'-P-C4' energy: -206.118 flat angles P-C4'-P energy: -123.392 tors. eta vs tors. theta energy: -212.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -2479.668253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2479.668253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2479.668253 (E_RNA) where: Base-Base interactions energy: -1601.683 where: short stacking energy: -748.340 Base-Backbone interact. energy: -4.154 local terms energy: -873.831248 where: bonds (distance) C4'-P energy: -191.021 bonds (distance) P-C4' energy: -182.295 flat angles C4'-P-C4' energy: -192.869 flat angles P-C4'-P energy: -110.617 tors. eta vs tors. theta energy: -197.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -2284.424013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2284.424013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2284.424013 (E_RNA) where: Base-Base interactions energy: -1465.489 where: short stacking energy: -791.511 Base-Backbone interact. energy: -1.028 local terms energy: -817.906593 where: bonds (distance) C4'-P energy: -160.095 bonds (distance) P-C4' energy: -162.348 flat angles C4'-P-C4' energy: -192.342 flat angles P-C4'-P energy: -124.603 tors. eta vs tors. theta energy: -178.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -2106.450907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2106.450907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2106.450907 (E_RNA) where: Base-Base interactions energy: -1347.165 where: short stacking energy: -677.405 Base-Backbone interact. energy: -1.469 local terms energy: -757.816510 where: bonds (distance) C4'-P energy: -153.216 bonds (distance) P-C4' energy: -183.444 flat angles C4'-P-C4' energy: -186.206 flat angles P-C4'-P energy: -101.161 tors. eta vs tors. theta energy: -133.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1929.048009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.048009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.048009 (E_RNA) where: Base-Base interactions energy: -1196.343 where: short stacking energy: -574.465 Base-Backbone interact. energy: -0.416 local terms energy: -732.289288 where: bonds (distance) C4'-P energy: -183.312 bonds (distance) P-C4' energy: -163.704 flat angles C4'-P-C4' energy: -165.149 flat angles P-C4'-P energy: -98.737 tors. eta vs tors. theta energy: -121.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1832.489766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1832.489766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1832.489766 (E_RNA) where: Base-Base interactions energy: -1144.998 where: short stacking energy: -599.445 Base-Backbone interact. energy: -0.997 local terms energy: -686.494508 where: bonds (distance) C4'-P energy: -157.855 bonds (distance) P-C4' energy: -164.410 flat angles C4'-P-C4' energy: -144.109 flat angles P-C4'-P energy: -114.967 tors. eta vs tors. theta energy: -105.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1508.228864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.228864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1508.228864 (E_RNA) where: Base-Base interactions energy: -898.635 where: short stacking energy: -489.836 Base-Backbone interact. energy: 1.361 local terms energy: -610.954446 where: bonds (distance) C4'-P energy: -156.365 bonds (distance) P-C4' energy: -143.361 flat angles C4'-P-C4' energy: -157.264 flat angles P-C4'-P energy: -88.435 tors. eta vs tors. theta energy: -65.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1161.551927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.551927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.551927 (E_RNA) where: Base-Base interactions energy: -594.202 where: short stacking energy: -363.178 Base-Backbone interact. energy: 3.981 local terms energy: -571.330490 where: bonds (distance) C4'-P energy: -136.747 bonds (distance) P-C4' energy: -164.916 flat angles C4'-P-C4' energy: -150.030 flat angles P-C4'-P energy: -88.856 tors. eta vs tors. theta energy: -30.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -1164.653160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.653160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.653160 (E_RNA) where: Base-Base interactions energy: -627.708 where: short stacking energy: -351.078 Base-Backbone interact. energy: 4.507 local terms energy: -541.451980 where: bonds (distance) C4'-P energy: -148.412 bonds (distance) P-C4' energy: -147.978 flat angles C4'-P-C4' energy: -141.974 flat angles P-C4'-P energy: -77.632 tors. eta vs tors. theta energy: -25.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -922.967604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.967604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.967604 (E_RNA) where: Base-Base interactions energy: -410.905 where: short stacking energy: -259.138 Base-Backbone interact. energy: 0.057 local terms energy: -512.119657 where: bonds (distance) C4'-P energy: -139.004 bonds (distance) P-C4' energy: -151.923 flat angles C4'-P-C4' energy: -129.936 flat angles P-C4'-P energy: -84.907 tors. eta vs tors. theta energy: -6.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2757.872322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2757.872322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2757.872322 (E_RNA) where: Base-Base interactions energy: -1828.096 where: short stacking energy: -868.519 Base-Backbone interact. energy: -3.865 local terms energy: -925.911676 where: bonds (distance) C4'-P energy: -182.977 bonds (distance) P-C4' energy: -182.264 flat angles C4'-P-C4' energy: -190.845 flat angles P-C4'-P energy: -139.053 tors. eta vs tors. theta energy: -230.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -2514.365550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.365550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2514.365550 (E_RNA) where: Base-Base interactions energy: -1630.413 where: short stacking energy: -762.650 Base-Backbone interact. energy: -0.354 local terms energy: -883.598202 where: bonds (distance) C4'-P energy: -180.800 bonds (distance) P-C4' energy: -189.133 flat angles C4'-P-C4' energy: -198.935 flat angles P-C4'-P energy: -127.355 tors. eta vs tors. theta energy: -187.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -2251.122121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2251.122121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2251.122121 (E_RNA) where: Base-Base interactions energy: -1395.260 where: short stacking energy: -727.952 Base-Backbone interact. energy: -4.800 local terms energy: -851.062104 where: bonds (distance) C4'-P energy: -187.642 bonds (distance) P-C4' energy: -188.754 flat angles C4'-P-C4' energy: -182.770 flat angles P-C4'-P energy: -122.835 tors. eta vs tors. theta energy: -169.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -2132.589890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2132.589890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2132.589890 (E_RNA) where: Base-Base interactions energy: -1359.462 where: short stacking energy: -658.849 Base-Backbone interact. energy: -2.926 local terms energy: -770.202191 where: bonds (distance) C4'-P energy: -160.092 bonds (distance) P-C4' energy: -183.052 flat angles C4'-P-C4' energy: -177.074 flat angles P-C4'-P energy: -109.011 tors. eta vs tors. theta energy: -140.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1942.939425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1942.939425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1942.939425 (E_RNA) where: Base-Base interactions energy: -1206.116 where: short stacking energy: -590.233 Base-Backbone interact. energy: -2.825 local terms energy: -733.998737 where: bonds (distance) C4'-P energy: -163.876 bonds (distance) P-C4' energy: -181.884 flat angles C4'-P-C4' energy: -169.353 flat angles P-C4'-P energy: -88.021 tors. eta vs tors. theta energy: -130.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1809.837927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1809.837927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1809.837927 (E_RNA) where: Base-Base interactions energy: -1064.976 where: short stacking energy: -577.426 Base-Backbone interact. energy: 3.962 local terms energy: -748.823378 where: bonds (distance) C4'-P energy: -157.960 bonds (distance) P-C4' energy: -174.390 flat angles C4'-P-C4' energy: -184.291 flat angles P-C4'-P energy: -108.487 tors. eta vs tors. theta energy: -123.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1558.180955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1558.180955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1558.180955 (E_RNA) where: Base-Base interactions energy: -917.634 where: short stacking energy: -493.743 Base-Backbone interact. energy: 1.198 local terms energy: -641.744767 where: bonds (distance) C4'-P energy: -163.086 bonds (distance) P-C4' energy: -163.108 flat angles C4'-P-C4' energy: -157.284 flat angles P-C4'-P energy: -91.632 tors. eta vs tors. theta energy: -66.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1256.735524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.735524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.735524 (E_RNA) where: Base-Base interactions energy: -689.995 where: short stacking energy: -357.597 Base-Backbone interact. energy: 4.813 local terms energy: -571.553632 where: bonds (distance) C4'-P energy: -149.633 bonds (distance) P-C4' energy: -154.879 flat angles C4'-P-C4' energy: -147.143 flat angles P-C4'-P energy: -92.596 tors. eta vs tors. theta energy: -27.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -1014.191394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.191394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.191394 (E_RNA) where: Base-Base interactions energy: -500.086 where: short stacking energy: -321.356 Base-Backbone interact. energy: -2.416 local terms energy: -511.689643 where: bonds (distance) C4'-P energy: -155.281 bonds (distance) P-C4' energy: -161.911 flat angles C4'-P-C4' energy: -132.116 flat angles P-C4'-P energy: -59.524 tors. eta vs tors. theta energy: -2.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -946.933369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -946.933369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -946.933369 (E_RNA) where: Base-Base interactions energy: -444.677 where: short stacking energy: -271.303 Base-Backbone interact. energy: 0.587 local terms energy: -502.843030 where: bonds (distance) C4'-P energy: -139.065 bonds (distance) P-C4' energy: -151.773 flat angles C4'-P-C4' energy: -130.782 flat angles P-C4'-P energy: -97.534 tors. eta vs tors. theta energy: 16.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2820.850037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2820.850037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2820.850037 (E_RNA) where: Base-Base interactions energy: -1855.990 where: short stacking energy: -902.730 Base-Backbone interact. energy: -4.311 local terms energy: -960.549301 where: bonds (distance) C4'-P energy: -190.614 bonds (distance) P-C4' energy: -192.519 flat angles C4'-P-C4' energy: -214.171 flat angles P-C4'-P energy: -133.302 tors. eta vs tors. theta energy: -229.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -2543.653948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2543.653948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2543.653948 (E_RNA) where: Base-Base interactions energy: -1667.971 where: short stacking energy: -797.601 Base-Backbone interact. energy: 3.505 local terms energy: -879.188059 where: bonds (distance) C4'-P energy: -181.911 bonds (distance) P-C4' energy: -177.081 flat angles C4'-P-C4' energy: -187.059 flat angles P-C4'-P energy: -140.196 tors. eta vs tors. theta energy: -192.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -2345.146586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2345.146586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2345.146586 (E_RNA) where: Base-Base interactions energy: -1537.960 where: short stacking energy: -740.838 Base-Backbone interact. energy: -2.931 local terms energy: -804.255923 where: bonds (distance) C4'-P energy: -165.172 bonds (distance) P-C4' energy: -161.367 flat angles C4'-P-C4' energy: -177.429 flat angles P-C4'-P energy: -123.166 tors. eta vs tors. theta energy: -177.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -2187.243214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2187.243214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2187.243214 (E_RNA) where: Base-Base interactions energy: -1437.874 where: short stacking energy: -676.148 Base-Backbone interact. energy: -4.239 local terms energy: -745.129674 where: bonds (distance) C4'-P energy: -177.522 bonds (distance) P-C4' energy: -138.217 flat angles C4'-P-C4' energy: -180.900 flat angles P-C4'-P energy: -106.986 tors. eta vs tors. theta energy: -141.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -2000.308725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2000.308725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2000.308725 (E_RNA) where: Base-Base interactions energy: -1250.045 where: short stacking energy: -608.044 Base-Backbone interact. energy: -4.772 local terms energy: -745.492246 where: bonds (distance) C4'-P energy: -166.354 bonds (distance) P-C4' energy: -169.637 flat angles C4'-P-C4' energy: -187.544 flat angles P-C4'-P energy: -101.562 tors. eta vs tors. theta energy: -120.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1787.103003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.103003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.103003 (E_RNA) where: Base-Base interactions energy: -1095.575 where: short stacking energy: -561.707 Base-Backbone interact. energy: 1.241 local terms energy: -692.768332 where: bonds (distance) C4'-P energy: -155.232 bonds (distance) P-C4' energy: -166.264 flat angles C4'-P-C4' energy: -155.681 flat angles P-C4'-P energy: -106.096 tors. eta vs tors. theta energy: -109.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1511.833029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.833029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.833029 (E_RNA) where: Base-Base interactions energy: -891.837 where: short stacking energy: -461.096 Base-Backbone interact. energy: 1.016 local terms energy: -621.011649 where: bonds (distance) C4'-P energy: -146.242 bonds (distance) P-C4' energy: -170.757 flat angles C4'-P-C4' energy: -147.869 flat angles P-C4'-P energy: -102.243 tors. eta vs tors. theta energy: -53.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -1331.730150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.730150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.730150 (E_RNA) where: Base-Base interactions energy: -766.551 where: short stacking energy: -430.746 Base-Backbone interact. energy: 2.247 local terms energy: -567.426436 where: bonds (distance) C4'-P energy: -137.022 bonds (distance) P-C4' energy: -145.329 flat angles C4'-P-C4' energy: -156.621 flat angles P-C4'-P energy: -83.579 tors. eta vs tors. theta energy: -44.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -980.298532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.298532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.298532 (E_RNA) where: Base-Base interactions energy: -479.170 where: short stacking energy: -291.974 Base-Backbone interact. energy: -2.052 local terms energy: -499.075872 where: bonds (distance) C4'-P energy: -115.704 bonds (distance) P-C4' energy: -182.064 flat angles C4'-P-C4' energy: -139.549 flat angles P-C4'-P energy: -79.755 tors. eta vs tors. theta energy: 17.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -822.242575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.242575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.242575 (E_RNA) where: Base-Base interactions energy: -366.459 where: short stacking energy: -229.214 Base-Backbone interact. energy: 3.952 local terms energy: -459.735994 where: bonds (distance) C4'-P energy: -147.595 bonds (distance) P-C4' energy: -148.281 flat angles C4'-P-C4' energy: -128.217 flat angles P-C4'-P energy: -75.614 tors. eta vs tors. theta energy: 39.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2775.972381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2775.972381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2775.972381 (E_RNA) where: Base-Base interactions energy: -1847.991 where: short stacking energy: -887.702 Base-Backbone interact. energy: -2.533 local terms energy: -925.447951 where: bonds (distance) C4'-P energy: -178.265 bonds (distance) P-C4' energy: -190.694 flat angles C4'-P-C4' energy: -197.260 flat angles P-C4'-P energy: -130.699 tors. eta vs tors. theta energy: -228.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -2573.332702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2573.332702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2573.332702 (E_RNA) where: Base-Base interactions energy: -1664.454 where: short stacking energy: -775.190 Base-Backbone interact. energy: 0.586 local terms energy: -909.464413 where: bonds (distance) C4'-P energy: -178.100 bonds (distance) P-C4' energy: -192.988 flat angles C4'-P-C4' energy: -196.509 flat angles P-C4'-P energy: -144.959 tors. eta vs tors. theta energy: -196.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -2378.150906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2378.150906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2378.150906 (E_RNA) where: Base-Base interactions energy: -1535.848 where: short stacking energy: -767.301 Base-Backbone interact. energy: -3.670 local terms energy: -838.632857 where: bonds (distance) C4'-P energy: -150.525 bonds (distance) P-C4' energy: -193.763 flat angles C4'-P-C4' energy: -201.774 flat angles P-C4'-P energy: -120.900 tors. eta vs tors. theta energy: -171.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -2267.583848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2267.583848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2267.583848 (E_RNA) where: Base-Base interactions energy: -1438.406 where: short stacking energy: -721.204 Base-Backbone interact. energy: -3.985 local terms energy: -825.193081 where: bonds (distance) C4'-P energy: -159.764 bonds (distance) P-C4' energy: -182.957 flat angles C4'-P-C4' energy: -184.646 flat angles P-C4'-P energy: -124.185 tors. eta vs tors. theta energy: -173.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -2076.609594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2076.609594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2076.609594 (E_RNA) where: Base-Base interactions energy: -1333.778 where: short stacking energy: -594.948 Base-Backbone interact. energy: 0.557 local terms energy: -743.389128 where: bonds (distance) C4'-P energy: -162.326 bonds (distance) P-C4' energy: -164.901 flat angles C4'-P-C4' energy: -178.902 flat angles P-C4'-P energy: -99.934 tors. eta vs tors. theta energy: -137.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1795.392755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1795.392755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1795.392755 (E_RNA) where: Base-Base interactions energy: -1103.378 where: short stacking energy: -571.493 Base-Backbone interact. energy: -1.148 local terms energy: -690.866463 where: bonds (distance) C4'-P energy: -158.656 bonds (distance) P-C4' energy: -168.322 flat angles C4'-P-C4' energy: -142.302 flat angles P-C4'-P energy: -91.238 tors. eta vs tors. theta energy: -130.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1585.075854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1585.075854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1585.075854 (E_RNA) where: Base-Base interactions energy: -937.270 where: short stacking energy: -479.502 Base-Backbone interact. energy: 2.706 local terms energy: -650.511280 where: bonds (distance) C4'-P energy: -162.117 bonds (distance) P-C4' energy: -145.768 flat angles C4'-P-C4' energy: -159.417 flat angles P-C4'-P energy: -102.446 tors. eta vs tors. theta energy: -80.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -1523.607158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1523.607158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1523.607158 (E_RNA) where: Base-Base interactions energy: -869.284 where: short stacking energy: -454.175 Base-Backbone interact. energy: -0.045 local terms energy: -654.277831 where: bonds (distance) C4'-P energy: -173.407 bonds (distance) P-C4' energy: -158.769 flat angles C4'-P-C4' energy: -138.284 flat angles P-C4'-P energy: -111.998 tors. eta vs tors. theta energy: -71.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -1001.085513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.085513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.085513 (E_RNA) where: Base-Base interactions energy: -465.816 where: short stacking energy: -305.938 Base-Backbone interact. energy: 0.537 local terms energy: -535.807208 where: bonds (distance) C4'-P energy: -154.673 bonds (distance) P-C4' energy: -175.246 flat angles C4'-P-C4' energy: -142.351 flat angles P-C4'-P energy: -60.189 tors. eta vs tors. theta energy: -3.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -827.398950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -827.398950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -827.398950 (E_RNA) where: Base-Base interactions energy: -362.710 where: short stacking energy: -272.287 Base-Backbone interact. energy: 6.138 local terms energy: -470.826259 where: bonds (distance) C4'-P energy: -143.477 bonds (distance) P-C4' energy: -136.070 flat angles C4'-P-C4' energy: -130.013 flat angles P-C4'-P energy: -65.309 tors. eta vs tors. theta energy: 4.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2799.194374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2799.194374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2799.194374 (E_RNA) where: Base-Base interactions energy: -1856.245 where: short stacking energy: -897.346 Base-Backbone interact. energy: -1.304 local terms energy: -941.645038 where: bonds (distance) C4'-P energy: -175.406 bonds (distance) P-C4' energy: -194.213 flat angles C4'-P-C4' energy: -211.091 flat angles P-C4'-P energy: -139.686 tors. eta vs tors. theta energy: -221.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2612.846320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2612.846320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2612.846320 (E_RNA) where: Base-Base interactions energy: -1745.926 where: short stacking energy: -799.045 Base-Backbone interact. energy: 6.334 local terms energy: -873.253963 where: bonds (distance) C4'-P energy: -177.458 bonds (distance) P-C4' energy: -191.857 flat angles C4'-P-C4' energy: -188.420 flat angles P-C4'-P energy: -113.833 tors. eta vs tors. theta energy: -201.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -2395.682353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2395.682353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2395.682353 (E_RNA) where: Base-Base interactions energy: -1580.961 where: short stacking energy: -768.244 Base-Backbone interact. energy: -2.417 local terms energy: -812.304150 where: bonds (distance) C4'-P energy: -181.921 bonds (distance) P-C4' energy: -178.916 flat angles C4'-P-C4' energy: -182.349 flat angles P-C4'-P energy: -110.149 tors. eta vs tors. theta energy: -158.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -2280.519671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.519671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.519671 (E_RNA) where: Base-Base interactions energy: -1428.165 where: short stacking energy: -699.967 Base-Backbone interact. energy: -5.448 local terms energy: -846.906784 where: bonds (distance) C4'-P energy: -178.707 bonds (distance) P-C4' energy: -167.926 flat angles C4'-P-C4' energy: -183.879 flat angles P-C4'-P energy: -135.976 tors. eta vs tors. theta energy: -180.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -2125.234477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2125.234477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2125.234477 (E_RNA) where: Base-Base interactions energy: -1382.439 where: short stacking energy: -670.626 Base-Backbone interact. energy: 4.810 local terms energy: -747.604696 where: bonds (distance) C4'-P energy: -156.850 bonds (distance) P-C4' energy: -154.594 flat angles C4'-P-C4' energy: -173.638 flat angles P-C4'-P energy: -115.197 tors. eta vs tors. theta energy: -147.326 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1871.268844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.268844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.268844 (E_RNA) where: Base-Base interactions energy: -1161.108 where: short stacking energy: -633.791 Base-Backbone interact. energy: -2.150 local terms energy: -708.011106 where: bonds (distance) C4'-P energy: -129.239 bonds (distance) P-C4' energy: -167.787 flat angles C4'-P-C4' energy: -179.482 flat angles P-C4'-P energy: -108.612 tors. eta vs tors. theta energy: -122.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1584.179974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1584.179974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1584.179974 (E_RNA) where: Base-Base interactions energy: -926.319 where: short stacking energy: -463.732 Base-Backbone interact. energy: 0.336 local terms energy: -658.197698 where: bonds (distance) C4'-P energy: -177.496 bonds (distance) P-C4' energy: -159.921 flat angles C4'-P-C4' energy: -148.003 flat angles P-C4'-P energy: -86.964 tors. eta vs tors. theta energy: -85.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -1467.577547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.577547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.577547 (E_RNA) where: Base-Base interactions energy: -870.288 where: short stacking energy: -469.132 Base-Backbone interact. energy: -0.479 local terms energy: -596.810777 where: bonds (distance) C4'-P energy: -134.885 bonds (distance) P-C4' energy: -177.525 flat angles C4'-P-C4' energy: -138.879 flat angles P-C4'-P energy: -81.894 tors. eta vs tors. theta energy: -63.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -1042.224331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.224331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.224331 (E_RNA) where: Base-Base interactions energy: -518.278 where: short stacking energy: -314.071 Base-Backbone interact. energy: 2.365 local terms energy: -526.311218 where: bonds (distance) C4'-P energy: -141.627 bonds (distance) P-C4' energy: -169.999 flat angles C4'-P-C4' energy: -123.272 flat angles P-C4'-P energy: -85.177 tors. eta vs tors. theta energy: -6.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -828.076574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.076574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.076574 (E_RNA) where: Base-Base interactions energy: -361.094 where: short stacking energy: -261.327 Base-Backbone interact. energy: -3.038 local terms energy: -463.944058 where: bonds (distance) C4'-P energy: -165.269 bonds (distance) P-C4' energy: -150.480 flat angles C4'-P-C4' energy: -121.943 flat angles P-C4'-P energy: -55.768 tors. eta vs tors. theta energy: 29.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2811.902772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2811.902772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2811.902772 (E_RNA) where: Base-Base interactions energy: -1876.940 where: short stacking energy: -894.905 Base-Backbone interact. energy: -4.337 local terms energy: -930.625990 where: bonds (distance) C4'-P energy: -166.425 bonds (distance) P-C4' energy: -191.949 flat angles C4'-P-C4' energy: -197.169 flat angles P-C4'-P energy: -130.198 tors. eta vs tors. theta energy: -244.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2637.061050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2637.061050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2637.061050 (E_RNA) where: Base-Base interactions energy: -1741.238 where: short stacking energy: -829.318 Base-Backbone interact. energy: 0.783 local terms energy: -896.605916 where: bonds (distance) C4'-P energy: -175.305 bonds (distance) P-C4' energy: -185.682 flat angles C4'-P-C4' energy: -188.049 flat angles P-C4'-P energy: -136.388 tors. eta vs tors. theta energy: -211.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -2452.372684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2452.372684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2452.372684 (E_RNA) where: Base-Base interactions energy: -1607.616 where: short stacking energy: -795.310 Base-Backbone interact. energy: -0.033 local terms energy: -844.723380 where: bonds (distance) C4'-P energy: -155.047 bonds (distance) P-C4' energy: -173.284 flat angles C4'-P-C4' energy: -187.588 flat angles P-C4'-P energy: -126.642 tors. eta vs tors. theta energy: -202.163 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -2282.457074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2282.457074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2282.457074 (E_RNA) where: Base-Base interactions energy: -1463.047 where: short stacking energy: -719.987 Base-Backbone interact. energy: -3.743 local terms energy: -815.667013 where: bonds (distance) C4'-P energy: -165.315 bonds (distance) P-C4' energy: -178.381 flat angles C4'-P-C4' energy: -178.796 flat angles P-C4'-P energy: -116.331 tors. eta vs tors. theta energy: -176.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -2084.391926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2084.391926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2084.391926 (E_RNA) where: Base-Base interactions energy: -1351.749 where: short stacking energy: -640.733 Base-Backbone interact. energy: -1.044 local terms energy: -731.598829 where: bonds (distance) C4'-P energy: -169.261 bonds (distance) P-C4' energy: -157.569 flat angles C4'-P-C4' energy: -170.557 flat angles P-C4'-P energy: -88.304 tors. eta vs tors. theta energy: -145.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1859.462483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1859.462483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1859.462483 (E_RNA) where: Base-Base interactions energy: -1125.992 where: short stacking energy: -582.409 Base-Backbone interact. energy: -2.919 local terms energy: -730.551625 where: bonds (distance) C4'-P energy: -171.686 bonds (distance) P-C4' energy: -177.419 flat angles C4'-P-C4' energy: -140.436 flat angles P-C4'-P energy: -121.744 tors. eta vs tors. theta energy: -119.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1649.038314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.038314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.038314 (E_RNA) where: Base-Base interactions energy: -997.615 where: short stacking energy: -462.996 Base-Backbone interact. energy: 4.533 local terms energy: -655.956477 where: bonds (distance) C4'-P energy: -152.259 bonds (distance) P-C4' energy: -184.224 flat angles C4'-P-C4' energy: -152.345 flat angles P-C4'-P energy: -97.683 tors. eta vs tors. theta energy: -69.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -1496.549383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1496.549383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1496.549383 (E_RNA) where: Base-Base interactions energy: -842.981 where: short stacking energy: -452.943 Base-Backbone interact. energy: -2.381 local terms energy: -651.188053 where: bonds (distance) C4'-P energy: -160.714 bonds (distance) P-C4' energy: -180.160 flat angles C4'-P-C4' energy: -172.551 flat angles P-C4'-P energy: -82.530 tors. eta vs tors. theta energy: -55.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -1128.313871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.313871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.313871 (E_RNA) where: Base-Base interactions energy: -632.467 where: short stacking energy: -335.889 Base-Backbone interact. energy: 0.469 local terms energy: -496.316006 where: bonds (distance) C4'-P energy: -133.228 bonds (distance) P-C4' energy: -138.443 flat angles C4'-P-C4' energy: -122.786 flat angles P-C4'-P energy: -89.030 tors. eta vs tors. theta energy: -12.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -835.945946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.945946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.945946 (E_RNA) where: Base-Base interactions energy: -386.416 where: short stacking energy: -261.144 Base-Backbone interact. energy: -1.047 local terms energy: -448.482712 where: bonds (distance) C4'-P energy: -145.454 bonds (distance) P-C4' energy: -147.971 flat angles C4'-P-C4' energy: -119.584 flat angles P-C4'-P energy: -51.324 tors. eta vs tors. theta energy: 15.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2826.645376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2826.645376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2826.645376 (E_RNA) where: Base-Base interactions energy: -1892.322 where: short stacking energy: -914.071 Base-Backbone interact. energy: -2.474 local terms energy: -931.849516 where: bonds (distance) C4'-P energy: -181.739 bonds (distance) P-C4' energy: -189.243 flat angles C4'-P-C4' energy: -203.338 flat angles P-C4'-P energy: -128.930 tors. eta vs tors. theta energy: -228.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -2610.514166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2610.514166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2610.514166 (E_RNA) where: Base-Base interactions energy: -1740.267 where: short stacking energy: -833.029 Base-Backbone interact. energy: -2.288 local terms energy: -867.958566 where: bonds (distance) C4'-P energy: -176.573 bonds (distance) P-C4' energy: -180.961 flat angles C4'-P-C4' energy: -188.424 flat angles P-C4'-P energy: -114.283 tors. eta vs tors. theta energy: -207.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -2486.776340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2486.776340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2486.776340 (E_RNA) where: Base-Base interactions energy: -1647.677 where: short stacking energy: -792.211 Base-Backbone interact. energy: 0.913 local terms energy: -840.012236 where: bonds (distance) C4'-P energy: -158.682 bonds (distance) P-C4' energy: -172.958 flat angles C4'-P-C4' energy: -199.199 flat angles P-C4'-P energy: -130.365 tors. eta vs tors. theta energy: -178.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -2350.185729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2350.185729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2350.185729 (E_RNA) where: Base-Base interactions energy: -1532.355 where: short stacking energy: -735.711 Base-Backbone interact. energy: 1.527 local terms energy: -819.357900 where: bonds (distance) C4'-P energy: -165.286 bonds (distance) P-C4' energy: -173.089 flat angles C4'-P-C4' energy: -196.423 flat angles P-C4'-P energy: -117.386 tors. eta vs tors. theta energy: -167.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -2078.977454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2078.977454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2078.977454 (E_RNA) where: Base-Base interactions energy: -1378.163 where: short stacking energy: -628.712 Base-Backbone interact. energy: 0.923 local terms energy: -701.736771 where: bonds (distance) C4'-P energy: -155.865 bonds (distance) P-C4' energy: -171.802 flat angles C4'-P-C4' energy: -149.948 flat angles P-C4'-P energy: -97.736 tors. eta vs tors. theta energy: -126.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1909.227882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1909.227882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1909.227882 (E_RNA) where: Base-Base interactions energy: -1211.954 where: short stacking energy: -606.261 Base-Backbone interact. energy: -0.585 local terms energy: -696.688624 where: bonds (distance) C4'-P energy: -157.549 bonds (distance) P-C4' energy: -176.676 flat angles C4'-P-C4' energy: -155.211 flat angles P-C4'-P energy: -88.226 tors. eta vs tors. theta energy: -119.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1682.723825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.723825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.723825 (E_RNA) where: Base-Base interactions energy: -1008.904 where: short stacking energy: -513.222 Base-Backbone interact. energy: -0.046 local terms energy: -673.774202 where: bonds (distance) C4'-P energy: -164.347 bonds (distance) P-C4' energy: -164.960 flat angles C4'-P-C4' energy: -156.175 flat angles P-C4'-P energy: -104.216 tors. eta vs tors. theta energy: -84.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1595.938618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.938618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.938618 (E_RNA) where: Base-Base interactions energy: -974.760 where: short stacking energy: -499.388 Base-Backbone interact. energy: -1.067 local terms energy: -620.111669 where: bonds (distance) C4'-P energy: -153.388 bonds (distance) P-C4' energy: -149.270 flat angles C4'-P-C4' energy: -157.234 flat angles P-C4'-P energy: -74.285 tors. eta vs tors. theta energy: -85.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -1129.788317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.788317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.788317 (E_RNA) where: Base-Base interactions energy: -588.724 where: short stacking energy: -357.789 Base-Backbone interact. energy: 0.489 local terms energy: -541.552966 where: bonds (distance) C4'-P energy: -151.836 bonds (distance) P-C4' energy: -145.205 flat angles C4'-P-C4' energy: -150.952 flat angles P-C4'-P energy: -72.536 tors. eta vs tors. theta energy: -21.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -909.642615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -909.642615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -909.642615 (E_RNA) where: Base-Base interactions energy: -436.466 where: short stacking energy: -278.388 Base-Backbone interact. energy: 1.476 local terms energy: -474.652341 where: bonds (distance) C4'-P energy: -156.422 bonds (distance) P-C4' energy: -140.249 flat angles C4'-P-C4' energy: -123.038 flat angles P-C4'-P energy: -70.577 tors. eta vs tors. theta energy: 15.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2867.003443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2867.003443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2867.003443 (E_RNA) where: Base-Base interactions energy: -1941.992 where: short stacking energy: -930.923 Base-Backbone interact. energy: -2.728 local terms energy: -922.283975 where: bonds (distance) C4'-P energy: -159.967 bonds (distance) P-C4' energy: -195.654 flat angles C4'-P-C4' energy: -208.774 flat angles P-C4'-P energy: -116.925 tors. eta vs tors. theta energy: -240.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -2611.087441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2611.087441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2611.087441 (E_RNA) where: Base-Base interactions energy: -1731.764 where: short stacking energy: -785.640 Base-Backbone interact. energy: -4.804 local terms energy: -874.519547 where: bonds (distance) C4'-P energy: -178.957 bonds (distance) P-C4' energy: -193.187 flat angles C4'-P-C4' energy: -176.855 flat angles P-C4'-P energy: -131.350 tors. eta vs tors. theta energy: -194.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -2470.994806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2470.994806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2470.994806 (E_RNA) where: Base-Base interactions energy: -1653.237 where: short stacking energy: -786.901 Base-Backbone interact. energy: -4.378 local terms energy: -813.379275 where: bonds (distance) C4'-P energy: -178.300 bonds (distance) P-C4' energy: -166.990 flat angles C4'-P-C4' energy: -181.425 flat angles P-C4'-P energy: -106.951 tors. eta vs tors. theta energy: -179.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -2420.250147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2420.250147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2420.250147 (E_RNA) where: Base-Base interactions energy: -1606.541 where: short stacking energy: -717.770 Base-Backbone interact. energy: -0.427 local terms energy: -813.282493 where: bonds (distance) C4'-P energy: -174.411 bonds (distance) P-C4' energy: -183.180 flat angles C4'-P-C4' energy: -174.765 flat angles P-C4'-P energy: -110.504 tors. eta vs tors. theta energy: -170.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -2079.014408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2079.014408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2079.014408 (E_RNA) where: Base-Base interactions energy: -1357.096 where: short stacking energy: -624.509 Base-Backbone interact. energy: -4.852 local terms energy: -717.067074 where: bonds (distance) C4'-P energy: -160.377 bonds (distance) P-C4' energy: -173.587 flat angles C4'-P-C4' energy: -165.832 flat angles P-C4'-P energy: -93.985 tors. eta vs tors. theta energy: -123.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1956.423192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1956.423192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1956.423192 (E_RNA) where: Base-Base interactions energy: -1224.327 where: short stacking energy: -625.504 Base-Backbone interact. energy: -1.264 local terms energy: -730.832084 where: bonds (distance) C4'-P energy: -136.683 bonds (distance) P-C4' energy: -175.301 flat angles C4'-P-C4' energy: -171.268 flat angles P-C4'-P energy: -117.632 tors. eta vs tors. theta energy: -129.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1717.410542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.410542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1717.410542 (E_RNA) where: Base-Base interactions energy: -1045.037 where: short stacking energy: -526.385 Base-Backbone interact. energy: -1.387 local terms energy: -670.986554 where: bonds (distance) C4'-P energy: -147.740 bonds (distance) P-C4' energy: -159.528 flat angles C4'-P-C4' energy: -176.822 flat angles P-C4'-P energy: -98.434 tors. eta vs tors. theta energy: -88.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -1651.076054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.076054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.076054 (E_RNA) where: Base-Base interactions energy: -983.307 where: short stacking energy: -495.060 Base-Backbone interact. energy: -2.071 local terms energy: -665.697511 where: bonds (distance) C4'-P energy: -162.231 bonds (distance) P-C4' energy: -154.457 flat angles C4'-P-C4' energy: -163.358 flat angles P-C4'-P energy: -92.470 tors. eta vs tors. theta energy: -93.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -1138.711386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.711386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.711386 (E_RNA) where: Base-Base interactions energy: -624.925 where: short stacking energy: -328.782 Base-Backbone interact. energy: 4.245 local terms energy: -518.031913 where: bonds (distance) C4'-P energy: -127.172 bonds (distance) P-C4' energy: -151.129 flat angles C4'-P-C4' energy: -144.412 flat angles P-C4'-P energy: -87.001 tors. eta vs tors. theta energy: -8.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -983.919375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.919375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.919375 (E_RNA) where: Base-Base interactions energy: -484.028 where: short stacking energy: -280.610 Base-Backbone interact. energy: 4.242 local terms energy: -504.133029 where: bonds (distance) C4'-P energy: -154.141 bonds (distance) P-C4' energy: -145.245 flat angles C4'-P-C4' energy: -132.304 flat angles P-C4'-P energy: -69.344 tors. eta vs tors. theta energy: -3.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2857.159623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2857.159623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2857.159623 (E_RNA) where: Base-Base interactions energy: -1888.559 where: short stacking energy: -893.281 Base-Backbone interact. energy: 0.243 local terms energy: -968.843697 where: bonds (distance) C4'-P energy: -181.967 bonds (distance) P-C4' energy: -196.839 flat angles C4'-P-C4' energy: -204.014 flat angles P-C4'-P energy: -143.563 tors. eta vs tors. theta energy: -242.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -2615.471105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2615.471105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2615.471105 (E_RNA) where: Base-Base interactions energy: -1739.759 where: short stacking energy: -813.710 Base-Backbone interact. energy: -2.066 local terms energy: -873.646366 where: bonds (distance) C4'-P energy: -173.173 bonds (distance) P-C4' energy: -181.786 flat angles C4'-P-C4' energy: -200.831 flat angles P-C4'-P energy: -126.039 tors. eta vs tors. theta energy: -191.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -2514.421031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.421031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2514.421031 (E_RNA) where: Base-Base interactions energy: -1613.333 where: short stacking energy: -789.309 Base-Backbone interact. energy: 1.433 local terms energy: -902.520783 where: bonds (distance) C4'-P energy: -178.912 bonds (distance) P-C4' energy: -187.571 flat angles C4'-P-C4' energy: -200.692 flat angles P-C4'-P energy: -133.128 tors. eta vs tors. theta energy: -202.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -2370.270849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2370.270849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2370.270849 (E_RNA) where: Base-Base interactions energy: -1572.824 where: short stacking energy: -730.794 Base-Backbone interact. energy: -1.775 local terms energy: -795.672140 where: bonds (distance) C4'-P energy: -157.384 bonds (distance) P-C4' energy: -166.006 flat angles C4'-P-C4' energy: -189.010 flat angles P-C4'-P energy: -124.351 tors. eta vs tors. theta energy: -158.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -2100.776837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2100.776837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2100.776837 (E_RNA) where: Base-Base interactions energy: -1376.390 where: short stacking energy: -667.394 Base-Backbone interact. energy: -0.972 local terms energy: -723.413917 where: bonds (distance) C4'-P energy: -150.269 bonds (distance) P-C4' energy: -161.735 flat angles C4'-P-C4' energy: -168.282 flat angles P-C4'-P energy: -93.858 tors. eta vs tors. theta energy: -149.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1907.584387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1907.584387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1907.584387 (E_RNA) where: Base-Base interactions energy: -1183.156 where: short stacking energy: -583.627 Base-Backbone interact. energy: -0.931 local terms energy: -723.497517 where: bonds (distance) C4'-P energy: -151.584 bonds (distance) P-C4' energy: -163.867 flat angles C4'-P-C4' energy: -171.499 flat angles P-C4'-P energy: -109.399 tors. eta vs tors. theta energy: -127.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1738.395416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1738.395416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.395416 (E_RNA) where: Base-Base interactions energy: -1064.379 where: short stacking energy: -526.084 Base-Backbone interact. energy: -2.561 local terms energy: -671.455840 where: bonds (distance) C4'-P energy: -156.823 bonds (distance) P-C4' energy: -149.703 flat angles C4'-P-C4' energy: -167.205 flat angles P-C4'-P energy: -93.176 tors. eta vs tors. theta energy: -104.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1631.053457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1631.053457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1631.053457 (E_RNA) where: Base-Base interactions energy: -1005.964 where: short stacking energy: -490.282 Base-Backbone interact. energy: 4.071 local terms energy: -629.160134 where: bonds (distance) C4'-P energy: -144.930 bonds (distance) P-C4' energy: -153.965 flat angles C4'-P-C4' energy: -158.478 flat angles P-C4'-P energy: -93.205 tors. eta vs tors. theta energy: -78.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -1157.226321 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.226321 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.226321 (E_RNA) where: Base-Base interactions energy: -634.262 where: short stacking energy: -356.451 Base-Backbone interact. energy: -5.438 local terms energy: -517.526622 where: bonds (distance) C4'-P energy: -140.948 bonds (distance) P-C4' energy: -165.319 flat angles C4'-P-C4' energy: -109.655 flat angles P-C4'-P energy: -81.018 tors. eta vs tors. theta energy: -20.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -963.248894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.248894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.248894 (E_RNA) where: Base-Base interactions energy: -516.753 where: short stacking energy: -295.780 Base-Backbone interact. energy: 1.469 local terms energy: -447.964836 where: bonds (distance) C4'-P energy: -126.624 bonds (distance) P-C4' energy: -137.506 flat angles C4'-P-C4' energy: -130.197 flat angles P-C4'-P energy: -54.320 tors. eta vs tors. theta energy: 0.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2882.116827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2882.116827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2882.116827 (E_RNA) where: Base-Base interactions energy: -1893.948 where: short stacking energy: -879.571 Base-Backbone interact. energy: -1.992 local terms energy: -986.176085 where: bonds (distance) C4'-P energy: -199.467 bonds (distance) P-C4' energy: -181.112 flat angles C4'-P-C4' energy: -211.239 flat angles P-C4'-P energy: -152.998 tors. eta vs tors. theta energy: -241.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -2611.213485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2611.213485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2611.213485 (E_RNA) where: Base-Base interactions energy: -1716.992 where: short stacking energy: -805.046 Base-Backbone interact. energy: -3.691 local terms energy: -890.530952 where: bonds (distance) C4'-P energy: -187.642 bonds (distance) P-C4' energy: -187.566 flat angles C4'-P-C4' energy: -186.545 flat angles P-C4'-P energy: -131.762 tors. eta vs tors. theta energy: -197.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -2482.489642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2482.489642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2482.489642 (E_RNA) where: Base-Base interactions energy: -1623.508 where: short stacking energy: -780.779 Base-Backbone interact. energy: 0.035 local terms energy: -859.017019 where: bonds (distance) C4'-P energy: -182.847 bonds (distance) P-C4' energy: -173.056 flat angles C4'-P-C4' energy: -192.810 flat angles P-C4'-P energy: -117.691 tors. eta vs tors. theta energy: -192.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -2413.061932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2413.061932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2413.061932 (E_RNA) where: Base-Base interactions energy: -1583.541 where: short stacking energy: -750.088 Base-Backbone interact. energy: 0.598 local terms energy: -830.118448 where: bonds (distance) C4'-P energy: -180.112 bonds (distance) P-C4' energy: -169.655 flat angles C4'-P-C4' energy: -194.478 flat angles P-C4'-P energy: -116.747 tors. eta vs tors. theta energy: -169.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -2138.482216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2138.482216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2138.482216 (E_RNA) where: Base-Base interactions energy: -1390.060 where: short stacking energy: -643.847 Base-Backbone interact. energy: 5.821 local terms energy: -754.242413 where: bonds (distance) C4'-P energy: -161.456 bonds (distance) P-C4' energy: -172.599 flat angles C4'-P-C4' energy: -174.471 flat angles P-C4'-P energy: -112.391 tors. eta vs tors. theta energy: -133.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1935.557823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.557823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1935.557823 (E_RNA) where: Base-Base interactions energy: -1240.414 where: short stacking energy: -618.878 Base-Backbone interact. energy: -1.929 local terms energy: -693.214300 where: bonds (distance) C4'-P energy: -145.737 bonds (distance) P-C4' energy: -161.237 flat angles C4'-P-C4' energy: -152.591 flat angles P-C4'-P energy: -103.340 tors. eta vs tors. theta energy: -130.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1781.104599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1781.104599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1781.104599 (E_RNA) where: Base-Base interactions energy: -1144.918 where: short stacking energy: -537.643 Base-Backbone interact. energy: 2.499 local terms energy: -638.685026 where: bonds (distance) C4'-P energy: -162.084 bonds (distance) P-C4' energy: -150.174 flat angles C4'-P-C4' energy: -159.707 flat angles P-C4'-P energy: -77.786 tors. eta vs tors. theta energy: -88.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1463.586153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.586153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.586153 (E_RNA) where: Base-Base interactions energy: -872.985 where: short stacking energy: -458.038 Base-Backbone interact. energy: -1.044 local terms energy: -589.557176 where: bonds (distance) C4'-P energy: -142.449 bonds (distance) P-C4' energy: -146.710 flat angles C4'-P-C4' energy: -144.356 flat angles P-C4'-P energy: -90.513 tors. eta vs tors. theta energy: -65.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -1139.512688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.512688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.512688 (E_RNA) where: Base-Base interactions energy: -583.389 where: short stacking energy: -344.284 Base-Backbone interact. energy: 2.576 local terms energy: -558.698753 where: bonds (distance) C4'-P energy: -146.115 bonds (distance) P-C4' energy: -169.874 flat angles C4'-P-C4' energy: -131.414 flat angles P-C4'-P energy: -90.266 tors. eta vs tors. theta energy: -21.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -1017.556816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.556816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.556816 (E_RNA) where: Base-Base interactions energy: -551.197 where: short stacking energy: -290.769 Base-Backbone interact. energy: 2.701 local terms energy: -469.060421 where: bonds (distance) C4'-P energy: -143.540 bonds (distance) P-C4' energy: -151.812 flat angles C4'-P-C4' energy: -126.020 flat angles P-C4'-P energy: -54.842 tors. eta vs tors. theta energy: 7.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2848.392902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2848.392902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2848.392902 (E_RNA) where: Base-Base interactions energy: -1922.277 where: short stacking energy: -911.875 Base-Backbone interact. energy: -2.513 local terms energy: -923.602915 where: bonds (distance) C4'-P energy: -177.803 bonds (distance) P-C4' energy: -177.520 flat angles C4'-P-C4' energy: -207.115 flat angles P-C4'-P energy: -128.699 tors. eta vs tors. theta energy: -232.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -2648.413053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2648.413053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2648.413053 (E_RNA) where: Base-Base interactions energy: -1794.173 where: short stacking energy: -820.915 Base-Backbone interact. energy: -0.698 local terms energy: -853.542926 where: bonds (distance) C4'-P energy: -175.057 bonds (distance) P-C4' energy: -172.788 flat angles C4'-P-C4' energy: -192.558 flat angles P-C4'-P energy: -115.451 tors. eta vs tors. theta energy: -197.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -2509.748731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2509.748731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2509.748731 (E_RNA) where: Base-Base interactions energy: -1669.251 where: short stacking energy: -801.080 Base-Backbone interact. energy: -1.087 local terms energy: -839.411289 where: bonds (distance) C4'-P energy: -163.705 bonds (distance) P-C4' energy: -182.191 flat angles C4'-P-C4' energy: -199.528 flat angles P-C4'-P energy: -107.154 tors. eta vs tors. theta energy: -186.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -2436.585471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2436.585471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2436.585471 (E_RNA) where: Base-Base interactions energy: -1605.828 where: short stacking energy: -759.090 Base-Backbone interact. energy: -3.363 local terms energy: -827.393941 where: bonds (distance) C4'-P energy: -162.458 bonds (distance) P-C4' energy: -178.483 flat angles C4'-P-C4' energy: -194.006 flat angles P-C4'-P energy: -109.056 tors. eta vs tors. theta energy: -183.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -2164.134482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2164.134482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2164.134482 (E_RNA) where: Base-Base interactions energy: -1420.794 where: short stacking energy: -649.803 Base-Backbone interact. energy: -3.887 local terms energy: -739.453471 where: bonds (distance) C4'-P energy: -166.105 bonds (distance) P-C4' energy: -174.888 flat angles C4'-P-C4' energy: -164.868 flat angles P-C4'-P energy: -90.985 tors. eta vs tors. theta energy: -142.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -2015.004690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.004690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.004690 (E_RNA) where: Base-Base interactions energy: -1315.744 where: short stacking energy: -611.703 Base-Backbone interact. energy: -1.689 local terms energy: -697.572128 where: bonds (distance) C4'-P energy: -165.841 bonds (distance) P-C4' energy: -156.850 flat angles C4'-P-C4' energy: -158.359 flat angles P-C4'-P energy: -110.432 tors. eta vs tors. theta energy: -106.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1810.922447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1810.922447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1810.922447 (E_RNA) where: Base-Base interactions energy: -1155.799 where: short stacking energy: -555.333 Base-Backbone interact. energy: 6.164 local terms energy: -661.288299 where: bonds (distance) C4'-P energy: -137.732 bonds (distance) P-C4' energy: -153.189 flat angles C4'-P-C4' energy: -161.215 flat angles P-C4'-P energy: -104.149 tors. eta vs tors. theta energy: -105.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1488.219543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.219543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.219543 (E_RNA) where: Base-Base interactions energy: -890.789 where: short stacking energy: -460.498 Base-Backbone interact. energy: 13.114 local terms energy: -610.544709 where: bonds (distance) C4'-P energy: -165.782 bonds (distance) P-C4' energy: -161.024 flat angles C4'-P-C4' energy: -144.042 flat angles P-C4'-P energy: -86.068 tors. eta vs tors. theta energy: -53.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -1192.629437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1192.629437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1192.629437 (E_RNA) where: Base-Base interactions energy: -672.818 where: short stacking energy: -366.357 Base-Backbone interact. energy: -1.631 local terms energy: -518.180574 where: bonds (distance) C4'-P energy: -130.782 bonds (distance) P-C4' energy: -170.870 flat angles C4'-P-C4' energy: -131.702 flat angles P-C4'-P energy: -65.008 tors. eta vs tors. theta energy: -19.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -1005.074786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.074786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.074786 (E_RNA) where: Base-Base interactions energy: -521.964 where: short stacking energy: -308.302 Base-Backbone interact. energy: -2.376 local terms energy: -480.734341 where: bonds (distance) C4'-P energy: -129.846 bonds (distance) P-C4' energy: -139.943 flat angles C4'-P-C4' energy: -132.724 flat angles P-C4'-P energy: -69.634 tors. eta vs tors. theta energy: -8.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2862.754810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2862.754810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2862.754810 (E_RNA) where: Base-Base interactions energy: -1910.373 where: short stacking energy: -902.686 Base-Backbone interact. energy: -4.533 local terms energy: -947.848147 where: bonds (distance) C4'-P energy: -183.517 bonds (distance) P-C4' energy: -192.416 flat angles C4'-P-C4' energy: -195.534 flat angles P-C4'-P energy: -123.555 tors. eta vs tors. theta energy: -252.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -2647.889723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2647.889723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2647.889723 (E_RNA) where: Base-Base interactions energy: -1739.526 where: short stacking energy: -809.554 Base-Backbone interact. energy: -3.154 local terms energy: -905.208944 where: bonds (distance) C4'-P energy: -179.396 bonds (distance) P-C4' energy: -184.552 flat angles C4'-P-C4' energy: -201.209 flat angles P-C4'-P energy: -124.783 tors. eta vs tors. theta energy: -215.270 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -2557.931632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2557.931632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2557.931632 (E_RNA) where: Base-Base interactions energy: -1679.616 where: short stacking energy: -804.909 Base-Backbone interact. energy: -1.446 local terms energy: -876.870213 where: bonds (distance) C4'-P energy: -184.563 bonds (distance) P-C4' energy: -169.486 flat angles C4'-P-C4' energy: -203.944 flat angles P-C4'-P energy: -121.906 tors. eta vs tors. theta energy: -196.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -2473.993358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2473.993358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2473.993358 (E_RNA) where: Base-Base interactions energy: -1662.963 where: short stacking energy: -746.781 Base-Backbone interact. energy: -1.472 local terms energy: -809.559189 where: bonds (distance) C4'-P energy: -170.991 bonds (distance) P-C4' energy: -159.676 flat angles C4'-P-C4' energy: -180.547 flat angles P-C4'-P energy: -120.937 tors. eta vs tors. theta energy: -177.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -2224.918997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2224.918997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2224.918997 (E_RNA) where: Base-Base interactions energy: -1434.382 where: short stacking energy: -671.821 Base-Backbone interact. energy: -5.210 local terms energy: -785.327180 where: bonds (distance) C4'-P energy: -164.106 bonds (distance) P-C4' energy: -180.942 flat angles C4'-P-C4' energy: -178.854 flat angles P-C4'-P energy: -98.463 tors. eta vs tors. theta energy: -162.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -2033.644327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.644327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.644327 (E_RNA) where: Base-Base interactions energy: -1303.305 where: short stacking energy: -606.343 Base-Backbone interact. energy: -1.939 local terms energy: -728.399790 where: bonds (distance) C4'-P energy: -176.298 bonds (distance) P-C4' energy: -164.981 flat angles C4'-P-C4' energy: -169.290 flat angles P-C4'-P energy: -94.602 tors. eta vs tors. theta energy: -123.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1800.659801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1800.659801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1800.659801 (E_RNA) where: Base-Base interactions energy: -1119.475 where: short stacking energy: -500.365 Base-Backbone interact. energy: 1.458 local terms energy: -682.643389 where: bonds (distance) C4'-P energy: -178.071 bonds (distance) P-C4' energy: -163.030 flat angles C4'-P-C4' energy: -154.228 flat angles P-C4'-P energy: -98.482 tors. eta vs tors. theta energy: -88.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1535.231311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.231311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.231311 (E_RNA) where: Base-Base interactions energy: -927.871 where: short stacking energy: -456.926 Base-Backbone interact. energy: -3.770 local terms energy: -603.590699 where: bonds (distance) C4'-P energy: -131.074 bonds (distance) P-C4' energy: -156.356 flat angles C4'-P-C4' energy: -151.632 flat angles P-C4'-P energy: -103.308 tors. eta vs tors. theta energy: -61.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -1193.445308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.445308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.445308 (E_RNA) where: Base-Base interactions energy: -653.362 where: short stacking energy: -340.822 Base-Backbone interact. energy: 9.823 local terms energy: -549.906144 where: bonds (distance) C4'-P energy: -144.918 bonds (distance) P-C4' energy: -163.586 flat angles C4'-P-C4' energy: -136.482 flat angles P-C4'-P energy: -84.747 tors. eta vs tors. theta energy: -20.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -948.535749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -948.535749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -948.535749 (E_RNA) where: Base-Base interactions energy: -493.556 where: short stacking energy: -288.471 Base-Backbone interact. energy: 1.695 local terms energy: -456.674527 where: bonds (distance) C4'-P energy: -113.126 bonds (distance) P-C4' energy: -144.261 flat angles C4'-P-C4' energy: -144.962 flat angles P-C4'-P energy: -66.611 tors. eta vs tors. theta energy: 12.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2872.009428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2872.009428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2872.009428 (E_RNA) where: Base-Base interactions energy: -1936.738 where: short stacking energy: -911.592 Base-Backbone interact. energy: -0.475 local terms energy: -934.796370 where: bonds (distance) C4'-P energy: -181.499 bonds (distance) P-C4' energy: -192.113 flat angles C4'-P-C4' energy: -193.340 flat angles P-C4'-P energy: -121.600 tors. eta vs tors. theta energy: -246.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2638.460762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2638.460762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2638.460762 (E_RNA) where: Base-Base interactions energy: -1742.977 where: short stacking energy: -799.681 Base-Backbone interact. energy: -1.213 local terms energy: -894.270826 where: bonds (distance) C4'-P energy: -170.164 bonds (distance) P-C4' energy: -194.914 flat angles C4'-P-C4' energy: -207.848 flat angles P-C4'-P energy: -126.592 tors. eta vs tors. theta energy: -194.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -2609.896451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2609.896451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2609.896451 (E_RNA) where: Base-Base interactions energy: -1743.600 where: short stacking energy: -790.046 Base-Backbone interact. energy: -1.177 local terms energy: -865.119910 where: bonds (distance) C4'-P energy: -162.005 bonds (distance) P-C4' energy: -199.501 flat angles C4'-P-C4' energy: -187.754 flat angles P-C4'-P energy: -128.904 tors. eta vs tors. theta energy: -186.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -2434.079869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2434.079869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2434.079869 (E_RNA) where: Base-Base interactions energy: -1618.002 where: short stacking energy: -748.611 Base-Backbone interact. energy: -3.418 local terms energy: -812.660146 where: bonds (distance) C4'-P energy: -170.662 bonds (distance) P-C4' energy: -172.502 flat angles C4'-P-C4' energy: -188.273 flat angles P-C4'-P energy: -116.210 tors. eta vs tors. theta energy: -165.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -2155.916198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2155.916198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2155.916198 (E_RNA) where: Base-Base interactions energy: -1402.953 where: short stacking energy: -630.525 Base-Backbone interact. energy: 5.566 local terms energy: -758.529162 where: bonds (distance) C4'-P energy: -176.130 bonds (distance) P-C4' energy: -140.507 flat angles C4'-P-C4' energy: -184.313 flat angles P-C4'-P energy: -115.285 tors. eta vs tors. theta energy: -142.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -2064.977370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2064.977370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2064.977370 (E_RNA) where: Base-Base interactions energy: -1322.709 where: short stacking energy: -616.640 Base-Backbone interact. energy: -3.608 local terms energy: -738.660548 where: bonds (distance) C4'-P energy: -164.726 bonds (distance) P-C4' energy: -168.219 flat angles C4'-P-C4' energy: -165.378 flat angles P-C4'-P energy: -102.304 tors. eta vs tors. theta energy: -138.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1790.132851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1790.132851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1790.132851 (E_RNA) where: Base-Base interactions energy: -1140.020 where: short stacking energy: -543.758 Base-Backbone interact. energy: 2.842 local terms energy: -652.954605 where: bonds (distance) C4'-P energy: -159.262 bonds (distance) P-C4' energy: -165.647 flat angles C4'-P-C4' energy: -150.245 flat angles P-C4'-P energy: -92.485 tors. eta vs tors. theta energy: -85.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1477.705538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.705538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.705538 (E_RNA) where: Base-Base interactions energy: -885.955 where: short stacking energy: -445.147 Base-Backbone interact. energy: -4.314 local terms energy: -587.436464 where: bonds (distance) C4'-P energy: -141.939 bonds (distance) P-C4' energy: -168.361 flat angles C4'-P-C4' energy: -149.724 flat angles P-C4'-P energy: -76.529 tors. eta vs tors. theta energy: -50.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -1280.757027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.757027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.757027 (E_RNA) where: Base-Base interactions energy: -754.932 where: short stacking energy: -373.648 Base-Backbone interact. energy: -2.621 local terms energy: -523.203155 where: bonds (distance) C4'-P energy: -152.213 bonds (distance) P-C4' energy: -138.115 flat angles C4'-P-C4' energy: -131.432 flat angles P-C4'-P energy: -77.622 tors. eta vs tors. theta energy: -23.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -1009.907913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.907913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.907913 (E_RNA) where: Base-Base interactions energy: -520.316 where: short stacking energy: -279.818 Base-Backbone interact. energy: 6.643 local terms energy: -496.235298 where: bonds (distance) C4'-P energy: -142.667 bonds (distance) P-C4' energy: -152.440 flat angles C4'-P-C4' energy: -138.627 flat angles P-C4'-P energy: -86.229 tors. eta vs tors. theta energy: 23.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2854.711737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2854.711737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2854.711737 (E_RNA) where: Base-Base interactions energy: -1924.616 where: short stacking energy: -899.038 Base-Backbone interact. energy: -4.002 local terms energy: -926.093852 where: bonds (distance) C4'-P energy: -176.450 bonds (distance) P-C4' energy: -180.453 flat angles C4'-P-C4' energy: -193.056 flat angles P-C4'-P energy: -136.859 tors. eta vs tors. theta energy: -239.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2649.499785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2649.499785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2649.499785 (E_RNA) where: Base-Base interactions energy: -1767.404 where: short stacking energy: -806.183 Base-Backbone interact. energy: -2.692 local terms energy: -879.403022 where: bonds (distance) C4'-P energy: -179.683 bonds (distance) P-C4' energy: -175.294 flat angles C4'-P-C4' energy: -189.811 flat angles P-C4'-P energy: -117.884 tors. eta vs tors. theta energy: -216.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -2539.995049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2539.995049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2539.995049 (E_RNA) where: Base-Base interactions energy: -1674.407 where: short stacking energy: -796.280 Base-Backbone interact. energy: -0.826 local terms energy: -864.761421 where: bonds (distance) C4'-P energy: -173.980 bonds (distance) P-C4' energy: -173.989 flat angles C4'-P-C4' energy: -187.195 flat angles P-C4'-P energy: -136.602 tors. eta vs tors. theta energy: -192.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -2530.942006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2530.942006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2530.942006 (E_RNA) where: Base-Base interactions energy: -1664.783 where: short stacking energy: -791.705 Base-Backbone interact. energy: -3.548 local terms energy: -862.611041 where: bonds (distance) C4'-P energy: -179.406 bonds (distance) P-C4' energy: -172.697 flat angles C4'-P-C4' energy: -200.595 flat angles P-C4'-P energy: -120.756 tors. eta vs tors. theta energy: -189.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -2286.366128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2286.366128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2286.366128 (E_RNA) where: Base-Base interactions energy: -1517.719 where: short stacking energy: -702.625 Base-Backbone interact. energy: -1.971 local terms energy: -766.676173 where: bonds (distance) C4'-P energy: -176.445 bonds (distance) P-C4' energy: -167.985 flat angles C4'-P-C4' energy: -169.882 flat angles P-C4'-P energy: -97.917 tors. eta vs tors. theta energy: -154.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -2096.209647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2096.209647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2096.209647 (E_RNA) where: Base-Base interactions energy: -1369.823 where: short stacking energy: -653.437 Base-Backbone interact. energy: -2.829 local terms energy: -723.557597 where: bonds (distance) C4'-P energy: -148.919 bonds (distance) P-C4' energy: -159.706 flat angles C4'-P-C4' energy: -172.319 flat angles P-C4'-P energy: -98.587 tors. eta vs tors. theta energy: -144.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1730.801079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1730.801079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1730.801079 (E_RNA) where: Base-Base interactions energy: -1115.442 where: short stacking energy: -469.991 Base-Backbone interact. energy: 0.581 local terms energy: -615.940565 where: bonds (distance) C4'-P energy: -130.587 bonds (distance) P-C4' energy: -162.240 flat angles C4'-P-C4' energy: -138.538 flat angles P-C4'-P energy: -104.382 tors. eta vs tors. theta energy: -80.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1455.348023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.348023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1455.348023 (E_RNA) where: Base-Base interactions energy: -854.611 where: short stacking energy: -435.742 Base-Backbone interact. energy: 5.705 local terms energy: -606.441698 where: bonds (distance) C4'-P energy: -137.691 bonds (distance) P-C4' energy: -135.349 flat angles C4'-P-C4' energy: -153.944 flat angles P-C4'-P energy: -113.195 tors. eta vs tors. theta energy: -66.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -1324.848880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.848880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.848880 (E_RNA) where: Base-Base interactions energy: -748.097 where: short stacking energy: -385.656 Base-Backbone interact. energy: -5.124 local terms energy: -571.627702 where: bonds (distance) C4'-P energy: -133.964 bonds (distance) P-C4' energy: -150.363 flat angles C4'-P-C4' energy: -153.726 flat angles P-C4'-P energy: -105.734 tors. eta vs tors. theta energy: -27.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -1106.066608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.066608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.066608 (E_RNA) where: Base-Base interactions energy: -588.931 where: short stacking energy: -312.728 Base-Backbone interact. energy: 8.346 local terms energy: -525.482036 where: bonds (distance) C4'-P energy: -139.221 bonds (distance) P-C4' energy: -147.837 flat angles C4'-P-C4' energy: -142.559 flat angles P-C4'-P energy: -80.742 tors. eta vs tors. theta energy: -15.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2849.328568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2849.328568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2849.328568 (E_RNA) where: Base-Base interactions energy: -1921.410 where: short stacking energy: -881.400 Base-Backbone interact. energy: -1.711 local terms energy: -926.208067 where: bonds (distance) C4'-P energy: -186.216 bonds (distance) P-C4' energy: -183.203 flat angles C4'-P-C4' energy: -195.001 flat angles P-C4'-P energy: -129.027 tors. eta vs tors. theta energy: -232.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2674.781659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2674.781659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2674.781659 (E_RNA) where: Base-Base interactions energy: -1788.357 where: short stacking energy: -815.566 Base-Backbone interact. energy: -5.834 local terms energy: -880.591045 where: bonds (distance) C4'-P energy: -161.142 bonds (distance) P-C4' energy: -180.138 flat angles C4'-P-C4' energy: -195.119 flat angles P-C4'-P energy: -138.744 tors. eta vs tors. theta energy: -205.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -2580.383058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2580.383058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2580.383058 (E_RNA) where: Base-Base interactions energy: -1718.623 where: short stacking energy: -786.141 Base-Backbone interact. energy: -3.566 local terms energy: -858.194235 where: bonds (distance) C4'-P energy: -170.231 bonds (distance) P-C4' energy: -189.185 flat angles C4'-P-C4' energy: -188.138 flat angles P-C4'-P energy: -112.767 tors. eta vs tors. theta energy: -197.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -2454.614561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2454.614561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2454.614561 (E_RNA) where: Base-Base interactions energy: -1648.460 where: short stacking energy: -776.819 Base-Backbone interact. energy: 0.655 local terms energy: -806.809873 where: bonds (distance) C4'-P energy: -165.073 bonds (distance) P-C4' energy: -171.738 flat angles C4'-P-C4' energy: -179.241 flat angles P-C4'-P energy: -124.532 tors. eta vs tors. theta energy: -166.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -2218.893495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.893495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.893495 (E_RNA) where: Base-Base interactions energy: -1477.941 where: short stacking energy: -658.587 Base-Backbone interact. energy: -2.555 local terms energy: -738.397680 where: bonds (distance) C4'-P energy: -155.497 bonds (distance) P-C4' energy: -169.857 flat angles C4'-P-C4' energy: -154.482 flat angles P-C4'-P energy: -110.040 tors. eta vs tors. theta energy: -148.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -2083.621146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2083.621146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2083.621146 (E_RNA) where: Base-Base interactions energy: -1378.734 where: short stacking energy: -672.784 Base-Backbone interact. energy: 0.941 local terms energy: -705.828769 where: bonds (distance) C4'-P energy: -147.361 bonds (distance) P-C4' energy: -144.418 flat angles C4'-P-C4' energy: -165.581 flat angles P-C4'-P energy: -104.283 tors. eta vs tors. theta energy: -144.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1780.586812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1780.586812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.586812 (E_RNA) where: Base-Base interactions energy: -1108.690 where: short stacking energy: -530.826 Base-Backbone interact. energy: 0.867 local terms energy: -672.763723 where: bonds (distance) C4'-P energy: -143.807 bonds (distance) P-C4' energy: -158.692 flat angles C4'-P-C4' energy: -181.152 flat angles P-C4'-P energy: -100.258 tors. eta vs tors. theta energy: -88.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1438.967784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.967784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.967784 (E_RNA) where: Base-Base interactions energy: -854.752 where: short stacking energy: -452.627 Base-Backbone interact. energy: 1.448 local terms energy: -585.663478 where: bonds (distance) C4'-P energy: -150.063 bonds (distance) P-C4' energy: -141.729 flat angles C4'-P-C4' energy: -128.544 flat angles P-C4'-P energy: -101.736 tors. eta vs tors. theta energy: -63.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -1284.702006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.702006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.702006 (E_RNA) where: Base-Base interactions energy: -709.793 where: short stacking energy: -366.570 Base-Backbone interact. energy: 4.649 local terms energy: -579.558095 where: bonds (distance) C4'-P energy: -132.377 bonds (distance) P-C4' energy: -176.115 flat angles C4'-P-C4' energy: -130.076 flat angles P-C4'-P energy: -81.550 tors. eta vs tors. theta energy: -59.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -1100.984293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1100.984293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1100.984293 (E_RNA) where: Base-Base interactions energy: -619.699 where: short stacking energy: -350.780 Base-Backbone interact. energy: 8.352 local terms energy: -489.636679 where: bonds (distance) C4'-P energy: -137.550 bonds (distance) P-C4' energy: -128.240 flat angles C4'-P-C4' energy: -134.740 flat angles P-C4'-P energy: -72.985 tors. eta vs tors. theta energy: -16.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2901.494094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2901.494094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2901.494094 (E_RNA) where: Base-Base interactions energy: -1957.768 where: short stacking energy: -918.597 Base-Backbone interact. energy: -1.746 local terms energy: -941.980132 where: bonds (distance) C4'-P energy: -174.767 bonds (distance) P-C4' energy: -191.494 flat angles C4'-P-C4' energy: -199.933 flat angles P-C4'-P energy: -138.421 tors. eta vs tors. theta energy: -237.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2643.659880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2643.659880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2643.659880 (E_RNA) where: Base-Base interactions energy: -1758.164 where: short stacking energy: -779.663 Base-Backbone interact. energy: 3.143 local terms energy: -888.638500 where: bonds (distance) C4'-P energy: -169.858 bonds (distance) P-C4' energy: -189.045 flat angles C4'-P-C4' energy: -203.951 flat angles P-C4'-P energy: -129.247 tors. eta vs tors. theta energy: -196.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -2561.177697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2561.177697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2561.177697 (E_RNA) where: Base-Base interactions energy: -1742.247 where: short stacking energy: -779.918 Base-Backbone interact. energy: -0.497 local terms energy: -818.433396 where: bonds (distance) C4'-P energy: -156.669 bonds (distance) P-C4' energy: -176.990 flat angles C4'-P-C4' energy: -192.546 flat angles P-C4'-P energy: -119.198 tors. eta vs tors. theta energy: -173.030 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -2474.261042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2474.261042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2474.261042 (E_RNA) where: Base-Base interactions energy: -1663.783 where: short stacking energy: -807.693 Base-Backbone interact. energy: 1.251 local terms energy: -811.729114 where: bonds (distance) C4'-P energy: -166.186 bonds (distance) P-C4' energy: -157.452 flat angles C4'-P-C4' energy: -192.979 flat angles P-C4'-P energy: -114.709 tors. eta vs tors. theta energy: -180.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -2247.573851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2247.573851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2247.573851 (E_RNA) where: Base-Base interactions energy: -1485.090 where: short stacking energy: -678.038 Base-Backbone interact. energy: -2.647 local terms energy: -759.837390 where: bonds (distance) C4'-P energy: -156.727 bonds (distance) P-C4' energy: -164.516 flat angles C4'-P-C4' energy: -187.754 flat angles P-C4'-P energy: -104.229 tors. eta vs tors. theta energy: -146.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -2146.452693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2146.452693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2146.452693 (E_RNA) where: Base-Base interactions energy: -1403.380 where: short stacking energy: -671.945 Base-Backbone interact. energy: -2.347 local terms energy: -740.725449 where: bonds (distance) C4'-P energy: -166.049 bonds (distance) P-C4' energy: -177.676 flat angles C4'-P-C4' energy: -148.670 flat angles P-C4'-P energy: -111.092 tors. eta vs tors. theta energy: -137.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1813.114259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1813.114259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1813.114259 (E_RNA) where: Base-Base interactions energy: -1198.456 where: short stacking energy: -523.715 Base-Backbone interact. energy: 2.530 local terms energy: -617.187825 where: bonds (distance) C4'-P energy: -133.882 bonds (distance) P-C4' energy: -164.049 flat angles C4'-P-C4' energy: -134.401 flat angles P-C4'-P energy: -98.581 tors. eta vs tors. theta energy: -86.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1478.270781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.270781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.270781 (E_RNA) where: Base-Base interactions energy: -889.601 where: short stacking energy: -435.066 Base-Backbone interact. energy: -5.150 local terms energy: -583.519846 where: bonds (distance) C4'-P energy: -139.869 bonds (distance) P-C4' energy: -144.498 flat angles C4'-P-C4' energy: -131.483 flat angles P-C4'-P energy: -99.158 tors. eta vs tors. theta energy: -68.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -1360.946565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.946565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.946565 (E_RNA) where: Base-Base interactions energy: -761.166 where: short stacking energy: -403.842 Base-Backbone interact. energy: 1.525 local terms energy: -601.305758 where: bonds (distance) C4'-P energy: -157.278 bonds (distance) P-C4' energy: -154.884 flat angles C4'-P-C4' energy: -145.129 flat angles P-C4'-P energy: -82.618 tors. eta vs tors. theta energy: -61.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -1134.794404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.794404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.794404 (E_RNA) where: Base-Base interactions energy: -609.288 where: short stacking energy: -331.600 Base-Backbone interact. energy: 0.783 local terms energy: -526.289565 where: bonds (distance) C4'-P energy: -140.160 bonds (distance) P-C4' energy: -157.170 flat angles C4'-P-C4' energy: -132.008 flat angles P-C4'-P energy: -96.632 tors. eta vs tors. theta energy: -0.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2878.415377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2878.415377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2878.415377 (E_RNA) where: Base-Base interactions energy: -1934.897 where: short stacking energy: -900.275 Base-Backbone interact. energy: -4.724 local terms energy: -938.794470 where: bonds (distance) C4'-P energy: -173.843 bonds (distance) P-C4' energy: -187.862 flat angles C4'-P-C4' energy: -202.027 flat angles P-C4'-P energy: -131.752 tors. eta vs tors. theta energy: -243.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2684.004789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2684.004789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2684.004789 (E_RNA) where: Base-Base interactions energy: -1798.272 where: short stacking energy: -810.671 Base-Backbone interact. energy: 1.607 local terms energy: -887.339615 where: bonds (distance) C4'-P energy: -168.062 bonds (distance) P-C4' energy: -195.009 flat angles C4'-P-C4' energy: -188.945 flat angles P-C4'-P energy: -131.085 tors. eta vs tors. theta energy: -204.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -2603.721189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2603.721189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2603.721189 (E_RNA) where: Base-Base interactions energy: -1734.958 where: short stacking energy: -816.677 Base-Backbone interact. energy: -2.242 local terms energy: -866.520960 where: bonds (distance) C4'-P energy: -184.155 bonds (distance) P-C4' energy: -172.221 flat angles C4'-P-C4' energy: -199.388 flat angles P-C4'-P energy: -121.159 tors. eta vs tors. theta energy: -189.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -2483.185634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2483.185634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2483.185634 (E_RNA) where: Base-Base interactions energy: -1679.017 where: short stacking energy: -767.005 Base-Backbone interact. energy: -3.671 local terms energy: -800.497459 where: bonds (distance) C4'-P energy: -164.587 bonds (distance) P-C4' energy: -169.349 flat angles C4'-P-C4' energy: -170.640 flat angles P-C4'-P energy: -122.380 tors. eta vs tors. theta energy: -173.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -2229.591949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2229.591949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2229.591949 (E_RNA) where: Base-Base interactions energy: -1477.518 where: short stacking energy: -668.755 Base-Backbone interact. energy: 1.459 local terms energy: -753.533682 where: bonds (distance) C4'-P energy: -162.381 bonds (distance) P-C4' energy: -163.919 flat angles C4'-P-C4' energy: -185.584 flat angles P-C4'-P energy: -100.064 tors. eta vs tors. theta energy: -141.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -2123.541613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2123.541613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2123.541613 (E_RNA) where: Base-Base interactions energy: -1380.629 where: short stacking energy: -645.302 Base-Backbone interact. energy: -0.184 local terms energy: -742.729148 where: bonds (distance) C4'-P energy: -150.074 bonds (distance) P-C4' energy: -158.198 flat angles C4'-P-C4' energy: -167.478 flat angles P-C4'-P energy: -103.793 tors. eta vs tors. theta energy: -163.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1812.883370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1812.883370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1812.883370 (E_RNA) where: Base-Base interactions energy: -1155.931 where: short stacking energy: -524.735 Base-Backbone interact. energy: 6.138 local terms energy: -663.090603 where: bonds (distance) C4'-P energy: -169.165 bonds (distance) P-C4' energy: -156.556 flat angles C4'-P-C4' energy: -137.782 flat angles P-C4'-P energy: -86.052 tors. eta vs tors. theta energy: -113.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1500.619888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1500.619888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1500.619888 (E_RNA) where: Base-Base interactions energy: -933.759 where: short stacking energy: -462.894 Base-Backbone interact. energy: -0.327 local terms energy: -566.533926 where: bonds (distance) C4'-P energy: -146.854 bonds (distance) P-C4' energy: -146.980 flat angles C4'-P-C4' energy: -128.825 flat angles P-C4'-P energy: -75.887 tors. eta vs tors. theta energy: -67.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -1378.979440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.979440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1378.979440 (E_RNA) where: Base-Base interactions energy: -799.195 where: short stacking energy: -419.147 Base-Backbone interact. energy: 1.274 local terms energy: -581.058017 where: bonds (distance) C4'-P energy: -161.440 bonds (distance) P-C4' energy: -150.104 flat angles C4'-P-C4' energy: -121.806 flat angles P-C4'-P energy: -94.653 tors. eta vs tors. theta energy: -53.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -1169.067368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.067368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.067368 (E_RNA) where: Base-Base interactions energy: -629.334 where: short stacking energy: -350.343 Base-Backbone interact. energy: -0.054 local terms energy: -539.678794 where: bonds (distance) C4'-P energy: -129.971 bonds (distance) P-C4' energy: -139.388 flat angles C4'-P-C4' energy: -134.436 flat angles P-C4'-P energy: -112.502 tors. eta vs tors. theta energy: -23.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2914.354416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2914.354416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2914.354416 (E_RNA) where: Base-Base interactions energy: -1975.974 where: short stacking energy: -923.588 Base-Backbone interact. energy: 7.166 local terms energy: -945.546495 where: bonds (distance) C4'-P energy: -189.712 bonds (distance) P-C4' energy: -185.202 flat angles C4'-P-C4' energy: -207.829 flat angles P-C4'-P energy: -124.015 tors. eta vs tors. theta energy: -238.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2686.894607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2686.894607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2686.894607 (E_RNA) where: Base-Base interactions energy: -1804.850 where: short stacking energy: -804.512 Base-Backbone interact. energy: -3.346 local terms energy: -878.698502 where: bonds (distance) C4'-P energy: -172.363 bonds (distance) P-C4' energy: -178.536 flat angles C4'-P-C4' energy: -192.267 flat angles P-C4'-P energy: -122.528 tors. eta vs tors. theta energy: -213.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -2572.473709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2572.473709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2572.473709 (E_RNA) where: Base-Base interactions energy: -1740.479 where: short stacking energy: -823.966 Base-Backbone interact. energy: -4.150 local terms energy: -827.845280 where: bonds (distance) C4'-P energy: -152.071 bonds (distance) P-C4' energy: -192.609 flat angles C4'-P-C4' energy: -179.015 flat angles P-C4'-P energy: -104.292 tors. eta vs tors. theta energy: -199.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -2525.625963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2525.625963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2525.625963 (E_RNA) where: Base-Base interactions energy: -1695.474 where: short stacking energy: -789.985 Base-Backbone interact. energy: -2.742 local terms energy: -827.410404 where: bonds (distance) C4'-P energy: -165.528 bonds (distance) P-C4' energy: -180.115 flat angles C4'-P-C4' energy: -186.351 flat angles P-C4'-P energy: -118.078 tors. eta vs tors. theta energy: -177.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -2354.193338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2354.193338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2354.193338 (E_RNA) where: Base-Base interactions energy: -1600.207 where: short stacking energy: -741.643 Base-Backbone interact. energy: -1.268 local terms energy: -752.717615 where: bonds (distance) C4'-P energy: -140.275 bonds (distance) P-C4' energy: -159.244 flat angles C4'-P-C4' energy: -177.474 flat angles P-C4'-P energy: -115.864 tors. eta vs tors. theta energy: -159.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -2149.828402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2149.828402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2149.828402 (E_RNA) where: Base-Base interactions energy: -1413.674 where: short stacking energy: -659.688 Base-Backbone interact. energy: 4.195 local terms energy: -740.349370 where: bonds (distance) C4'-P energy: -145.329 bonds (distance) P-C4' energy: -182.526 flat angles C4'-P-C4' energy: -179.773 flat angles P-C4'-P energy: -96.273 tors. eta vs tors. theta energy: -136.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1909.931377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1909.931377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1909.931377 (E_RNA) where: Base-Base interactions energy: -1223.727 where: short stacking energy: -568.722 Base-Backbone interact. energy: 0.095 local terms energy: -686.299516 where: bonds (distance) C4'-P energy: -144.109 bonds (distance) P-C4' energy: -181.025 flat angles C4'-P-C4' energy: -159.884 flat angles P-C4'-P energy: -88.466 tors. eta vs tors. theta energy: -112.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1494.328813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.328813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.328813 (E_RNA) where: Base-Base interactions energy: -878.940 where: short stacking energy: -437.992 Base-Backbone interact. energy: -3.523 local terms energy: -611.865016 where: bonds (distance) C4'-P energy: -158.447 bonds (distance) P-C4' energy: -162.435 flat angles C4'-P-C4' energy: -154.618 flat angles P-C4'-P energy: -87.412 tors. eta vs tors. theta energy: -48.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -1315.922136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.922136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.922136 (E_RNA) where: Base-Base interactions energy: -789.384 where: short stacking energy: -393.766 Base-Backbone interact. energy: 1.209 local terms energy: -527.747286 where: bonds (distance) C4'-P energy: -132.394 bonds (distance) P-C4' energy: -130.493 flat angles C4'-P-C4' energy: -133.556 flat angles P-C4'-P energy: -108.599 tors. eta vs tors. theta energy: -22.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -1067.313775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.313775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.313775 (E_RNA) where: Base-Base interactions energy: -585.870 where: short stacking energy: -334.968 Base-Backbone interact. energy: -0.708 local terms energy: -480.734972 where: bonds (distance) C4'-P energy: -144.084 bonds (distance) P-C4' energy: -153.829 flat angles C4'-P-C4' energy: -117.540 flat angles P-C4'-P energy: -62.731 tors. eta vs tors. theta energy: -2.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2915.388457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2915.388457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2915.388457 (E_RNA) where: Base-Base interactions energy: -1957.916 where: short stacking energy: -905.584 Base-Backbone interact. energy: -5.849 local terms energy: -951.622631 where: bonds (distance) C4'-P energy: -182.109 bonds (distance) P-C4' energy: -177.357 flat angles C4'-P-C4' energy: -207.160 flat angles P-C4'-P energy: -139.638 tors. eta vs tors. theta energy: -245.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2704.521140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2704.521140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2704.521140 (E_RNA) where: Base-Base interactions energy: -1822.998 where: short stacking energy: -817.811 Base-Backbone interact. energy: -4.564 local terms energy: -876.959156 where: bonds (distance) C4'-P energy: -175.775 bonds (distance) P-C4' energy: -165.217 flat angles C4'-P-C4' energy: -198.647 flat angles P-C4'-P energy: -135.197 tors. eta vs tors. theta energy: -202.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2647.713463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2647.713463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2647.713463 (E_RNA) where: Base-Base interactions energy: -1808.391 where: short stacking energy: -819.706 Base-Backbone interact. energy: -3.154 local terms energy: -836.168209 where: bonds (distance) C4'-P energy: -173.998 bonds (distance) P-C4' energy: -161.596 flat angles C4'-P-C4' energy: -197.844 flat angles P-C4'-P energy: -111.758 tors. eta vs tors. theta energy: -190.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -2482.083005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2482.083005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2482.083005 (E_RNA) where: Base-Base interactions energy: -1659.965 where: short stacking energy: -764.614 Base-Backbone interact. energy: -5.845 local terms energy: -816.273392 where: bonds (distance) C4'-P energy: -161.245 bonds (distance) P-C4' energy: -154.818 flat angles C4'-P-C4' energy: -196.417 flat angles P-C4'-P energy: -115.959 tors. eta vs tors. theta energy: -187.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -2335.934028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2335.934028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2335.934028 (E_RNA) where: Base-Base interactions energy: -1551.798 where: short stacking energy: -694.635 Base-Backbone interact. energy: -1.148 local terms energy: -782.987708 where: bonds (distance) C4'-P energy: -162.841 bonds (distance) P-C4' energy: -170.309 flat angles C4'-P-C4' energy: -181.031 flat angles P-C4'-P energy: -114.784 tors. eta vs tors. theta energy: -154.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -2115.047665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2115.047665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.047665 (E_RNA) where: Base-Base interactions energy: -1374.581 where: short stacking energy: -659.152 Base-Backbone interact. energy: 2.708 local terms energy: -743.174603 where: bonds (distance) C4'-P energy: -153.847 bonds (distance) P-C4' energy: -156.933 flat angles C4'-P-C4' energy: -169.006 flat angles P-C4'-P energy: -109.526 tors. eta vs tors. theta energy: -153.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1909.328864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1909.328864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1909.328864 (E_RNA) where: Base-Base interactions energy: -1184.652 where: short stacking energy: -551.688 Base-Backbone interact. energy: -1.779 local terms energy: -722.897596 where: bonds (distance) C4'-P energy: -153.793 bonds (distance) P-C4' energy: -170.393 flat angles C4'-P-C4' energy: -152.749 flat angles P-C4'-P energy: -120.954 tors. eta vs tors. theta energy: -125.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1559.026889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.026889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1559.026889 (E_RNA) where: Base-Base interactions energy: -970.443 where: short stacking energy: -455.327 Base-Backbone interact. energy: 1.257 local terms energy: -589.841386 where: bonds (distance) C4'-P energy: -167.009 bonds (distance) P-C4' energy: -159.567 flat angles C4'-P-C4' energy: -127.763 flat angles P-C4'-P energy: -75.184 tors. eta vs tors. theta energy: -60.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -1224.364044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.364044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.364044 (E_RNA) where: Base-Base interactions energy: -652.956 where: short stacking energy: -348.995 Base-Backbone interact. energy: 1.340 local terms energy: -572.747861 where: bonds (distance) C4'-P energy: -149.223 bonds (distance) P-C4' energy: -169.759 flat angles C4'-P-C4' energy: -146.754 flat angles P-C4'-P energy: -77.657 tors. eta vs tors. theta energy: -29.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -1070.879078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.879078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.879078 (E_RNA) where: Base-Base interactions energy: -598.773 where: short stacking energy: -327.217 Base-Backbone interact. energy: 0.599 local terms energy: -472.704792 where: bonds (distance) C4'-P energy: -122.353 bonds (distance) P-C4' energy: -167.349 flat angles C4'-P-C4' energy: -113.416 flat angles P-C4'-P energy: -69.681 tors. eta vs tors. theta energy: 0.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2910.732996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2910.732996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2910.732996 (E_RNA) where: Base-Base interactions energy: -1967.298 where: short stacking energy: -922.413 Base-Backbone interact. energy: -2.297 local terms energy: -941.137726 where: bonds (distance) C4'-P energy: -180.055 bonds (distance) P-C4' energy: -174.026 flat angles C4'-P-C4' energy: -206.969 flat angles P-C4'-P energy: -130.295 tors. eta vs tors. theta energy: -249.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2682.870347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2682.870347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2682.870347 (E_RNA) where: Base-Base interactions energy: -1822.667 where: short stacking energy: -789.828 Base-Backbone interact. energy: 1.025 local terms energy: -861.227967 where: bonds (distance) C4'-P energy: -160.241 bonds (distance) P-C4' energy: -181.899 flat angles C4'-P-C4' energy: -204.628 flat angles P-C4'-P energy: -108.010 tors. eta vs tors. theta energy: -206.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2618.580130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2618.580130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2618.580130 (E_RNA) where: Base-Base interactions energy: -1760.786 where: short stacking energy: -789.222 Base-Backbone interact. energy: -4.561 local terms energy: -853.232631 where: bonds (distance) C4'-P energy: -190.846 bonds (distance) P-C4' energy: -186.822 flat angles C4'-P-C4' energy: -179.223 flat angles P-C4'-P energy: -102.469 tors. eta vs tors. theta energy: -193.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -2505.828711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.828711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2505.828711 (E_RNA) where: Base-Base interactions energy: -1671.954 where: short stacking energy: -766.490 Base-Backbone interact. energy: -0.099 local terms energy: -833.775287 where: bonds (distance) C4'-P energy: -160.453 bonds (distance) P-C4' energy: -170.285 flat angles C4'-P-C4' energy: -185.102 flat angles P-C4'-P energy: -133.603 tors. eta vs tors. theta energy: -184.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -2416.312291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2416.312291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2416.312291 (E_RNA) where: Base-Base interactions energy: -1596.464 where: short stacking energy: -680.802 Base-Backbone interact. energy: -0.075 local terms energy: -819.773458 where: bonds (distance) C4'-P energy: -175.310 bonds (distance) P-C4' energy: -161.914 flat angles C4'-P-C4' energy: -189.657 flat angles P-C4'-P energy: -111.468 tors. eta vs tors. theta energy: -181.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -2101.741450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.741450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.741450 (E_RNA) where: Base-Base interactions energy: -1368.991 where: short stacking energy: -594.270 Base-Backbone interact. energy: -0.137 local terms energy: -732.614271 where: bonds (distance) C4'-P energy: -145.255 bonds (distance) P-C4' energy: -156.246 flat angles C4'-P-C4' energy: -187.499 flat angles P-C4'-P energy: -108.094 tors. eta vs tors. theta energy: -135.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1915.480622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.480622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.480622 (E_RNA) where: Base-Base interactions energy: -1226.297 where: short stacking energy: -578.807 Base-Backbone interact. energy: -2.732 local terms energy: -686.450997 where: bonds (distance) C4'-P energy: -141.128 bonds (distance) P-C4' energy: -161.091 flat angles C4'-P-C4' energy: -176.132 flat angles P-C4'-P energy: -100.851 tors. eta vs tors. theta energy: -107.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1571.206327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.206327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.206327 (E_RNA) where: Base-Base interactions energy: -958.751 where: short stacking energy: -476.194 Base-Backbone interact. energy: 0.719 local terms energy: -613.175185 where: bonds (distance) C4'-P energy: -139.323 bonds (distance) P-C4' energy: -161.369 flat angles C4'-P-C4' energy: -148.803 flat angles P-C4'-P energy: -102.303 tors. eta vs tors. theta energy: -61.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -1251.342658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.342658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.342658 (E_RNA) where: Base-Base interactions energy: -718.551 where: short stacking energy: -397.991 Base-Backbone interact. energy: 1.535 local terms energy: -534.326146 where: bonds (distance) C4'-P energy: -161.282 bonds (distance) P-C4' energy: -152.579 flat angles C4'-P-C4' energy: -114.329 flat angles P-C4'-P energy: -67.719 tors. eta vs tors. theta energy: -38.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -1061.907600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.907600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.907600 (E_RNA) where: Base-Base interactions energy: -587.518 where: short stacking energy: -338.637 Base-Backbone interact. energy: 1.928 local terms energy: -476.317616 where: bonds (distance) C4'-P energy: -123.591 bonds (distance) P-C4' energy: -134.847 flat angles C4'-P-C4' energy: -126.450 flat angles P-C4'-P energy: -63.720 tors. eta vs tors. theta energy: -27.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2914.199459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2914.199459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2914.199459 (E_RNA) where: Base-Base interactions energy: -1975.208 where: short stacking energy: -935.511 Base-Backbone interact. energy: 3.681 local terms energy: -942.672785 where: bonds (distance) C4'-P energy: -176.996 bonds (distance) P-C4' energy: -188.917 flat angles C4'-P-C4' energy: -204.037 flat angles P-C4'-P energy: -130.665 tors. eta vs tors. theta energy: -242.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2741.147920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2741.147920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2741.147920 (E_RNA) where: Base-Base interactions energy: -1838.518 where: short stacking energy: -864.552 Base-Backbone interact. energy: -4.209 local terms energy: -898.420262 where: bonds (distance) C4'-P energy: -180.433 bonds (distance) P-C4' energy: -163.647 flat angles C4'-P-C4' energy: -216.284 flat angles P-C4'-P energy: -124.005 tors. eta vs tors. theta energy: -214.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2641.430732 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2641.430732 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2641.430732 (E_RNA) where: Base-Base interactions energy: -1746.119 where: short stacking energy: -824.952 Base-Backbone interact. energy: -3.495 local terms energy: -891.816221 where: bonds (distance) C4'-P energy: -165.348 bonds (distance) P-C4' energy: -180.287 flat angles C4'-P-C4' energy: -194.341 flat angles P-C4'-P energy: -134.780 tors. eta vs tors. theta energy: -217.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -2499.075977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2499.075977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2499.075977 (E_RNA) where: Base-Base interactions energy: -1693.745 where: short stacking energy: -793.044 Base-Backbone interact. energy: 3.902 local terms energy: -809.232508 where: bonds (distance) C4'-P energy: -166.630 bonds (distance) P-C4' energy: -161.635 flat angles C4'-P-C4' energy: -200.734 flat angles P-C4'-P energy: -102.119 tors. eta vs tors. theta energy: -178.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -2454.392600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2454.392600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2454.392600 (E_RNA) where: Base-Base interactions energy: -1653.070 where: short stacking energy: -758.251 Base-Backbone interact. energy: -4.366 local terms energy: -796.957181 where: bonds (distance) C4'-P energy: -170.823 bonds (distance) P-C4' energy: -156.595 flat angles C4'-P-C4' energy: -181.924 flat angles P-C4'-P energy: -100.979 tors. eta vs tors. theta energy: -186.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -2165.907338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2165.907338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2165.907338 (E_RNA) where: Base-Base interactions energy: -1431.774 where: short stacking energy: -650.081 Base-Backbone interact. energy: 2.145 local terms energy: -736.278161 where: bonds (distance) C4'-P energy: -147.747 bonds (distance) P-C4' energy: -160.005 flat angles C4'-P-C4' energy: -161.391 flat angles P-C4'-P energy: -112.356 tors. eta vs tors. theta energy: -154.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1885.795065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1885.795065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1885.795065 (E_RNA) where: Base-Base interactions energy: -1199.869 where: short stacking energy: -535.457 Base-Backbone interact. energy: -4.077 local terms energy: -681.848830 where: bonds (distance) C4'-P energy: -155.223 bonds (distance) P-C4' energy: -174.033 flat angles C4'-P-C4' energy: -149.772 flat angles P-C4'-P energy: -123.710 tors. eta vs tors. theta energy: -79.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1604.344951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.344951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.344951 (E_RNA) where: Base-Base interactions energy: -982.854 where: short stacking energy: -481.022 Base-Backbone interact. energy: 0.662 local terms energy: -622.153310 where: bonds (distance) C4'-P energy: -148.477 bonds (distance) P-C4' energy: -158.325 flat angles C4'-P-C4' energy: -149.770 flat angles P-C4'-P energy: -85.215 tors. eta vs tors. theta energy: -80.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -1235.344402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1235.344402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1235.344402 (E_RNA) where: Base-Base interactions energy: -684.670 where: short stacking energy: -382.209 Base-Backbone interact. energy: 4.690 local terms energy: -555.363559 where: bonds (distance) C4'-P energy: -134.513 bonds (distance) P-C4' energy: -147.560 flat angles C4'-P-C4' energy: -141.618 flat angles P-C4'-P energy: -87.820 tors. eta vs tors. theta energy: -43.852 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -1047.073343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.073343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.073343 (E_RNA) where: Base-Base interactions energy: -610.435 where: short stacking energy: -333.244 Base-Backbone interact. energy: -3.127 local terms energy: -433.511130 where: bonds (distance) C4'-P energy: -139.260 bonds (distance) P-C4' energy: -120.466 flat angles C4'-P-C4' energy: -136.851 flat angles P-C4'-P energy: -36.250 tors. eta vs tors. theta energy: -0.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2920.072031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2920.072031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2920.072031 (E_RNA) where: Base-Base interactions energy: -1980.334 where: short stacking energy: -939.986 Base-Backbone interact. energy: -3.968 local terms energy: -935.769257 where: bonds (distance) C4'-P energy: -169.890 bonds (distance) P-C4' energy: -177.704 flat angles C4'-P-C4' energy: -206.070 flat angles P-C4'-P energy: -135.469 tors. eta vs tors. theta energy: -246.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2754.610792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2754.610792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2754.610792 (E_RNA) where: Base-Base interactions energy: -1828.372 where: short stacking energy: -811.188 Base-Backbone interact. energy: -3.773 local terms energy: -922.465941 where: bonds (distance) C4'-P energy: -188.560 bonds (distance) P-C4' energy: -193.784 flat angles C4'-P-C4' energy: -202.159 flat angles P-C4'-P energy: -124.147 tors. eta vs tors. theta energy: -213.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2634.176538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2634.176538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2634.176538 (E_RNA) where: Base-Base interactions energy: -1791.640 where: short stacking energy: -802.896 Base-Backbone interact. energy: -1.261 local terms energy: -841.275418 where: bonds (distance) C4'-P energy: -165.713 bonds (distance) P-C4' energy: -172.529 flat angles C4'-P-C4' energy: -172.151 flat angles P-C4'-P energy: -126.314 tors. eta vs tors. theta energy: -204.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -2549.294057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2549.294057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2549.294057 (E_RNA) where: Base-Base interactions energy: -1714.409 where: short stacking energy: -790.931 Base-Backbone interact. energy: -3.027 local terms energy: -831.858261 where: bonds (distance) C4'-P energy: -157.705 bonds (distance) P-C4' energy: -175.935 flat angles C4'-P-C4' energy: -180.448 flat angles P-C4'-P energy: -127.337 tors. eta vs tors. theta energy: -190.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -2411.779425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2411.779425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2411.779425 (E_RNA) where: Base-Base interactions energy: -1592.232 where: short stacking energy: -717.936 Base-Backbone interact. energy: -3.588 local terms energy: -815.958476 where: bonds (distance) C4'-P energy: -165.549 bonds (distance) P-C4' energy: -167.336 flat angles C4'-P-C4' energy: -205.967 flat angles P-C4'-P energy: -112.493 tors. eta vs tors. theta energy: -164.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -2196.971571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.971571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.971571 (E_RNA) where: Base-Base interactions energy: -1485.769 where: short stacking energy: -694.125 Base-Backbone interact. energy: -3.645 local terms energy: -707.557880 where: bonds (distance) C4'-P energy: -134.729 bonds (distance) P-C4' energy: -154.548 flat angles C4'-P-C4' energy: -168.222 flat angles P-C4'-P energy: -102.079 tors. eta vs tors. theta energy: -147.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1897.580429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1897.580429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1897.580429 (E_RNA) where: Base-Base interactions energy: -1231.580 where: short stacking energy: -583.717 Base-Backbone interact. energy: 4.541 local terms energy: -670.541839 where: bonds (distance) C4'-P energy: -170.584 bonds (distance) P-C4' energy: -154.379 flat angles C4'-P-C4' energy: -170.442 flat angles P-C4'-P energy: -83.727 tors. eta vs tors. theta energy: -91.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1599.476065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.476065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.476065 (E_RNA) where: Base-Base interactions energy: -958.003 where: short stacking energy: -451.668 Base-Backbone interact. energy: -1.997 local terms energy: -639.475878 where: bonds (distance) C4'-P energy: -163.858 bonds (distance) P-C4' energy: -156.800 flat angles C4'-P-C4' energy: -144.955 flat angles P-C4'-P energy: -86.427 tors. eta vs tors. theta energy: -87.436 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -1176.823364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.823364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.823364 (E_RNA) where: Base-Base interactions energy: -612.428 where: short stacking energy: -346.644 Base-Backbone interact. energy: 2.138 local terms energy: -566.533017 where: bonds (distance) C4'-P energy: -144.150 bonds (distance) P-C4' energy: -171.212 flat angles C4'-P-C4' energy: -135.205 flat angles P-C4'-P energy: -90.982 tors. eta vs tors. theta energy: -24.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -1036.969632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1036.969632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1036.969632 (E_RNA) where: Base-Base interactions energy: -556.675 where: short stacking energy: -304.847 Base-Backbone interact. energy: 1.104 local terms energy: -481.398176 where: bonds (distance) C4'-P energy: -157.270 bonds (distance) P-C4' energy: -160.991 flat angles C4'-P-C4' energy: -112.483 flat angles P-C4'-P energy: -71.553 tors. eta vs tors. theta energy: 20.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2920.836573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2920.836573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2920.836573 (E_RNA) where: Base-Base interactions energy: -1979.543 where: short stacking energy: -902.106 Base-Backbone interact. energy: -2.101 local terms energy: -939.192419 where: bonds (distance) C4'-P energy: -171.779 bonds (distance) P-C4' energy: -194.067 flat angles C4'-P-C4' energy: -202.692 flat angles P-C4'-P energy: -133.966 tors. eta vs tors. theta energy: -236.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2787.827128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2787.827128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2787.827128 (E_RNA) where: Base-Base interactions energy: -1897.650 where: short stacking energy: -875.242 Base-Backbone interact. energy: 0.083 local terms energy: -890.260907 where: bonds (distance) C4'-P energy: -174.547 bonds (distance) P-C4' energy: -176.542 flat angles C4'-P-C4' energy: -204.085 flat angles P-C4'-P energy: -123.024 tors. eta vs tors. theta energy: -212.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -2684.515491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2684.515491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2684.515491 (E_RNA) where: Base-Base interactions energy: -1797.291 where: short stacking energy: -811.083 Base-Backbone interact. energy: 1.710 local terms energy: -888.934760 where: bonds (distance) C4'-P energy: -183.159 bonds (distance) P-C4' energy: -176.748 flat angles C4'-P-C4' energy: -189.304 flat angles P-C4'-P energy: -126.347 tors. eta vs tors. theta energy: -213.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -2493.839276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2493.839276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2493.839276 (E_RNA) where: Base-Base interactions energy: -1686.528 where: short stacking energy: -750.162 Base-Backbone interact. energy: -2.908 local terms energy: -804.404165 where: bonds (distance) C4'-P energy: -156.791 bonds (distance) P-C4' energy: -153.867 flat angles C4'-P-C4' energy: -198.821 flat angles P-C4'-P energy: -126.948 tors. eta vs tors. theta energy: -167.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -2388.783958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2388.783958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2388.783958 (E_RNA) where: Base-Base interactions energy: -1587.449 where: short stacking energy: -701.185 Base-Backbone interact. energy: 6.173 local terms energy: -807.507955 where: bonds (distance) C4'-P energy: -162.392 bonds (distance) P-C4' energy: -171.552 flat angles C4'-P-C4' energy: -184.528 flat angles P-C4'-P energy: -120.427 tors. eta vs tors. theta energy: -168.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -2241.119690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2241.119690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2241.119690 (E_RNA) where: Base-Base interactions energy: -1471.995 where: short stacking energy: -655.803 Base-Backbone interact. energy: -2.348 local terms energy: -766.776577 where: bonds (distance) C4'-P energy: -158.127 bonds (distance) P-C4' energy: -186.111 flat angles C4'-P-C4' energy: -165.464 flat angles P-C4'-P energy: -93.264 tors. eta vs tors. theta energy: -163.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1906.488342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1906.488342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1906.488342 (E_RNA) where: Base-Base interactions energy: -1218.310 where: short stacking energy: -569.408 Base-Backbone interact. energy: 0.519 local terms energy: -688.697509 where: bonds (distance) C4'-P energy: -158.691 bonds (distance) P-C4' energy: -168.880 flat angles C4'-P-C4' energy: -156.970 flat angles P-C4'-P energy: -97.067 tors. eta vs tors. theta energy: -107.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1661.877570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1661.877570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.877570 (E_RNA) where: Base-Base interactions energy: -1014.061 where: short stacking energy: -519.873 Base-Backbone interact. energy: 0.101 local terms energy: -647.916892 where: bonds (distance) C4'-P energy: -142.210 bonds (distance) P-C4' energy: -169.402 flat angles C4'-P-C4' energy: -160.141 flat angles P-C4'-P energy: -91.564 tors. eta vs tors. theta energy: -84.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -1099.128545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.128545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.128545 (E_RNA) where: Base-Base interactions energy: -581.382 where: short stacking energy: -346.186 Base-Backbone interact. energy: 0.447 local terms energy: -518.193649 where: bonds (distance) C4'-P energy: -147.985 bonds (distance) P-C4' energy: -155.724 flat angles C4'-P-C4' energy: -133.757 flat angles P-C4'-P energy: -68.087 tors. eta vs tors. theta energy: -12.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -977.536898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -977.536898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -977.536898 (E_RNA) where: Base-Base interactions energy: -488.316 where: short stacking energy: -306.120 Base-Backbone interact. energy: -0.846 local terms energy: -488.374519 where: bonds (distance) C4'-P energy: -141.053 bonds (distance) P-C4' energy: -146.569 flat angles C4'-P-C4' energy: -116.406 flat angles P-C4'-P energy: -89.292 tors. eta vs tors. theta energy: 4.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2936.134147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2936.134147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2936.134147 (E_RNA) where: Base-Base interactions energy: -1999.800 where: short stacking energy: -925.020 Base-Backbone interact. energy: -2.546 local terms energy: -933.788308 where: bonds (distance) C4'-P energy: -168.060 bonds (distance) P-C4' energy: -184.175 flat angles C4'-P-C4' energy: -203.965 flat angles P-C4'-P energy: -129.886 tors. eta vs tors. theta energy: -247.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2754.801473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2754.801473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2754.801473 (E_RNA) where: Base-Base interactions energy: -1875.988 where: short stacking energy: -813.519 Base-Backbone interact. energy: 0.560 local terms energy: -879.373368 where: bonds (distance) C4'-P energy: -183.271 bonds (distance) P-C4' energy: -164.851 flat angles C4'-P-C4' energy: -199.800 flat angles P-C4'-P energy: -127.317 tors. eta vs tors. theta energy: -204.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -2576.229597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2576.229597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2576.229597 (E_RNA) where: Base-Base interactions energy: -1738.433 where: short stacking energy: -803.881 Base-Backbone interact. energy: -2.902 local terms energy: -834.894572 where: bonds (distance) C4'-P energy: -145.890 bonds (distance) P-C4' energy: -173.074 flat angles C4'-P-C4' energy: -200.244 flat angles P-C4'-P energy: -115.087 tors. eta vs tors. theta energy: -200.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -2515.710953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2515.710953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2515.710953 (E_RNA) where: Base-Base interactions energy: -1725.493 where: short stacking energy: -778.557 Base-Backbone interact. energy: -2.157 local terms energy: -788.060386 where: bonds (distance) C4'-P energy: -163.460 bonds (distance) P-C4' energy: -176.584 flat angles C4'-P-C4' energy: -173.382 flat angles P-C4'-P energy: -101.173 tors. eta vs tors. theta energy: -173.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -2397.620990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2397.620990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2397.620990 (E_RNA) where: Base-Base interactions energy: -1582.821 where: short stacking energy: -693.878 Base-Backbone interact. energy: -3.895 local terms energy: -810.904369 where: bonds (distance) C4'-P energy: -179.058 bonds (distance) P-C4' energy: -176.861 flat angles C4'-P-C4' energy: -202.636 flat angles P-C4'-P energy: -95.614 tors. eta vs tors. theta energy: -156.735 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -2221.175901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2221.175901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2221.175901 (E_RNA) where: Base-Base interactions energy: -1493.977 where: short stacking energy: -679.222 Base-Backbone interact. energy: -3.429 local terms energy: -723.770232 where: bonds (distance) C4'-P energy: -149.137 bonds (distance) P-C4' energy: -149.690 flat angles C4'-P-C4' energy: -154.306 flat angles P-C4'-P energy: -114.532 tors. eta vs tors. theta energy: -156.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1895.638562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1895.638562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1895.638562 (E_RNA) where: Base-Base interactions energy: -1240.749 where: short stacking energy: -546.428 Base-Backbone interact. energy: 0.714 local terms energy: -655.603326 where: bonds (distance) C4'-P energy: -135.533 bonds (distance) P-C4' energy: -157.654 flat angles C4'-P-C4' energy: -163.752 flat angles P-C4'-P energy: -100.203 tors. eta vs tors. theta energy: -98.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1629.346655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1629.346655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1629.346655 (E_RNA) where: Base-Base interactions energy: -1037.095 where: short stacking energy: -494.006 Base-Backbone interact. energy: 3.643 local terms energy: -595.894802 where: bonds (distance) C4'-P energy: -143.272 bonds (distance) P-C4' energy: -140.564 flat angles C4'-P-C4' energy: -160.794 flat angles P-C4'-P energy: -101.024 tors. eta vs tors. theta energy: -50.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -1191.115042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.115042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.115042 (E_RNA) where: Base-Base interactions energy: -639.321 where: short stacking energy: -356.260 Base-Backbone interact. energy: 5.182 local terms energy: -556.975347 where: bonds (distance) C4'-P energy: -129.300 bonds (distance) P-C4' energy: -167.810 flat angles C4'-P-C4' energy: -152.409 flat angles P-C4'-P energy: -81.037 tors. eta vs tors. theta energy: -26.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -1009.293946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.293946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.293946 (E_RNA) where: Base-Base interactions energy: -541.773 where: short stacking energy: -283.556 Base-Backbone interact. energy: 0.841 local terms energy: -468.361780 where: bonds (distance) C4'-P energy: -139.790 bonds (distance) P-C4' energy: -134.089 flat angles C4'-P-C4' energy: -131.211 flat angles P-C4'-P energy: -74.190 tors. eta vs tors. theta energy: 10.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2938.679529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2938.679529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2938.679529 (E_RNA) where: Base-Base interactions energy: -1978.144 where: short stacking energy: -923.983 Base-Backbone interact. energy: -2.411 local terms energy: -958.124970 where: bonds (distance) C4'-P energy: -198.742 bonds (distance) P-C4' energy: -187.060 flat angles C4'-P-C4' energy: -188.319 flat angles P-C4'-P energy: -138.150 tors. eta vs tors. theta energy: -245.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2796.756873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2796.756873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2796.756873 (E_RNA) where: Base-Base interactions energy: -1890.517 where: short stacking energy: -854.782 Base-Backbone interact. energy: 2.776 local terms energy: -909.015754 where: bonds (distance) C4'-P energy: -169.154 bonds (distance) P-C4' energy: -173.072 flat angles C4'-P-C4' energy: -199.771 flat angles P-C4'-P energy: -140.214 tors. eta vs tors. theta energy: -226.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -2535.492603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2535.492603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2535.492603 (E_RNA) where: Base-Base interactions energy: -1699.204 where: short stacking energy: -784.126 Base-Backbone interact. energy: -3.544 local terms energy: -832.744289 where: bonds (distance) C4'-P energy: -180.520 bonds (distance) P-C4' energy: -171.044 flat angles C4'-P-C4' energy: -179.140 flat angles P-C4'-P energy: -117.964 tors. eta vs tors. theta energy: -184.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -2549.909045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2549.909045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2549.909045 (E_RNA) where: Base-Base interactions energy: -1738.009 where: short stacking energy: -817.431 Base-Backbone interact. energy: -2.293 local terms energy: -809.607960 where: bonds (distance) C4'-P energy: -140.392 bonds (distance) P-C4' energy: -178.756 flat angles C4'-P-C4' energy: -182.959 flat angles P-C4'-P energy: -110.316 tors. eta vs tors. theta energy: -197.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -2293.608347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2293.608347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2293.608347 (E_RNA) where: Base-Base interactions energy: -1518.316 where: short stacking energy: -704.282 Base-Backbone interact. energy: -3.085 local terms energy: -772.207492 where: bonds (distance) C4'-P energy: -151.834 bonds (distance) P-C4' energy: -155.918 flat angles C4'-P-C4' energy: -173.465 flat angles P-C4'-P energy: -123.716 tors. eta vs tors. theta energy: -167.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -2110.996805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.996805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2110.996805 (E_RNA) where: Base-Base interactions energy: -1380.533 where: short stacking energy: -662.689 Base-Backbone interact. energy: -2.537 local terms energy: -727.927198 where: bonds (distance) C4'-P energy: -145.606 bonds (distance) P-C4' energy: -161.969 flat angles C4'-P-C4' energy: -186.934 flat angles P-C4'-P energy: -96.894 tors. eta vs tors. theta energy: -136.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1893.704379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1893.704379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1893.704379 (E_RNA) where: Base-Base interactions energy: -1224.912 where: short stacking energy: -567.453 Base-Backbone interact. energy: -0.071 local terms energy: -668.722120 where: bonds (distance) C4'-P energy: -147.258 bonds (distance) P-C4' energy: -160.445 flat angles C4'-P-C4' energy: -161.215 flat angles P-C4'-P energy: -108.040 tors. eta vs tors. theta energy: -91.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1764.188344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1764.188344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1764.188344 (E_RNA) where: Base-Base interactions energy: -1115.763 where: short stacking energy: -537.978 Base-Backbone interact. energy: 2.658 local terms energy: -651.082764 where: bonds (distance) C4'-P energy: -122.194 bonds (distance) P-C4' energy: -156.026 flat angles C4'-P-C4' energy: -160.045 flat angles P-C4'-P energy: -91.705 tors. eta vs tors. theta energy: -121.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -1174.108312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.108312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.108312 (E_RNA) where: Base-Base interactions energy: -602.811 where: short stacking energy: -342.329 Base-Backbone interact. energy: -3.608 local terms energy: -567.689435 where: bonds (distance) C4'-P energy: -169.635 bonds (distance) P-C4' energy: -156.483 flat angles C4'-P-C4' energy: -127.804 flat angles P-C4'-P energy: -89.772 tors. eta vs tors. theta energy: -23.997 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -1053.007494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.007494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.007494 (E_RNA) where: Base-Base interactions energy: -558.580 where: short stacking energy: -325.975 Base-Backbone interact. energy: -0.076 local terms energy: -494.350966 where: bonds (distance) C4'-P energy: -146.463 bonds (distance) P-C4' energy: -147.189 flat angles C4'-P-C4' energy: -129.421 flat angles P-C4'-P energy: -55.176 tors. eta vs tors. theta energy: -16.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2909.619850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2909.619850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2909.619850 (E_RNA) where: Base-Base interactions energy: -1980.206 where: short stacking energy: -941.036 Base-Backbone interact. energy: -5.119 local terms energy: -924.295334 where: bonds (distance) C4'-P energy: -176.580 bonds (distance) P-C4' energy: -183.316 flat angles C4'-P-C4' energy: -201.240 flat angles P-C4'-P energy: -124.713 tors. eta vs tors. theta energy: -238.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2837.448889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2837.448889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2837.448889 (E_RNA) where: Base-Base interactions energy: -1923.072 where: short stacking energy: -882.225 Base-Backbone interact. energy: 2.018 local terms energy: -916.394620 where: bonds (distance) C4'-P energy: -193.453 bonds (distance) P-C4' energy: -178.905 flat angles C4'-P-C4' energy: -205.526 flat angles P-C4'-P energy: -112.555 tors. eta vs tors. theta energy: -225.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -2593.585918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2593.585918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2593.585918 (E_RNA) where: Base-Base interactions energy: -1738.300 where: short stacking energy: -829.620 Base-Backbone interact. energy: 2.122 local terms energy: -857.407978 where: bonds (distance) C4'-P energy: -167.353 bonds (distance) P-C4' energy: -160.901 flat angles C4'-P-C4' energy: -198.968 flat angles P-C4'-P energy: -115.136 tors. eta vs tors. theta energy: -215.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -2529.454273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2529.454273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2529.454273 (E_RNA) where: Base-Base interactions energy: -1696.966 where: short stacking energy: -776.256 Base-Backbone interact. energy: -0.352 local terms energy: -832.135333 where: bonds (distance) C4'-P energy: -161.981 bonds (distance) P-C4' energy: -197.957 flat angles C4'-P-C4' energy: -181.526 flat angles P-C4'-P energy: -121.731 tors. eta vs tors. theta energy: -168.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -2299.874931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2299.874931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2299.874931 (E_RNA) where: Base-Base interactions energy: -1494.917 where: short stacking energy: -722.098 Base-Backbone interact. energy: -0.498 local terms energy: -804.459856 where: bonds (distance) C4'-P energy: -161.540 bonds (distance) P-C4' energy: -163.683 flat angles C4'-P-C4' energy: -190.490 flat angles P-C4'-P energy: -125.231 tors. eta vs tors. theta energy: -163.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -2132.796434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2132.796434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2132.796434 (E_RNA) where: Base-Base interactions energy: -1397.190 where: short stacking energy: -665.285 Base-Backbone interact. energy: -0.945 local terms energy: -734.661678 where: bonds (distance) C4'-P energy: -152.071 bonds (distance) P-C4' energy: -171.009 flat angles C4'-P-C4' energy: -187.755 flat angles P-C4'-P energy: -94.685 tors. eta vs tors. theta energy: -129.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1892.850378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1892.850378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1892.850378 (E_RNA) where: Base-Base interactions energy: -1249.258 where: short stacking energy: -535.804 Base-Backbone interact. energy: -0.565 local terms energy: -643.027398 where: bonds (distance) C4'-P energy: -144.478 bonds (distance) P-C4' energy: -157.879 flat angles C4'-P-C4' energy: -166.225 flat angles P-C4'-P energy: -77.273 tors. eta vs tors. theta energy: -97.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1770.788624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1770.788624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.788624 (E_RNA) where: Base-Base interactions energy: -1098.041 where: short stacking energy: -524.686 Base-Backbone interact. energy: -2.268 local terms energy: -670.479700 where: bonds (distance) C4'-P energy: -144.432 bonds (distance) P-C4' energy: -170.607 flat angles C4'-P-C4' energy: -161.198 flat angles P-C4'-P energy: -79.710 tors. eta vs tors. theta energy: -114.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -1122.451922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1122.451922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.451922 (E_RNA) where: Base-Base interactions energy: -653.274 where: short stacking energy: -364.604 Base-Backbone interact. energy: 2.024 local terms energy: -471.201337 where: bonds (distance) C4'-P energy: -145.218 bonds (distance) P-C4' energy: -135.249 flat angles C4'-P-C4' energy: -121.441 flat angles P-C4'-P energy: -56.270 tors. eta vs tors. theta energy: -13.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -1222.825255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.825255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.825255 (E_RNA) where: Base-Base interactions energy: -669.989 where: short stacking energy: -354.213 Base-Backbone interact. energy: -5.032 local terms energy: -547.804280 where: bonds (distance) C4'-P energy: -157.207 bonds (distance) P-C4' energy: -140.539 flat angles C4'-P-C4' energy: -142.214 flat angles P-C4'-P energy: -69.123 tors. eta vs tors. theta energy: -38.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2916.226761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2916.226761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2916.226761 (E_RNA) where: Base-Base interactions energy: -1985.022 where: short stacking energy: -929.858 Base-Backbone interact. energy: -3.070 local terms energy: -928.135451 where: bonds (distance) C4'-P energy: -182.321 bonds (distance) P-C4' energy: -181.123 flat angles C4'-P-C4' energy: -211.575 flat angles P-C4'-P energy: -114.076 tors. eta vs tors. theta energy: -239.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2845.637663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2845.637663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2845.637663 (E_RNA) where: Base-Base interactions energy: -1951.260 where: short stacking energy: -846.349 Base-Backbone interact. energy: -5.206 local terms energy: -889.170900 where: bonds (distance) C4'-P energy: -169.552 bonds (distance) P-C4' energy: -184.002 flat angles C4'-P-C4' energy: -196.963 flat angles P-C4'-P energy: -134.849 tors. eta vs tors. theta energy: -203.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2642.405686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2642.405686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2642.405686 (E_RNA) where: Base-Base interactions energy: -1813.692 where: short stacking energy: -833.266 Base-Backbone interact. energy: 1.805 local terms energy: -830.518489 where: bonds (distance) C4'-P energy: -158.985 bonds (distance) P-C4' energy: -171.722 flat angles C4'-P-C4' energy: -184.107 flat angles P-C4'-P energy: -122.820 tors. eta vs tors. theta energy: -192.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2537.993283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2537.993283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2537.993283 (E_RNA) where: Base-Base interactions energy: -1691.830 where: short stacking energy: -781.592 Base-Backbone interact. energy: -2.875 local terms energy: -843.288134 where: bonds (distance) C4'-P energy: -168.660 bonds (distance) P-C4' energy: -174.256 flat angles C4'-P-C4' energy: -167.729 flat angles P-C4'-P energy: -129.150 tors. eta vs tors. theta energy: -203.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -2287.330322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2287.330322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2287.330322 (E_RNA) where: Base-Base interactions energy: -1515.489 where: short stacking energy: -743.102 Base-Backbone interact. energy: 1.127 local terms energy: -772.967887 where: bonds (distance) C4'-P energy: -173.079 bonds (distance) P-C4' energy: -159.496 flat angles C4'-P-C4' energy: -177.528 flat angles P-C4'-P energy: -91.837 tors. eta vs tors. theta energy: -171.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -2193.957371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.957371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.957371 (E_RNA) where: Base-Base interactions energy: -1448.630 where: short stacking energy: -648.324 Base-Backbone interact. energy: -4.129 local terms energy: -741.198024 where: bonds (distance) C4'-P energy: -153.692 bonds (distance) P-C4' energy: -173.061 flat angles C4'-P-C4' energy: -159.946 flat angles P-C4'-P energy: -105.932 tors. eta vs tors. theta energy: -148.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1959.684705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.684705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1959.684705 (E_RNA) where: Base-Base interactions energy: -1288.015 where: short stacking energy: -580.376 Base-Backbone interact. energy: -0.765 local terms energy: -670.904879 where: bonds (distance) C4'-P energy: -173.003 bonds (distance) P-C4' energy: -161.730 flat angles C4'-P-C4' energy: -131.392 flat angles P-C4'-P energy: -99.231 tors. eta vs tors. theta energy: -105.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1726.118774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1726.118774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1726.118774 (E_RNA) where: Base-Base interactions energy: -1088.268 where: short stacking energy: -516.681 Base-Backbone interact. energy: -1.766 local terms energy: -636.084485 where: bonds (distance) C4'-P energy: -145.691 bonds (distance) P-C4' energy: -159.369 flat angles C4'-P-C4' energy: -152.339 flat angles P-C4'-P energy: -87.100 tors. eta vs tors. theta energy: -91.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -1295.335438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.335438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.335438 (E_RNA) where: Base-Base interactions energy: -731.764 where: short stacking energy: -393.038 Base-Backbone interact. energy: 2.201 local terms energy: -565.772470 where: bonds (distance) C4'-P energy: -148.192 bonds (distance) P-C4' energy: -156.651 flat angles C4'-P-C4' energy: -136.905 flat angles P-C4'-P energy: -80.462 tors. eta vs tors. theta energy: -43.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -1227.548739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.548739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1227.548739 (E_RNA) where: Base-Base interactions energy: -702.795 where: short stacking energy: -362.496 Base-Backbone interact. energy: 5.840 local terms energy: -530.593391 where: bonds (distance) C4'-P energy: -143.238 bonds (distance) P-C4' energy: -149.326 flat angles C4'-P-C4' energy: -136.396 flat angles P-C4'-P energy: -77.886 tors. eta vs tors. theta energy: -23.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2894.413191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2894.413191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2894.413191 (E_RNA) where: Base-Base interactions energy: -1956.116 where: short stacking energy: -907.914 Base-Backbone interact. energy: -3.382 local terms energy: -934.914595 where: bonds (distance) C4'-P energy: -173.638 bonds (distance) P-C4' energy: -187.847 flat angles C4'-P-C4' energy: -203.893 flat angles P-C4'-P energy: -136.594 tors. eta vs tors. theta energy: -232.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2835.303540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2835.303540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2835.303540 (E_RNA) where: Base-Base interactions energy: -1951.132 where: short stacking energy: -824.214 Base-Backbone interact. energy: -2.176 local terms energy: -881.995683 where: bonds (distance) C4'-P energy: -191.366 bonds (distance) P-C4' energy: -167.628 flat angles C4'-P-C4' energy: -194.194 flat angles P-C4'-P energy: -125.727 tors. eta vs tors. theta energy: -203.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2661.428375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2661.428375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2661.428375 (E_RNA) where: Base-Base interactions energy: -1826.534 where: short stacking energy: -843.158 Base-Backbone interact. energy: -3.593 local terms energy: -831.301179 where: bonds (distance) C4'-P energy: -165.863 bonds (distance) P-C4' energy: -165.587 flat angles C4'-P-C4' energy: -192.039 flat angles P-C4'-P energy: -116.372 tors. eta vs tors. theta energy: -191.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -2508.936499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2508.936499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2508.936499 (E_RNA) where: Base-Base interactions energy: -1679.869 where: short stacking energy: -759.190 Base-Backbone interact. energy: -3.345 local terms energy: -825.722783 where: bonds (distance) C4'-P energy: -177.940 bonds (distance) P-C4' energy: -165.994 flat angles C4'-P-C4' energy: -179.821 flat angles P-C4'-P energy: -127.914 tors. eta vs tors. theta energy: -174.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -2350.345879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2350.345879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2350.345879 (E_RNA) where: Base-Base interactions energy: -1555.591 where: short stacking energy: -742.943 Base-Backbone interact. energy: -2.333 local terms energy: -792.421901 where: bonds (distance) C4'-P energy: -147.371 bonds (distance) P-C4' energy: -157.758 flat angles C4'-P-C4' energy: -189.937 flat angles P-C4'-P energy: -116.070 tors. eta vs tors. theta energy: -181.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -2182.438492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2182.438492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2182.438492 (E_RNA) where: Base-Base interactions energy: -1433.498 where: short stacking energy: -650.482 Base-Backbone interact. energy: -4.023 local terms energy: -744.917485 where: bonds (distance) C4'-P energy: -157.004 bonds (distance) P-C4' energy: -167.233 flat angles C4'-P-C4' energy: -169.728 flat angles P-C4'-P energy: -104.744 tors. eta vs tors. theta energy: -146.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1963.129554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1963.129554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1963.129554 (E_RNA) where: Base-Base interactions energy: -1314.701 where: short stacking energy: -560.387 Base-Backbone interact. energy: 1.363 local terms energy: -649.791749 where: bonds (distance) C4'-P energy: -147.890 bonds (distance) P-C4' energy: -175.595 flat angles C4'-P-C4' energy: -152.557 flat angles P-C4'-P energy: -68.819 tors. eta vs tors. theta energy: -104.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1727.971642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.971642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.971642 (E_RNA) where: Base-Base interactions energy: -1117.063 where: short stacking energy: -521.325 Base-Backbone interact. energy: -3.869 local terms energy: -607.040078 where: bonds (distance) C4'-P energy: -143.096 bonds (distance) P-C4' energy: -132.468 flat angles C4'-P-C4' energy: -174.029 flat angles P-C4'-P energy: -72.721 tors. eta vs tors. theta energy: -84.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -1303.826185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.826185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.826185 (E_RNA) where: Base-Base interactions energy: -722.623 where: short stacking energy: -421.743 Base-Backbone interact. energy: 3.590 local terms energy: -584.793566 where: bonds (distance) C4'-P energy: -156.387 bonds (distance) P-C4' energy: -149.439 flat angles C4'-P-C4' energy: -141.081 flat angles P-C4'-P energy: -87.782 tors. eta vs tors. theta energy: -50.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -1221.124026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.124026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.124026 (E_RNA) where: Base-Base interactions energy: -710.504 where: short stacking energy: -357.959 Base-Backbone interact. energy: 2.143 local terms energy: -512.763385 where: bonds (distance) C4'-P energy: -130.404 bonds (distance) P-C4' energy: -138.368 flat angles C4'-P-C4' energy: -148.476 flat angles P-C4'-P energy: -63.100 tors. eta vs tors. theta energy: -32.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2967.410030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2967.410030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2967.410030 (E_RNA) where: Base-Base interactions energy: -2050.417 where: short stacking energy: -863.859 Base-Backbone interact. energy: 0.034 local terms energy: -917.027051 where: bonds (distance) C4'-P energy: -165.331 bonds (distance) P-C4' energy: -183.761 flat angles C4'-P-C4' energy: -204.919 flat angles P-C4'-P energy: -136.041 tors. eta vs tors. theta energy: -226.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2844.247581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2844.247581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2844.247581 (E_RNA) where: Base-Base interactions energy: -1951.286 where: short stacking energy: -887.729 Base-Backbone interact. energy: -4.845 local terms energy: -888.116407 where: bonds (distance) C4'-P energy: -170.370 bonds (distance) P-C4' energy: -168.460 flat angles C4'-P-C4' energy: -203.630 flat angles P-C4'-P energy: -117.821 tors. eta vs tors. theta energy: -227.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2660.863867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2660.863867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2660.863867 (E_RNA) where: Base-Base interactions energy: -1828.613 where: short stacking energy: -814.670 Base-Backbone interact. energy: 2.363 local terms energy: -834.613596 where: bonds (distance) C4'-P energy: -177.242 bonds (distance) P-C4' energy: -167.256 flat angles C4'-P-C4' energy: -189.197 flat angles P-C4'-P energy: -126.604 tors. eta vs tors. theta energy: -174.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -2520.712031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2520.712031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2520.712031 (E_RNA) where: Base-Base interactions energy: -1679.388 where: short stacking energy: -792.283 Base-Backbone interact. energy: -4.802 local terms energy: -836.522090 where: bonds (distance) C4'-P energy: -170.861 bonds (distance) P-C4' energy: -156.230 flat angles C4'-P-C4' energy: -186.431 flat angles P-C4'-P energy: -122.245 tors. eta vs tors. theta energy: -200.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -2370.369020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2370.369020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2370.369020 (E_RNA) where: Base-Base interactions energy: -1598.182 where: short stacking energy: -735.333 Base-Backbone interact. energy: -5.004 local terms energy: -767.182533 where: bonds (distance) C4'-P energy: -147.425 bonds (distance) P-C4' energy: -172.432 flat angles C4'-P-C4' energy: -182.247 flat angles P-C4'-P energy: -104.974 tors. eta vs tors. theta energy: -160.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -2223.488340 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2223.488340 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2223.488340 (E_RNA) where: Base-Base interactions energy: -1468.493 where: short stacking energy: -687.257 Base-Backbone interact. energy: 2.848 local terms energy: -757.844271 where: bonds (distance) C4'-P energy: -163.020 bonds (distance) P-C4' energy: -170.692 flat angles C4'-P-C4' energy: -163.192 flat angles P-C4'-P energy: -106.433 tors. eta vs tors. theta energy: -154.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -2085.232403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2085.232403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2085.232403 (E_RNA) where: Base-Base interactions energy: -1386.859 where: short stacking energy: -620.513 Base-Backbone interact. energy: -0.560 local terms energy: -697.813036 where: bonds (distance) C4'-P energy: -144.226 bonds (distance) P-C4' energy: -129.617 flat angles C4'-P-C4' energy: -186.963 flat angles P-C4'-P energy: -111.603 tors. eta vs tors. theta energy: -125.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1707.129224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1707.129224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.129224 (E_RNA) where: Base-Base interactions energy: -1109.080 where: short stacking energy: -539.611 Base-Backbone interact. energy: -0.696 local terms energy: -597.352974 where: bonds (distance) C4'-P energy: -142.807 bonds (distance) P-C4' energy: -127.998 flat angles C4'-P-C4' energy: -154.294 flat angles P-C4'-P energy: -87.028 tors. eta vs tors. theta energy: -85.227 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -1360.038757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.038757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.038757 (E_RNA) where: Base-Base interactions energy: -800.382 where: short stacking energy: -413.844 Base-Backbone interact. energy: 4.456 local terms energy: -564.112542 where: bonds (distance) C4'-P energy: -150.083 bonds (distance) P-C4' energy: -154.681 flat angles C4'-P-C4' energy: -142.957 flat angles P-C4'-P energy: -71.050 tors. eta vs tors. theta energy: -45.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -1174.795085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.795085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.795085 (E_RNA) where: Base-Base interactions energy: -673.315 where: short stacking energy: -361.416 Base-Backbone interact. energy: 5.911 local terms energy: -507.390970 where: bonds (distance) C4'-P energy: -146.509 bonds (distance) P-C4' energy: -141.358 flat angles C4'-P-C4' energy: -134.770 flat angles P-C4'-P energy: -63.020 tors. eta vs tors. theta energy: -21.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2981.836881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2981.836881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2981.836881 (E_RNA) where: Base-Base interactions energy: -2042.242 where: short stacking energy: -851.944 Base-Backbone interact. energy: -2.977 local terms energy: -936.618577 where: bonds (distance) C4'-P energy: -169.413 bonds (distance) P-C4' energy: -190.632 flat angles C4'-P-C4' energy: -206.903 flat angles P-C4'-P energy: -141.361 tors. eta vs tors. theta energy: -228.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2815.152430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2815.152430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2815.152430 (E_RNA) where: Base-Base interactions energy: -1885.974 where: short stacking energy: -882.768 Base-Backbone interact. energy: -5.671 local terms energy: -923.507819 where: bonds (distance) C4'-P energy: -178.152 bonds (distance) P-C4' energy: -188.620 flat angles C4'-P-C4' energy: -192.934 flat angles P-C4'-P energy: -136.606 tors. eta vs tors. theta energy: -227.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2695.435632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2695.435632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2695.435632 (E_RNA) where: Base-Base interactions energy: -1851.448 where: short stacking energy: -811.034 Base-Backbone interact. energy: -1.133 local terms energy: -842.854211 where: bonds (distance) C4'-P energy: -166.235 bonds (distance) P-C4' energy: -178.987 flat angles C4'-P-C4' energy: -181.093 flat angles P-C4'-P energy: -117.514 tors. eta vs tors. theta energy: -199.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -2467.009447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2467.009447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2467.009447 (E_RNA) where: Base-Base interactions energy: -1661.719 where: short stacking energy: -778.058 Base-Backbone interact. energy: 1.297 local terms energy: -806.587474 where: bonds (distance) C4'-P energy: -163.055 bonds (distance) P-C4' energy: -169.677 flat angles C4'-P-C4' energy: -193.350 flat angles P-C4'-P energy: -97.126 tors. eta vs tors. theta energy: -183.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -2463.055198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2463.055198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2463.055198 (E_RNA) where: Base-Base interactions energy: -1642.566 where: short stacking energy: -754.419 Base-Backbone interact. energy: 1.060 local terms energy: -821.549840 where: bonds (distance) C4'-P energy: -170.264 bonds (distance) P-C4' energy: -178.087 flat angles C4'-P-C4' energy: -172.861 flat angles P-C4'-P energy: -122.872 tors. eta vs tors. theta energy: -177.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -2283.089109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2283.089109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2283.089109 (E_RNA) where: Base-Base interactions energy: -1543.441 where: short stacking energy: -705.753 Base-Backbone interact. energy: 0.685 local terms energy: -740.333648 where: bonds (distance) C4'-P energy: -159.968 bonds (distance) P-C4' energy: -156.280 flat angles C4'-P-C4' energy: -181.853 flat angles P-C4'-P energy: -95.753 tors. eta vs tors. theta energy: -146.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -2050.649485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2050.649485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2050.649485 (E_RNA) where: Base-Base interactions energy: -1365.635 where: short stacking energy: -611.940 Base-Backbone interact. energy: 3.323 local terms energy: -688.337472 where: bonds (distance) C4'-P energy: -156.547 bonds (distance) P-C4' energy: -155.899 flat angles C4'-P-C4' energy: -167.664 flat angles P-C4'-P energy: -88.122 tors. eta vs tors. theta energy: -120.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1830.806092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1830.806092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1830.806092 (E_RNA) where: Base-Base interactions energy: -1210.405 where: short stacking energy: -541.383 Base-Backbone interact. energy: -2.486 local terms energy: -617.914825 where: bonds (distance) C4'-P energy: -142.460 bonds (distance) P-C4' energy: -154.005 flat angles C4'-P-C4' energy: -157.026 flat angles P-C4'-P energy: -95.478 tors. eta vs tors. theta energy: -68.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -1504.182844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.182844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.182844 (E_RNA) where: Base-Base interactions energy: -901.917 where: short stacking energy: -454.421 Base-Backbone interact. energy: 1.844 local terms energy: -604.110043 where: bonds (distance) C4'-P energy: -151.507 bonds (distance) P-C4' energy: -154.439 flat angles C4'-P-C4' energy: -152.677 flat angles P-C4'-P energy: -88.655 tors. eta vs tors. theta energy: -56.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -1140.921903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.921903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.921903 (E_RNA) where: Base-Base interactions energy: -624.561 where: short stacking energy: -351.432 Base-Backbone interact. energy: -1.262 local terms energy: -515.098403 where: bonds (distance) C4'-P energy: -155.197 bonds (distance) P-C4' energy: -125.956 flat angles C4'-P-C4' energy: -128.618 flat angles P-C4'-P energy: -73.721 tors. eta vs tors. theta energy: -31.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2980.885374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2980.885374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2980.885374 (E_RNA) where: Base-Base interactions energy: -2063.257 where: short stacking energy: -879.747 Base-Backbone interact. energy: -5.254 local terms energy: -912.375195 where: bonds (distance) C4'-P energy: -179.450 bonds (distance) P-C4' energy: -175.744 flat angles C4'-P-C4' energy: -198.137 flat angles P-C4'-P energy: -137.148 tors. eta vs tors. theta energy: -221.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2806.552148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2806.552148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2806.552148 (E_RNA) where: Base-Base interactions energy: -1904.389 where: short stacking energy: -869.622 Base-Backbone interact. energy: -1.893 local terms energy: -900.270196 where: bonds (distance) C4'-P energy: -176.728 bonds (distance) P-C4' energy: -174.287 flat angles C4'-P-C4' energy: -196.064 flat angles P-C4'-P energy: -118.289 tors. eta vs tors. theta energy: -234.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2672.659118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2672.659118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2672.659118 (E_RNA) where: Base-Base interactions energy: -1791.570 where: short stacking energy: -830.930 Base-Backbone interact. energy: 0.634 local terms energy: -881.723366 where: bonds (distance) C4'-P energy: -186.691 bonds (distance) P-C4' energy: -160.099 flat angles C4'-P-C4' energy: -190.546 flat angles P-C4'-P energy: -135.924 tors. eta vs tors. theta energy: -208.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -2438.319659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2438.319659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2438.319659 (E_RNA) where: Base-Base interactions energy: -1613.016 where: short stacking energy: -757.623 Base-Backbone interact. energy: -1.820 local terms energy: -823.483473 where: bonds (distance) C4'-P energy: -155.692 bonds (distance) P-C4' energy: -179.262 flat angles C4'-P-C4' energy: -187.628 flat angles P-C4'-P energy: -123.597 tors. eta vs tors. theta energy: -177.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -2422.712735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2422.712735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2422.712735 (E_RNA) where: Base-Base interactions energy: -1639.761 where: short stacking energy: -736.216 Base-Backbone interact. energy: 2.631 local terms energy: -785.582704 where: bonds (distance) C4'-P energy: -168.952 bonds (distance) P-C4' energy: -158.948 flat angles C4'-P-C4' energy: -176.361 flat angles P-C4'-P energy: -102.424 tors. eta vs tors. theta energy: -178.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -2318.508385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2318.508385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2318.508385 (E_RNA) where: Base-Base interactions energy: -1548.846 where: short stacking energy: -732.184 Base-Backbone interact. energy: 2.377 local terms energy: -772.039819 where: bonds (distance) C4'-P energy: -141.268 bonds (distance) P-C4' energy: -152.532 flat angles C4'-P-C4' energy: -186.515 flat angles P-C4'-P energy: -105.523 tors. eta vs tors. theta energy: -186.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -2050.493572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2050.493572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2050.493572 (E_RNA) where: Base-Base interactions energy: -1366.681 where: short stacking energy: -601.021 Base-Backbone interact. energy: 2.582 local terms energy: -686.395169 where: bonds (distance) C4'-P energy: -149.664 bonds (distance) P-C4' energy: -174.960 flat angles C4'-P-C4' energy: -161.339 flat angles P-C4'-P energy: -83.631 tors. eta vs tors. theta energy: -116.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1817.712607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1817.712607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1817.712607 (E_RNA) where: Base-Base interactions energy: -1192.289 where: short stacking energy: -524.739 Base-Backbone interact. energy: -2.208 local terms energy: -623.216007 where: bonds (distance) C4'-P energy: -148.094 bonds (distance) P-C4' energy: -159.864 flat angles C4'-P-C4' energy: -167.996 flat angles P-C4'-P energy: -78.179 tors. eta vs tors. theta energy: -69.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -1484.109304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.109304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.109304 (E_RNA) where: Base-Base interactions energy: -897.904 where: short stacking energy: -440.472 Base-Backbone interact. energy: 2.186 local terms energy: -588.391670 where: bonds (distance) C4'-P energy: -149.559 bonds (distance) P-C4' energy: -161.151 flat angles C4'-P-C4' energy: -133.028 flat angles P-C4'-P energy: -97.225 tors. eta vs tors. theta energy: -47.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -1167.498126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1167.498126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1167.498126 (E_RNA) where: Base-Base interactions energy: -687.898 where: short stacking energy: -355.461 Base-Backbone interact. energy: -2.361 local terms energy: -477.239219 where: bonds (distance) C4'-P energy: -151.749 bonds (distance) P-C4' energy: -130.418 flat angles C4'-P-C4' energy: -115.216 flat angles P-C4'-P energy: -45.761 tors. eta vs tors. theta energy: -34.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2981.076527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2981.076527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2981.076527 (E_RNA) where: Base-Base interactions energy: -2047.473 where: short stacking energy: -896.167 Base-Backbone interact. energy: -2.981 local terms energy: -930.622171 where: bonds (distance) C4'-P energy: -182.791 bonds (distance) P-C4' energy: -193.855 flat angles C4'-P-C4' energy: -202.542 flat angles P-C4'-P energy: -125.027 tors. eta vs tors. theta energy: -226.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2799.962307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2799.962307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2799.962307 (E_RNA) where: Base-Base interactions energy: -1909.116 where: short stacking energy: -892.766 Base-Backbone interact. energy: 1.361 local terms energy: -892.208027 where: bonds (distance) C4'-P energy: -181.662 bonds (distance) P-C4' energy: -181.333 flat angles C4'-P-C4' energy: -181.952 flat angles P-C4'-P energy: -120.278 tors. eta vs tors. theta energy: -226.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2705.994578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2705.994578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2705.994578 (E_RNA) where: Base-Base interactions energy: -1816.597 where: short stacking energy: -837.047 Base-Backbone interact. energy: -2.896 local terms energy: -886.501987 where: bonds (distance) C4'-P energy: -188.221 bonds (distance) P-C4' energy: -194.892 flat angles C4'-P-C4' energy: -192.583 flat angles P-C4'-P energy: -109.168 tors. eta vs tors. theta energy: -201.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -2459.379085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2459.379085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2459.379085 (E_RNA) where: Base-Base interactions energy: -1618.620 where: short stacking energy: -776.012 Base-Backbone interact. energy: -1.151 local terms energy: -839.608189 where: bonds (distance) C4'-P energy: -154.752 bonds (distance) P-C4' energy: -187.934 flat angles C4'-P-C4' energy: -177.393 flat angles P-C4'-P energy: -136.488 tors. eta vs tors. theta energy: -183.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -2411.429285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2411.429285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2411.429285 (E_RNA) where: Base-Base interactions energy: -1606.534 where: short stacking energy: -744.117 Base-Backbone interact. energy: -5.233 local terms energy: -799.661574 where: bonds (distance) C4'-P energy: -152.532 bonds (distance) P-C4' energy: -174.965 flat angles C4'-P-C4' energy: -162.961 flat angles P-C4'-P energy: -118.233 tors. eta vs tors. theta energy: -190.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -2197.953329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2197.953329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2197.953329 (E_RNA) where: Base-Base interactions energy: -1449.479 where: short stacking energy: -612.305 Base-Backbone interact. energy: -0.420 local terms energy: -748.054493 where: bonds (distance) C4'-P energy: -166.591 bonds (distance) P-C4' energy: -150.928 flat angles C4'-P-C4' energy: -174.637 flat angles P-C4'-P energy: -120.250 tors. eta vs tors. theta energy: -135.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -2145.172665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2145.172665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2145.172665 (E_RNA) where: Base-Base interactions energy: -1445.716 where: short stacking energy: -683.185 Base-Backbone interact. energy: -0.788 local terms energy: -698.669074 where: bonds (distance) C4'-P energy: -158.210 bonds (distance) P-C4' energy: -134.191 flat angles C4'-P-C4' energy: -155.872 flat angles P-C4'-P energy: -93.510 tors. eta vs tors. theta energy: -156.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1824.096900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1824.096900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1824.096900 (E_RNA) where: Base-Base interactions energy: -1207.356 where: short stacking energy: -552.109 Base-Backbone interact. energy: 5.018 local terms energy: -621.758721 where: bonds (distance) C4'-P energy: -128.974 bonds (distance) P-C4' energy: -160.975 flat angles C4'-P-C4' energy: -150.529 flat angles P-C4'-P energy: -87.763 tors. eta vs tors. theta energy: -93.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -1617.223735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.223735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.223735 (E_RNA) where: Base-Base interactions energy: -1026.197 where: short stacking energy: -453.696 Base-Backbone interact. energy: -2.989 local terms energy: -588.037717 where: bonds (distance) C4'-P energy: -141.272 bonds (distance) P-C4' energy: -167.950 flat angles C4'-P-C4' energy: -134.398 flat angles P-C4'-P energy: -91.392 tors. eta vs tors. theta energy: -53.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -1252.426795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.426795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.426795 (E_RNA) where: Base-Base interactions energy: -733.650 where: short stacking energy: -367.438 Base-Backbone interact. energy: 4.587 local terms energy: -523.364473 where: bonds (distance) C4'-P energy: -117.771 bonds (distance) P-C4' energy: -165.542 flat angles C4'-P-C4' energy: -131.850 flat angles P-C4'-P energy: -88.528 tors. eta vs tors. theta energy: -19.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2983.204543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2983.204543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2983.204543 (E_RNA) where: Base-Base interactions energy: -2027.788 where: short stacking energy: -893.255 Base-Backbone interact. energy: -3.785 local terms energy: -951.632415 where: bonds (distance) C4'-P energy: -185.538 bonds (distance) P-C4' energy: -202.090 flat angles C4'-P-C4' energy: -188.984 flat angles P-C4'-P energy: -148.267 tors. eta vs tors. theta energy: -226.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2775.997394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2775.997394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2775.997394 (E_RNA) where: Base-Base interactions energy: -1866.819 where: short stacking energy: -896.659 Base-Backbone interact. energy: 0.012 local terms energy: -909.190536 where: bonds (distance) C4'-P energy: -169.686 bonds (distance) P-C4' energy: -184.266 flat angles C4'-P-C4' energy: -205.265 flat angles P-C4'-P energy: -136.781 tors. eta vs tors. theta energy: -213.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2706.306808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2706.306808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2706.306808 (E_RNA) where: Base-Base interactions energy: -1859.917 where: short stacking energy: -821.620 Base-Backbone interact. energy: 4.450 local terms energy: -850.839565 where: bonds (distance) C4'-P energy: -159.023 bonds (distance) P-C4' energy: -174.605 flat angles C4'-P-C4' energy: -202.023 flat angles P-C4'-P energy: -117.560 tors. eta vs tors. theta energy: -197.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -2488.799345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2488.799345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2488.799345 (E_RNA) where: Base-Base interactions energy: -1632.375 where: short stacking energy: -780.573 Base-Backbone interact. energy: -4.162 local terms energy: -852.261682 where: bonds (distance) C4'-P energy: -176.769 bonds (distance) P-C4' energy: -181.531 flat angles C4'-P-C4' energy: -186.798 flat angles P-C4'-P energy: -106.315 tors. eta vs tors. theta energy: -200.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -2509.112178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2509.112178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2509.112178 (E_RNA) where: Base-Base interactions energy: -1654.197 where: short stacking energy: -743.098 Base-Backbone interact. energy: -2.508 local terms energy: -852.407172 where: bonds (distance) C4'-P energy: -171.565 bonds (distance) P-C4' energy: -192.637 flat angles C4'-P-C4' energy: -179.109 flat angles P-C4'-P energy: -125.495 tors. eta vs tors. theta energy: -183.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -2209.883434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2209.883434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2209.883434 (E_RNA) where: Base-Base interactions energy: -1478.585 where: short stacking energy: -618.817 Base-Backbone interact. energy: 4.100 local terms energy: -735.398276 where: bonds (distance) C4'-P energy: -157.650 bonds (distance) P-C4' energy: -156.993 flat angles C4'-P-C4' energy: -175.229 flat angles P-C4'-P energy: -106.148 tors. eta vs tors. theta energy: -139.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -2076.308579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2076.308579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2076.308579 (E_RNA) where: Base-Base interactions energy: -1377.769 where: short stacking energy: -639.297 Base-Backbone interact. energy: -0.461 local terms energy: -698.078488 where: bonds (distance) C4'-P energy: -132.864 bonds (distance) P-C4' energy: -162.987 flat angles C4'-P-C4' energy: -178.558 flat angles P-C4'-P energy: -86.848 tors. eta vs tors. theta energy: -136.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1762.926255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1762.926255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.926255 (E_RNA) where: Base-Base interactions energy: -1141.445 where: short stacking energy: -518.990 Base-Backbone interact. energy: -1.915 local terms energy: -619.566231 where: bonds (distance) C4'-P energy: -149.620 bonds (distance) P-C4' energy: -143.639 flat angles C4'-P-C4' energy: -168.359 flat angles P-C4'-P energy: -86.583 tors. eta vs tors. theta energy: -71.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -1615.214208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1615.214208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1615.214208 (E_RNA) where: Base-Base interactions energy: -1043.219 where: short stacking energy: -480.805 Base-Backbone interact. energy: 1.060 local terms energy: -573.054634 where: bonds (distance) C4'-P energy: -98.117 bonds (distance) P-C4' energy: -141.830 flat angles C4'-P-C4' energy: -144.520 flat angles P-C4'-P energy: -105.038 tors. eta vs tors. theta energy: -83.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -1218.664614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.664614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.664614 (E_RNA) where: Base-Base interactions energy: -701.843 where: short stacking energy: -331.023 Base-Backbone interact. energy: 0.589 local terms energy: -517.410190 where: bonds (distance) C4'-P energy: -139.699 bonds (distance) P-C4' energy: -161.996 flat angles C4'-P-C4' energy: -129.473 flat angles P-C4'-P energy: -77.387 tors. eta vs tors. theta energy: -8.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2973.093927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2973.093927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2973.093927 (E_RNA) where: Base-Base interactions energy: -2056.357 where: short stacking energy: -874.364 Base-Backbone interact. energy: -4.652 local terms energy: -912.084414 where: bonds (distance) C4'-P energy: -185.538 bonds (distance) P-C4' energy: -187.643 flat angles C4'-P-C4' energy: -194.600 flat angles P-C4'-P energy: -123.543 tors. eta vs tors. theta energy: -220.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2753.455252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2753.455252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2753.455252 (E_RNA) where: Base-Base interactions energy: -1844.487 where: short stacking energy: -841.727 Base-Backbone interact. energy: -5.307 local terms energy: -903.661546 where: bonds (distance) C4'-P energy: -172.423 bonds (distance) P-C4' energy: -181.568 flat angles C4'-P-C4' energy: -209.082 flat angles P-C4'-P energy: -128.806 tors. eta vs tors. theta energy: -211.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2709.742411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2709.742411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2709.742411 (E_RNA) where: Base-Base interactions energy: -1892.357 where: short stacking energy: -854.452 Base-Backbone interact. energy: -2.209 local terms energy: -815.176280 where: bonds (distance) C4'-P energy: -153.465 bonds (distance) P-C4' energy: -174.774 flat angles C4'-P-C4' energy: -175.084 flat angles P-C4'-P energy: -117.408 tors. eta vs tors. theta energy: -194.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -2532.798841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2532.798841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2532.798841 (E_RNA) where: Base-Base interactions energy: -1689.845 where: short stacking energy: -722.326 Base-Backbone interact. energy: -2.231 local terms energy: -840.723212 where: bonds (distance) C4'-P energy: -164.244 bonds (distance) P-C4' energy: -185.028 flat angles C4'-P-C4' energy: -187.175 flat angles P-C4'-P energy: -119.095 tors. eta vs tors. theta energy: -185.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -2339.258811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2339.258811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2339.258811 (E_RNA) where: Base-Base interactions energy: -1568.340 where: short stacking energy: -743.353 Base-Backbone interact. energy: -2.851 local terms energy: -768.067693 where: bonds (distance) C4'-P energy: -160.090 bonds (distance) P-C4' energy: -178.849 flat angles C4'-P-C4' energy: -166.227 flat angles P-C4'-P energy: -97.814 tors. eta vs tors. theta energy: -165.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -2320.503737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2320.503737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2320.503737 (E_RNA) where: Base-Base interactions energy: -1587.258 where: short stacking energy: -680.717 Base-Backbone interact. energy: 3.787 local terms energy: -737.033337 where: bonds (distance) C4'-P energy: -152.088 bonds (distance) P-C4' energy: -164.297 flat angles C4'-P-C4' energy: -185.810 flat angles P-C4'-P energy: -93.472 tors. eta vs tors. theta energy: -141.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -2089.726600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.726600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.726600 (E_RNA) where: Base-Base interactions energy: -1367.500 where: short stacking energy: -608.826 Base-Backbone interact. energy: -3.721 local terms energy: -718.505932 where: bonds (distance) C4'-P energy: -170.181 bonds (distance) P-C4' energy: -149.098 flat angles C4'-P-C4' energy: -170.299 flat angles P-C4'-P energy: -100.241 tors. eta vs tors. theta energy: -128.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1662.276005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.276005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.276005 (E_RNA) where: Base-Base interactions energy: -1050.262 where: short stacking energy: -499.491 Base-Backbone interact. energy: -3.138 local terms energy: -608.875804 where: bonds (distance) C4'-P energy: -163.665 bonds (distance) P-C4' energy: -144.888 flat angles C4'-P-C4' energy: -136.128 flat angles P-C4'-P energy: -93.899 tors. eta vs tors. theta energy: -70.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -1534.784334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.784334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1534.784334 (E_RNA) where: Base-Base interactions energy: -935.875 where: short stacking energy: -486.536 Base-Backbone interact. energy: 5.137 local terms energy: -604.045789 where: bonds (distance) C4'-P energy: -146.261 bonds (distance) P-C4' energy: -150.344 flat angles C4'-P-C4' energy: -153.341 flat angles P-C4'-P energy: -84.935 tors. eta vs tors. theta energy: -69.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -1071.801092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1071.801092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1071.801092 (E_RNA) where: Base-Base interactions energy: -644.162 where: short stacking energy: -331.060 Base-Backbone interact. energy: 9.759 local terms energy: -437.398260 where: bonds (distance) C4'-P energy: -97.821 bonds (distance) P-C4' energy: -132.434 flat angles C4'-P-C4' energy: -134.834 flat angles P-C4'-P energy: -71.032 tors. eta vs tors. theta energy: -1.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2977.502300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2977.502300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2977.502300 (E_RNA) where: Base-Base interactions energy: -2031.528 where: short stacking energy: -913.731 Base-Backbone interact. energy: -5.580 local terms energy: -940.394531 where: bonds (distance) C4'-P energy: -189.460 bonds (distance) P-C4' energy: -189.277 flat angles C4'-P-C4' energy: -201.371 flat angles P-C4'-P energy: -135.707 tors. eta vs tors. theta energy: -224.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2776.491031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2776.491031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2776.491031 (E_RNA) where: Base-Base interactions energy: -1883.254 where: short stacking energy: -867.224 Base-Backbone interact. energy: -1.037 local terms energy: -892.199794 where: bonds (distance) C4'-P energy: -171.931 bonds (distance) P-C4' energy: -175.818 flat angles C4'-P-C4' energy: -191.679 flat angles P-C4'-P energy: -133.937 tors. eta vs tors. theta energy: -218.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2745.010644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2745.010644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2745.010644 (E_RNA) where: Base-Base interactions energy: -1878.073 where: short stacking energy: -856.389 Base-Backbone interact. energy: -2.551 local terms energy: -864.386772 where: bonds (distance) C4'-P energy: -167.797 bonds (distance) P-C4' energy: -197.655 flat angles C4'-P-C4' energy: -189.448 flat angles P-C4'-P energy: -111.123 tors. eta vs tors. theta energy: -198.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -2522.286635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2522.286635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2522.286635 (E_RNA) where: Base-Base interactions energy: -1681.424 where: short stacking energy: -772.093 Base-Backbone interact. energy: -2.489 local terms energy: -838.373639 where: bonds (distance) C4'-P energy: -166.675 bonds (distance) P-C4' energy: -171.748 flat angles C4'-P-C4' energy: -201.382 flat angles P-C4'-P energy: -128.236 tors. eta vs tors. theta energy: -170.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -2323.548146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2323.548146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2323.548146 (E_RNA) where: Base-Base interactions energy: -1527.281 where: short stacking energy: -676.334 Base-Backbone interact. energy: -4.866 local terms energy: -791.400956 where: bonds (distance) C4'-P energy: -146.254 bonds (distance) P-C4' energy: -189.598 flat angles C4'-P-C4' energy: -181.223 flat angles P-C4'-P energy: -120.061 tors. eta vs tors. theta energy: -154.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -2325.901260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2325.901260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2325.901260 (E_RNA) where: Base-Base interactions energy: -1602.047 where: short stacking energy: -671.034 Base-Backbone interact. energy: 3.006 local terms energy: -726.859910 where: bonds (distance) C4'-P energy: -149.652 bonds (distance) P-C4' energy: -168.710 flat angles C4'-P-C4' energy: -182.932 flat angles P-C4'-P energy: -93.365 tors. eta vs tors. theta energy: -132.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -2064.472621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2064.472621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2064.472621 (E_RNA) where: Base-Base interactions energy: -1393.650 where: short stacking energy: -627.224 Base-Backbone interact. energy: -1.494 local terms energy: -669.328833 where: bonds (distance) C4'-P energy: -158.913 bonds (distance) P-C4' energy: -148.977 flat angles C4'-P-C4' energy: -142.240 flat angles P-C4'-P energy: -90.772 tors. eta vs tors. theta energy: -128.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1715.382446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1715.382446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1715.382446 (E_RNA) where: Base-Base interactions energy: -1087.851 where: short stacking energy: -522.309 Base-Backbone interact. energy: 0.986 local terms energy: -628.518017 where: bonds (distance) C4'-P energy: -132.151 bonds (distance) P-C4' energy: -159.086 flat angles C4'-P-C4' energy: -156.755 flat angles P-C4'-P energy: -85.038 tors. eta vs tors. theta energy: -95.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1568.942055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.942055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.942055 (E_RNA) where: Base-Base interactions energy: -938.126 where: short stacking energy: -469.502 Base-Backbone interact. energy: 2.077 local terms energy: -632.893641 where: bonds (distance) C4'-P energy: -145.427 bonds (distance) P-C4' energy: -169.113 flat angles C4'-P-C4' energy: -149.596 flat angles P-C4'-P energy: -100.836 tors. eta vs tors. theta energy: -67.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -1161.247712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.247712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.247712 (E_RNA) where: Base-Base interactions energy: -708.535 where: short stacking energy: -369.077 Base-Backbone interact. energy: 0.835 local terms energy: -453.548342 where: bonds (distance) C4'-P energy: -134.140 bonds (distance) P-C4' energy: -121.485 flat angles C4'-P-C4' energy: -133.259 flat angles P-C4'-P energy: -43.805 tors. eta vs tors. theta energy: -20.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -2990.460476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2990.460476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2990.460476 (E_RNA) where: Base-Base interactions energy: -2029.139 where: short stacking energy: -903.918 Base-Backbone interact. energy: -7.319 local terms energy: -954.002588 where: bonds (distance) C4'-P energy: -183.820 bonds (distance) P-C4' energy: -185.555 flat angles C4'-P-C4' energy: -212.841 flat angles P-C4'-P energy: -133.848 tors. eta vs tors. theta energy: -237.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -2842.819784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2842.819784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2842.819784 (E_RNA) where: Base-Base interactions energy: -1926.842 where: short stacking energy: -871.031 Base-Backbone interact. energy: -3.773 local terms energy: -912.204821 where: bonds (distance) C4'-P energy: -170.766 bonds (distance) P-C4' energy: -195.898 flat angles C4'-P-C4' energy: -200.877 flat angles P-C4'-P energy: -115.779 tors. eta vs tors. theta energy: -228.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -2756.309820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2756.309820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2756.309820 (E_RNA) where: Base-Base interactions energy: -1906.326 where: short stacking energy: -870.215 Base-Backbone interact. energy: -0.693 local terms energy: -849.291089 where: bonds (distance) C4'-P energy: -155.987 bonds (distance) P-C4' energy: -167.011 flat angles C4'-P-C4' energy: -193.360 flat angles P-C4'-P energy: -114.754 tors. eta vs tors. theta energy: -218.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -2561.582578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2561.582578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2561.582578 (E_RNA) where: Base-Base interactions energy: -1737.472 where: short stacking energy: -785.069 Base-Backbone interact. energy: 1.388 local terms energy: -825.498253 where: bonds (distance) C4'-P energy: -152.384 bonds (distance) P-C4' energy: -173.411 flat angles C4'-P-C4' energy: -196.268 flat angles P-C4'-P energy: -113.967 tors. eta vs tors. theta energy: -189.468 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -2367.018502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2367.018502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2367.018502 (E_RNA) where: Base-Base interactions energy: -1607.272 where: short stacking energy: -727.613 Base-Backbone interact. energy: 1.490 local terms energy: -761.235840 where: bonds (distance) C4'-P energy: -150.097 bonds (distance) P-C4' energy: -164.335 flat angles C4'-P-C4' energy: -173.439 flat angles P-C4'-P energy: -96.465 tors. eta vs tors. theta energy: -176.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -2342.871895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2342.871895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2342.871895 (E_RNA) where: Base-Base interactions energy: -1589.796 where: short stacking energy: -665.445 Base-Backbone interact. energy: -3.291 local terms energy: -749.784833 where: bonds (distance) C4'-P energy: -153.104 bonds (distance) P-C4' energy: -163.168 flat angles C4'-P-C4' energy: -167.471 flat angles P-C4'-P energy: -111.443 tors. eta vs tors. theta energy: -154.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -2112.888078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.888078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.888078 (E_RNA) where: Base-Base interactions energy: -1379.138 where: short stacking energy: -648.023 Base-Backbone interact. energy: 2.456 local terms energy: -736.206051 where: bonds (distance) C4'-P energy: -143.273 bonds (distance) P-C4' energy: -159.244 flat angles C4'-P-C4' energy: -167.125 flat angles P-C4'-P energy: -104.350 tors. eta vs tors. theta energy: -162.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1648.438687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1648.438687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1648.438687 (E_RNA) where: Base-Base interactions energy: -1043.097 where: short stacking energy: -514.516 Base-Backbone interact. energy: 2.337 local terms energy: -607.678870 where: bonds (distance) C4'-P energy: -120.173 bonds (distance) P-C4' energy: -119.755 flat angles C4'-P-C4' energy: -182.828 flat angles P-C4'-P energy: -99.705 tors. eta vs tors. theta energy: -85.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1620.860487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1620.860487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1620.860487 (E_RNA) where: Base-Base interactions energy: -1024.794 where: short stacking energy: -514.900 Base-Backbone interact. energy: 0.035 local terms energy: -596.101521 where: bonds (distance) C4'-P energy: -155.735 bonds (distance) P-C4' energy: -146.316 flat angles C4'-P-C4' energy: -130.206 flat angles P-C4'-P energy: -65.638 tors. eta vs tors. theta energy: -98.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -1187.988679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.988679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.988679 (E_RNA) where: Base-Base interactions energy: -693.220 where: short stacking energy: -372.331 Base-Backbone interact. energy: -3.257 local terms energy: -491.511583 where: bonds (distance) C4'-P energy: -122.252 bonds (distance) P-C4' energy: -131.246 flat angles C4'-P-C4' energy: -126.580 flat angles P-C4'-P energy: -81.656 tors. eta vs tors. theta energy: -29.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -2976.661038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2976.661038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2976.661038 (E_RNA) where: Base-Base interactions energy: -2039.005 where: short stacking energy: -901.743 Base-Backbone interact. energy: -5.126 local terms energy: -932.529694 where: bonds (distance) C4'-P energy: -184.057 bonds (distance) P-C4' energy: -176.552 flat angles C4'-P-C4' energy: -203.683 flat angles P-C4'-P energy: -136.682 tors. eta vs tors. theta energy: -231.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -2871.012488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2871.012488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2871.012488 (E_RNA) where: Base-Base interactions energy: -1970.909 where: short stacking energy: -906.687 Base-Backbone interact. energy: 0.539 local terms energy: -900.641992 where: bonds (distance) C4'-P energy: -156.096 bonds (distance) P-C4' energy: -176.062 flat angles C4'-P-C4' energy: -203.669 flat angles P-C4'-P energy: -131.762 tors. eta vs tors. theta energy: -233.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -2725.016184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2725.016184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2725.016184 (E_RNA) where: Base-Base interactions energy: -1871.584 where: short stacking energy: -833.486 Base-Backbone interact. energy: -6.845 local terms energy: -846.587428 where: bonds (distance) C4'-P energy: -169.905 bonds (distance) P-C4' energy: -174.372 flat angles C4'-P-C4' energy: -185.786 flat angles P-C4'-P energy: -109.421 tors. eta vs tors. theta energy: -207.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -2585.318435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2585.318435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2585.318435 (E_RNA) where: Base-Base interactions energy: -1762.765 where: short stacking energy: -815.275 Base-Backbone interact. energy: -2.021 local terms energy: -820.532713 where: bonds (distance) C4'-P energy: -166.908 bonds (distance) P-C4' energy: -151.756 flat angles C4'-P-C4' energy: -181.251 flat angles P-C4'-P energy: -124.003 tors. eta vs tors. theta energy: -196.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -2443.663861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2443.663861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2443.663861 (E_RNA) where: Base-Base interactions energy: -1643.767 where: short stacking energy: -689.424 Base-Backbone interact. energy: -1.368 local terms energy: -798.529464 where: bonds (distance) C4'-P energy: -167.800 bonds (distance) P-C4' energy: -164.032 flat angles C4'-P-C4' energy: -181.721 flat angles P-C4'-P energy: -130.833 tors. eta vs tors. theta energy: -154.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -2301.455597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.455597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.455597 (E_RNA) where: Base-Base interactions energy: -1525.584 where: short stacking energy: -714.447 Base-Backbone interact. energy: 4.200 local terms energy: -780.071746 where: bonds (distance) C4'-P energy: -165.715 bonds (distance) P-C4' energy: -148.278 flat angles C4'-P-C4' energy: -179.460 flat angles P-C4'-P energy: -113.926 tors. eta vs tors. theta energy: -172.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -2094.844646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2094.844646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2094.844646 (E_RNA) where: Base-Base interactions energy: -1393.450 where: short stacking energy: -669.458 Base-Backbone interact. energy: 0.460 local terms energy: -701.854348 where: bonds (distance) C4'-P energy: -106.597 bonds (distance) P-C4' energy: -150.944 flat angles C4'-P-C4' energy: -179.823 flat angles P-C4'-P energy: -115.175 tors. eta vs tors. theta energy: -149.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1685.941615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.941615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.941615 (E_RNA) where: Base-Base interactions energy: -1079.719 where: short stacking energy: -541.215 Base-Backbone interact. energy: 0.596 local terms energy: -606.818283 where: bonds (distance) C4'-P energy: -153.544 bonds (distance) P-C4' energy: -139.313 flat angles C4'-P-C4' energy: -145.089 flat angles P-C4'-P energy: -79.379 tors. eta vs tors. theta energy: -89.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -1537.632715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1537.632715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1537.632715 (E_RNA) where: Base-Base interactions energy: -979.836 where: short stacking energy: -456.734 Base-Backbone interact. energy: -3.976 local terms energy: -553.820603 where: bonds (distance) C4'-P energy: -125.438 bonds (distance) P-C4' energy: -161.189 flat angles C4'-P-C4' energy: -133.241 flat angles P-C4'-P energy: -74.662 tors. eta vs tors. theta energy: -59.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -1255.386574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.386574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.386574 (E_RNA) where: Base-Base interactions energy: -695.624 where: short stacking energy: -368.916 Base-Backbone interact. energy: 3.010 local terms energy: -562.771889 where: bonds (distance) C4'-P energy: -142.908 bonds (distance) P-C4' energy: -140.215 flat angles C4'-P-C4' energy: -149.185 flat angles P-C4'-P energy: -105.248 tors. eta vs tors. theta energy: -25.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -2978.390820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2978.390820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2978.390820 (E_RNA) where: Base-Base interactions energy: -2056.071 where: short stacking energy: -881.973 Base-Backbone interact. energy: -7.199 local terms energy: -915.120856 where: bonds (distance) C4'-P energy: -174.351 bonds (distance) P-C4' energy: -180.814 flat angles C4'-P-C4' energy: -198.475 flat angles P-C4'-P energy: -144.767 tors. eta vs tors. theta energy: -216.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -2797.738409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2797.738409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2797.738409 (E_RNA) where: Base-Base interactions energy: -1893.771 where: short stacking energy: -829.522 Base-Backbone interact. energy: -7.661 local terms energy: -896.306492 where: bonds (distance) C4'-P energy: -183.073 bonds (distance) P-C4' energy: -175.672 flat angles C4'-P-C4' energy: -193.859 flat angles P-C4'-P energy: -134.554 tors. eta vs tors. theta energy: -209.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -2737.518830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2737.518830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2737.518830 (E_RNA) where: Base-Base interactions energy: -1872.030 where: short stacking energy: -817.523 Base-Backbone interact. energy: -1.956 local terms energy: -863.533144 where: bonds (distance) C4'-P energy: -161.688 bonds (distance) P-C4' energy: -194.437 flat angles C4'-P-C4' energy: -187.377 flat angles P-C4'-P energy: -104.413 tors. eta vs tors. theta energy: -215.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -2568.127371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2568.127371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2568.127371 (E_RNA) where: Base-Base interactions energy: -1732.778 where: short stacking energy: -750.526 Base-Backbone interact. energy: -2.128 local terms energy: -833.220976 where: bonds (distance) C4'-P energy: -163.743 bonds (distance) P-C4' energy: -181.552 flat angles C4'-P-C4' energy: -190.970 flat angles P-C4'-P energy: -122.189 tors. eta vs tors. theta energy: -174.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -2463.545541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2463.545541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2463.545541 (E_RNA) where: Base-Base interactions energy: -1679.964 where: short stacking energy: -699.499 Base-Backbone interact. energy: -2.719 local terms energy: -780.863117 where: bonds (distance) C4'-P energy: -167.023 bonds (distance) P-C4' energy: -169.860 flat angles C4'-P-C4' energy: -168.872 flat angles P-C4'-P energy: -107.797 tors. eta vs tors. theta energy: -167.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -2290.480179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2290.480179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2290.480179 (E_RNA) where: Base-Base interactions energy: -1518.502 where: short stacking energy: -723.949 Base-Backbone interact. energy: -0.900 local terms energy: -771.078028 where: bonds (distance) C4'-P energy: -139.481 bonds (distance) P-C4' energy: -156.519 flat angles C4'-P-C4' energy: -178.554 flat angles P-C4'-P energy: -123.650 tors. eta vs tors. theta energy: -172.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -2115.700681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2115.700681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2115.700681 (E_RNA) where: Base-Base interactions energy: -1414.803 where: short stacking energy: -633.750 Base-Backbone interact. energy: -0.806 local terms energy: -700.091363 where: bonds (distance) C4'-P energy: -121.845 bonds (distance) P-C4' energy: -166.058 flat angles C4'-P-C4' energy: -165.403 flat angles P-C4'-P energy: -101.805 tors. eta vs tors. theta energy: -144.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1626.736131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.736131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.736131 (E_RNA) where: Base-Base interactions energy: -1003.696 where: short stacking energy: -501.669 Base-Backbone interact. energy: -3.310 local terms energy: -619.730221 where: bonds (distance) C4'-P energy: -156.180 bonds (distance) P-C4' energy: -123.057 flat angles C4'-P-C4' energy: -164.331 flat angles P-C4'-P energy: -85.903 tors. eta vs tors. theta energy: -90.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -1491.010850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.010850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.010850 (E_RNA) where: Base-Base interactions energy: -880.982 where: short stacking energy: -434.971 Base-Backbone interact. energy: 1.072 local terms energy: -611.100415 where: bonds (distance) C4'-P energy: -154.061 bonds (distance) P-C4' energy: -158.665 flat angles C4'-P-C4' energy: -153.501 flat angles P-C4'-P energy: -92.452 tors. eta vs tors. theta energy: -52.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -1297.811248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1297.811248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1297.811248 (E_RNA) where: Base-Base interactions energy: -771.922 where: short stacking energy: -396.774 Base-Backbone interact. energy: 9.240 local terms energy: -535.129054 where: bonds (distance) C4'-P energy: -166.383 bonds (distance) P-C4' energy: -136.183 flat angles C4'-P-C4' energy: -132.946 flat angles P-C4'-P energy: -69.932 tors. eta vs tors. theta energy: -29.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -2988.250712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2988.250712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2988.250712 (E_RNA) where: Base-Base interactions energy: -2052.135 where: short stacking energy: -909.654 Base-Backbone interact. energy: -9.276 local terms energy: -926.840272 where: bonds (distance) C4'-P energy: -171.562 bonds (distance) P-C4' energy: -198.413 flat angles C4'-P-C4' energy: -203.008 flat angles P-C4'-P energy: -128.755 tors. eta vs tors. theta energy: -225.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -2866.676402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2866.676402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2866.676402 (E_RNA) where: Base-Base interactions energy: -1928.780 where: short stacking energy: -873.343 Base-Backbone interact. energy: -4.152 local terms energy: -933.745189 where: bonds (distance) C4'-P energy: -167.440 bonds (distance) P-C4' energy: -190.208 flat angles C4'-P-C4' energy: -209.443 flat angles P-C4'-P energy: -132.365 tors. eta vs tors. theta energy: -234.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -2737.759019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2737.759019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2737.759019 (E_RNA) where: Base-Base interactions energy: -1874.578 where: short stacking energy: -843.856 Base-Backbone interact. energy: -5.795 local terms energy: -857.386186 where: bonds (distance) C4'-P energy: -166.122 bonds (distance) P-C4' energy: -189.152 flat angles C4'-P-C4' energy: -190.730 flat angles P-C4'-P energy: -118.105 tors. eta vs tors. theta energy: -193.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -2573.113980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2573.113980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2573.113980 (E_RNA) where: Base-Base interactions energy: -1753.495 where: short stacking energy: -801.974 Base-Backbone interact. energy: -3.476 local terms energy: -816.142897 where: bonds (distance) C4'-P energy: -172.862 bonds (distance) P-C4' energy: -162.005 flat angles C4'-P-C4' energy: -189.157 flat angles P-C4'-P energy: -109.845 tors. eta vs tors. theta energy: -182.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -2545.878094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2545.878094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2545.878094 (E_RNA) where: Base-Base interactions energy: -1773.709 where: short stacking energy: -742.871 Base-Backbone interact. energy: 5.430 local terms energy: -777.599364 where: bonds (distance) C4'-P energy: -164.948 bonds (distance) P-C4' energy: -146.983 flat angles C4'-P-C4' energy: -177.013 flat angles P-C4'-P energy: -115.729 tors. eta vs tors. theta energy: -172.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -2245.532053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2245.532053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2245.532053 (E_RNA) where: Base-Base interactions energy: -1466.107 where: short stacking energy: -638.676 Base-Backbone interact. energy: -0.867 local terms energy: -778.557677 where: bonds (distance) C4'-P energy: -153.613 bonds (distance) P-C4' energy: -173.655 flat angles C4'-P-C4' energy: -174.399 flat angles P-C4'-P energy: -123.307 tors. eta vs tors. theta energy: -153.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -2133.524584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.524584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.524584 (E_RNA) where: Base-Base interactions energy: -1421.848 where: short stacking energy: -653.652 Base-Backbone interact. energy: 0.737 local terms energy: -712.414054 where: bonds (distance) C4'-P energy: -143.091 bonds (distance) P-C4' energy: -165.790 flat angles C4'-P-C4' energy: -171.269 flat angles P-C4'-P energy: -76.245 tors. eta vs tors. theta energy: -156.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1669.936980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1669.936980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1669.936980 (E_RNA) where: Base-Base interactions energy: -1019.279 where: short stacking energy: -515.061 Base-Backbone interact. energy: -0.052 local terms energy: -650.605497 where: bonds (distance) C4'-P energy: -156.374 bonds (distance) P-C4' energy: -128.362 flat angles C4'-P-C4' energy: -150.820 flat angles P-C4'-P energy: -105.246 tors. eta vs tors. theta energy: -109.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1482.154148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.154148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.154148 (E_RNA) where: Base-Base interactions energy: -881.538 where: short stacking energy: -430.494 Base-Backbone interact. energy: 0.145 local terms energy: -600.760456 where: bonds (distance) C4'-P energy: -149.933 bonds (distance) P-C4' energy: -160.491 flat angles C4'-P-C4' energy: -139.560 flat angles P-C4'-P energy: -89.760 tors. eta vs tors. theta energy: -61.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -1364.742298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.742298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.742298 (E_RNA) where: Base-Base interactions energy: -830.305 where: short stacking energy: -390.599 Base-Backbone interact. energy: -0.966 local terms energy: -533.471105 where: bonds (distance) C4'-P energy: -124.663 bonds (distance) P-C4' energy: -152.252 flat angles C4'-P-C4' energy: -138.136 flat angles P-C4'-P energy: -77.769 tors. eta vs tors. theta energy: -40.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -3006.051266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3006.051266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3006.051266 (E_RNA) where: Base-Base interactions energy: -2033.988 where: short stacking energy: -918.921 Base-Backbone interact. energy: -2.161 local terms energy: -969.902263 where: bonds (distance) C4'-P energy: -179.391 bonds (distance) P-C4' energy: -198.666 flat angles C4'-P-C4' energy: -216.373 flat angles P-C4'-P energy: -137.466 tors. eta vs tors. theta energy: -238.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -2884.300974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2884.300974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2884.300974 (E_RNA) where: Base-Base interactions energy: -1976.284 where: short stacking energy: -901.602 Base-Backbone interact. energy: -3.899 local terms energy: -904.117542 where: bonds (distance) C4'-P energy: -172.957 bonds (distance) P-C4' energy: -177.670 flat angles C4'-P-C4' energy: -211.830 flat angles P-C4'-P energy: -115.257 tors. eta vs tors. theta energy: -226.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -2766.730181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2766.730181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2766.730181 (E_RNA) where: Base-Base interactions energy: -1887.894 where: short stacking energy: -854.546 Base-Backbone interact. energy: -3.464 local terms energy: -875.372511 where: bonds (distance) C4'-P energy: -178.388 bonds (distance) P-C4' energy: -180.250 flat angles C4'-P-C4' energy: -191.866 flat angles P-C4'-P energy: -124.357 tors. eta vs tors. theta energy: -200.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -2639.220905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2639.220905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2639.220905 (E_RNA) where: Base-Base interactions energy: -1808.406 where: short stacking energy: -768.526 Base-Backbone interact. energy: -1.294 local terms energy: -829.520625 where: bonds (distance) C4'-P energy: -185.753 bonds (distance) P-C4' energy: -177.891 flat angles C4'-P-C4' energy: -175.154 flat angles P-C4'-P energy: -106.598 tors. eta vs tors. theta energy: -184.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -2501.228793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2501.228793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2501.228793 (E_RNA) where: Base-Base interactions energy: -1637.306 where: short stacking energy: -742.092 Base-Backbone interact. energy: -0.416 local terms energy: -863.506968 where: bonds (distance) C4'-P energy: -165.678 bonds (distance) P-C4' energy: -183.347 flat angles C4'-P-C4' energy: -195.697 flat angles P-C4'-P energy: -132.268 tors. eta vs tors. theta energy: -186.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -2260.364242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.364242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.364242 (E_RNA) where: Base-Base interactions energy: -1518.071 where: short stacking energy: -709.290 Base-Backbone interact. energy: -3.411 local terms energy: -738.882317 where: bonds (distance) C4'-P energy: -157.047 bonds (distance) P-C4' energy: -142.887 flat angles C4'-P-C4' energy: -176.660 flat angles P-C4'-P energy: -98.340 tors. eta vs tors. theta energy: -163.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -2128.581842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2128.581842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2128.581842 (E_RNA) where: Base-Base interactions energy: -1411.580 where: short stacking energy: -637.460 Base-Backbone interact. energy: -0.421 local terms energy: -716.579993 where: bonds (distance) C4'-P energy: -149.973 bonds (distance) P-C4' energy: -172.182 flat angles C4'-P-C4' energy: -158.355 flat angles P-C4'-P energy: -107.888 tors. eta vs tors. theta energy: -128.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1686.195277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.195277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.195277 (E_RNA) where: Base-Base interactions energy: -1037.114 where: short stacking energy: -510.575 Base-Backbone interact. energy: -0.927 local terms energy: -648.153967 where: bonds (distance) C4'-P energy: -165.908 bonds (distance) P-C4' energy: -162.091 flat angles C4'-P-C4' energy: -145.050 flat angles P-C4'-P energy: -99.778 tors. eta vs tors. theta energy: -75.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -1485.366350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1485.366350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.366350 (E_RNA) where: Base-Base interactions energy: -911.432 where: short stacking energy: -425.498 Base-Backbone interact. energy: -2.131 local terms energy: -571.803135 where: bonds (distance) C4'-P energy: -155.638 bonds (distance) P-C4' energy: -133.194 flat angles C4'-P-C4' energy: -137.426 flat angles P-C4'-P energy: -85.204 tors. eta vs tors. theta energy: -60.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -1324.805111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.805111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.805111 (E_RNA) where: Base-Base interactions energy: -815.404 where: short stacking energy: -367.776 Base-Backbone interact. energy: 4.746 local terms energy: -514.147916 where: bonds (distance) C4'-P energy: -138.462 bonds (distance) P-C4' energy: -145.196 flat angles C4'-P-C4' energy: -127.380 flat angles P-C4'-P energy: -90.970 tors. eta vs tors. theta energy: -12.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -2966.270991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2966.270991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2966.270991 (E_RNA) where: Base-Base interactions energy: -2041.446 where: short stacking energy: -902.140 Base-Backbone interact. energy: -5.558 local terms energy: -919.266710 where: bonds (distance) C4'-P energy: -171.278 bonds (distance) P-C4' energy: -182.345 flat angles C4'-P-C4' energy: -205.869 flat angles P-C4'-P energy: -127.019 tors. eta vs tors. theta energy: -232.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -2890.571860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2890.571860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2890.571860 (E_RNA) where: Base-Base interactions energy: -1994.955 where: short stacking energy: -913.387 Base-Backbone interact. energy: -2.355 local terms energy: -893.262445 where: bonds (distance) C4'-P energy: -182.351 bonds (distance) P-C4' energy: -173.982 flat angles C4'-P-C4' energy: -188.937 flat angles P-C4'-P energy: -113.468 tors. eta vs tors. theta energy: -234.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -2791.679942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2791.679942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2791.679942 (E_RNA) where: Base-Base interactions energy: -1919.444 where: short stacking energy: -862.277 Base-Backbone interact. energy: 0.152 local terms energy: -872.388677 where: bonds (distance) C4'-P energy: -164.148 bonds (distance) P-C4' energy: -155.286 flat angles C4'-P-C4' energy: -195.788 flat angles P-C4'-P energy: -128.479 tors. eta vs tors. theta energy: -228.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -2689.820611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2689.820611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2689.820611 (E_RNA) where: Base-Base interactions energy: -1868.214 where: short stacking energy: -805.661 Base-Backbone interact. energy: -2.371 local terms energy: -819.235538 where: bonds (distance) C4'-P energy: -155.359 bonds (distance) P-C4' energy: -162.009 flat angles C4'-P-C4' energy: -186.508 flat angles P-C4'-P energy: -119.065 tors. eta vs tors. theta energy: -196.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -2589.106325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2589.106325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2589.106325 (E_RNA) where: Base-Base interactions energy: -1806.870 where: short stacking energy: -769.562 Base-Backbone interact. energy: 0.522 local terms energy: -782.758090 where: bonds (distance) C4'-P energy: -146.642 bonds (distance) P-C4' energy: -154.477 flat angles C4'-P-C4' energy: -182.307 flat angles P-C4'-P energy: -125.213 tors. eta vs tors. theta energy: -174.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -2223.738947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2223.738947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2223.738947 (E_RNA) where: Base-Base interactions energy: -1467.853 where: short stacking energy: -701.282 Base-Backbone interact. energy: -3.222 local terms energy: -752.663905 where: bonds (distance) C4'-P energy: -150.536 bonds (distance) P-C4' energy: -168.562 flat angles C4'-P-C4' energy: -180.994 flat angles P-C4'-P energy: -110.295 tors. eta vs tors. theta energy: -142.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -2060.426969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2060.426969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2060.426969 (E_RNA) where: Base-Base interactions energy: -1370.251 where: short stacking energy: -616.077 Base-Backbone interact. energy: -3.440 local terms energy: -686.736014 where: bonds (distance) C4'-P energy: -138.884 bonds (distance) P-C4' energy: -167.186 flat angles C4'-P-C4' energy: -157.074 flat angles P-C4'-P energy: -104.408 tors. eta vs tors. theta energy: -119.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1643.211299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1643.211299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1643.211299 (E_RNA) where: Base-Base interactions energy: -1041.321 where: short stacking energy: -477.293 Base-Backbone interact. energy: -1.493 local terms energy: -600.397453 where: bonds (distance) C4'-P energy: -143.855 bonds (distance) P-C4' energy: -149.185 flat angles C4'-P-C4' energy: -164.824 flat angles P-C4'-P energy: -65.729 tors. eta vs tors. theta energy: -76.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1507.536572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1507.536572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1507.536572 (E_RNA) where: Base-Base interactions energy: -920.834 where: short stacking energy: -438.905 Base-Backbone interact. energy: -1.625 local terms energy: -585.077383 where: bonds (distance) C4'-P energy: -132.584 bonds (distance) P-C4' energy: -159.329 flat angles C4'-P-C4' energy: -136.130 flat angles P-C4'-P energy: -88.992 tors. eta vs tors. theta energy: -68.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -1372.698726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1372.698726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1372.698726 (E_RNA) where: Base-Base interactions energy: -813.010 where: short stacking energy: -377.115 Base-Backbone interact. energy: 1.339 local terms energy: -561.027557 where: bonds (distance) C4'-P energy: -148.053 bonds (distance) P-C4' energy: -152.272 flat angles C4'-P-C4' energy: -149.309 flat angles P-C4'-P energy: -66.072 tors. eta vs tors. theta energy: -45.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -2995.131652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2995.131652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2995.131652 (E_RNA) where: Base-Base interactions energy: -2064.853 where: short stacking energy: -898.973 Base-Backbone interact. energy: -4.965 local terms energy: -925.313719 where: bonds (distance) C4'-P energy: -179.553 bonds (distance) P-C4' energy: -175.535 flat angles C4'-P-C4' energy: -210.315 flat angles P-C4'-P energy: -141.687 tors. eta vs tors. theta energy: -218.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -2862.505827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2862.505827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2862.505827 (E_RNA) where: Base-Base interactions energy: -1965.327 where: short stacking energy: -921.498 Base-Backbone interact. energy: -1.294 local terms energy: -895.885057 where: bonds (distance) C4'-P energy: -166.318 bonds (distance) P-C4' energy: -179.976 flat angles C4'-P-C4' energy: -209.327 flat angles P-C4'-P energy: -103.481 tors. eta vs tors. theta energy: -236.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -2826.680744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2826.680744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2826.680744 (E_RNA) where: Base-Base interactions energy: -1952.154 where: short stacking energy: -872.520 Base-Backbone interact. energy: -1.037 local terms energy: -873.490026 where: bonds (distance) C4'-P energy: -174.177 bonds (distance) P-C4' energy: -176.860 flat angles C4'-P-C4' energy: -170.008 flat angles P-C4'-P energy: -122.644 tors. eta vs tors. theta energy: -229.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -2684.370890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2684.370890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2684.370890 (E_RNA) where: Base-Base interactions energy: -1841.323 where: short stacking energy: -797.515 Base-Backbone interact. energy: -1.356 local terms energy: -841.691746 where: bonds (distance) C4'-P energy: -166.166 bonds (distance) P-C4' energy: -188.289 flat angles C4'-P-C4' energy: -168.013 flat angles P-C4'-P energy: -130.907 tors. eta vs tors. theta energy: -188.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -2603.407208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2603.407208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2603.407208 (E_RNA) where: Base-Base interactions energy: -1800.488 where: short stacking energy: -790.201 Base-Backbone interact. energy: -1.979 local terms energy: -800.939802 where: bonds (distance) C4'-P energy: -150.113 bonds (distance) P-C4' energy: -151.908 flat angles C4'-P-C4' energy: -189.161 flat angles P-C4'-P energy: -132.343 tors. eta vs tors. theta energy: -177.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -2197.535748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2197.535748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2197.535748 (E_RNA) where: Base-Base interactions energy: -1453.892 where: short stacking energy: -684.638 Base-Backbone interact. energy: 6.376 local terms energy: -750.020361 where: bonds (distance) C4'-P energy: -149.102 bonds (distance) P-C4' energy: -188.362 flat angles C4'-P-C4' energy: -168.916 flat angles P-C4'-P energy: -98.390 tors. eta vs tors. theta energy: -145.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1960.923744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1960.923744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1960.923744 (E_RNA) where: Base-Base interactions energy: -1254.175 where: short stacking energy: -583.542 Base-Backbone interact. energy: 0.273 local terms energy: -707.021787 where: bonds (distance) C4'-P energy: -138.797 bonds (distance) P-C4' energy: -167.317 flat angles C4'-P-C4' energy: -163.397 flat angles P-C4'-P energy: -108.550 tors. eta vs tors. theta energy: -128.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1685.175235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1685.175235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1685.175235 (E_RNA) where: Base-Base interactions energy: -1075.221 where: short stacking energy: -536.070 Base-Backbone interact. energy: -1.856 local terms energy: -608.098103 where: bonds (distance) C4'-P energy: -143.723 bonds (distance) P-C4' energy: -155.222 flat angles C4'-P-C4' energy: -143.010 flat angles P-C4'-P energy: -84.309 tors. eta vs tors. theta energy: -81.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1632.773662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1632.773662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1632.773662 (E_RNA) where: Base-Base interactions energy: -1042.032 where: short stacking energy: -509.685 Base-Backbone interact. energy: -0.325 local terms energy: -590.415918 where: bonds (distance) C4'-P energy: -130.858 bonds (distance) P-C4' energy: -163.583 flat angles C4'-P-C4' energy: -136.424 flat angles P-C4'-P energy: -72.756 tors. eta vs tors. theta energy: -86.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -1450.095520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.095520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.095520 (E_RNA) where: Base-Base interactions energy: -907.214 where: short stacking energy: -413.951 Base-Backbone interact. energy: -1.850 local terms energy: -541.032040 where: bonds (distance) C4'-P energy: -135.172 bonds (distance) P-C4' energy: -154.710 flat angles C4'-P-C4' energy: -130.792 flat angles P-C4'-P energy: -78.377 tors. eta vs tors. theta energy: -41.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -2985.801442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2985.801442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2985.801442 (E_RNA) where: Base-Base interactions energy: -2028.366 where: short stacking energy: -900.841 Base-Backbone interact. energy: -5.539 local terms energy: -951.896354 where: bonds (distance) C4'-P energy: -183.285 bonds (distance) P-C4' energy: -195.434 flat angles C4'-P-C4' energy: -214.636 flat angles P-C4'-P energy: -123.912 tors. eta vs tors. theta energy: -234.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -2883.286449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2883.286449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2883.286449 (E_RNA) where: Base-Base interactions energy: -1959.765 where: short stacking energy: -895.315 Base-Backbone interact. energy: -5.956 local terms energy: -917.565414 where: bonds (distance) C4'-P energy: -175.978 bonds (distance) P-C4' energy: -169.438 flat angles C4'-P-C4' energy: -206.891 flat angles P-C4'-P energy: -137.101 tors. eta vs tors. theta energy: -228.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -2803.131912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2803.131912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2803.131912 (E_RNA) where: Base-Base interactions energy: -1894.787 where: short stacking energy: -843.034 Base-Backbone interact. energy: 2.845 local terms energy: -911.190297 where: bonds (distance) C4'-P energy: -189.682 bonds (distance) P-C4' energy: -171.986 flat angles C4'-P-C4' energy: -190.646 flat angles P-C4'-P energy: -134.825 tors. eta vs tors. theta energy: -224.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -2697.312212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2697.312212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2697.312212 (E_RNA) where: Base-Base interactions energy: -1851.399 where: short stacking energy: -847.050 Base-Backbone interact. energy: -1.520 local terms energy: -844.393094 where: bonds (distance) C4'-P energy: -169.297 bonds (distance) P-C4' energy: -161.188 flat angles C4'-P-C4' energy: -184.411 flat angles P-C4'-P energy: -125.657 tors. eta vs tors. theta energy: -203.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -2580.569683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2580.569683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2580.569683 (E_RNA) where: Base-Base interactions energy: -1786.341 where: short stacking energy: -728.733 Base-Backbone interact. energy: 1.360 local terms energy: -795.588401 where: bonds (distance) C4'-P energy: -161.964 bonds (distance) P-C4' energy: -155.567 flat angles C4'-P-C4' energy: -168.285 flat angles P-C4'-P energy: -137.220 tors. eta vs tors. theta energy: -172.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -2223.426453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2223.426453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2223.426453 (E_RNA) where: Base-Base interactions energy: -1453.854 where: short stacking energy: -682.199 Base-Backbone interact. energy: 1.495 local terms energy: -771.067320 where: bonds (distance) C4'-P energy: -154.153 bonds (distance) P-C4' energy: -176.040 flat angles C4'-P-C4' energy: -177.337 flat angles P-C4'-P energy: -106.848 tors. eta vs tors. theta energy: -156.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1981.554971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1981.554971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1981.554971 (E_RNA) where: Base-Base interactions energy: -1289.140 where: short stacking energy: -585.449 Base-Backbone interact. energy: -7.457 local terms energy: -684.958138 where: bonds (distance) C4'-P energy: -164.594 bonds (distance) P-C4' energy: -154.966 flat angles C4'-P-C4' energy: -145.858 flat angles P-C4'-P energy: -110.621 tors. eta vs tors. theta energy: -108.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1675.722038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.722038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.722038 (E_RNA) where: Base-Base interactions energy: -1060.610 where: short stacking energy: -508.901 Base-Backbone interact. energy: -1.281 local terms energy: -613.831083 where: bonds (distance) C4'-P energy: -149.484 bonds (distance) P-C4' energy: -149.962 flat angles C4'-P-C4' energy: -128.264 flat angles P-C4'-P energy: -86.738 tors. eta vs tors. theta energy: -99.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1651.041165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.041165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1651.041165 (E_RNA) where: Base-Base interactions energy: -1068.606 where: short stacking energy: -503.377 Base-Backbone interact. energy: -1.647 local terms energy: -580.789052 where: bonds (distance) C4'-P energy: -145.188 bonds (distance) P-C4' energy: -160.694 flat angles C4'-P-C4' energy: -133.555 flat angles P-C4'-P energy: -63.375 tors. eta vs tors. theta energy: -77.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -1475.090940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.090940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.090940 (E_RNA) where: Base-Base interactions energy: -916.356 where: short stacking energy: -437.469 Base-Backbone interact. energy: 1.085 local terms energy: -559.819923 where: bonds (distance) C4'-P energy: -123.909 bonds (distance) P-C4' energy: -157.148 flat angles C4'-P-C4' energy: -141.975 flat angles P-C4'-P energy: -90.700 tors. eta vs tors. theta energy: -46.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -3012.071498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3012.071498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3012.071498 (E_RNA) where: Base-Base interactions energy: -2047.337 where: short stacking energy: -915.172 Base-Backbone interact. energy: -6.968 local terms energy: -957.766408 where: bonds (distance) C4'-P energy: -169.728 bonds (distance) P-C4' energy: -183.395 flat angles C4'-P-C4' energy: -213.312 flat angles P-C4'-P energy: -145.017 tors. eta vs tors. theta energy: -246.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -2901.370446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2901.370446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2901.370446 (E_RNA) where: Base-Base interactions energy: -2025.469 where: short stacking energy: -893.010 Base-Backbone interact. energy: -4.507 local terms energy: -871.395047 where: bonds (distance) C4'-P energy: -170.698 bonds (distance) P-C4' energy: -182.288 flat angles C4'-P-C4' energy: -199.381 flat angles P-C4'-P energy: -107.935 tors. eta vs tors. theta energy: -211.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -2820.202969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2820.202969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2820.202969 (E_RNA) where: Base-Base interactions energy: -1942.967 where: short stacking energy: -873.322 Base-Backbone interact. energy: 8.810 local terms energy: -886.045651 where: bonds (distance) C4'-P energy: -160.486 bonds (distance) P-C4' energy: -194.043 flat angles C4'-P-C4' energy: -189.710 flat angles P-C4'-P energy: -130.199 tors. eta vs tors. theta energy: -211.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -2658.555397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2658.555397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2658.555397 (E_RNA) where: Base-Base interactions energy: -1827.562 where: short stacking energy: -802.638 Base-Backbone interact. energy: 3.159 local terms energy: -834.152291 where: bonds (distance) C4'-P energy: -142.024 bonds (distance) P-C4' energy: -180.288 flat angles C4'-P-C4' energy: -185.249 flat angles P-C4'-P energy: -131.240 tors. eta vs tors. theta energy: -195.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -2621.519242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2621.519242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2621.519242 (E_RNA) where: Base-Base interactions energy: -1773.821 where: short stacking energy: -717.004 Base-Backbone interact. energy: -3.974 local terms energy: -843.724283 where: bonds (distance) C4'-P energy: -166.549 bonds (distance) P-C4' energy: -164.051 flat angles C4'-P-C4' energy: -199.629 flat angles P-C4'-P energy: -132.038 tors. eta vs tors. theta energy: -181.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -2199.813721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.813721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2199.813721 (E_RNA) where: Base-Base interactions energy: -1457.234 where: short stacking energy: -682.376 Base-Backbone interact. energy: -4.310 local terms energy: -738.269424 where: bonds (distance) C4'-P energy: -168.611 bonds (distance) P-C4' energy: -165.727 flat angles C4'-P-C4' energy: -167.098 flat angles P-C4'-P energy: -95.019 tors. eta vs tors. theta energy: -141.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1981.047017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1981.047017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1981.047017 (E_RNA) where: Base-Base interactions energy: -1256.322 where: short stacking energy: -584.343 Base-Backbone interact. energy: -1.962 local terms energy: -722.763593 where: bonds (distance) C4'-P energy: -154.916 bonds (distance) P-C4' energy: -165.952 flat angles C4'-P-C4' energy: -183.554 flat angles P-C4'-P energy: -108.363 tors. eta vs tors. theta energy: -109.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1735.474294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.474294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.474294 (E_RNA) where: Base-Base interactions energy: -1124.715 where: short stacking energy: -552.970 Base-Backbone interact. energy: 3.461 local terms energy: -614.219940 where: bonds (distance) C4'-P energy: -150.991 bonds (distance) P-C4' energy: -139.432 flat angles C4'-P-C4' energy: -137.746 flat angles P-C4'-P energy: -98.477 tors. eta vs tors. theta energy: -87.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1659.005552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.005552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.005552 (E_RNA) where: Base-Base interactions energy: -1069.120 where: short stacking energy: -505.523 Base-Backbone interact. energy: -2.065 local terms energy: -587.820664 where: bonds (distance) C4'-P energy: -111.791 bonds (distance) P-C4' energy: -156.915 flat angles C4'-P-C4' energy: -145.522 flat angles P-C4'-P energy: -97.058 tors. eta vs tors. theta energy: -76.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -1434.172655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.172655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.172655 (E_RNA) where: Base-Base interactions energy: -870.955 where: short stacking energy: -397.694 Base-Backbone interact. energy: 1.768 local terms energy: -564.985458 where: bonds (distance) C4'-P energy: -137.440 bonds (distance) P-C4' energy: -145.977 flat angles C4'-P-C4' energy: -142.873 flat angles P-C4'-P energy: -87.403 tors. eta vs tors. theta energy: -51.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -3007.933130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3007.933130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3007.933130 (E_RNA) where: Base-Base interactions energy: -2055.489 where: short stacking energy: -880.718 Base-Backbone interact. energy: -7.930 local terms energy: -944.514527 where: bonds (distance) C4'-P energy: -179.588 bonds (distance) P-C4' energy: -187.500 flat angles C4'-P-C4' energy: -207.486 flat angles P-C4'-P energy: -135.728 tors. eta vs tors. theta energy: -234.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -2853.781590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2853.781590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2853.781590 (E_RNA) where: Base-Base interactions energy: -1963.070 where: short stacking energy: -877.432 Base-Backbone interact. energy: -4.112 local terms energy: -886.599702 where: bonds (distance) C4'-P energy: -182.272 bonds (distance) P-C4' energy: -177.583 flat angles C4'-P-C4' energy: -202.722 flat angles P-C4'-P energy: -118.253 tors. eta vs tors. theta energy: -205.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -2810.521345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2810.521345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2810.521345 (E_RNA) where: Base-Base interactions energy: -1930.247 where: short stacking energy: -890.677 Base-Backbone interact. energy: 11.911 local terms energy: -892.185699 where: bonds (distance) C4'-P energy: -163.252 bonds (distance) P-C4' energy: -151.845 flat angles C4'-P-C4' energy: -200.904 flat angles P-C4'-P energy: -132.024 tors. eta vs tors. theta energy: -244.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -2629.785111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2629.785111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2629.785111 (E_RNA) where: Base-Base interactions energy: -1789.740 where: short stacking energy: -789.248 Base-Backbone interact. energy: -5.298 local terms energy: -834.747512 where: bonds (distance) C4'-P energy: -152.837 bonds (distance) P-C4' energy: -174.862 flat angles C4'-P-C4' energy: -196.393 flat angles P-C4'-P energy: -126.202 tors. eta vs tors. theta energy: -184.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -2591.660268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2591.660268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2591.660268 (E_RNA) where: Base-Base interactions energy: -1814.735 where: short stacking energy: -755.716 Base-Backbone interact. energy: 7.641 local terms energy: -784.565994 where: bonds (distance) C4'-P energy: -162.530 bonds (distance) P-C4' energy: -165.090 flat angles C4'-P-C4' energy: -170.948 flat angles P-C4'-P energy: -123.052 tors. eta vs tors. theta energy: -162.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -2195.991093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2195.991093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2195.991093 (E_RNA) where: Base-Base interactions energy: -1466.461 where: short stacking energy: -670.721 Base-Backbone interact. energy: -1.641 local terms energy: -727.889140 where: bonds (distance) C4'-P energy: -161.824 bonds (distance) P-C4' energy: -130.904 flat angles C4'-P-C4' energy: -169.398 flat angles P-C4'-P energy: -101.495 tors. eta vs tors. theta energy: -164.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1996.280706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1996.280706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1996.280706 (E_RNA) where: Base-Base interactions energy: -1315.029 where: short stacking energy: -611.484 Base-Backbone interact. energy: -0.931 local terms energy: -680.321308 where: bonds (distance) C4'-P energy: -143.786 bonds (distance) P-C4' energy: -148.386 flat angles C4'-P-C4' energy: -163.167 flat angles P-C4'-P energy: -99.312 tors. eta vs tors. theta energy: -125.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1694.230589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1694.230589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1694.230589 (E_RNA) where: Base-Base interactions energy: -1064.472 where: short stacking energy: -535.664 Base-Backbone interact. energy: 4.762 local terms energy: -634.519816 where: bonds (distance) C4'-P energy: -153.509 bonds (distance) P-C4' energy: -152.586 flat angles C4'-P-C4' energy: -154.702 flat angles P-C4'-P energy: -86.799 tors. eta vs tors. theta energy: -86.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1634.031096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.031096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.031096 (E_RNA) where: Base-Base interactions energy: -1001.813 where: short stacking energy: -476.215 Base-Backbone interact. energy: -2.058 local terms energy: -630.160004 where: bonds (distance) C4'-P energy: -159.977 bonds (distance) P-C4' energy: -169.275 flat angles C4'-P-C4' energy: -143.919 flat angles P-C4'-P energy: -79.755 tors. eta vs tors. theta energy: -77.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -1494.135978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.135978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.135978 (E_RNA) where: Base-Base interactions energy: -936.312 where: short stacking energy: -427.336 Base-Backbone interact. energy: 0.897 local terms energy: -558.721078 where: bonds (distance) C4'-P energy: -149.782 bonds (distance) P-C4' energy: -146.748 flat angles C4'-P-C4' energy: -130.645 flat angles P-C4'-P energy: -73.301 tors. eta vs tors. theta energy: -58.245 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -3011.547226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3011.547226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3011.547226 (E_RNA) where: Base-Base interactions energy: -2092.155 where: short stacking energy: -910.981 Base-Backbone interact. energy: -6.946 local terms energy: -912.446587 where: bonds (distance) C4'-P energy: -172.724 bonds (distance) P-C4' energy: -174.056 flat angles C4'-P-C4' energy: -199.005 flat angles P-C4'-P energy: -138.255 tors. eta vs tors. theta energy: -228.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -2894.793829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2894.793829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2894.793829 (E_RNA) where: Base-Base interactions energy: -1970.360 where: short stacking energy: -870.684 Base-Backbone interact. energy: -1.540 local terms energy: -922.893325 where: bonds (distance) C4'-P energy: -180.257 bonds (distance) P-C4' energy: -184.947 flat angles C4'-P-C4' energy: -190.879 flat angles P-C4'-P energy: -133.766 tors. eta vs tors. theta energy: -233.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -2792.262949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2792.262949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2792.262949 (E_RNA) where: Base-Base interactions energy: -1891.242 where: short stacking energy: -815.597 Base-Backbone interact. energy: -1.437 local terms energy: -899.583772 where: bonds (distance) C4'-P energy: -160.213 bonds (distance) P-C4' energy: -185.343 flat angles C4'-P-C4' energy: -199.592 flat angles P-C4'-P energy: -137.967 tors. eta vs tors. theta energy: -216.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -2634.266698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2634.266698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2634.266698 (E_RNA) where: Base-Base interactions energy: -1806.265 where: short stacking energy: -760.394 Base-Backbone interact. energy: 0.434 local terms energy: -828.436112 where: bonds (distance) C4'-P energy: -162.534 bonds (distance) P-C4' energy: -164.512 flat angles C4'-P-C4' energy: -199.667 flat angles P-C4'-P energy: -123.118 tors. eta vs tors. theta energy: -178.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -2568.876280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2568.876280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2568.876280 (E_RNA) where: Base-Base interactions energy: -1772.149 where: short stacking energy: -757.487 Base-Backbone interact. energy: 0.651 local terms energy: -797.378158 where: bonds (distance) C4'-P energy: -144.750 bonds (distance) P-C4' energy: -167.002 flat angles C4'-P-C4' energy: -203.315 flat angles P-C4'-P energy: -102.634 tors. eta vs tors. theta energy: -179.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -2181.857191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2181.857191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2181.857191 (E_RNA) where: Base-Base interactions energy: -1487.826 where: short stacking energy: -659.627 Base-Backbone interact. energy: 6.128 local terms energy: -700.158337 where: bonds (distance) C4'-P energy: -158.875 bonds (distance) P-C4' energy: -163.337 flat angles C4'-P-C4' energy: -157.830 flat angles P-C4'-P energy: -89.466 tors. eta vs tors. theta energy: -130.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1935.152639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1935.152639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1935.152639 (E_RNA) where: Base-Base interactions energy: -1274.916 where: short stacking energy: -609.149 Base-Backbone interact. energy: -1.950 local terms energy: -658.286492 where: bonds (distance) C4'-P energy: -156.202 bonds (distance) P-C4' energy: -153.091 flat angles C4'-P-C4' energy: -152.442 flat angles P-C4'-P energy: -97.196 tors. eta vs tors. theta energy: -99.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1666.622955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1666.622955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1666.622955 (E_RNA) where: Base-Base interactions energy: -1064.781 where: short stacking energy: -491.291 Base-Backbone interact. energy: 9.748 local terms energy: -611.589322 where: bonds (distance) C4'-P energy: -146.843 bonds (distance) P-C4' energy: -151.876 flat angles C4'-P-C4' energy: -157.687 flat angles P-C4'-P energy: -84.937 tors. eta vs tors. theta energy: -70.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1593.853082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.853082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.853082 (E_RNA) where: Base-Base interactions energy: -984.361 where: short stacking energy: -430.580 Base-Backbone interact. energy: -2.382 local terms energy: -607.109993 where: bonds (distance) C4'-P energy: -143.172 bonds (distance) P-C4' energy: -138.575 flat angles C4'-P-C4' energy: -164.245 flat angles P-C4'-P energy: -97.763 tors. eta vs tors. theta energy: -63.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -1520.789642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.789642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.789642 (E_RNA) where: Base-Base interactions energy: -959.951 where: short stacking energy: -472.053 Base-Backbone interact. energy: 1.239 local terms energy: -562.077977 where: bonds (distance) C4'-P energy: -129.633 bonds (distance) P-C4' energy: -145.320 flat angles C4'-P-C4' energy: -153.504 flat angles P-C4'-P energy: -65.686 tors. eta vs tors. theta energy: -67.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -3017.055630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3017.055630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3017.055630 (E_RNA) where: Base-Base interactions energy: -2072.615 where: short stacking energy: -907.492 Base-Backbone interact. energy: -3.625 local terms energy: -940.815680 where: bonds (distance) C4'-P energy: -177.172 bonds (distance) P-C4' energy: -179.480 flat angles C4'-P-C4' energy: -202.665 flat angles P-C4'-P energy: -151.403 tors. eta vs tors. theta energy: -230.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -2923.375304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2923.375304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2923.375304 (E_RNA) where: Base-Base interactions energy: -2023.339 where: short stacking energy: -892.704 Base-Backbone interact. energy: 2.038 local terms energy: -902.075054 where: bonds (distance) C4'-P energy: -194.375 bonds (distance) P-C4' energy: -177.614 flat angles C4'-P-C4' energy: -186.456 flat angles P-C4'-P energy: -132.210 tors. eta vs tors. theta energy: -211.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -2790.121843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2790.121843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2790.121843 (E_RNA) where: Base-Base interactions energy: -1949.806 where: short stacking energy: -861.680 Base-Backbone interact. energy: 1.504 local terms energy: -841.820321 where: bonds (distance) C4'-P energy: -146.063 bonds (distance) P-C4' energy: -165.284 flat angles C4'-P-C4' energy: -176.074 flat angles P-C4'-P energy: -132.765 tors. eta vs tors. theta energy: -221.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -2604.276776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2604.276776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2604.276776 (E_RNA) where: Base-Base interactions energy: -1763.934 where: short stacking energy: -789.347 Base-Backbone interact. energy: -0.054 local terms energy: -840.288075 where: bonds (distance) C4'-P energy: -159.045 bonds (distance) P-C4' energy: -179.465 flat angles C4'-P-C4' energy: -180.961 flat angles P-C4'-P energy: -122.857 tors. eta vs tors. theta energy: -197.960 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -2631.158747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2631.158747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2631.158747 (E_RNA) where: Base-Base interactions energy: -1834.378 where: short stacking energy: -799.085 Base-Backbone interact. energy: 2.902 local terms energy: -799.682781 where: bonds (distance) C4'-P energy: -149.186 bonds (distance) P-C4' energy: -156.043 flat angles C4'-P-C4' energy: -185.956 flat angles P-C4'-P energy: -120.238 tors. eta vs tors. theta energy: -188.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -2156.026447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2156.026447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2156.026447 (E_RNA) where: Base-Base interactions energy: -1457.059 where: short stacking energy: -671.382 Base-Backbone interact. energy: -7.157 local terms energy: -691.810680 where: bonds (distance) C4'-P energy: -142.575 bonds (distance) P-C4' energy: -134.888 flat angles C4'-P-C4' energy: -190.558 flat angles P-C4'-P energy: -93.448 tors. eta vs tors. theta energy: -130.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1986.431537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1986.431537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1986.431537 (E_RNA) where: Base-Base interactions energy: -1289.255 where: short stacking energy: -594.955 Base-Backbone interact. energy: 5.618 local terms energy: -702.794513 where: bonds (distance) C4'-P energy: -161.924 bonds (distance) P-C4' energy: -153.548 flat angles C4'-P-C4' energy: -159.783 flat angles P-C4'-P energy: -109.102 tors. eta vs tors. theta energy: -118.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1700.744693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.744693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.744693 (E_RNA) where: Base-Base interactions energy: -1096.252 where: short stacking energy: -514.331 Base-Backbone interact. energy: 0.683 local terms energy: -605.175532 where: bonds (distance) C4'-P energy: -144.577 bonds (distance) P-C4' energy: -163.541 flat angles C4'-P-C4' energy: -154.113 flat angles P-C4'-P energy: -79.082 tors. eta vs tors. theta energy: -63.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1646.622501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1646.622501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1646.622501 (E_RNA) where: Base-Base interactions energy: -1065.198 where: short stacking energy: -456.832 Base-Backbone interact. energy: 9.769 local terms energy: -591.193307 where: bonds (distance) C4'-P energy: -144.985 bonds (distance) P-C4' energy: -149.346 flat angles C4'-P-C4' energy: -125.152 flat angles P-C4'-P energy: -78.826 tors. eta vs tors. theta energy: -92.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -1478.046162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.046162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.046162 (E_RNA) where: Base-Base interactions energy: -955.315 where: short stacking energy: -449.351 Base-Backbone interact. energy: -0.559 local terms energy: -522.172271 where: bonds (distance) C4'-P energy: -112.482 bonds (distance) P-C4' energy: -138.161 flat angles C4'-P-C4' energy: -127.663 flat angles P-C4'-P energy: -90.940 tors. eta vs tors. theta energy: -52.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -3001.678015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3001.678015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3001.678015 (E_RNA) where: Base-Base interactions energy: -2066.903 where: short stacking energy: -915.562 Base-Backbone interact. energy: -6.430 local terms energy: -928.344294 where: bonds (distance) C4'-P energy: -168.108 bonds (distance) P-C4' energy: -181.920 flat angles C4'-P-C4' energy: -194.863 flat angles P-C4'-P energy: -139.336 tors. eta vs tors. theta energy: -244.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -2871.650880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2871.650880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2871.650880 (E_RNA) where: Base-Base interactions energy: -1927.065 where: short stacking energy: -913.737 Base-Backbone interact. energy: -3.151 local terms energy: -941.435695 where: bonds (distance) C4'-P energy: -193.751 bonds (distance) P-C4' energy: -179.004 flat angles C4'-P-C4' energy: -203.397 flat angles P-C4'-P energy: -125.222 tors. eta vs tors. theta energy: -240.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -2818.864120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2818.864120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2818.864120 (E_RNA) where: Base-Base interactions energy: -1943.334 where: short stacking energy: -873.626 Base-Backbone interact. energy: -3.731 local terms energy: -871.799451 where: bonds (distance) C4'-P energy: -163.539 bonds (distance) P-C4' energy: -180.654 flat angles C4'-P-C4' energy: -197.949 flat angles P-C4'-P energy: -112.137 tors. eta vs tors. theta energy: -217.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -2630.522069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2630.522069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2630.522069 (E_RNA) where: Base-Base interactions energy: -1829.396 where: short stacking energy: -799.162 Base-Backbone interact. energy: -2.711 local terms energy: -798.415302 where: bonds (distance) C4'-P energy: -143.496 bonds (distance) P-C4' energy: -153.553 flat angles C4'-P-C4' energy: -192.672 flat angles P-C4'-P energy: -115.897 tors. eta vs tors. theta energy: -192.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -2616.160046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2616.160046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2616.160046 (E_RNA) where: Base-Base interactions energy: -1786.264 where: short stacking energy: -788.755 Base-Backbone interact. energy: 0.692 local terms energy: -830.587739 where: bonds (distance) C4'-P energy: -160.169 bonds (distance) P-C4' energy: -170.818 flat angles C4'-P-C4' energy: -171.409 flat angles P-C4'-P energy: -125.134 tors. eta vs tors. theta energy: -203.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -2249.110142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2249.110142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2249.110142 (E_RNA) where: Base-Base interactions energy: -1458.165 where: short stacking energy: -688.799 Base-Backbone interact. energy: 3.381 local terms energy: -794.325889 where: bonds (distance) C4'-P energy: -171.188 bonds (distance) P-C4' energy: -160.877 flat angles C4'-P-C4' energy: -190.532 flat angles P-C4'-P energy: -116.616 tors. eta vs tors. theta energy: -155.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -2062.376140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2062.376140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2062.376140 (E_RNA) where: Base-Base interactions energy: -1345.456 where: short stacking energy: -636.631 Base-Backbone interact. energy: 2.288 local terms energy: -719.208234 where: bonds (distance) C4'-P energy: -140.659 bonds (distance) P-C4' energy: -156.322 flat angles C4'-P-C4' energy: -181.979 flat angles P-C4'-P energy: -119.713 tors. eta vs tors. theta energy: -120.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1738.153348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1738.153348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.153348 (E_RNA) where: Base-Base interactions energy: -1121.196 where: short stacking energy: -509.343 Base-Backbone interact. energy: 0.905 local terms energy: -617.862867 where: bonds (distance) C4'-P energy: -146.142 bonds (distance) P-C4' energy: -150.092 flat angles C4'-P-C4' energy: -159.301 flat angles P-C4'-P energy: -79.638 tors. eta vs tors. theta energy: -82.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -1560.989532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.989532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.989532 (E_RNA) where: Base-Base interactions energy: -1014.422 where: short stacking energy: -461.929 Base-Backbone interact. energy: 2.801 local terms energy: -549.368514 where: bonds (distance) C4'-P energy: -131.784 bonds (distance) P-C4' energy: -138.439 flat angles C4'-P-C4' energy: -160.088 flat angles P-C4'-P energy: -67.660 tors. eta vs tors. theta energy: -51.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -1467.859191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.859191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.859191 (E_RNA) where: Base-Base interactions energy: -936.642 where: short stacking energy: -453.338 Base-Backbone interact. energy: 0.195 local terms energy: -531.412203 where: bonds (distance) C4'-P energy: -138.596 bonds (distance) P-C4' energy: -149.428 flat angles C4'-P-C4' energy: -128.167 flat angles P-C4'-P energy: -77.806 tors. eta vs tors. theta energy: -37.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -3025.362886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3025.362886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3025.362886 (E_RNA) where: Base-Base interactions energy: -2078.405 where: short stacking energy: -916.843 Base-Backbone interact. energy: -7.222 local terms energy: -939.735510 where: bonds (distance) C4'-P energy: -182.543 bonds (distance) P-C4' energy: -194.074 flat angles C4'-P-C4' energy: -194.750 flat angles P-C4'-P energy: -118.014 tors. eta vs tors. theta energy: -250.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -2860.605131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2860.605131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2860.605131 (E_RNA) where: Base-Base interactions energy: -1954.414 where: short stacking energy: -859.626 Base-Backbone interact. energy: -4.585 local terms energy: -901.606432 where: bonds (distance) C4'-P energy: -178.543 bonds (distance) P-C4' energy: -183.436 flat angles C4'-P-C4' energy: -194.276 flat angles P-C4'-P energy: -133.113 tors. eta vs tors. theta energy: -212.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -2765.857020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2765.857020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2765.857020 (E_RNA) where: Base-Base interactions energy: -1894.408 where: short stacking energy: -831.386 Base-Backbone interact. energy: -0.315 local terms energy: -871.134318 where: bonds (distance) C4'-P energy: -177.758 bonds (distance) P-C4' energy: -178.263 flat angles C4'-P-C4' energy: -189.291 flat angles P-C4'-P energy: -111.730 tors. eta vs tors. theta energy: -214.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -2667.245436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2667.245436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2667.245436 (E_RNA) where: Base-Base interactions energy: -1809.798 where: short stacking energy: -841.562 Base-Backbone interact. energy: -3.027 local terms energy: -854.420441 where: bonds (distance) C4'-P energy: -161.798 bonds (distance) P-C4' energy: -185.571 flat angles C4'-P-C4' energy: -191.878 flat angles P-C4'-P energy: -111.929 tors. eta vs tors. theta energy: -203.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -2613.913016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2613.913016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2613.913016 (E_RNA) where: Base-Base interactions energy: -1781.619 where: short stacking energy: -784.645 Base-Backbone interact. energy: -1.970 local terms energy: -830.323949 where: bonds (distance) C4'-P energy: -168.679 bonds (distance) P-C4' energy: -175.056 flat angles C4'-P-C4' energy: -175.569 flat angles P-C4'-P energy: -118.920 tors. eta vs tors. theta energy: -192.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -2191.559684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2191.559684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2191.559684 (E_RNA) where: Base-Base interactions energy: -1493.707 where: short stacking energy: -700.589 Base-Backbone interact. energy: 6.537 local terms energy: -704.389219 where: bonds (distance) C4'-P energy: -130.842 bonds (distance) P-C4' energy: -182.158 flat angles C4'-P-C4' energy: -175.816 flat angles P-C4'-P energy: -85.028 tors. eta vs tors. theta energy: -130.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -2074.039160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2074.039160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2074.039160 (E_RNA) where: Base-Base interactions energy: -1371.465 where: short stacking energy: -638.440 Base-Backbone interact. energy: -3.352 local terms energy: -699.222199 where: bonds (distance) C4'-P energy: -144.170 bonds (distance) P-C4' energy: -153.344 flat angles C4'-P-C4' energy: -175.774 flat angles P-C4'-P energy: -91.379 tors. eta vs tors. theta energy: -134.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1776.494064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.494064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.494064 (E_RNA) where: Base-Base interactions energy: -1136.490 where: short stacking energy: -560.113 Base-Backbone interact. energy: 0.482 local terms energy: -640.485875 where: bonds (distance) C4'-P energy: -155.851 bonds (distance) P-C4' energy: -145.007 flat angles C4'-P-C4' energy: -133.526 flat angles P-C4'-P energy: -108.877 tors. eta vs tors. theta energy: -97.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -1592.719557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.719557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.719557 (E_RNA) where: Base-Base interactions energy: -1019.003 where: short stacking energy: -482.093 Base-Backbone interact. energy: -1.259 local terms energy: -572.456985 where: bonds (distance) C4'-P energy: -117.273 bonds (distance) P-C4' energy: -142.590 flat angles C4'-P-C4' energy: -147.674 flat angles P-C4'-P energy: -97.689 tors. eta vs tors. theta energy: -67.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -1502.048603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.048603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1502.048603 (E_RNA) where: Base-Base interactions energy: -947.865 where: short stacking energy: -444.834 Base-Backbone interact. energy: 3.729 local terms energy: -557.912709 where: bonds (distance) C4'-P energy: -136.442 bonds (distance) P-C4' energy: -144.013 flat angles C4'-P-C4' energy: -126.119 flat angles P-C4'-P energy: -102.117 tors. eta vs tors. theta energy: -49.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -3017.220582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3017.220582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3017.220582 (E_RNA) where: Base-Base interactions energy: -2069.164 where: short stacking energy: -917.205 Base-Backbone interact. energy: -6.015 local terms energy: -942.041727 where: bonds (distance) C4'-P energy: -180.484 bonds (distance) P-C4' energy: -187.754 flat angles C4'-P-C4' energy: -196.775 flat angles P-C4'-P energy: -135.579 tors. eta vs tors. theta energy: -241.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -2865.276693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2865.276693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2865.276693 (E_RNA) where: Base-Base interactions energy: -1968.771 where: short stacking energy: -896.700 Base-Backbone interact. energy: -4.854 local terms energy: -891.651579 where: bonds (distance) C4'-P energy: -156.170 bonds (distance) P-C4' energy: -170.625 flat angles C4'-P-C4' energy: -215.004 flat angles P-C4'-P energy: -123.039 tors. eta vs tors. theta energy: -226.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -2808.723389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2808.723389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2808.723389 (E_RNA) where: Base-Base interactions energy: -1934.607 where: short stacking energy: -869.583 Base-Backbone interact. energy: -1.068 local terms energy: -873.047880 where: bonds (distance) C4'-P energy: -152.909 bonds (distance) P-C4' energy: -185.499 flat angles C4'-P-C4' energy: -201.568 flat angles P-C4'-P energy: -128.021 tors. eta vs tors. theta energy: -205.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -2647.820411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2647.820411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2647.820411 (E_RNA) where: Base-Base interactions energy: -1805.924 where: short stacking energy: -822.936 Base-Backbone interact. energy: -5.557 local terms energy: -836.339059 where: bonds (distance) C4'-P energy: -165.130 bonds (distance) P-C4' energy: -171.945 flat angles C4'-P-C4' energy: -182.480 flat angles P-C4'-P energy: -120.510 tors. eta vs tors. theta energy: -196.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -2612.963052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2612.963052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2612.963052 (E_RNA) where: Base-Base interactions energy: -1784.374 where: short stacking energy: -770.313 Base-Backbone interact. energy: 0.525 local terms energy: -829.113617 where: bonds (distance) C4'-P energy: -150.490 bonds (distance) P-C4' energy: -168.046 flat angles C4'-P-C4' energy: -198.006 flat angles P-C4'-P energy: -138.032 tors. eta vs tors. theta energy: -174.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -2203.623268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2203.623268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2203.623268 (E_RNA) where: Base-Base interactions energy: -1465.983 where: short stacking energy: -679.432 Base-Backbone interact. energy: -0.955 local terms energy: -736.685805 where: bonds (distance) C4'-P energy: -159.505 bonds (distance) P-C4' energy: -162.824 flat angles C4'-P-C4' energy: -163.680 flat angles P-C4'-P energy: -101.820 tors. eta vs tors. theta energy: -148.857 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -2055.150181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.150181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.150181 (E_RNA) where: Base-Base interactions energy: -1342.172 where: short stacking energy: -629.837 Base-Backbone interact. energy: -3.423 local terms energy: -709.555837 where: bonds (distance) C4'-P energy: -152.126 bonds (distance) P-C4' energy: -128.879 flat angles C4'-P-C4' energy: -172.930 flat angles P-C4'-P energy: -119.226 tors. eta vs tors. theta energy: -136.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1806.310896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.310896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.310896 (E_RNA) where: Base-Base interactions energy: -1152.527 where: short stacking energy: -543.625 Base-Backbone interact. energy: -1.467 local terms energy: -652.316797 where: bonds (distance) C4'-P energy: -132.804 bonds (distance) P-C4' energy: -161.649 flat angles C4'-P-C4' energy: -132.241 flat angles P-C4'-P energy: -120.101 tors. eta vs tors. theta energy: -105.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -1435.239282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.239282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.239282 (E_RNA) where: Base-Base interactions energy: -899.845 where: short stacking energy: -453.485 Base-Backbone interact. energy: -1.874 local terms energy: -533.520032 where: bonds (distance) C4'-P energy: -128.695 bonds (distance) P-C4' energy: -153.075 flat angles C4'-P-C4' energy: -128.218 flat angles P-C4'-P energy: -70.228 tors. eta vs tors. theta energy: -53.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -1505.044534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1505.044534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1505.044534 (E_RNA) where: Base-Base interactions energy: -999.740 where: short stacking energy: -422.568 Base-Backbone interact. energy: -2.807 local terms energy: -502.497992 where: bonds (distance) C4'-P energy: -124.949 bonds (distance) P-C4' energy: -147.611 flat angles C4'-P-C4' energy: -134.384 flat angles P-C4'-P energy: -61.601 tors. eta vs tors. theta energy: -33.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -3051.320171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3051.320171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3051.320171 (E_RNA) where: Base-Base interactions energy: -2079.617 where: short stacking energy: -922.801 Base-Backbone interact. energy: -2.527 local terms energy: -969.176319 where: bonds (distance) C4'-P energy: -179.049 bonds (distance) P-C4' energy: -196.340 flat angles C4'-P-C4' energy: -202.359 flat angles P-C4'-P energy: -141.530 tors. eta vs tors. theta energy: -249.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -2869.504349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2869.504349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2869.504349 (E_RNA) where: Base-Base interactions energy: -1936.676 where: short stacking energy: -860.270 Base-Backbone interact. energy: -3.594 local terms energy: -929.234123 where: bonds (distance) C4'-P energy: -187.158 bonds (distance) P-C4' energy: -186.557 flat angles C4'-P-C4' energy: -209.990 flat angles P-C4'-P energy: -116.770 tors. eta vs tors. theta energy: -228.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -2790.369308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2790.369308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2790.369308 (E_RNA) where: Base-Base interactions energy: -1895.773 where: short stacking energy: -843.926 Base-Backbone interact. energy: -3.117 local terms energy: -891.479546 where: bonds (distance) C4'-P energy: -177.706 bonds (distance) P-C4' energy: -183.296 flat angles C4'-P-C4' energy: -196.581 flat angles P-C4'-P energy: -117.311 tors. eta vs tors. theta energy: -216.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -2708.967688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2708.967688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2708.967688 (E_RNA) where: Base-Base interactions energy: -1840.888 where: short stacking energy: -852.405 Base-Backbone interact. energy: -3.016 local terms energy: -865.063577 where: bonds (distance) C4'-P energy: -158.239 bonds (distance) P-C4' energy: -173.696 flat angles C4'-P-C4' energy: -184.001 flat angles P-C4'-P energy: -127.853 tors. eta vs tors. theta energy: -221.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -2630.969524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2630.969524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2630.969524 (E_RNA) where: Base-Base interactions energy: -1818.564 where: short stacking energy: -766.447 Base-Backbone interact. energy: -1.912 local terms energy: -810.494099 where: bonds (distance) C4'-P energy: -155.807 bonds (distance) P-C4' energy: -167.470 flat angles C4'-P-C4' energy: -179.313 flat angles P-C4'-P energy: -122.030 tors. eta vs tors. theta energy: -185.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -2101.123485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.123485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.123485 (E_RNA) where: Base-Base interactions energy: -1332.367 where: short stacking energy: -641.120 Base-Backbone interact. energy: -0.798 local terms energy: -767.957929 where: bonds (distance) C4'-P energy: -171.675 bonds (distance) P-C4' energy: -183.392 flat angles C4'-P-C4' energy: -180.712 flat angles P-C4'-P energy: -97.529 tors. eta vs tors. theta energy: -134.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -2066.609973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2066.609973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2066.609973 (E_RNA) where: Base-Base interactions energy: -1390.415 where: short stacking energy: -642.197 Base-Backbone interact. energy: 0.174 local terms energy: -676.369331 where: bonds (distance) C4'-P energy: -140.230 bonds (distance) P-C4' energy: -130.227 flat angles C4'-P-C4' energy: -154.072 flat angles P-C4'-P energy: -106.564 tors. eta vs tors. theta energy: -145.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1806.114045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.114045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.114045 (E_RNA) where: Base-Base interactions energy: -1108.266 where: short stacking energy: -524.681 Base-Backbone interact. energy: -3.010 local terms energy: -694.837424 where: bonds (distance) C4'-P energy: -147.221 bonds (distance) P-C4' energy: -176.486 flat angles C4'-P-C4' energy: -159.018 flat angles P-C4'-P energy: -108.401 tors. eta vs tors. theta energy: -103.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -1564.603074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.603074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.603074 (E_RNA) where: Base-Base interactions energy: -985.402 where: short stacking energy: -470.644 Base-Backbone interact. energy: 3.231 local terms energy: -582.431827 where: bonds (distance) C4'-P energy: -138.603 bonds (distance) P-C4' energy: -160.523 flat angles C4'-P-C4' energy: -131.359 flat angles P-C4'-P energy: -80.545 tors. eta vs tors. theta energy: -71.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -1392.469221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1392.469221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1392.469221 (E_RNA) where: Base-Base interactions energy: -818.512 where: short stacking energy: -384.601 Base-Backbone interact. energy: 4.338 local terms energy: -578.294507 where: bonds (distance) C4'-P energy: -151.813 bonds (distance) P-C4' energy: -157.694 flat angles C4'-P-C4' energy: -143.951 flat angles P-C4'-P energy: -84.493 tors. eta vs tors. theta energy: -40.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -3037.184395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3037.184395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3037.184395 (E_RNA) where: Base-Base interactions energy: -2079.009 where: short stacking energy: -896.619 Base-Backbone interact. energy: -4.703 local terms energy: -953.472242 where: bonds (distance) C4'-P energy: -177.066 bonds (distance) P-C4' energy: -191.551 flat angles C4'-P-C4' energy: -216.224 flat angles P-C4'-P energy: -132.676 tors. eta vs tors. theta energy: -235.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -2883.338419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2883.338419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2883.338419 (E_RNA) where: Base-Base interactions energy: -1961.565 where: short stacking energy: -893.336 Base-Backbone interact. energy: 2.499 local terms energy: -924.272731 where: bonds (distance) C4'-P energy: -171.547 bonds (distance) P-C4' energy: -184.011 flat angles C4'-P-C4' energy: -209.835 flat angles P-C4'-P energy: -128.233 tors. eta vs tors. theta energy: -230.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -2826.671715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2826.671715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2826.671715 (E_RNA) where: Base-Base interactions energy: -1947.392 where: short stacking energy: -874.739 Base-Backbone interact. energy: -2.549 local terms energy: -876.731308 where: bonds (distance) C4'-P energy: -168.699 bonds (distance) P-C4' energy: -182.772 flat angles C4'-P-C4' energy: -192.288 flat angles P-C4'-P energy: -113.475 tors. eta vs tors. theta energy: -219.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -2710.849153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2710.849153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2710.849153 (E_RNA) where: Base-Base interactions energy: -1873.480 where: short stacking energy: -845.600 Base-Backbone interact. energy: 4.683 local terms energy: -842.052054 where: bonds (distance) C4'-P energy: -153.290 bonds (distance) P-C4' energy: -162.563 flat angles C4'-P-C4' energy: -197.260 flat angles P-C4'-P energy: -120.738 tors. eta vs tors. theta energy: -208.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -2648.745949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2648.745949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2648.745949 (E_RNA) where: Base-Base interactions energy: -1838.782 where: short stacking energy: -809.941 Base-Backbone interact. energy: -1.356 local terms energy: -808.608072 where: bonds (distance) C4'-P energy: -160.148 bonds (distance) P-C4' energy: -168.680 flat angles C4'-P-C4' energy: -180.713 flat angles P-C4'-P energy: -108.395 tors. eta vs tors. theta energy: -190.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -2222.638731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2222.638731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2222.638731 (E_RNA) where: Base-Base interactions energy: -1496.519 where: short stacking energy: -685.932 Base-Backbone interact. energy: -1.350 local terms energy: -724.769204 where: bonds (distance) C4'-P energy: -145.073 bonds (distance) P-C4' energy: -165.878 flat angles C4'-P-C4' energy: -154.707 flat angles P-C4'-P energy: -105.482 tors. eta vs tors. theta energy: -153.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -2089.312404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.312404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.312404 (E_RNA) where: Base-Base interactions energy: -1378.230 where: short stacking energy: -644.831 Base-Backbone interact. energy: 1.455 local terms energy: -712.537059 where: bonds (distance) C4'-P energy: -147.375 bonds (distance) P-C4' energy: -158.378 flat angles C4'-P-C4' energy: -173.206 flat angles P-C4'-P energy: -100.103 tors. eta vs tors. theta energy: -133.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1788.991837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1788.991837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1788.991837 (E_RNA) where: Base-Base interactions energy: -1150.100 where: short stacking energy: -525.812 Base-Backbone interact. energy: 0.581 local terms energy: -639.472547 where: bonds (distance) C4'-P energy: -154.350 bonds (distance) P-C4' energy: -159.315 flat angles C4'-P-C4' energy: -162.249 flat angles P-C4'-P energy: -76.704 tors. eta vs tors. theta energy: -86.853 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -1720.015455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1720.015455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1720.015455 (E_RNA) where: Base-Base interactions energy: -1075.514 where: short stacking energy: -521.159 Base-Backbone interact. energy: 1.145 local terms energy: -645.646506 where: bonds (distance) C4'-P energy: -158.705 bonds (distance) P-C4' energy: -165.870 flat angles C4'-P-C4' energy: -146.891 flat angles P-C4'-P energy: -89.572 tors. eta vs tors. theta energy: -84.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -1401.946802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.946802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.946802 (E_RNA) where: Base-Base interactions energy: -828.265 where: short stacking energy: -425.375 Base-Backbone interact. energy: -1.985 local terms energy: -571.696336 where: bonds (distance) C4'-P energy: -140.692 bonds (distance) P-C4' energy: -157.631 flat angles C4'-P-C4' energy: -127.884 flat angles P-C4'-P energy: -101.596 tors. eta vs tors. theta energy: -43.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -3036.667255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3036.667255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3036.667255 (E_RNA) where: Base-Base interactions energy: -2073.484 where: short stacking energy: -902.301 Base-Backbone interact. energy: 0.023 local terms energy: -963.205529 where: bonds (distance) C4'-P energy: -201.629 bonds (distance) P-C4' energy: -191.132 flat angles C4'-P-C4' energy: -199.526 flat angles P-C4'-P energy: -137.189 tors. eta vs tors. theta energy: -233.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -2893.300226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2893.300226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2893.300226 (E_RNA) where: Base-Base interactions energy: -1974.772 where: short stacking energy: -870.607 Base-Backbone interact. energy: -0.914 local terms energy: -917.614002 where: bonds (distance) C4'-P energy: -188.080 bonds (distance) P-C4' energy: -191.517 flat angles C4'-P-C4' energy: -198.373 flat angles P-C4'-P energy: -111.461 tors. eta vs tors. theta energy: -228.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -2809.903734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2809.903734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2809.903734 (E_RNA) where: Base-Base interactions energy: -1941.210 where: short stacking energy: -842.449 Base-Backbone interact. energy: -5.584 local terms energy: -863.109989 where: bonds (distance) C4'-P energy: -154.225 bonds (distance) P-C4' energy: -185.163 flat angles C4'-P-C4' energy: -193.897 flat angles P-C4'-P energy: -114.748 tors. eta vs tors. theta energy: -215.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -2708.188929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2708.188929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2708.188929 (E_RNA) where: Base-Base interactions energy: -1834.974 where: short stacking energy: -797.425 Base-Backbone interact. energy: -1.061 local terms energy: -872.153706 where: bonds (distance) C4'-P energy: -167.425 bonds (distance) P-C4' energy: -182.021 flat angles C4'-P-C4' energy: -191.338 flat angles P-C4'-P energy: -122.680 tors. eta vs tors. theta energy: -208.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -2651.727759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2651.727759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2651.727759 (E_RNA) where: Base-Base interactions energy: -1839.948 where: short stacking energy: -794.302 Base-Backbone interact. energy: 7.289 local terms energy: -819.069605 where: bonds (distance) C4'-P energy: -176.852 bonds (distance) P-C4' energy: -158.855 flat angles C4'-P-C4' energy: -185.672 flat angles P-C4'-P energy: -115.274 tors. eta vs tors. theta energy: -182.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -2188.618622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2188.618622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2188.618622 (E_RNA) where: Base-Base interactions energy: -1443.211 where: short stacking energy: -668.503 Base-Backbone interact. energy: 3.471 local terms energy: -748.879499 where: bonds (distance) C4'-P energy: -152.350 bonds (distance) P-C4' energy: -164.221 flat angles C4'-P-C4' energy: -177.522 flat angles P-C4'-P energy: -111.055 tors. eta vs tors. theta energy: -143.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -2160.419864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2160.419864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2160.419864 (E_RNA) where: Base-Base interactions energy: -1438.597 where: short stacking energy: -623.204 Base-Backbone interact. energy: -0.571 local terms energy: -721.252761 where: bonds (distance) C4'-P energy: -129.808 bonds (distance) P-C4' energy: -171.188 flat angles C4'-P-C4' energy: -167.644 flat angles P-C4'-P energy: -112.838 tors. eta vs tors. theta energy: -139.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1852.794277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1852.794277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1852.794277 (E_RNA) where: Base-Base interactions energy: -1179.380 where: short stacking energy: -526.100 Base-Backbone interact. energy: -0.708 local terms energy: -672.706305 where: bonds (distance) C4'-P energy: -144.073 bonds (distance) P-C4' energy: -169.952 flat angles C4'-P-C4' energy: -175.286 flat angles P-C4'-P energy: -94.566 tors. eta vs tors. theta energy: -88.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -1654.324652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1654.324652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1654.324652 (E_RNA) where: Base-Base interactions energy: -1064.661 where: short stacking energy: -469.355 Base-Backbone interact. energy: 3.374 local terms energy: -593.036974 where: bonds (distance) C4'-P energy: -144.518 bonds (distance) P-C4' energy: -163.009 flat angles C4'-P-C4' energy: -135.678 flat angles P-C4'-P energy: -71.901 tors. eta vs tors. theta energy: -77.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -1363.161520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.161520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.161520 (E_RNA) where: Base-Base interactions energy: -809.878 where: short stacking energy: -388.849 Base-Backbone interact. energy: -2.867 local terms energy: -550.416207 where: bonds (distance) C4'-P energy: -155.668 bonds (distance) P-C4' energy: -134.933 flat angles C4'-P-C4' energy: -129.554 flat angles P-C4'-P energy: -84.328 tors. eta vs tors. theta energy: -45.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -3038.758699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3038.758699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3038.758699 (E_RNA) where: Base-Base interactions energy: -2071.475 where: short stacking energy: -924.022 Base-Backbone interact. energy: 3.083 local terms energy: -970.367257 where: bonds (distance) C4'-P energy: -186.331 bonds (distance) P-C4' energy: -185.672 flat angles C4'-P-C4' energy: -218.053 flat angles P-C4'-P energy: -148.709 tors. eta vs tors. theta energy: -231.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -2923.161046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2923.161046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2923.161046 (E_RNA) where: Base-Base interactions energy: -1993.792 where: short stacking energy: -904.578 Base-Backbone interact. energy: -2.544 local terms energy: -926.825440 where: bonds (distance) C4'-P energy: -181.597 bonds (distance) P-C4' energy: -170.718 flat angles C4'-P-C4' energy: -212.314 flat angles P-C4'-P energy: -136.119 tors. eta vs tors. theta energy: -226.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -2796.294899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2796.294899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2796.294899 (E_RNA) where: Base-Base interactions energy: -1955.124 where: short stacking energy: -868.990 Base-Backbone interact. energy: -4.064 local terms energy: -837.107682 where: bonds (distance) C4'-P energy: -142.147 bonds (distance) P-C4' energy: -176.921 flat angles C4'-P-C4' energy: -197.473 flat angles P-C4'-P energy: -114.337 tors. eta vs tors. theta energy: -206.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -2690.615467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2690.615467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2690.615467 (E_RNA) where: Base-Base interactions energy: -1834.862 where: short stacking energy: -829.473 Base-Backbone interact. energy: -4.120 local terms energy: -851.633173 where: bonds (distance) C4'-P energy: -182.796 bonds (distance) P-C4' energy: -161.115 flat angles C4'-P-C4' energy: -183.010 flat angles P-C4'-P energy: -117.883 tors. eta vs tors. theta energy: -206.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -2602.700760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2602.700760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2602.700760 (E_RNA) where: Base-Base interactions energy: -1817.277 where: short stacking energy: -795.469 Base-Backbone interact. energy: 9.696 local terms energy: -795.119522 where: bonds (distance) C4'-P energy: -157.890 bonds (distance) P-C4' energy: -166.296 flat angles C4'-P-C4' energy: -179.140 flat angles P-C4'-P energy: -122.917 tors. eta vs tors. theta energy: -168.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -2240.547034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2240.547034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2240.547034 (E_RNA) where: Base-Base interactions energy: -1507.968 where: short stacking energy: -680.496 Base-Backbone interact. energy: 1.260 local terms energy: -733.839004 where: bonds (distance) C4'-P energy: -158.058 bonds (distance) P-C4' energy: -158.842 flat angles C4'-P-C4' energy: -163.951 flat angles P-C4'-P energy: -108.435 tors. eta vs tors. theta energy: -144.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -2120.796746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2120.796746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2120.796746 (E_RNA) where: Base-Base interactions energy: -1409.731 where: short stacking energy: -615.886 Base-Backbone interact. energy: -3.123 local terms energy: -707.943059 where: bonds (distance) C4'-P energy: -173.343 bonds (distance) P-C4' energy: -131.210 flat angles C4'-P-C4' energy: -171.622 flat angles P-C4'-P energy: -106.590 tors. eta vs tors. theta energy: -125.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1762.126769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1762.126769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1762.126769 (E_RNA) where: Base-Base interactions energy: -1119.808 where: short stacking energy: -511.161 Base-Backbone interact. energy: -1.249 local terms energy: -641.069311 where: bonds (distance) C4'-P energy: -134.780 bonds (distance) P-C4' energy: -159.473 flat angles C4'-P-C4' energy: -167.879 flat angles P-C4'-P energy: -78.698 tors. eta vs tors. theta energy: -100.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -1649.686058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1649.686058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1649.686058 (E_RNA) where: Base-Base interactions energy: -1058.005 where: short stacking energy: -491.458 Base-Backbone interact. energy: 4.434 local terms energy: -596.115361 where: bonds (distance) C4'-P energy: -141.263 bonds (distance) P-C4' energy: -134.599 flat angles C4'-P-C4' energy: -157.456 flat angles P-C4'-P energy: -84.831 tors. eta vs tors. theta energy: -77.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -1330.253032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.253032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.253032 (E_RNA) where: Base-Base interactions energy: -786.696 where: short stacking energy: -396.883 Base-Backbone interact. energy: 1.690 local terms energy: -545.247277 where: bonds (distance) C4'-P energy: -162.003 bonds (distance) P-C4' energy: -133.941 flat angles C4'-P-C4' energy: -122.812 flat angles P-C4'-P energy: -85.200 tors. eta vs tors. theta energy: -41.291 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -3035.599350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3035.599350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3035.599350 (E_RNA) where: Base-Base interactions energy: -2087.730 where: short stacking energy: -926.707 Base-Backbone interact. energy: -2.536 local terms energy: -945.333945 where: bonds (distance) C4'-P energy: -183.454 bonds (distance) P-C4' energy: -190.083 flat angles C4'-P-C4' energy: -208.310 flat angles P-C4'-P energy: -123.551 tors. eta vs tors. theta energy: -239.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -2933.746115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2933.746115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2933.746115 (E_RNA) where: Base-Base interactions energy: -2020.522 where: short stacking energy: -904.709 Base-Backbone interact. energy: -0.485 local terms energy: -912.738856 where: bonds (distance) C4'-P energy: -168.749 bonds (distance) P-C4' energy: -183.207 flat angles C4'-P-C4' energy: -203.742 flat angles P-C4'-P energy: -119.041 tors. eta vs tors. theta energy: -238.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -2832.402164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2832.402164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2832.402164 (E_RNA) where: Base-Base interactions energy: -1948.585 where: short stacking energy: -856.594 Base-Backbone interact. energy: -1.739 local terms energy: -882.077414 where: bonds (distance) C4'-P energy: -168.452 bonds (distance) P-C4' energy: -192.204 flat angles C4'-P-C4' energy: -191.645 flat angles P-C4'-P energy: -119.282 tors. eta vs tors. theta energy: -210.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -2688.961392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2688.961392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2688.961392 (E_RNA) where: Base-Base interactions energy: -1813.586 where: short stacking energy: -814.666 Base-Backbone interact. energy: -4.073 local terms energy: -871.302984 where: bonds (distance) C4'-P energy: -146.971 bonds (distance) P-C4' energy: -173.777 flat angles C4'-P-C4' energy: -197.640 flat angles P-C4'-P energy: -142.249 tors. eta vs tors. theta energy: -210.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -2643.962000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2643.962000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2643.962000 (E_RNA) where: Base-Base interactions energy: -1813.501 where: short stacking energy: -785.516 Base-Backbone interact. energy: 8.400 local terms energy: -838.860825 where: bonds (distance) C4'-P energy: -139.123 bonds (distance) P-C4' energy: -190.134 flat angles C4'-P-C4' energy: -192.965 flat angles P-C4'-P energy: -124.784 tors. eta vs tors. theta energy: -191.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -2260.518822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.518822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.518822 (E_RNA) where: Base-Base interactions energy: -1499.281 where: short stacking energy: -694.212 Base-Backbone interact. energy: -2.460 local terms energy: -758.777325 where: bonds (distance) C4'-P energy: -126.936 bonds (distance) P-C4' energy: -176.085 flat angles C4'-P-C4' energy: -177.229 flat angles P-C4'-P energy: -114.687 tors. eta vs tors. theta energy: -163.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -2131.749121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2131.749121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2131.749121 (E_RNA) where: Base-Base interactions energy: -1436.262 where: short stacking energy: -646.297 Base-Backbone interact. energy: -1.352 local terms energy: -694.134404 where: bonds (distance) C4'-P energy: -149.892 bonds (distance) P-C4' energy: -168.096 flat angles C4'-P-C4' energy: -157.996 flat angles P-C4'-P energy: -103.447 tors. eta vs tors. theta energy: -114.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1770.818457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1770.818457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1770.818457 (E_RNA) where: Base-Base interactions energy: -1126.024 where: short stacking energy: -521.568 Base-Backbone interact. energy: -0.371 local terms energy: -644.424002 where: bonds (distance) C4'-P energy: -138.459 bonds (distance) P-C4' energy: -162.209 flat angles C4'-P-C4' energy: -158.666 flat angles P-C4'-P energy: -84.438 tors. eta vs tors. theta energy: -100.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -1679.469128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1679.469128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1679.469128 (E_RNA) where: Base-Base interactions energy: -1048.461 where: short stacking energy: -477.930 Base-Backbone interact. energy: 1.789 local terms energy: -632.796433 where: bonds (distance) C4'-P energy: -158.741 bonds (distance) P-C4' energy: -168.702 flat angles C4'-P-C4' energy: -134.677 flat angles P-C4'-P energy: -97.415 tors. eta vs tors. theta energy: -73.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -1316.183410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.183410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.183410 (E_RNA) where: Base-Base interactions energy: -829.893 where: short stacking energy: -435.208 Base-Backbone interact. energy: 12.768 local terms energy: -499.059025 where: bonds (distance) C4'-P energy: -124.102 bonds (distance) P-C4' energy: -149.626 flat angles C4'-P-C4' energy: -108.309 flat angles P-C4'-P energy: -72.493 tors. eta vs tors. theta energy: -44.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -3062.328614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3062.328614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3062.328614 (E_RNA) where: Base-Base interactions energy: -2099.637 where: short stacking energy: -927.450 Base-Backbone interact. energy: -5.465 local terms energy: -957.227294 where: bonds (distance) C4'-P energy: -175.449 bonds (distance) P-C4' energy: -195.662 flat angles C4'-P-C4' energy: -205.315 flat angles P-C4'-P energy: -134.858 tors. eta vs tors. theta energy: -245.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -2918.072171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2918.072171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2918.072171 (E_RNA) where: Base-Base interactions energy: -2016.691 where: short stacking energy: -895.430 Base-Backbone interact. energy: 1.155 local terms energy: -902.535663 where: bonds (distance) C4'-P energy: -177.349 bonds (distance) P-C4' energy: -168.774 flat angles C4'-P-C4' energy: -200.511 flat angles P-C4'-P energy: -120.933 tors. eta vs tors. theta energy: -234.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -2759.556503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2759.556503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2759.556503 (E_RNA) where: Base-Base interactions energy: -1869.909 where: short stacking energy: -799.475 Base-Backbone interact. energy: -6.257 local terms energy: -883.390118 where: bonds (distance) C4'-P energy: -175.780 bonds (distance) P-C4' energy: -170.456 flat angles C4'-P-C4' energy: -200.265 flat angles P-C4'-P energy: -133.945 tors. eta vs tors. theta energy: -202.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -2706.156986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2706.156986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2706.156986 (E_RNA) where: Base-Base interactions energy: -1866.049 where: short stacking energy: -793.357 Base-Backbone interact. energy: 3.899 local terms energy: -844.007249 where: bonds (distance) C4'-P energy: -155.473 bonds (distance) P-C4' energy: -168.984 flat angles C4'-P-C4' energy: -187.653 flat angles P-C4'-P energy: -134.319 tors. eta vs tors. theta energy: -197.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -2596.508519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2596.508519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2596.508519 (E_RNA) where: Base-Base interactions energy: -1761.907 where: short stacking energy: -778.890 Base-Backbone interact. energy: -4.790 local terms energy: -829.811566 where: bonds (distance) C4'-P energy: -161.179 bonds (distance) P-C4' energy: -171.069 flat angles C4'-P-C4' energy: -187.991 flat angles P-C4'-P energy: -123.880 tors. eta vs tors. theta energy: -185.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -2331.667241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2331.667241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2331.667241 (E_RNA) where: Base-Base interactions energy: -1585.155 where: short stacking energy: -677.507 Base-Backbone interact. energy: -0.701 local terms energy: -745.811247 where: bonds (distance) C4'-P energy: -163.433 bonds (distance) P-C4' energy: -157.556 flat angles C4'-P-C4' energy: -170.027 flat angles P-C4'-P energy: -111.064 tors. eta vs tors. theta energy: -143.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -2133.457254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.457254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.457254 (E_RNA) where: Base-Base interactions energy: -1460.128 where: short stacking energy: -649.407 Base-Backbone interact. energy: -1.832 local terms energy: -671.496987 where: bonds (distance) C4'-P energy: -141.638 bonds (distance) P-C4' energy: -163.805 flat angles C4'-P-C4' energy: -145.551 flat angles P-C4'-P energy: -91.763 tors. eta vs tors. theta energy: -128.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1943.682136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1943.682136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1943.682136 (E_RNA) where: Base-Base interactions energy: -1248.088 where: short stacking energy: -581.840 Base-Backbone interact. energy: 2.561 local terms energy: -698.155972 where: bonds (distance) C4'-P energy: -173.918 bonds (distance) P-C4' energy: -151.042 flat angles C4'-P-C4' energy: -163.320 flat angles P-C4'-P energy: -95.275 tors. eta vs tors. theta energy: -114.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -1745.596665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1745.596665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1745.596665 (E_RNA) where: Base-Base interactions energy: -1110.457 where: short stacking energy: -510.388 Base-Backbone interact. energy: 4.825 local terms energy: -639.964724 where: bonds (distance) C4'-P energy: -159.141 bonds (distance) P-C4' energy: -144.493 flat angles C4'-P-C4' energy: -157.385 flat angles P-C4'-P energy: -86.796 tors. eta vs tors. theta energy: -92.149 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -1382.753295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.753295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.753295 (E_RNA) where: Base-Base interactions energy: -841.503 where: short stacking energy: -437.829 Base-Backbone interact. energy: -0.274 local terms energy: -540.976894 where: bonds (distance) C4'-P energy: -148.900 bonds (distance) P-C4' energy: -130.535 flat angles C4'-P-C4' energy: -142.229 flat angles P-C4'-P energy: -67.532 tors. eta vs tors. theta energy: -51.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -2991.818061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2991.818061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2991.818061 (E_RNA) where: Base-Base interactions energy: -2083.007 where: short stacking energy: -924.400 Base-Backbone interact. energy: -3.748 local terms energy: -905.062771 where: bonds (distance) C4'-P energy: -168.871 bonds (distance) P-C4' energy: -180.710 flat angles C4'-P-C4' energy: -197.164 flat angles P-C4'-P energy: -117.841 tors. eta vs tors. theta energy: -240.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -2964.623390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2964.623390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2964.623390 (E_RNA) where: Base-Base interactions energy: -2054.668 where: short stacking energy: -876.020 Base-Backbone interact. energy: -8.471 local terms energy: -901.483960 where: bonds (distance) C4'-P energy: -172.367 bonds (distance) P-C4' energy: -162.287 flat angles C4'-P-C4' energy: -202.329 flat angles P-C4'-P energy: -134.480 tors. eta vs tors. theta energy: -230.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -2799.913816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2799.913816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2799.913816 (E_RNA) where: Base-Base interactions energy: -1945.704 where: short stacking energy: -861.518 Base-Backbone interact. energy: -3.038 local terms energy: -851.171235 where: bonds (distance) C4'-P energy: -170.290 bonds (distance) P-C4' energy: -170.943 flat angles C4'-P-C4' energy: -190.239 flat angles P-C4'-P energy: -119.639 tors. eta vs tors. theta energy: -200.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -2743.980325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2743.980325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2743.980325 (E_RNA) where: Base-Base interactions energy: -1876.844 where: short stacking energy: -839.754 Base-Backbone interact. energy: -1.476 local terms energy: -865.659583 where: bonds (distance) C4'-P energy: -178.307 bonds (distance) P-C4' energy: -172.705 flat angles C4'-P-C4' energy: -176.667 flat angles P-C4'-P energy: -122.711 tors. eta vs tors. theta energy: -215.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -2560.871749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2560.871749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2560.871749 (E_RNA) where: Base-Base interactions energy: -1740.378 where: short stacking energy: -783.966 Base-Backbone interact. energy: -0.678 local terms energy: -819.815626 where: bonds (distance) C4'-P energy: -162.218 bonds (distance) P-C4' energy: -170.758 flat angles C4'-P-C4' energy: -165.162 flat angles P-C4'-P energy: -129.159 tors. eta vs tors. theta energy: -192.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -2348.845254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2348.845254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2348.845254 (E_RNA) where: Base-Base interactions energy: -1608.617 where: short stacking energy: -721.003 Base-Backbone interact. energy: 1.032 local terms energy: -741.260205 where: bonds (distance) C4'-P energy: -133.057 bonds (distance) P-C4' energy: -178.956 flat angles C4'-P-C4' energy: -163.519 flat angles P-C4'-P energy: -97.111 tors. eta vs tors. theta energy: -168.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -2201.158686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2201.158686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2201.158686 (E_RNA) where: Base-Base interactions energy: -1454.925 where: short stacking energy: -646.796 Base-Backbone interact. energy: 1.323 local terms energy: -747.556095 where: bonds (distance) C4'-P energy: -168.677 bonds (distance) P-C4' energy: -164.504 flat angles C4'-P-C4' energy: -185.592 flat angles P-C4'-P energy: -97.750 tors. eta vs tors. theta energy: -131.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1955.450156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1955.450156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1955.450156 (E_RNA) where: Base-Base interactions energy: -1306.288 where: short stacking energy: -617.075 Base-Backbone interact. energy: -1.566 local terms energy: -647.595616 where: bonds (distance) C4'-P energy: -151.064 bonds (distance) P-C4' energy: -137.689 flat angles C4'-P-C4' energy: -153.524 flat angles P-C4'-P energy: -88.474 tors. eta vs tors. theta energy: -116.844 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -1807.408715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1807.408715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1807.408715 (E_RNA) where: Base-Base interactions energy: -1203.480 where: short stacking energy: -531.504 Base-Backbone interact. energy: 2.547 local terms energy: -606.476400 where: bonds (distance) C4'-P energy: -115.039 bonds (distance) P-C4' energy: -160.252 flat angles C4'-P-C4' energy: -149.144 flat angles P-C4'-P energy: -78.796 tors. eta vs tors. theta energy: -103.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -1224.835033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1224.835033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1224.835033 (E_RNA) where: Base-Base interactions energy: -706.908 where: short stacking energy: -361.236 Base-Backbone interact. energy: 1.874 local terms energy: -519.801395 where: bonds (distance) C4'-P energy: -123.131 bonds (distance) P-C4' energy: -156.669 flat angles C4'-P-C4' energy: -126.655 flat angles P-C4'-P energy: -76.413 tors. eta vs tors. theta energy: -36.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -2990.380985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2990.380985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2990.380985 (E_RNA) where: Base-Base interactions energy: -2005.542 where: short stacking energy: -900.492 Base-Backbone interact. energy: -4.688 local terms energy: -980.150869 where: bonds (distance) C4'-P energy: -204.474 bonds (distance) P-C4' energy: -195.525 flat angles C4'-P-C4' energy: -205.975 flat angles P-C4'-P energy: -134.332 tors. eta vs tors. theta energy: -239.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -2969.906222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2969.906222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2969.906222 (E_RNA) where: Base-Base interactions energy: -2038.126 where: short stacking energy: -912.467 Base-Backbone interact. energy: -6.097 local terms energy: -925.683127 where: bonds (distance) C4'-P energy: -173.853 bonds (distance) P-C4' energy: -185.631 flat angles C4'-P-C4' energy: -203.917 flat angles P-C4'-P energy: -110.124 tors. eta vs tors. theta energy: -252.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -2798.366797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2798.366797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2798.366797 (E_RNA) where: Base-Base interactions energy: -1936.384 where: short stacking energy: -836.480 Base-Backbone interact. energy: -2.165 local terms energy: -859.817408 where: bonds (distance) C4'-P energy: -168.492 bonds (distance) P-C4' energy: -176.054 flat angles C4'-P-C4' energy: -193.794 flat angles P-C4'-P energy: -131.071 tors. eta vs tors. theta energy: -190.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -2741.882098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2741.882098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2741.882098 (E_RNA) where: Base-Base interactions energy: -1879.610 where: short stacking energy: -781.769 Base-Backbone interact. energy: -3.748 local terms energy: -858.523879 where: bonds (distance) C4'-P energy: -188.112 bonds (distance) P-C4' energy: -161.712 flat angles C4'-P-C4' energy: -185.131 flat angles P-C4'-P energy: -129.005 tors. eta vs tors. theta energy: -194.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -2551.103071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2551.103071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2551.103071 (E_RNA) where: Base-Base interactions energy: -1727.943 where: short stacking energy: -742.252 Base-Backbone interact. energy: -3.298 local terms energy: -819.862634 where: bonds (distance) C4'-P energy: -162.046 bonds (distance) P-C4' energy: -178.653 flat angles C4'-P-C4' energy: -191.536 flat angles P-C4'-P energy: -99.407 tors. eta vs tors. theta energy: -188.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -2421.814077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2421.814077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2421.814077 (E_RNA) where: Base-Base interactions energy: -1612.836 where: short stacking energy: -711.338 Base-Backbone interact. energy: 1.601 local terms energy: -810.579206 where: bonds (distance) C4'-P energy: -199.683 bonds (distance) P-C4' energy: -170.778 flat angles C4'-P-C4' energy: -179.427 flat angles P-C4'-P energy: -103.547 tors. eta vs tors. theta energy: -157.144 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -2175.702228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2175.702228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2175.702228 (E_RNA) where: Base-Base interactions energy: -1477.668 where: short stacking energy: -637.945 Base-Backbone interact. energy: -2.970 local terms energy: -695.064295 where: bonds (distance) C4'-P energy: -147.927 bonds (distance) P-C4' energy: -159.452 flat angles C4'-P-C4' energy: -155.521 flat angles P-C4'-P energy: -103.228 tors. eta vs tors. theta energy: -128.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1953.794580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1953.794580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1953.794580 (E_RNA) where: Base-Base interactions energy: -1317.809 where: short stacking energy: -595.253 Base-Backbone interact. energy: 0.643 local terms energy: -636.628292 where: bonds (distance) C4'-P energy: -134.040 bonds (distance) P-C4' energy: -134.406 flat angles C4'-P-C4' energy: -166.923 flat angles P-C4'-P energy: -91.161 tors. eta vs tors. theta energy: -110.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -1821.383043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1821.383043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1821.383043 (E_RNA) where: Base-Base interactions energy: -1182.690 where: short stacking energy: -545.379 Base-Backbone interact. energy: -0.526 local terms energy: -638.166911 where: bonds (distance) C4'-P energy: -156.687 bonds (distance) P-C4' energy: -159.385 flat angles C4'-P-C4' energy: -153.745 flat angles P-C4'-P energy: -69.459 tors. eta vs tors. theta energy: -98.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -1216.736206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.736206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.736206 (E_RNA) where: Base-Base interactions energy: -713.151 where: short stacking energy: -389.067 Base-Backbone interact. energy: -2.891 local terms energy: -500.694517 where: bonds (distance) C4'-P energy: -119.081 bonds (distance) P-C4' energy: -144.327 flat angles C4'-P-C4' energy: -137.111 flat angles P-C4'-P energy: -66.575 tors. eta vs tors. theta energy: -33.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -2983.283992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2983.283992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2983.283992 (E_RNA) where: Base-Base interactions energy: -2066.655 where: short stacking energy: -932.862 Base-Backbone interact. energy: -2.957 local terms energy: -913.672408 where: bonds (distance) C4'-P energy: -182.542 bonds (distance) P-C4' energy: -179.820 flat angles C4'-P-C4' energy: -210.177 flat angles P-C4'-P energy: -118.087 tors. eta vs tors. theta energy: -223.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -3006.677669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3006.677669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3006.677669 (E_RNA) where: Base-Base interactions energy: -2088.273 where: short stacking energy: -925.605 Base-Backbone interact. energy: 2.208 local terms energy: -920.613117 where: bonds (distance) C4'-P energy: -154.875 bonds (distance) P-C4' energy: -179.756 flat angles C4'-P-C4' energy: -207.683 flat angles P-C4'-P energy: -137.100 tors. eta vs tors. theta energy: -241.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -2805.040565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2805.040565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2805.040565 (E_RNA) where: Base-Base interactions energy: -1940.006 where: short stacking energy: -886.955 Base-Backbone interact. energy: 0.556 local terms energy: -865.590568 where: bonds (distance) C4'-P energy: -166.366 bonds (distance) P-C4' energy: -178.477 flat angles C4'-P-C4' energy: -197.832 flat angles P-C4'-P energy: -114.363 tors. eta vs tors. theta energy: -208.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -2708.356665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2708.356665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2708.356665 (E_RNA) where: Base-Base interactions energy: -1875.729 where: short stacking energy: -809.857 Base-Backbone interact. energy: 4.097 local terms energy: -836.725513 where: bonds (distance) C4'-P energy: -133.404 bonds (distance) P-C4' energy: -181.712 flat angles C4'-P-C4' energy: -181.187 flat angles P-C4'-P energy: -134.749 tors. eta vs tors. theta energy: -205.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -2534.321952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2534.321952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2534.321952 (E_RNA) where: Base-Base interactions energy: -1725.399 where: short stacking energy: -778.597 Base-Backbone interact. energy: 0.491 local terms energy: -809.414406 where: bonds (distance) C4'-P energy: -171.797 bonds (distance) P-C4' energy: -151.151 flat angles C4'-P-C4' energy: -184.437 flat angles P-C4'-P energy: -122.657 tors. eta vs tors. theta energy: -179.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -2462.124567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2462.124567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2462.124567 (E_RNA) where: Base-Base interactions energy: -1644.834 where: short stacking energy: -732.912 Base-Backbone interact. energy: -7.063 local terms energy: -810.228404 where: bonds (distance) C4'-P energy: -156.551 bonds (distance) P-C4' energy: -180.232 flat angles C4'-P-C4' energy: -185.702 flat angles P-C4'-P energy: -112.073 tors. eta vs tors. theta energy: -175.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -2193.959832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2193.959832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2193.959832 (E_RNA) where: Base-Base interactions energy: -1463.175 where: short stacking energy: -657.519 Base-Backbone interact. energy: -1.136 local terms energy: -729.648547 where: bonds (distance) C4'-P energy: -148.764 bonds (distance) P-C4' energy: -157.365 flat angles C4'-P-C4' energy: -180.072 flat angles P-C4'-P energy: -101.083 tors. eta vs tors. theta energy: -142.364 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1981.858960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1981.858960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1981.858960 (E_RNA) where: Base-Base interactions energy: -1297.570 where: short stacking energy: -582.020 Base-Backbone interact. energy: 4.493 local terms energy: -688.782835 where: bonds (distance) C4'-P energy: -160.159 bonds (distance) P-C4' energy: -159.011 flat angles C4'-P-C4' energy: -174.163 flat angles P-C4'-P energy: -90.032 tors. eta vs tors. theta energy: -105.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -1763.006245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1763.006245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1763.006245 (E_RNA) where: Base-Base interactions energy: -1139.194 where: short stacking energy: -522.573 Base-Backbone interact. energy: -2.773 local terms energy: -621.038755 where: bonds (distance) C4'-P energy: -144.074 bonds (distance) P-C4' energy: -156.241 flat angles C4'-P-C4' energy: -129.167 flat angles P-C4'-P energy: -101.964 tors. eta vs tors. theta energy: -89.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -1232.633454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1232.633454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1232.633454 (E_RNA) where: Base-Base interactions energy: -736.947 where: short stacking energy: -386.926 Base-Backbone interact. energy: 1.352 local terms energy: -497.037689 where: bonds (distance) C4'-P energy: -135.476 bonds (distance) P-C4' energy: -132.247 flat angles C4'-P-C4' energy: -125.027 flat angles P-C4'-P energy: -85.096 tors. eta vs tors. theta energy: -19.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -2980.159179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2980.159179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2980.159179 (E_RNA) where: Base-Base interactions energy: -2038.647 where: short stacking energy: -932.402 Base-Backbone interact. energy: -5.262 local terms energy: -936.249680 where: bonds (distance) C4'-P energy: -178.121 bonds (distance) P-C4' energy: -181.203 flat angles C4'-P-C4' energy: -199.143 flat angles P-C4'-P energy: -135.389 tors. eta vs tors. theta energy: -242.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -2968.754790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2968.754790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2968.754790 (E_RNA) where: Base-Base interactions energy: -2065.133 where: short stacking energy: -906.425 Base-Backbone interact. energy: 0.615 local terms energy: -904.237122 where: bonds (distance) C4'-P energy: -176.806 bonds (distance) P-C4' energy: -171.469 flat angles C4'-P-C4' energy: -205.393 flat angles P-C4'-P energy: -119.006 tors. eta vs tors. theta energy: -231.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -2773.992695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2773.992695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2773.992695 (E_RNA) where: Base-Base interactions energy: -1934.600 where: short stacking energy: -831.542 Base-Backbone interact. energy: -2.843 local terms energy: -836.549729 where: bonds (distance) C4'-P energy: -163.630 bonds (distance) P-C4' energy: -169.099 flat angles C4'-P-C4' energy: -179.048 flat angles P-C4'-P energy: -123.010 tors. eta vs tors. theta energy: -201.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -2787.805493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2787.805493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2787.805493 (E_RNA) where: Base-Base interactions energy: -1942.663 where: short stacking energy: -835.535 Base-Backbone interact. energy: -1.027 local terms energy: -844.115790 where: bonds (distance) C4'-P energy: -151.257 bonds (distance) P-C4' energy: -170.887 flat angles C4'-P-C4' energy: -205.688 flat angles P-C4'-P energy: -115.105 tors. eta vs tors. theta energy: -201.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -2550.411063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2550.411063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2550.411063 (E_RNA) where: Base-Base interactions energy: -1713.374 where: short stacking energy: -765.224 Base-Backbone interact. energy: 2.457 local terms energy: -839.493611 where: bonds (distance) C4'-P energy: -168.711 bonds (distance) P-C4' energy: -164.642 flat angles C4'-P-C4' energy: -185.403 flat angles P-C4'-P energy: -122.607 tors. eta vs tors. theta energy: -198.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -2466.371432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2466.371432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2466.371432 (E_RNA) where: Base-Base interactions energy: -1703.643 where: short stacking energy: -760.357 Base-Backbone interact. energy: 1.381 local terms energy: -764.109234 where: bonds (distance) C4'-P energy: -154.356 bonds (distance) P-C4' energy: -154.671 flat angles C4'-P-C4' energy: -156.568 flat angles P-C4'-P energy: -116.895 tors. eta vs tors. theta energy: -181.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -2201.314305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2201.314305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2201.314305 (E_RNA) where: Base-Base interactions energy: -1455.190 where: short stacking energy: -662.634 Base-Backbone interact. energy: -1.803 local terms energy: -744.321270 where: bonds (distance) C4'-P energy: -146.596 bonds (distance) P-C4' energy: -171.367 flat angles C4'-P-C4' energy: -171.972 flat angles P-C4'-P energy: -104.570 tors. eta vs tors. theta energy: -149.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1956.329592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1956.329592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1956.329592 (E_RNA) where: Base-Base interactions energy: -1290.120 where: short stacking energy: -576.619 Base-Backbone interact. energy: 3.883 local terms energy: -670.092451 where: bonds (distance) C4'-P energy: -154.083 bonds (distance) P-C4' energy: -139.516 flat angles C4'-P-C4' energy: -175.197 flat angles P-C4'-P energy: -90.341 tors. eta vs tors. theta energy: -110.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1743.675677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1743.675677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1743.675677 (E_RNA) where: Base-Base interactions energy: -1121.676 where: short stacking energy: -538.189 Base-Backbone interact. energy: -4.865 local terms energy: -617.134569 where: bonds (distance) C4'-P energy: -138.784 bonds (distance) P-C4' energy: -139.558 flat angles C4'-P-C4' energy: -159.354 flat angles P-C4'-P energy: -80.467 tors. eta vs tors. theta energy: -98.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -1140.921974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1140.921974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1140.921974 (E_RNA) where: Base-Base interactions energy: -655.477 where: short stacking energy: -360.402 Base-Backbone interact. energy: 4.450 local terms energy: -489.894406 where: bonds (distance) C4'-P energy: -129.959 bonds (distance) P-C4' energy: -124.291 flat angles C4'-P-C4' energy: -149.424 flat angles P-C4'-P energy: -60.086 tors. eta vs tors. theta energy: -26.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -3063.004947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3063.004947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3063.004947 (E_RNA) where: Base-Base interactions energy: -2107.022 where: short stacking energy: -911.857 Base-Backbone interact. energy: -3.829 local terms energy: -952.154400 where: bonds (distance) C4'-P energy: -184.946 bonds (distance) P-C4' energy: -189.547 flat angles C4'-P-C4' energy: -203.330 flat angles P-C4'-P energy: -131.520 tors. eta vs tors. theta energy: -242.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -2975.748051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2975.748051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2975.748051 (E_RNA) where: Base-Base interactions energy: -2051.616 where: short stacking energy: -951.236 Base-Backbone interact. energy: -4.808 local terms energy: -919.324162 where: bonds (distance) C4'-P energy: -175.885 bonds (distance) P-C4' energy: -196.931 flat angles C4'-P-C4' energy: -205.006 flat angles P-C4'-P energy: -104.702 tors. eta vs tors. theta energy: -236.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -2894.437186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2894.437186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2894.437186 (E_RNA) where: Base-Base interactions energy: -1997.898 where: short stacking energy: -880.335 Base-Backbone interact. energy: 2.017 local terms energy: -898.556269 where: bonds (distance) C4'-P energy: -161.757 bonds (distance) P-C4' energy: -165.481 flat angles C4'-P-C4' energy: -201.207 flat angles P-C4'-P energy: -139.384 tors. eta vs tors. theta energy: -230.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -2749.555278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2749.555278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2749.555278 (E_RNA) where: Base-Base interactions energy: -1894.058 where: short stacking energy: -800.967 Base-Backbone interact. energy: -6.379 local terms energy: -849.118143 where: bonds (distance) C4'-P energy: -158.399 bonds (distance) P-C4' energy: -174.282 flat angles C4'-P-C4' energy: -184.619 flat angles P-C4'-P energy: -121.763 tors. eta vs tors. theta energy: -210.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -2559.173955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2559.173955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2559.173955 (E_RNA) where: Base-Base interactions energy: -1729.918 where: short stacking energy: -783.330 Base-Backbone interact. energy: -3.652 local terms energy: -825.604437 where: bonds (distance) C4'-P energy: -169.504 bonds (distance) P-C4' energy: -153.063 flat angles C4'-P-C4' energy: -180.465 flat angles P-C4'-P energy: -116.608 tors. eta vs tors. theta energy: -205.964 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -2489.070511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2489.070511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2489.070511 (E_RNA) where: Base-Base interactions energy: -1715.278 where: short stacking energy: -735.899 Base-Backbone interact. energy: 1.306 local terms energy: -775.098563 where: bonds (distance) C4'-P energy: -164.476 bonds (distance) P-C4' energy: -168.976 flat angles C4'-P-C4' energy: -171.633 flat angles P-C4'-P energy: -101.546 tors. eta vs tors. theta energy: -168.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -2172.773173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2172.773173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2172.773173 (E_RNA) where: Base-Base interactions energy: -1477.317 where: short stacking energy: -654.857 Base-Backbone interact. energy: -4.138 local terms energy: -691.318330 where: bonds (distance) C4'-P energy: -145.894 bonds (distance) P-C4' energy: -146.759 flat angles C4'-P-C4' energy: -179.488 flat angles P-C4'-P energy: -80.272 tors. eta vs tors. theta energy: -138.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1931.509856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1931.509856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1931.509856 (E_RNA) where: Base-Base interactions energy: -1273.065 where: short stacking energy: -597.760 Base-Backbone interact. energy: -0.049 local terms energy: -658.395798 where: bonds (distance) C4'-P energy: -151.341 bonds (distance) P-C4' energy: -144.986 flat angles C4'-P-C4' energy: -175.323 flat angles P-C4'-P energy: -89.091 tors. eta vs tors. theta energy: -97.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1741.435842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1741.435842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.435842 (E_RNA) where: Base-Base interactions energy: -1085.777 where: short stacking energy: -494.131 Base-Backbone interact. energy: -1.130 local terms energy: -654.528725 where: bonds (distance) C4'-P energy: -128.628 bonds (distance) P-C4' energy: -162.939 flat angles C4'-P-C4' energy: -138.244 flat angles P-C4'-P energy: -117.596 tors. eta vs tors. theta energy: -107.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -1215.595655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.595655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.595655 (E_RNA) where: Base-Base interactions energy: -696.939 where: short stacking energy: -383.702 Base-Backbone interact. energy: 1.800 local terms energy: -520.456477 where: bonds (distance) C4'-P energy: -150.687 bonds (distance) P-C4' energy: -144.751 flat angles C4'-P-C4' energy: -128.787 flat angles P-C4'-P energy: -61.726 tors. eta vs tors. theta energy: -34.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -3100.108412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3100.108412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3100.108412 (E_RNA) where: Base-Base interactions energy: -2134.567 where: short stacking energy: -910.664 Base-Backbone interact. energy: 0.900 local terms energy: -966.441229 where: bonds (distance) C4'-P energy: -164.108 bonds (distance) P-C4' energy: -195.925 flat angles C4'-P-C4' energy: -219.742 flat angles P-C4'-P energy: -147.193 tors. eta vs tors. theta energy: -239.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -2953.239453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2953.239453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2953.239453 (E_RNA) where: Base-Base interactions energy: -2038.677 where: short stacking energy: -878.743 Base-Backbone interact. energy: -0.690 local terms energy: -913.871659 where: bonds (distance) C4'-P energy: -155.911 bonds (distance) P-C4' energy: -182.023 flat angles C4'-P-C4' energy: -206.810 flat angles P-C4'-P energy: -146.299 tors. eta vs tors. theta energy: -222.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -2834.672528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2834.672528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2834.672528 (E_RNA) where: Base-Base interactions energy: -1948.661 where: short stacking energy: -851.891 Base-Backbone interact. energy: -3.103 local terms energy: -882.908469 where: bonds (distance) C4'-P energy: -165.545 bonds (distance) P-C4' energy: -168.382 flat angles C4'-P-C4' energy: -195.112 flat angles P-C4'-P energy: -125.142 tors. eta vs tors. theta energy: -228.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -2813.964956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2813.964956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2813.964956 (E_RNA) where: Base-Base interactions energy: -1966.406 where: short stacking energy: -872.433 Base-Backbone interact. energy: -4.660 local terms energy: -842.898902 where: bonds (distance) C4'-P energy: -170.276 bonds (distance) P-C4' energy: -173.687 flat angles C4'-P-C4' energy: -180.764 flat angles P-C4'-P energy: -110.750 tors. eta vs tors. theta energy: -207.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -2495.810507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2495.810507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2495.810507 (E_RNA) where: Base-Base interactions energy: -1629.494 where: short stacking energy: -740.515 Base-Backbone interact. energy: -0.415 local terms energy: -865.901591 where: bonds (distance) C4'-P energy: -169.090 bonds (distance) P-C4' energy: -193.668 flat angles C4'-P-C4' energy: -198.656 flat angles P-C4'-P energy: -123.923 tors. eta vs tors. theta energy: -180.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -2380.658351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2380.658351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2380.658351 (E_RNA) where: Base-Base interactions energy: -1682.463 where: short stacking energy: -715.534 Base-Backbone interact. energy: 5.398 local terms energy: -703.592957 where: bonds (distance) C4'-P energy: -146.981 bonds (distance) P-C4' energy: -149.299 flat angles C4'-P-C4' energy: -168.420 flat angles P-C4'-P energy: -92.702 tors. eta vs tors. theta energy: -146.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -2203.779255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2203.779255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2203.779255 (E_RNA) where: Base-Base interactions energy: -1483.547 where: short stacking energy: -655.100 Base-Backbone interact. energy: -2.132 local terms energy: -718.100564 where: bonds (distance) C4'-P energy: -157.851 bonds (distance) P-C4' energy: -152.911 flat angles C4'-P-C4' energy: -161.241 flat angles P-C4'-P energy: -97.326 tors. eta vs tors. theta energy: -148.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1899.922434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1899.922434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1899.922434 (E_RNA) where: Base-Base interactions energy: -1268.927 where: short stacking energy: -578.298 Base-Backbone interact. energy: 3.363 local terms energy: -634.358140 where: bonds (distance) C4'-P energy: -154.334 bonds (distance) P-C4' energy: -136.590 flat angles C4'-P-C4' energy: -155.627 flat angles P-C4'-P energy: -71.878 tors. eta vs tors. theta energy: -115.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1746.639849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1746.639849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1746.639849 (E_RNA) where: Base-Base interactions energy: -1116.699 where: short stacking energy: -526.907 Base-Backbone interact. energy: -2.612 local terms energy: -627.329375 where: bonds (distance) C4'-P energy: -151.713 bonds (distance) P-C4' energy: -120.131 flat angles C4'-P-C4' energy: -144.600 flat angles P-C4'-P energy: -107.687 tors. eta vs tors. theta energy: -103.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -1160.317165 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1160.317165 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1160.317165 (E_RNA) where: Base-Base interactions energy: -671.014 where: short stacking energy: -344.233 Base-Backbone interact. energy: 9.316 local terms energy: -498.619820 where: bonds (distance) C4'-P energy: -149.421 bonds (distance) P-C4' energy: -141.597 flat angles C4'-P-C4' energy: -121.493 flat angles P-C4'-P energy: -77.194 tors. eta vs tors. theta energy: -8.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -3072.364120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3072.364120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3072.364120 (E_RNA) where: Base-Base interactions energy: -2151.003 where: short stacking energy: -936.416 Base-Backbone interact. energy: -4.309 local terms energy: -917.051752 where: bonds (distance) C4'-P energy: -166.239 bonds (distance) P-C4' energy: -184.731 flat angles C4'-P-C4' energy: -207.875 flat angles P-C4'-P energy: -119.539 tors. eta vs tors. theta energy: -238.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -3015.976691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3015.976691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3015.976691 (E_RNA) where: Base-Base interactions energy: -2088.656 where: short stacking energy: -879.265 Base-Backbone interact. energy: 0.015 local terms energy: -927.334852 where: bonds (distance) C4'-P energy: -183.382 bonds (distance) P-C4' energy: -187.429 flat angles C4'-P-C4' energy: -207.656 flat angles P-C4'-P energy: -130.308 tors. eta vs tors. theta energy: -218.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -2836.970094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2836.970094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2836.970094 (E_RNA) where: Base-Base interactions energy: -1949.573 where: short stacking energy: -861.018 Base-Backbone interact. energy: 1.696 local terms energy: -889.092725 where: bonds (distance) C4'-P energy: -182.440 bonds (distance) P-C4' energy: -178.450 flat angles C4'-P-C4' energy: -181.264 flat angles P-C4'-P energy: -120.772 tors. eta vs tors. theta energy: -226.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -2752.432476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2752.432476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2752.432476 (E_RNA) where: Base-Base interactions energy: -1934.763 where: short stacking energy: -852.072 Base-Backbone interact. energy: 9.682 local terms energy: -827.351057 where: bonds (distance) C4'-P energy: -162.463 bonds (distance) P-C4' energy: -163.810 flat angles C4'-P-C4' energy: -173.618 flat angles P-C4'-P energy: -125.545 tors. eta vs tors. theta energy: -201.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -2495.978937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2495.978937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2495.978937 (E_RNA) where: Base-Base interactions energy: -1700.574 where: short stacking energy: -749.747 Base-Backbone interact. energy: 7.837 local terms energy: -803.242101 where: bonds (distance) C4'-P energy: -160.380 bonds (distance) P-C4' energy: -157.208 flat angles C4'-P-C4' energy: -188.318 flat angles P-C4'-P energy: -120.915 tors. eta vs tors. theta energy: -176.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -2428.519214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2428.519214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2428.519214 (E_RNA) where: Base-Base interactions energy: -1650.450 where: short stacking energy: -718.862 Base-Backbone interact. energy: -0.291 local terms energy: -777.777717 where: bonds (distance) C4'-P energy: -159.509 bonds (distance) P-C4' energy: -149.420 flat angles C4'-P-C4' energy: -183.010 flat angles P-C4'-P energy: -123.795 tors. eta vs tors. theta energy: -162.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -2207.845284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2207.845284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2207.845284 (E_RNA) where: Base-Base interactions energy: -1478.763 where: short stacking energy: -658.267 Base-Backbone interact. energy: -3.010 local terms energy: -726.072193 where: bonds (distance) C4'-P energy: -163.539 bonds (distance) P-C4' energy: -155.213 flat angles C4'-P-C4' energy: -184.393 flat angles P-C4'-P energy: -79.146 tors. eta vs tors. theta energy: -143.781 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1879.710472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1879.710472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1879.710472 (E_RNA) where: Base-Base interactions energy: -1210.922 where: short stacking energy: -558.144 Base-Backbone interact. energy: -4.058 local terms energy: -664.730626 where: bonds (distance) C4'-P energy: -150.562 bonds (distance) P-C4' energy: -149.373 flat angles C4'-P-C4' energy: -165.949 flat angles P-C4'-P energy: -91.380 tors. eta vs tors. theta energy: -107.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1846.912590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1846.912590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1846.912590 (E_RNA) where: Base-Base interactions energy: -1223.559 where: short stacking energy: -595.260 Base-Backbone interact. energy: 3.536 local terms energy: -626.890106 where: bonds (distance) C4'-P energy: -123.236 bonds (distance) P-C4' energy: -152.228 flat angles C4'-P-C4' energy: -139.685 flat angles P-C4'-P energy: -80.224 tors. eta vs tors. theta energy: -131.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -1162.724285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.724285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.724285 (E_RNA) where: Base-Base interactions energy: -662.394 where: short stacking energy: -321.108 Base-Backbone interact. energy: 6.674 local terms energy: -507.004267 where: bonds (distance) C4'-P energy: -136.572 bonds (distance) P-C4' energy: -154.270 flat angles C4'-P-C4' energy: -114.393 flat angles P-C4'-P energy: -85.276 tors. eta vs tors. theta energy: -16.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -3119.473844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3119.473844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3119.473844 (E_RNA) where: Base-Base interactions energy: -2173.296 where: short stacking energy: -942.090 Base-Backbone interact. energy: -0.367 local terms energy: -945.811098 where: bonds (distance) C4'-P energy: -167.956 bonds (distance) P-C4' energy: -181.794 flat angles C4'-P-C4' energy: -211.026 flat angles P-C4'-P energy: -145.090 tors. eta vs tors. theta energy: -239.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -3007.525483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3007.525483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3007.525483 (E_RNA) where: Base-Base interactions energy: -2075.641 where: short stacking energy: -901.020 Base-Backbone interact. energy: -1.654 local terms energy: -930.230260 where: bonds (distance) C4'-P energy: -178.040 bonds (distance) P-C4' energy: -190.037 flat angles C4'-P-C4' energy: -205.011 flat angles P-C4'-P energy: -128.547 tors. eta vs tors. theta energy: -228.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -2851.595273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2851.595273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2851.595273 (E_RNA) where: Base-Base interactions energy: -1953.966 where: short stacking energy: -859.658 Base-Backbone interact. energy: 0.558 local terms energy: -898.187031 where: bonds (distance) C4'-P energy: -175.624 bonds (distance) P-C4' energy: -168.008 flat angles C4'-P-C4' energy: -194.728 flat angles P-C4'-P energy: -139.095 tors. eta vs tors. theta energy: -220.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -2832.669574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2832.669574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2832.669574 (E_RNA) where: Base-Base interactions energy: -1959.676 where: short stacking energy: -843.278 Base-Backbone interact. energy: -5.399 local terms energy: -867.594319 where: bonds (distance) C4'-P energy: -145.061 bonds (distance) P-C4' energy: -176.163 flat angles C4'-P-C4' energy: -208.593 flat angles P-C4'-P energy: -125.333 tors. eta vs tors. theta energy: -212.444 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -2583.864428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2583.864428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2583.864428 (E_RNA) where: Base-Base interactions energy: -1776.185 where: short stacking energy: -816.797 Base-Backbone interact. energy: -4.436 local terms energy: -803.243756 where: bonds (distance) C4'-P energy: -147.232 bonds (distance) P-C4' energy: -166.894 flat angles C4'-P-C4' energy: -167.290 flat angles P-C4'-P energy: -112.224 tors. eta vs tors. theta energy: -209.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -2448.114552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2448.114552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2448.114552 (E_RNA) where: Base-Base interactions energy: -1670.101 where: short stacking energy: -730.123 Base-Backbone interact. energy: -1.126 local terms energy: -776.887597 where: bonds (distance) C4'-P energy: -139.673 bonds (distance) P-C4' energy: -169.093 flat angles C4'-P-C4' energy: -180.310 flat angles P-C4'-P energy: -116.058 tors. eta vs tors. theta energy: -171.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -2180.418601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2180.418601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2180.418601 (E_RNA) where: Base-Base interactions energy: -1455.075 where: short stacking energy: -685.075 Base-Backbone interact. energy: -1.277 local terms energy: -724.066705 where: bonds (distance) C4'-P energy: -152.131 bonds (distance) P-C4' energy: -156.419 flat angles C4'-P-C4' energy: -161.134 flat angles P-C4'-P energy: -103.190 tors. eta vs tors. theta energy: -151.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1842.033698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1842.033698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1842.033698 (E_RNA) where: Base-Base interactions energy: -1197.405 where: short stacking energy: -534.578 Base-Backbone interact. energy: -0.129 local terms energy: -644.499524 where: bonds (distance) C4'-P energy: -159.358 bonds (distance) P-C4' energy: -164.816 flat angles C4'-P-C4' energy: -145.002 flat angles P-C4'-P energy: -85.307 tors. eta vs tors. theta energy: -90.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1908.640133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1908.640133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1908.640133 (E_RNA) where: Base-Base interactions energy: -1262.948 where: short stacking energy: -569.778 Base-Backbone interact. energy: 4.960 local terms energy: -650.652835 where: bonds (distance) C4'-P energy: -137.140 bonds (distance) P-C4' energy: -147.625 flat angles C4'-P-C4' energy: -172.271 flat angles P-C4'-P energy: -83.761 tors. eta vs tors. theta energy: -109.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -1242.734334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.734334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.734334 (E_RNA) where: Base-Base interactions energy: -696.919 where: short stacking energy: -355.475 Base-Backbone interact. energy: 3.590 local terms energy: -549.405547 where: bonds (distance) C4'-P energy: -138.114 bonds (distance) P-C4' energy: -155.864 flat angles C4'-P-C4' energy: -140.812 flat angles P-C4'-P energy: -77.116 tors. eta vs tors. theta energy: -37.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -3125.313382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3125.313382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3125.313382 (E_RNA) where: Base-Base interactions energy: -2172.666 where: short stacking energy: -938.997 Base-Backbone interact. energy: -8.965 local terms energy: -943.682496 where: bonds (distance) C4'-P energy: -183.957 bonds (distance) P-C4' energy: -172.605 flat angles C4'-P-C4' energy: -206.581 flat angles P-C4'-P energy: -136.710 tors. eta vs tors. theta energy: -243.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -2974.726135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2974.726135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2974.726135 (E_RNA) where: Base-Base interactions energy: -2077.939 where: short stacking energy: -885.481 Base-Backbone interact. energy: 0.140 local terms energy: -896.927616 where: bonds (distance) C4'-P energy: -180.940 bonds (distance) P-C4' energy: -165.792 flat angles C4'-P-C4' energy: -208.742 flat angles P-C4'-P energy: -123.184 tors. eta vs tors. theta energy: -218.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -2850.375486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2850.375486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2850.375486 (E_RNA) where: Base-Base interactions energy: -1929.421 where: short stacking energy: -857.792 Base-Backbone interact. energy: -4.867 local terms energy: -916.087132 where: bonds (distance) C4'-P energy: -182.653 bonds (distance) P-C4' energy: -182.408 flat angles C4'-P-C4' energy: -207.166 flat angles P-C4'-P energy: -119.227 tors. eta vs tors. theta energy: -224.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -2758.863804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2758.863804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2758.863804 (E_RNA) where: Base-Base interactions energy: -1911.016 where: short stacking energy: -820.428 Base-Backbone interact. energy: -1.320 local terms energy: -846.527359 where: bonds (distance) C4'-P energy: -165.973 bonds (distance) P-C4' energy: -183.432 flat angles C4'-P-C4' energy: -190.045 flat angles P-C4'-P energy: -113.080 tors. eta vs tors. theta energy: -193.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -2565.917554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2565.917554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2565.917554 (E_RNA) where: Base-Base interactions energy: -1737.657 where: short stacking energy: -777.580 Base-Backbone interact. energy: -2.371 local terms energy: -825.888981 where: bonds (distance) C4'-P energy: -157.261 bonds (distance) P-C4' energy: -167.408 flat angles C4'-P-C4' energy: -187.751 flat angles P-C4'-P energy: -129.072 tors. eta vs tors. theta energy: -184.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -2470.190830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2470.190830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2470.190830 (E_RNA) where: Base-Base interactions energy: -1717.846 where: short stacking energy: -758.781 Base-Backbone interact. energy: 1.685 local terms energy: -754.029621 where: bonds (distance) C4'-P energy: -161.581 bonds (distance) P-C4' energy: -145.689 flat angles C4'-P-C4' energy: -182.351 flat angles P-C4'-P energy: -96.797 tors. eta vs tors. theta energy: -167.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -2151.970502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2151.970502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2151.970502 (E_RNA) where: Base-Base interactions energy: -1413.418 where: short stacking energy: -643.562 Base-Backbone interact. energy: 6.640 local terms energy: -745.191808 where: bonds (distance) C4'-P energy: -162.174 bonds (distance) P-C4' energy: -160.387 flat angles C4'-P-C4' energy: -166.860 flat angles P-C4'-P energy: -113.505 tors. eta vs tors. theta energy: -142.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -2008.453413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2008.453413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2008.453413 (E_RNA) where: Base-Base interactions energy: -1299.006 where: short stacking energy: -617.570 Base-Backbone interact. energy: -6.920 local terms energy: -702.527258 where: bonds (distance) C4'-P energy: -141.883 bonds (distance) P-C4' energy: -146.307 flat angles C4'-P-C4' energy: -174.892 flat angles P-C4'-P energy: -87.468 tors. eta vs tors. theta energy: -151.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1874.090223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1874.090223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1874.090223 (E_RNA) where: Base-Base interactions energy: -1242.629 where: short stacking energy: -557.879 Base-Backbone interact. energy: -3.092 local terms energy: -628.369486 where: bonds (distance) C4'-P energy: -148.839 bonds (distance) P-C4' energy: -136.967 flat angles C4'-P-C4' energy: -147.365 flat angles P-C4'-P energy: -89.894 tors. eta vs tors. theta energy: -105.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -1255.679415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1255.679415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1255.679415 (E_RNA) where: Base-Base interactions energy: -732.963 where: short stacking energy: -391.298 Base-Backbone interact. energy: 2.298 local terms energy: -525.014427 where: bonds (distance) C4'-P energy: -131.983 bonds (distance) P-C4' energy: -152.847 flat angles C4'-P-C4' energy: -139.031 flat angles P-C4'-P energy: -69.304 tors. eta vs tors. theta energy: -31.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -3118.114183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3118.114183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3118.114183 (E_RNA) where: Base-Base interactions energy: -2185.627 where: short stacking energy: -938.236 Base-Backbone interact. energy: -4.608 local terms energy: -927.879451 where: bonds (distance) C4'-P energy: -164.051 bonds (distance) P-C4' energy: -180.620 flat angles C4'-P-C4' energy: -203.223 flat angles P-C4'-P energy: -135.290 tors. eta vs tors. theta energy: -244.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -3045.572139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3045.572139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3045.572139 (E_RNA) where: Base-Base interactions energy: -2104.979 where: short stacking energy: -920.427 Base-Backbone interact. energy: 9.631 local terms energy: -950.224801 where: bonds (distance) C4'-P energy: -173.803 bonds (distance) P-C4' energy: -178.731 flat angles C4'-P-C4' energy: -223.244 flat angles P-C4'-P energy: -141.537 tors. eta vs tors. theta energy: -232.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -2844.045990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2844.045990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2844.045990 (E_RNA) where: Base-Base interactions energy: -1935.007 where: short stacking energy: -858.536 Base-Backbone interact. energy: -2.526 local terms energy: -906.513023 where: bonds (distance) C4'-P energy: -180.475 bonds (distance) P-C4' energy: -161.105 flat angles C4'-P-C4' energy: -194.969 flat angles P-C4'-P energy: -133.416 tors. eta vs tors. theta energy: -236.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -2767.597213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2767.597213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2767.597213 (E_RNA) where: Base-Base interactions energy: -1931.420 where: short stacking energy: -831.751 Base-Backbone interact. energy: -4.068 local terms energy: -832.108681 where: bonds (distance) C4'-P energy: -166.093 bonds (distance) P-C4' energy: -166.847 flat angles C4'-P-C4' energy: -178.344 flat angles P-C4'-P energy: -126.073 tors. eta vs tors. theta energy: -194.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -2538.374543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2538.374543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2538.374543 (E_RNA) where: Base-Base interactions energy: -1761.653 where: short stacking energy: -785.542 Base-Backbone interact. energy: 5.697 local terms energy: -782.417960 where: bonds (distance) C4'-P energy: -162.878 bonds (distance) P-C4' energy: -159.687 flat angles C4'-P-C4' energy: -172.283 flat angles P-C4'-P energy: -121.492 tors. eta vs tors. theta energy: -166.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -2519.136563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2519.136563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2519.136563 (E_RNA) where: Base-Base interactions energy: -1725.855 where: short stacking energy: -752.159 Base-Backbone interact. energy: -4.605 local terms energy: -788.677007 where: bonds (distance) C4'-P energy: -157.042 bonds (distance) P-C4' energy: -172.897 flat angles C4'-P-C4' energy: -184.897 flat angles P-C4'-P energy: -112.073 tors. eta vs tors. theta energy: -161.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -2133.098582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.098582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.098582 (E_RNA) where: Base-Base interactions energy: -1366.952 where: short stacking energy: -640.752 Base-Backbone interact. energy: -4.635 local terms energy: -761.512241 where: bonds (distance) C4'-P energy: -188.096 bonds (distance) P-C4' energy: -157.029 flat angles C4'-P-C4' energy: -183.157 flat angles P-C4'-P energy: -90.618 tors. eta vs tors. theta energy: -142.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1972.857152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1972.857152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1972.857152 (E_RNA) where: Base-Base interactions energy: -1267.517 where: short stacking energy: -577.801 Base-Backbone interact. energy: -2.792 local terms energy: -702.547631 where: bonds (distance) C4'-P energy: -148.327 bonds (distance) P-C4' energy: -165.144 flat angles C4'-P-C4' energy: -170.465 flat angles P-C4'-P energy: -103.023 tors. eta vs tors. theta energy: -115.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1929.946683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.946683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.946683 (E_RNA) where: Base-Base interactions energy: -1288.192 where: short stacking energy: -565.960 Base-Backbone interact. energy: 3.029 local terms energy: -644.783646 where: bonds (distance) C4'-P energy: -141.543 bonds (distance) P-C4' energy: -154.442 flat angles C4'-P-C4' energy: -146.247 flat angles P-C4'-P energy: -105.076 tors. eta vs tors. theta energy: -97.476 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -1196.944954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.944954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.944954 (E_RNA) where: Base-Base interactions energy: -702.406 where: short stacking energy: -366.145 Base-Backbone interact. energy: -4.255 local terms energy: -490.284606 where: bonds (distance) C4'-P energy: -143.958 bonds (distance) P-C4' energy: -141.259 flat angles C4'-P-C4' energy: -141.497 flat angles P-C4'-P energy: -60.783 tors. eta vs tors. theta energy: -2.787 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -3132.512622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3132.512622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3132.512622 (E_RNA) where: Base-Base interactions energy: -2157.028 where: short stacking energy: -956.040 Base-Backbone interact. energy: -4.230 local terms energy: -971.253742 where: bonds (distance) C4'-P energy: -186.443 bonds (distance) P-C4' energy: -188.401 flat angles C4'-P-C4' energy: -209.846 flat angles P-C4'-P energy: -145.092 tors. eta vs tors. theta energy: -241.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -3065.747723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3065.747723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3065.747723 (E_RNA) where: Base-Base interactions energy: -2130.616 where: short stacking energy: -928.930 Base-Backbone interact. energy: 0.599 local terms energy: -935.730708 where: bonds (distance) C4'-P energy: -172.965 bonds (distance) P-C4' energy: -184.421 flat angles C4'-P-C4' energy: -202.202 flat angles P-C4'-P energy: -126.901 tors. eta vs tors. theta energy: -249.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -2853.971493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2853.971493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2853.971493 (E_RNA) where: Base-Base interactions energy: -1946.200 where: short stacking energy: -879.112 Base-Backbone interact. energy: 3.466 local terms energy: -911.237351 where: bonds (distance) C4'-P energy: -165.178 bonds (distance) P-C4' energy: -172.130 flat angles C4'-P-C4' energy: -202.029 flat angles P-C4'-P energy: -129.198 tors. eta vs tors. theta energy: -242.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -2807.499215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2807.499215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2807.499215 (E_RNA) where: Base-Base interactions energy: -1955.326 where: short stacking energy: -872.275 Base-Backbone interact. energy: 0.133 local terms energy: -852.306618 where: bonds (distance) C4'-P energy: -165.842 bonds (distance) P-C4' energy: -170.737 flat angles C4'-P-C4' energy: -196.736 flat angles P-C4'-P energy: -111.264 tors. eta vs tors. theta energy: -207.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -2596.819047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2596.819047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2596.819047 (E_RNA) where: Base-Base interactions energy: -1783.982 where: short stacking energy: -792.028 Base-Backbone interact. energy: -1.183 local terms energy: -811.654851 where: bonds (distance) C4'-P energy: -144.236 bonds (distance) P-C4' energy: -166.892 flat angles C4'-P-C4' energy: -188.999 flat angles P-C4'-P energy: -133.767 tors. eta vs tors. theta energy: -177.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -2514.612564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2514.612564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2514.612564 (E_RNA) where: Base-Base interactions energy: -1730.131 where: short stacking energy: -738.599 Base-Backbone interact. energy: 5.342 local terms energy: -789.824405 where: bonds (distance) C4'-P energy: -156.785 bonds (distance) P-C4' energy: -178.429 flat angles C4'-P-C4' energy: -162.538 flat angles P-C4'-P energy: -118.169 tors. eta vs tors. theta energy: -173.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -2085.523634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2085.523634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2085.523634 (E_RNA) where: Base-Base interactions energy: -1371.842 where: short stacking energy: -633.339 Base-Backbone interact. energy: -4.846 local terms energy: -708.835684 where: bonds (distance) C4'-P energy: -161.735 bonds (distance) P-C4' energy: -155.381 flat angles C4'-P-C4' energy: -169.695 flat angles P-C4'-P energy: -72.924 tors. eta vs tors. theta energy: -149.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1992.026076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1992.026076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1992.026076 (E_RNA) where: Base-Base interactions energy: -1339.547 where: short stacking energy: -605.819 Base-Backbone interact. energy: -2.293 local terms energy: -650.186473 where: bonds (distance) C4'-P energy: -145.539 bonds (distance) P-C4' energy: -138.786 flat angles C4'-P-C4' energy: -145.704 flat angles P-C4'-P energy: -103.239 tors. eta vs tors. theta energy: -116.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1818.243550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1818.243550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.243550 (E_RNA) where: Base-Base interactions energy: -1229.493 where: short stacking energy: -557.843 Base-Backbone interact. energy: -1.262 local terms energy: -587.488789 where: bonds (distance) C4'-P energy: -132.292 bonds (distance) P-C4' energy: -150.781 flat angles C4'-P-C4' energy: -132.533 flat angles P-C4'-P energy: -67.599 tors. eta vs tors. theta energy: -104.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -1244.312294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.312294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.312294 (E_RNA) where: Base-Base interactions energy: -709.497 where: short stacking energy: -355.995 Base-Backbone interact. energy: -0.437 local terms energy: -534.378228 where: bonds (distance) C4'-P energy: -154.459 bonds (distance) P-C4' energy: -140.656 flat angles C4'-P-C4' energy: -153.735 flat angles P-C4'-P energy: -65.365 tors. eta vs tors. theta energy: -20.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -3124.949117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3124.949117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3124.949117 (E_RNA) where: Base-Base interactions energy: -2177.805 where: short stacking energy: -944.241 Base-Backbone interact. energy: -1.472 local terms energy: -945.672139 where: bonds (distance) C4'-P energy: -180.123 bonds (distance) P-C4' energy: -168.973 flat angles C4'-P-C4' energy: -201.725 flat angles P-C4'-P energy: -144.979 tors. eta vs tors. theta energy: -249.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -3045.611193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3045.611193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3045.611193 (E_RNA) where: Base-Base interactions energy: -2119.817 where: short stacking energy: -897.698 Base-Backbone interact. energy: 2.130 local terms energy: -927.924727 where: bonds (distance) C4'-P energy: -176.392 bonds (distance) P-C4' energy: -180.905 flat angles C4'-P-C4' energy: -196.493 flat angles P-C4'-P energy: -138.451 tors. eta vs tors. theta energy: -235.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -2820.439268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2820.439268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2820.439268 (E_RNA) where: Base-Base interactions energy: -1946.924 where: short stacking energy: -832.614 Base-Backbone interact. energy: 2.648 local terms energy: -876.162495 where: bonds (distance) C4'-P energy: -166.023 bonds (distance) P-C4' energy: -169.355 flat angles C4'-P-C4' energy: -197.740 flat angles P-C4'-P energy: -129.861 tors. eta vs tors. theta energy: -213.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -2810.534005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2810.534005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2810.534005 (E_RNA) where: Base-Base interactions energy: -1965.174 where: short stacking energy: -839.479 Base-Backbone interact. energy: -0.181 local terms energy: -845.179337 where: bonds (distance) C4'-P energy: -162.569 bonds (distance) P-C4' energy: -167.386 flat angles C4'-P-C4' energy: -187.552 flat angles P-C4'-P energy: -127.787 tors. eta vs tors. theta energy: -199.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -2660.976457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2660.976457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2660.976457 (E_RNA) where: Base-Base interactions energy: -1849.964 where: short stacking energy: -824.273 Base-Backbone interact. energy: -2.582 local terms energy: -808.430373 where: bonds (distance) C4'-P energy: -144.296 bonds (distance) P-C4' energy: -163.677 flat angles C4'-P-C4' energy: -193.697 flat angles P-C4'-P energy: -110.727 tors. eta vs tors. theta energy: -196.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -2516.377311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2516.377311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2516.377311 (E_RNA) where: Base-Base interactions energy: -1712.235 where: short stacking energy: -747.460 Base-Backbone interact. energy: -3.416 local terms energy: -800.726276 where: bonds (distance) C4'-P energy: -161.379 bonds (distance) P-C4' energy: -165.104 flat angles C4'-P-C4' energy: -168.578 flat angles P-C4'-P energy: -121.800 tors. eta vs tors. theta energy: -183.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -2100.667571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2100.667571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2100.667571 (E_RNA) where: Base-Base interactions energy: -1384.063 where: short stacking energy: -612.735 Base-Backbone interact. energy: -0.701 local terms energy: -715.904165 where: bonds (distance) C4'-P energy: -161.368 bonds (distance) P-C4' energy: -167.373 flat angles C4'-P-C4' energy: -179.292 flat angles P-C4'-P energy: -83.032 tors. eta vs tors. theta energy: -124.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1976.549205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1976.549205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1976.549205 (E_RNA) where: Base-Base interactions energy: -1308.346 where: short stacking energy: -588.671 Base-Backbone interact. energy: -1.814 local terms energy: -666.389247 where: bonds (distance) C4'-P energy: -154.046 bonds (distance) P-C4' energy: -164.292 flat angles C4'-P-C4' energy: -135.491 flat angles P-C4'-P energy: -89.514 tors. eta vs tors. theta energy: -123.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1866.873796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1866.873796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1866.873796 (E_RNA) where: Base-Base interactions energy: -1229.704 where: short stacking energy: -554.906 Base-Backbone interact. energy: 3.363 local terms energy: -640.532641 where: bonds (distance) C4'-P energy: -147.328 bonds (distance) P-C4' energy: -138.320 flat angles C4'-P-C4' energy: -152.677 flat angles P-C4'-P energy: -97.748 tors. eta vs tors. theta energy: -104.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -1292.897589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.897589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.897589 (E_RNA) where: Base-Base interactions energy: -759.767 where: short stacking energy: -391.328 Base-Backbone interact. energy: -1.692 local terms energy: -531.438332 where: bonds (distance) C4'-P energy: -144.070 bonds (distance) P-C4' energy: -151.551 flat angles C4'-P-C4' energy: -140.941 flat angles P-C4'-P energy: -66.957 tors. eta vs tors. theta energy: -27.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -3184.803721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3184.803721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3184.803721 (E_RNA) where: Base-Base interactions energy: -2247.013 where: short stacking energy: -961.956 Base-Backbone interact. energy: -8.092 local terms energy: -929.698419 where: bonds (distance) C4'-P energy: -176.890 bonds (distance) P-C4' energy: -170.412 flat angles C4'-P-C4' energy: -200.176 flat angles P-C4'-P energy: -132.788 tors. eta vs tors. theta energy: -249.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -3091.451560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3091.451560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3091.451560 (E_RNA) where: Base-Base interactions energy: -2131.950 where: short stacking energy: -934.721 Base-Backbone interact. energy: 2.120 local terms energy: -961.621284 where: bonds (distance) C4'-P energy: -183.209 bonds (distance) P-C4' energy: -191.114 flat angles C4'-P-C4' energy: -213.002 flat angles P-C4'-P energy: -137.919 tors. eta vs tors. theta energy: -236.378 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -2911.785279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2911.785279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2911.785279 (E_RNA) where: Base-Base interactions energy: -1983.892 where: short stacking energy: -884.455 Base-Backbone interact. energy: -2.990 local terms energy: -924.903746 where: bonds (distance) C4'-P energy: -167.164 bonds (distance) P-C4' energy: -187.041 flat angles C4'-P-C4' energy: -201.751 flat angles P-C4'-P energy: -135.836 tors. eta vs tors. theta energy: -233.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -2785.939177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2785.939177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2785.939177 (E_RNA) where: Base-Base interactions energy: -1951.394 where: short stacking energy: -862.210 Base-Backbone interact. energy: -3.312 local terms energy: -831.233324 where: bonds (distance) C4'-P energy: -165.080 bonds (distance) P-C4' energy: -169.695 flat angles C4'-P-C4' energy: -183.773 flat angles P-C4'-P energy: -109.959 tors. eta vs tors. theta energy: -202.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -2685.167823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2685.167823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2685.167823 (E_RNA) where: Base-Base interactions energy: -1867.093 where: short stacking energy: -782.447 Base-Backbone interact. energy: -1.550 local terms energy: -816.525083 where: bonds (distance) C4'-P energy: -139.810 bonds (distance) P-C4' energy: -187.679 flat angles C4'-P-C4' energy: -175.581 flat angles P-C4'-P energy: -127.630 tors. eta vs tors. theta energy: -185.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -2400.758863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2400.758863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2400.758863 (E_RNA) where: Base-Base interactions energy: -1613.391 where: short stacking energy: -754.036 Base-Backbone interact. energy: -0.325 local terms energy: -787.043563 where: bonds (distance) C4'-P energy: -170.077 bonds (distance) P-C4' energy: -158.564 flat angles C4'-P-C4' energy: -179.443 flat angles P-C4'-P energy: -97.762 tors. eta vs tors. theta energy: -181.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -2150.949733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2150.949733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2150.949733 (E_RNA) where: Base-Base interactions energy: -1397.308 where: short stacking energy: -668.188 Base-Backbone interact. energy: -2.724 local terms energy: -750.917616 where: bonds (distance) C4'-P energy: -141.538 bonds (distance) P-C4' energy: -168.494 flat angles C4'-P-C4' energy: -174.164 flat angles P-C4'-P energy: -105.943 tors. eta vs tors. theta energy: -160.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -2024.924106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2024.924106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2024.924106 (E_RNA) where: Base-Base interactions energy: -1339.710 where: short stacking energy: -607.022 Base-Backbone interact. energy: 1.873 local terms energy: -687.087049 where: bonds (distance) C4'-P energy: -137.750 bonds (distance) P-C4' energy: -150.882 flat angles C4'-P-C4' energy: -163.051 flat angles P-C4'-P energy: -103.417 tors. eta vs tors. theta energy: -131.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1827.186313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1827.186313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1827.186313 (E_RNA) where: Base-Base interactions energy: -1207.487 where: short stacking energy: -536.550 Base-Backbone interact. energy: -2.364 local terms energy: -617.335885 where: bonds (distance) C4'-P energy: -140.391 bonds (distance) P-C4' energy: -137.471 flat angles C4'-P-C4' energy: -150.449 flat angles P-C4'-P energy: -89.169 tors. eta vs tors. theta energy: -99.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -1324.423160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.423160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.423160 (E_RNA) where: Base-Base interactions energy: -824.606 where: short stacking energy: -386.575 Base-Backbone interact. energy: 0.476 local terms energy: -500.293567 where: bonds (distance) C4'-P energy: -125.529 bonds (distance) P-C4' energy: -162.570 flat angles C4'-P-C4' energy: -111.996 flat angles P-C4'-P energy: -73.773 tors. eta vs tors. theta energy: -26.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -3141.949008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3141.949008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3141.949008 (E_RNA) where: Base-Base interactions energy: -2194.199 where: short stacking energy: -949.552 Base-Backbone interact. energy: -6.269 local terms energy: -941.481179 where: bonds (distance) C4'-P energy: -187.138 bonds (distance) P-C4' energy: -176.683 flat angles C4'-P-C4' energy: -195.252 flat angles P-C4'-P energy: -134.458 tors. eta vs tors. theta energy: -247.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -3088.092968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3088.092968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3088.092968 (E_RNA) where: Base-Base interactions energy: -2174.491 where: short stacking energy: -930.086 Base-Backbone interact. energy: -0.420 local terms energy: -913.181870 where: bonds (distance) C4'-P energy: -161.309 bonds (distance) P-C4' energy: -179.922 flat angles C4'-P-C4' energy: -197.076 flat angles P-C4'-P energy: -147.967 tors. eta vs tors. theta energy: -226.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -2834.952312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2834.952312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2834.952312 (E_RNA) where: Base-Base interactions energy: -1939.022 where: short stacking energy: -879.007 Base-Backbone interact. energy: -6.130 local terms energy: -889.800706 where: bonds (distance) C4'-P energy: -171.442 bonds (distance) P-C4' energy: -179.577 flat angles C4'-P-C4' energy: -193.537 flat angles P-C4'-P energy: -114.094 tors. eta vs tors. theta energy: -231.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -2737.166196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2737.166196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2737.166196 (E_RNA) where: Base-Base interactions energy: -1899.921 where: short stacking energy: -837.654 Base-Backbone interact. energy: 2.521 local terms energy: -839.765922 where: bonds (distance) C4'-P energy: -163.282 bonds (distance) P-C4' energy: -164.443 flat angles C4'-P-C4' energy: -195.302 flat angles P-C4'-P energy: -121.288 tors. eta vs tors. theta energy: -195.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -2657.599043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2657.599043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2657.599043 (E_RNA) where: Base-Base interactions energy: -1849.519 where: short stacking energy: -799.550 Base-Backbone interact. energy: -0.353 local terms energy: -807.726924 where: bonds (distance) C4'-P energy: -160.692 bonds (distance) P-C4' energy: -178.064 flat angles C4'-P-C4' energy: -170.677 flat angles P-C4'-P energy: -121.118 tors. eta vs tors. theta energy: -177.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -2415.123797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2415.123797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2415.123797 (E_RNA) where: Base-Base interactions energy: -1668.480 where: short stacking energy: -719.688 Base-Backbone interact. energy: 0.760 local terms energy: -747.403516 where: bonds (distance) C4'-P energy: -149.705 bonds (distance) P-C4' energy: -151.141 flat angles C4'-P-C4' energy: -170.753 flat angles P-C4'-P energy: -110.862 tors. eta vs tors. theta energy: -164.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -2186.986619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2186.986619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2186.986619 (E_RNA) where: Base-Base interactions energy: -1468.385 where: short stacking energy: -661.070 Base-Backbone interact. energy: 1.561 local terms energy: -720.163180 where: bonds (distance) C4'-P energy: -145.230 bonds (distance) P-C4' energy: -158.333 flat angles C4'-P-C4' energy: -181.056 flat angles P-C4'-P energy: -102.106 tors. eta vs tors. theta energy: -133.438 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1964.804474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.804474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.804474 (E_RNA) where: Base-Base interactions energy: -1324.317 where: short stacking energy: -632.354 Base-Backbone interact. energy: -2.049 local terms energy: -638.439193 where: bonds (distance) C4'-P energy: -125.309 bonds (distance) P-C4' energy: -139.637 flat angles C4'-P-C4' energy: -147.996 flat angles P-C4'-P energy: -92.305 tors. eta vs tors. theta energy: -133.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1817.915063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1817.915063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1817.915063 (E_RNA) where: Base-Base interactions energy: -1206.237 where: short stacking energy: -532.506 Base-Backbone interact. energy: 2.172 local terms energy: -613.850182 where: bonds (distance) C4'-P energy: -139.439 bonds (distance) P-C4' energy: -133.487 flat angles C4'-P-C4' energy: -138.917 flat angles P-C4'-P energy: -97.994 tors. eta vs tors. theta energy: -104.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -1374.442558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.442558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.442558 (E_RNA) where: Base-Base interactions energy: -882.892 where: short stacking energy: -431.818 Base-Backbone interact. energy: -0.850 local terms energy: -490.700631 where: bonds (distance) C4'-P energy: -115.517 bonds (distance) P-C4' energy: -129.862 flat angles C4'-P-C4' energy: -114.929 flat angles P-C4'-P energy: -89.982 tors. eta vs tors. theta energy: -40.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -3159.741010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3159.741010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3159.741010 (E_RNA) where: Base-Base interactions energy: -2198.542 where: short stacking energy: -944.197 Base-Backbone interact. energy: -1.569 local terms energy: -959.630434 where: bonds (distance) C4'-P energy: -181.413 bonds (distance) P-C4' energy: -169.005 flat angles C4'-P-C4' energy: -203.695 flat angles P-C4'-P energy: -143.912 tors. eta vs tors. theta energy: -261.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -3080.602866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3080.602866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3080.602866 (E_RNA) where: Base-Base interactions energy: -2155.303 where: short stacking energy: -942.170 Base-Backbone interact. energy: -3.487 local terms energy: -921.812792 where: bonds (distance) C4'-P energy: -160.003 bonds (distance) P-C4' energy: -180.901 flat angles C4'-P-C4' energy: -222.777 flat angles P-C4'-P energy: -123.502 tors. eta vs tors. theta energy: -234.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -2870.782679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2870.782679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2870.782679 (E_RNA) where: Base-Base interactions energy: -1970.558 where: short stacking energy: -866.402 Base-Backbone interact. energy: -5.993 local terms energy: -894.231750 where: bonds (distance) C4'-P energy: -160.512 bonds (distance) P-C4' energy: -174.554 flat angles C4'-P-C4' energy: -199.605 flat angles P-C4'-P energy: -126.142 tors. eta vs tors. theta energy: -233.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -2795.416313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2795.416313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2795.416313 (E_RNA) where: Base-Base interactions energy: -1950.677 where: short stacking energy: -878.012 Base-Backbone interact. energy: 0.525 local terms energy: -845.263912 where: bonds (distance) C4'-P energy: -164.104 bonds (distance) P-C4' energy: -170.252 flat angles C4'-P-C4' energy: -191.462 flat angles P-C4'-P energy: -113.851 tors. eta vs tors. theta energy: -205.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -2673.612806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2673.612806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2673.612806 (E_RNA) where: Base-Base interactions energy: -1852.854 where: short stacking energy: -787.083 Base-Backbone interact. energy: 5.260 local terms energy: -826.019451 where: bonds (distance) C4'-P energy: -159.072 bonds (distance) P-C4' energy: -159.367 flat angles C4'-P-C4' energy: -201.570 flat angles P-C4'-P energy: -102.351 tors. eta vs tors. theta energy: -203.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -2379.843525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2379.843525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2379.843525 (E_RNA) where: Base-Base interactions energy: -1653.904 where: short stacking energy: -730.021 Base-Backbone interact. energy: -4.040 local terms energy: -721.899133 where: bonds (distance) C4'-P energy: -153.304 bonds (distance) P-C4' energy: -154.773 flat angles C4'-P-C4' energy: -164.759 flat angles P-C4'-P energy: -85.290 tors. eta vs tors. theta energy: -163.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -2215.389966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2215.389966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2215.389966 (E_RNA) where: Base-Base interactions energy: -1502.468 where: short stacking energy: -656.390 Base-Backbone interact. energy: -0.495 local terms energy: -712.427361 where: bonds (distance) C4'-P energy: -140.278 bonds (distance) P-C4' energy: -171.688 flat angles C4'-P-C4' energy: -187.234 flat angles P-C4'-P energy: -70.880 tors. eta vs tors. theta energy: -142.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -2019.904371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2019.904371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2019.904371 (E_RNA) where: Base-Base interactions energy: -1294.795 where: short stacking energy: -589.830 Base-Backbone interact. energy: 2.954 local terms energy: -728.063788 where: bonds (distance) C4'-P energy: -155.451 bonds (distance) P-C4' energy: -165.548 flat angles C4'-P-C4' energy: -168.903 flat angles P-C4'-P energy: -109.976 tors. eta vs tors. theta energy: -128.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1782.170410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1782.170410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1782.170410 (E_RNA) where: Base-Base interactions energy: -1145.522 where: short stacking energy: -517.891 Base-Backbone interact. energy: 3.173 local terms energy: -639.821367 where: bonds (distance) C4'-P energy: -151.268 bonds (distance) P-C4' energy: -160.990 flat angles C4'-P-C4' energy: -154.429 flat angles P-C4'-P energy: -94.392 tors. eta vs tors. theta energy: -78.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -1330.660822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.660822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.660822 (E_RNA) where: Base-Base interactions energy: -812.819 where: short stacking energy: -389.190 Base-Backbone interact. energy: 2.912 local terms energy: -520.753808 where: bonds (distance) C4'-P energy: -126.089 bonds (distance) P-C4' energy: -149.768 flat angles C4'-P-C4' energy: -146.459 flat angles P-C4'-P energy: -69.166 tors. eta vs tors. theta energy: -29.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -3149.572697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3149.572697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3149.572697 (E_RNA) where: Base-Base interactions energy: -2211.695 where: short stacking energy: -975.717 Base-Backbone interact. energy: -2.392 local terms energy: -935.485410 where: bonds (distance) C4'-P energy: -172.047 bonds (distance) P-C4' energy: -177.078 flat angles C4'-P-C4' energy: -204.771 flat angles P-C4'-P energy: -129.139 tors. eta vs tors. theta energy: -252.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -3100.076695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3100.076695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3100.076695 (E_RNA) where: Base-Base interactions energy: -2167.666 where: short stacking energy: -940.778 Base-Backbone interact. energy: -4.172 local terms energy: -928.238554 where: bonds (distance) C4'-P energy: -178.757 bonds (distance) P-C4' energy: -184.940 flat angles C4'-P-C4' energy: -207.573 flat angles P-C4'-P energy: -123.587 tors. eta vs tors. theta energy: -233.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -2903.002914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2903.002914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2903.002914 (E_RNA) where: Base-Base interactions energy: -2009.259 where: short stacking energy: -905.075 Base-Backbone interact. energy: -4.935 local terms energy: -888.808956 where: bonds (distance) C4'-P energy: -163.673 bonds (distance) P-C4' energy: -170.077 flat angles C4'-P-C4' energy: -191.309 flat angles P-C4'-P energy: -128.260 tors. eta vs tors. theta energy: -235.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -2776.238216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2776.238216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2776.238216 (E_RNA) where: Base-Base interactions energy: -1936.789 where: short stacking energy: -846.997 Base-Backbone interact. energy: -0.412 local terms energy: -839.037249 where: bonds (distance) C4'-P energy: -147.196 bonds (distance) P-C4' energy: -160.791 flat angles C4'-P-C4' energy: -196.590 flat angles P-C4'-P energy: -124.616 tors. eta vs tors. theta energy: -209.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -2652.196753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2652.196753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2652.196753 (E_RNA) where: Base-Base interactions energy: -1850.314 where: short stacking energy: -761.986 Base-Backbone interact. energy: 0.553 local terms energy: -802.436414 where: bonds (distance) C4'-P energy: -169.643 bonds (distance) P-C4' energy: -157.418 flat angles C4'-P-C4' energy: -186.950 flat angles P-C4'-P energy: -113.832 tors. eta vs tors. theta energy: -174.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -2397.757768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2397.757768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2397.757768 (E_RNA) where: Base-Base interactions energy: -1646.545 where: short stacking energy: -712.843 Base-Backbone interact. energy: 1.386 local terms energy: -752.599168 where: bonds (distance) C4'-P energy: -129.503 bonds (distance) P-C4' energy: -157.685 flat angles C4'-P-C4' energy: -172.994 flat angles P-C4'-P energy: -125.157 tors. eta vs tors. theta energy: -167.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -2255.553517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2255.553517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2255.553517 (E_RNA) where: Base-Base interactions energy: -1538.370 where: short stacking energy: -677.916 Base-Backbone interact. energy: -1.978 local terms energy: -715.205995 where: bonds (distance) C4'-P energy: -149.643 bonds (distance) P-C4' energy: -133.396 flat angles C4'-P-C4' energy: -175.428 flat angles P-C4'-P energy: -110.784 tors. eta vs tors. theta energy: -145.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1934.763792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1934.763792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1934.763792 (E_RNA) where: Base-Base interactions energy: -1292.092 where: short stacking energy: -622.717 Base-Backbone interact. energy: 1.259 local terms energy: -643.931572 where: bonds (distance) C4'-P energy: -119.387 bonds (distance) P-C4' energy: -169.593 flat angles C4'-P-C4' energy: -151.183 flat angles P-C4'-P energy: -85.025 tors. eta vs tors. theta energy: -118.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1657.443342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.443342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.443342 (E_RNA) where: Base-Base interactions energy: -1061.038 where: short stacking energy: -486.349 Base-Backbone interact. energy: 0.442 local terms energy: -596.846428 where: bonds (distance) C4'-P energy: -151.682 bonds (distance) P-C4' energy: -164.234 flat angles C4'-P-C4' energy: -136.297 flat angles P-C4'-P energy: -72.988 tors. eta vs tors. theta energy: -71.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -1364.792750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1364.792750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.792750 (E_RNA) where: Base-Base interactions energy: -816.158 where: short stacking energy: -374.772 Base-Backbone interact. energy: -3.220 local terms energy: -545.415630 where: bonds (distance) C4'-P energy: -143.041 bonds (distance) P-C4' energy: -135.911 flat angles C4'-P-C4' energy: -135.380 flat angles P-C4'-P energy: -91.474 tors. eta vs tors. theta energy: -39.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -3131.573963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3131.573963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3131.573963 (E_RNA) where: Base-Base interactions energy: -2206.828 where: short stacking energy: -932.840 Base-Backbone interact. energy: -2.699 local terms energy: -922.046752 where: bonds (distance) C4'-P energy: -174.277 bonds (distance) P-C4' energy: -177.773 flat angles C4'-P-C4' energy: -191.942 flat angles P-C4'-P energy: -127.896 tors. eta vs tors. theta energy: -250.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -3067.678833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3067.678833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3067.678833 (E_RNA) where: Base-Base interactions energy: -2146.572 where: short stacking energy: -927.157 Base-Backbone interact. energy: -2.822 local terms energy: -918.284573 where: bonds (distance) C4'-P energy: -159.159 bonds (distance) P-C4' energy: -192.246 flat angles C4'-P-C4' energy: -206.060 flat angles P-C4'-P energy: -127.428 tors. eta vs tors. theta energy: -233.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -2894.660064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2894.660064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2894.660064 (E_RNA) where: Base-Base interactions energy: -1999.445 where: short stacking energy: -855.364 Base-Backbone interact. energy: -3.995 local terms energy: -891.220495 where: bonds (distance) C4'-P energy: -162.895 bonds (distance) P-C4' energy: -181.278 flat angles C4'-P-C4' energy: -198.003 flat angles P-C4'-P energy: -123.021 tors. eta vs tors. theta energy: -226.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -2892.181355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2892.181355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2892.181355 (E_RNA) where: Base-Base interactions energy: -2042.475 where: short stacking energy: -895.757 Base-Backbone interact. energy: -7.511 local terms energy: -842.195754 where: bonds (distance) C4'-P energy: -164.494 bonds (distance) P-C4' energy: -162.339 flat angles C4'-P-C4' energy: -194.476 flat angles P-C4'-P energy: -96.355 tors. eta vs tors. theta energy: -224.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -2702.447771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2702.447771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2702.447771 (E_RNA) where: Base-Base interactions energy: -1878.227 where: short stacking energy: -801.380 Base-Backbone interact. energy: 1.175 local terms energy: -825.395988 where: bonds (distance) C4'-P energy: -148.379 bonds (distance) P-C4' energy: -167.241 flat angles C4'-P-C4' energy: -182.748 flat angles P-C4'-P energy: -130.028 tors. eta vs tors. theta energy: -197.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -2485.077770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2485.077770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2485.077770 (E_RNA) where: Base-Base interactions energy: -1720.138 where: short stacking energy: -748.611 Base-Backbone interact. energy: 2.764 local terms energy: -767.703865 where: bonds (distance) C4'-P energy: -154.267 bonds (distance) P-C4' energy: -143.115 flat angles C4'-P-C4' energy: -191.154 flat angles P-C4'-P energy: -113.837 tors. eta vs tors. theta energy: -165.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -2280.949930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2280.949930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2280.949930 (E_RNA) where: Base-Base interactions energy: -1542.564 where: short stacking energy: -666.502 Base-Backbone interact. energy: -1.142 local terms energy: -737.243797 where: bonds (distance) C4'-P energy: -162.632 bonds (distance) P-C4' energy: -145.377 flat angles C4'-P-C4' energy: -174.423 flat angles P-C4'-P energy: -94.698 tors. eta vs tors. theta energy: -160.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1924.580040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1924.580040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1924.580040 (E_RNA) where: Base-Base interactions energy: -1242.749 where: short stacking energy: -563.108 Base-Backbone interact. energy: -3.622 local terms energy: -678.209123 where: bonds (distance) C4'-P energy: -153.550 bonds (distance) P-C4' energy: -136.942 flat angles C4'-P-C4' energy: -175.492 flat angles P-C4'-P energy: -107.216 tors. eta vs tors. theta energy: -105.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1724.016190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1724.016190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.016190 (E_RNA) where: Base-Base interactions energy: -1111.844 where: short stacking energy: -528.719 Base-Backbone interact. energy: 0.396 local terms energy: -612.567943 where: bonds (distance) C4'-P energy: -145.167 bonds (distance) P-C4' energy: -143.912 flat angles C4'-P-C4' energy: -141.087 flat angles P-C4'-P energy: -94.072 tors. eta vs tors. theta energy: -88.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -1321.108653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.108653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.108653 (E_RNA) where: Base-Base interactions energy: -788.563 where: short stacking energy: -381.092 Base-Backbone interact. energy: 5.530 local terms energy: -538.075698 where: bonds (distance) C4'-P energy: -152.520 bonds (distance) P-C4' energy: -159.059 flat angles C4'-P-C4' energy: -118.324 flat angles P-C4'-P energy: -76.089 tors. eta vs tors. theta energy: -32.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -3133.135955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3133.135955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3133.135955 (E_RNA) where: Base-Base interactions energy: -2178.712 where: short stacking energy: -928.922 Base-Backbone interact. energy: -6.951 local terms energy: -947.472712 where: bonds (distance) C4'-P energy: -183.315 bonds (distance) P-C4' energy: -172.600 flat angles C4'-P-C4' energy: -204.080 flat angles P-C4'-P energy: -138.807 tors. eta vs tors. theta energy: -248.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -3058.168723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3058.168723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3058.168723 (E_RNA) where: Base-Base interactions energy: -2127.334 where: short stacking energy: -921.233 Base-Backbone interact. energy: -4.448 local terms energy: -926.386831 where: bonds (distance) C4'-P energy: -169.185 bonds (distance) P-C4' energy: -194.517 flat angles C4'-P-C4' energy: -208.657 flat angles P-C4'-P energy: -117.344 tors. eta vs tors. theta energy: -236.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -2897.528106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2897.528106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2897.528106 (E_RNA) where: Base-Base interactions energy: -1984.339 where: short stacking energy: -890.694 Base-Backbone interact. energy: -3.652 local terms energy: -909.536539 where: bonds (distance) C4'-P energy: -169.938 bonds (distance) P-C4' energy: -174.334 flat angles C4'-P-C4' energy: -199.169 flat angles P-C4'-P energy: -133.022 tors. eta vs tors. theta energy: -233.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -2867.776210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2867.776210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2867.776210 (E_RNA) where: Base-Base interactions energy: -1968.182 where: short stacking energy: -865.864 Base-Backbone interact. energy: -5.536 local terms energy: -894.058228 where: bonds (distance) C4'-P energy: -175.333 bonds (distance) P-C4' energy: -194.450 flat angles C4'-P-C4' energy: -186.302 flat angles P-C4'-P energy: -119.480 tors. eta vs tors. theta energy: -218.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -2670.475087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2670.475087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2670.475087 (E_RNA) where: Base-Base interactions energy: -1877.103 where: short stacking energy: -777.803 Base-Backbone interact. energy: -2.566 local terms energy: -790.806398 where: bonds (distance) C4'-P energy: -146.159 bonds (distance) P-C4' energy: -151.748 flat angles C4'-P-C4' energy: -197.182 flat angles P-C4'-P energy: -101.401 tors. eta vs tors. theta energy: -194.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -2471.469364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2471.469364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2471.469364 (E_RNA) where: Base-Base interactions energy: -1664.261 where: short stacking energy: -776.878 Base-Backbone interact. energy: -2.631 local terms energy: -804.577421 where: bonds (distance) C4'-P energy: -152.227 bonds (distance) P-C4' energy: -164.268 flat angles C4'-P-C4' energy: -188.197 flat angles P-C4'-P energy: -112.324 tors. eta vs tors. theta energy: -187.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -2292.626483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2292.626483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2292.626483 (E_RNA) where: Base-Base interactions energy: -1536.720 where: short stacking energy: -652.925 Base-Backbone interact. energy: -0.219 local terms energy: -755.687800 where: bonds (distance) C4'-P energy: -173.956 bonds (distance) P-C4' energy: -170.168 flat angles C4'-P-C4' energy: -156.179 flat angles P-C4'-P energy: -104.491 tors. eta vs tors. theta energy: -150.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1947.332139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1947.332139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1947.332139 (E_RNA) where: Base-Base interactions energy: -1265.252 where: short stacking energy: -591.549 Base-Backbone interact. energy: -0.932 local terms energy: -681.148568 where: bonds (distance) C4'-P energy: -162.829 bonds (distance) P-C4' energy: -157.967 flat angles C4'-P-C4' energy: -152.574 flat angles P-C4'-P energy: -80.858 tors. eta vs tors. theta energy: -126.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1735.305675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.305675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.305675 (E_RNA) where: Base-Base interactions energy: -1150.163 where: short stacking energy: -505.149 Base-Backbone interact. energy: -2.570 local terms energy: -582.572404 where: bonds (distance) C4'-P energy: -135.996 bonds (distance) P-C4' energy: -138.987 flat angles C4'-P-C4' energy: -155.788 flat angles P-C4'-P energy: -89.864 tors. eta vs tors. theta energy: -61.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -1272.512735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.512735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.512735 (E_RNA) where: Base-Base interactions energy: -741.837 where: short stacking energy: -351.282 Base-Backbone interact. energy: -2.900 local terms energy: -527.775881 where: bonds (distance) C4'-P energy: -139.754 bonds (distance) P-C4' energy: -149.032 flat angles C4'-P-C4' energy: -114.878 flat angles P-C4'-P energy: -93.920 tors. eta vs tors. theta energy: -30.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -3133.307856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3133.307856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3133.307856 (E_RNA) where: Base-Base interactions energy: -2148.242 where: short stacking energy: -971.698 Base-Backbone interact. energy: -6.250 local terms energy: -978.816668 where: bonds (distance) C4'-P energy: -181.393 bonds (distance) P-C4' energy: -183.189 flat angles C4'-P-C4' energy: -226.459 flat angles P-C4'-P energy: -133.538 tors. eta vs tors. theta energy: -254.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -3084.782096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3084.782096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3084.782096 (E_RNA) where: Base-Base interactions energy: -2142.167 where: short stacking energy: -934.058 Base-Backbone interact. energy: -8.144 local terms energy: -934.471118 where: bonds (distance) C4'-P energy: -172.508 bonds (distance) P-C4' energy: -191.118 flat angles C4'-P-C4' energy: -204.569 flat angles P-C4'-P energy: -119.567 tors. eta vs tors. theta energy: -246.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -2893.734648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2893.734648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2893.734648 (E_RNA) where: Base-Base interactions energy: -1990.157 where: short stacking energy: -888.889 Base-Backbone interact. energy: -3.119 local terms energy: -900.458938 where: bonds (distance) C4'-P energy: -161.784 bonds (distance) P-C4' energy: -179.697 flat angles C4'-P-C4' energy: -195.973 flat angles P-C4'-P energy: -125.276 tors. eta vs tors. theta energy: -237.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -2846.343010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2846.343010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2846.343010 (E_RNA) where: Base-Base interactions energy: -1971.905 where: short stacking energy: -863.076 Base-Backbone interact. energy: 1.294 local terms energy: -875.731610 where: bonds (distance) C4'-P energy: -181.551 bonds (distance) P-C4' energy: -151.277 flat angles C4'-P-C4' energy: -199.163 flat angles P-C4'-P energy: -122.482 tors. eta vs tors. theta energy: -221.258 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -2719.447961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2719.447961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2719.447961 (E_RNA) where: Base-Base interactions energy: -1874.523 where: short stacking energy: -766.179 Base-Backbone interact. energy: -2.336 local terms energy: -842.588778 where: bonds (distance) C4'-P energy: -140.010 bonds (distance) P-C4' energy: -178.587 flat angles C4'-P-C4' energy: -201.954 flat angles P-C4'-P energy: -112.273 tors. eta vs tors. theta energy: -209.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -2408.670849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2408.670849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2408.670849 (E_RNA) where: Base-Base interactions energy: -1627.824 where: short stacking energy: -714.979 Base-Backbone interact. energy: -3.126 local terms energy: -777.720267 where: bonds (distance) C4'-P energy: -164.288 bonds (distance) P-C4' energy: -150.860 flat angles C4'-P-C4' energy: -184.175 flat angles P-C4'-P energy: -99.624 tors. eta vs tors. theta energy: -178.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -2262.967360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2262.967360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2262.967360 (E_RNA) where: Base-Base interactions energy: -1547.075 where: short stacking energy: -702.877 Base-Backbone interact. energy: 5.892 local terms energy: -721.784461 where: bonds (distance) C4'-P energy: -140.942 bonds (distance) P-C4' energy: -154.221 flat angles C4'-P-C4' energy: -179.254 flat angles P-C4'-P energy: -86.193 tors. eta vs tors. theta energy: -161.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1968.998987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1968.998987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1968.998987 (E_RNA) where: Base-Base interactions energy: -1289.023 where: short stacking energy: -572.548 Base-Backbone interact. energy: -0.596 local terms energy: -679.379553 where: bonds (distance) C4'-P energy: -141.108 bonds (distance) P-C4' energy: -161.266 flat angles C4'-P-C4' energy: -164.889 flat angles P-C4'-P energy: -75.786 tors. eta vs tors. theta energy: -136.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -1713.241930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1713.241930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1713.241930 (E_RNA) where: Base-Base interactions energy: -1087.607 where: short stacking energy: -498.092 Base-Backbone interact. energy: 2.805 local terms energy: -628.440269 where: bonds (distance) C4'-P energy: -139.104 bonds (distance) P-C4' energy: -166.905 flat angles C4'-P-C4' energy: -150.677 flat angles P-C4'-P energy: -93.295 tors. eta vs tors. theta energy: -78.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -1316.807009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.807009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.807009 (E_RNA) where: Base-Base interactions energy: -768.922 where: short stacking energy: -424.220 Base-Backbone interact. energy: 1.707 local terms energy: -549.591727 where: bonds (distance) C4'-P energy: -138.465 bonds (distance) P-C4' energy: -143.230 flat angles C4'-P-C4' energy: -135.540 flat angles P-C4'-P energy: -96.049 tors. eta vs tors. theta energy: -36.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -3146.568641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3146.568641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3146.568641 (E_RNA) where: Base-Base interactions energy: -2157.351 where: short stacking energy: -945.509 Base-Backbone interact. energy: 4.049 local terms energy: -993.266700 where: bonds (distance) C4'-P energy: -196.568 bonds (distance) P-C4' energy: -177.074 flat angles C4'-P-C4' energy: -216.166 flat angles P-C4'-P energy: -138.822 tors. eta vs tors. theta energy: -264.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -3062.268963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3062.268963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3062.268963 (E_RNA) where: Base-Base interactions energy: -2123.807 where: short stacking energy: -913.733 Base-Backbone interact. energy: -0.879 local terms energy: -937.582199 where: bonds (distance) C4'-P energy: -170.705 bonds (distance) P-C4' energy: -195.764 flat angles C4'-P-C4' energy: -211.136 flat angles P-C4'-P energy: -118.787 tors. eta vs tors. theta energy: -241.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -2869.025289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2869.025289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2869.025289 (E_RNA) where: Base-Base interactions energy: -1986.196 where: short stacking energy: -909.857 Base-Backbone interact. energy: -1.740 local terms energy: -881.088951 where: bonds (distance) C4'-P energy: -155.054 bonds (distance) P-C4' energy: -167.069 flat angles C4'-P-C4' energy: -195.130 flat angles P-C4'-P energy: -126.035 tors. eta vs tors. theta energy: -237.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -2916.530839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2916.530839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2916.530839 (E_RNA) where: Base-Base interactions energy: -2023.049 where: short stacking energy: -877.538 Base-Backbone interact. energy: -8.364 local terms energy: -885.116957 where: bonds (distance) C4'-P energy: -155.832 bonds (distance) P-C4' energy: -177.264 flat angles C4'-P-C4' energy: -204.060 flat angles P-C4'-P energy: -106.843 tors. eta vs tors. theta energy: -241.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -2740.916232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2740.916232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2740.916232 (E_RNA) where: Base-Base interactions energy: -1892.665 where: short stacking energy: -799.816 Base-Backbone interact. energy: 5.547 local terms energy: -853.797890 where: bonds (distance) C4'-P energy: -159.545 bonds (distance) P-C4' energy: -174.668 flat angles C4'-P-C4' energy: -201.779 flat angles P-C4'-P energy: -127.558 tors. eta vs tors. theta energy: -190.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -2439.871042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2439.871042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2439.871042 (E_RNA) where: Base-Base interactions energy: -1669.847 where: short stacking energy: -752.942 Base-Backbone interact. energy: 1.800 local terms energy: -771.823323 where: bonds (distance) C4'-P energy: -148.875 bonds (distance) P-C4' energy: -149.984 flat angles C4'-P-C4' energy: -189.681 flat angles P-C4'-P energy: -111.892 tors. eta vs tors. theta energy: -171.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -2190.417930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2190.417930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2190.417930 (E_RNA) where: Base-Base interactions energy: -1462.999 where: short stacking energy: -642.744 Base-Backbone interact. energy: 0.510 local terms energy: -727.928257 where: bonds (distance) C4'-P energy: -171.865 bonds (distance) P-C4' energy: -169.646 flat angles C4'-P-C4' energy: -142.286 flat angles P-C4'-P energy: -101.122 tors. eta vs tors. theta energy: -143.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -2000.363580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2000.363580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2000.363580 (E_RNA) where: Base-Base interactions energy: -1293.126 where: short stacking energy: -589.471 Base-Backbone interact. energy: -4.878 local terms energy: -702.358982 where: bonds (distance) C4'-P energy: -143.706 bonds (distance) P-C4' energy: -151.905 flat angles C4'-P-C4' energy: -152.430 flat angles P-C4'-P energy: -113.510 tors. eta vs tors. theta energy: -140.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -1700.854801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1700.854801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1700.854801 (E_RNA) where: Base-Base interactions energy: -1155.608 where: short stacking energy: -480.486 Base-Backbone interact. energy: 1.228 local terms energy: -546.474379 where: bonds (distance) C4'-P energy: -141.906 bonds (distance) P-C4' energy: -142.867 flat angles C4'-P-C4' energy: -147.013 flat angles P-C4'-P energy: -58.090 tors. eta vs tors. theta energy: -56.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -1362.826091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.826091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.826091 (E_RNA) where: Base-Base interactions energy: -832.756 where: short stacking energy: -407.171 Base-Backbone interact. energy: 0.493 local terms energy: -530.563299 where: bonds (distance) C4'-P energy: -128.749 bonds (distance) P-C4' energy: -157.734 flat angles C4'-P-C4' energy: -131.235 flat angles P-C4'-P energy: -69.988 tors. eta vs tors. theta energy: -42.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -3123.160690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3123.160690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3123.160690 (E_RNA) where: Base-Base interactions energy: -2158.306 where: short stacking energy: -962.646 Base-Backbone interact. energy: -1.520 local terms energy: -963.334586 where: bonds (distance) C4'-P energy: -187.368 bonds (distance) P-C4' energy: -184.790 flat angles C4'-P-C4' energy: -194.849 flat angles P-C4'-P energy: -142.800 tors. eta vs tors. theta energy: -253.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -3109.591896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3109.591896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3109.591896 (E_RNA) where: Base-Base interactions energy: -2196.008 where: short stacking energy: -935.639 Base-Backbone interact. energy: -1.303 local terms energy: -912.281203 where: bonds (distance) C4'-P energy: -165.469 bonds (distance) P-C4' energy: -174.056 flat angles C4'-P-C4' energy: -199.882 flat angles P-C4'-P energy: -134.841 tors. eta vs tors. theta energy: -238.033 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -2858.395227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2858.395227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2858.395227 (E_RNA) where: Base-Base interactions energy: -1954.919 where: short stacking energy: -856.805 Base-Backbone interact. energy: 3.748 local terms energy: -907.223622 where: bonds (distance) C4'-P energy: -161.176 bonds (distance) P-C4' energy: -191.238 flat angles C4'-P-C4' energy: -218.705 flat angles P-C4'-P energy: -110.828 tors. eta vs tors. theta energy: -225.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -2867.723944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2867.723944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2867.723944 (E_RNA) where: Base-Base interactions energy: -1980.545 where: short stacking energy: -853.738 Base-Backbone interact. energy: -4.122 local terms energy: -883.056344 where: bonds (distance) C4'-P energy: -174.284 bonds (distance) P-C4' energy: -181.771 flat angles C4'-P-C4' energy: -181.905 flat angles P-C4'-P energy: -111.585 tors. eta vs tors. theta energy: -233.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -2717.766331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2717.766331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2717.766331 (E_RNA) where: Base-Base interactions energy: -1885.683 where: short stacking energy: -810.022 Base-Backbone interact. energy: -3.056 local terms energy: -829.026987 where: bonds (distance) C4'-P energy: -161.522 bonds (distance) P-C4' energy: -158.601 flat angles C4'-P-C4' energy: -184.866 flat angles P-C4'-P energy: -116.239 tors. eta vs tors. theta energy: -207.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -2438.173876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2438.173876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2438.173876 (E_RNA) where: Base-Base interactions energy: -1648.499 where: short stacking energy: -716.877 Base-Backbone interact. energy: -2.100 local terms energy: -787.574791 where: bonds (distance) C4'-P energy: -166.632 bonds (distance) P-C4' energy: -165.988 flat angles C4'-P-C4' energy: -168.298 flat angles P-C4'-P energy: -121.668 tors. eta vs tors. theta energy: -164.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -2218.735068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.735068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.735068 (E_RNA) where: Base-Base interactions energy: -1476.630 where: short stacking energy: -662.039 Base-Backbone interact. energy: -5.166 local terms energy: -736.939386 where: bonds (distance) C4'-P energy: -146.253 bonds (distance) P-C4' energy: -168.373 flat angles C4'-P-C4' energy: -168.031 flat angles P-C4'-P energy: -109.482 tors. eta vs tors. theta energy: -144.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -1983.811086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1983.811086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1983.811086 (E_RNA) where: Base-Base interactions energy: -1300.796 where: short stacking energy: -586.791 Base-Backbone interact. energy: 3.212 local terms energy: -686.227052 where: bonds (distance) C4'-P energy: -166.779 bonds (distance) P-C4' energy: -147.167 flat angles C4'-P-C4' energy: -146.149 flat angles P-C4'-P energy: -104.271 tors. eta vs tors. theta energy: -121.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -1674.135701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1674.135701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1674.135701 (E_RNA) where: Base-Base interactions energy: -1088.041 where: short stacking energy: -498.825 Base-Backbone interact. energy: -1.028 local terms energy: -585.066426 where: bonds (distance) C4'-P energy: -115.647 bonds (distance) P-C4' energy: -139.380 flat angles C4'-P-C4' energy: -157.021 flat angles P-C4'-P energy: -101.000 tors. eta vs tors. theta energy: -72.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -1228.160037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.160037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.160037 (E_RNA) where: Base-Base interactions energy: -717.839 where: short stacking energy: -381.313 Base-Backbone interact. energy: -0.359 local terms energy: -509.962119 where: bonds (distance) C4'-P energy: -157.409 bonds (distance) P-C4' energy: -140.413 flat angles C4'-P-C4' energy: -140.508 flat angles P-C4'-P energy: -58.803 tors. eta vs tors. theta energy: -12.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -3122.652554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3122.652554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3122.652554 (E_RNA) where: Base-Base interactions energy: -2155.621 where: short stacking energy: -964.809 Base-Backbone interact. energy: -0.922 local terms energy: -966.109604 where: bonds (distance) C4'-P energy: -185.219 bonds (distance) P-C4' energy: -195.683 flat angles C4'-P-C4' energy: -193.016 flat angles P-C4'-P energy: -131.617 tors. eta vs tors. theta energy: -260.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -3079.456612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3079.456612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3079.456612 (E_RNA) where: Base-Base interactions energy: -2149.689 where: short stacking energy: -923.995 Base-Backbone interact. energy: 0.352 local terms energy: -930.119574 where: bonds (distance) C4'-P energy: -180.726 bonds (distance) P-C4' energy: -171.679 flat angles C4'-P-C4' energy: -205.877 flat angles P-C4'-P energy: -140.037 tors. eta vs tors. theta energy: -231.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -2857.134751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2857.134751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2857.134751 (E_RNA) where: Base-Base interactions energy: -1995.428 where: short stacking energy: -847.907 Base-Backbone interact. energy: -0.011 local terms energy: -861.695967 where: bonds (distance) C4'-P energy: -157.441 bonds (distance) P-C4' energy: -174.680 flat angles C4'-P-C4' energy: -177.888 flat angles P-C4'-P energy: -131.265 tors. eta vs tors. theta energy: -220.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -2922.968380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2922.968380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2922.968380 (E_RNA) where: Base-Base interactions energy: -1990.698 where: short stacking energy: -884.957 Base-Backbone interact. energy: 1.157 local terms energy: -933.427742 where: bonds (distance) C4'-P energy: -174.905 bonds (distance) P-C4' energy: -179.676 flat angles C4'-P-C4' energy: -203.817 flat angles P-C4'-P energy: -128.855 tors. eta vs tors. theta energy: -246.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -2680.606813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2680.606813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2680.606813 (E_RNA) where: Base-Base interactions energy: -1872.163 where: short stacking energy: -767.669 Base-Backbone interact. energy: -2.620 local terms energy: -805.823411 where: bonds (distance) C4'-P energy: -150.356 bonds (distance) P-C4' energy: -163.352 flat angles C4'-P-C4' energy: -194.713 flat angles P-C4'-P energy: -115.376 tors. eta vs tors. theta energy: -182.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -2427.374603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2427.374603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2427.374603 (E_RNA) where: Base-Base interactions energy: -1644.201 where: short stacking energy: -741.689 Base-Backbone interact. energy: -2.249 local terms energy: -780.925201 where: bonds (distance) C4'-P energy: -174.353 bonds (distance) P-C4' energy: -163.294 flat angles C4'-P-C4' energy: -158.032 flat angles P-C4'-P energy: -106.313 tors. eta vs tors. theta energy: -178.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -2166.117374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2166.117374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2166.117374 (E_RNA) where: Base-Base interactions energy: -1463.280 where: short stacking energy: -641.107 Base-Backbone interact. energy: -4.321 local terms energy: -698.516540 where: bonds (distance) C4'-P energy: -147.665 bonds (distance) P-C4' energy: -143.059 flat angles C4'-P-C4' energy: -172.909 flat angles P-C4'-P energy: -95.598 tors. eta vs tors. theta energy: -139.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -2052.293436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2052.293436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2052.293436 (E_RNA) where: Base-Base interactions energy: -1364.259 where: short stacking energy: -599.954 Base-Backbone interact. energy: -2.365 local terms energy: -685.669350 where: bonds (distance) C4'-P energy: -137.226 bonds (distance) P-C4' energy: -138.618 flat angles C4'-P-C4' energy: -167.174 flat angles P-C4'-P energy: -104.846 tors. eta vs tors. theta energy: -137.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -1779.110829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1779.110829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1779.110829 (E_RNA) where: Base-Base interactions energy: -1172.553 where: short stacking energy: -518.032 Base-Backbone interact. energy: 2.620 local terms energy: -609.177874 where: bonds (distance) C4'-P energy: -160.645 bonds (distance) P-C4' energy: -148.139 flat angles C4'-P-C4' energy: -131.186 flat angles P-C4'-P energy: -90.669 tors. eta vs tors. theta energy: -78.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -1220.250488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.250488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.250488 (E_RNA) where: Base-Base interactions energy: -727.962 where: short stacking energy: -374.132 Base-Backbone interact. energy: 10.016 local terms energy: -502.304766 where: bonds (distance) C4'-P energy: -137.678 bonds (distance) P-C4' energy: -148.174 flat angles C4'-P-C4' energy: -148.265 flat angles P-C4'-P energy: -79.908 tors. eta vs tors. theta energy: 11.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -3118.746425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3118.746425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3118.746425 (E_RNA) where: Base-Base interactions energy: -2132.821 where: short stacking energy: -936.025 Base-Backbone interact. energy: -7.719 local terms energy: -978.205904 where: bonds (distance) C4'-P energy: -186.179 bonds (distance) P-C4' energy: -190.242 flat angles C4'-P-C4' energy: -205.661 flat angles P-C4'-P energy: -143.777 tors. eta vs tors. theta energy: -252.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -3066.428631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3066.428631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3066.428631 (E_RNA) where: Base-Base interactions energy: -2113.823 where: short stacking energy: -901.964 Base-Backbone interact. energy: 2.169 local terms energy: -954.774577 where: bonds (distance) C4'-P energy: -181.519 bonds (distance) P-C4' energy: -196.658 flat angles C4'-P-C4' energy: -207.562 flat angles P-C4'-P energy: -138.585 tors. eta vs tors. theta energy: -230.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -2936.361981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2936.361981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2936.361981 (E_RNA) where: Base-Base interactions energy: -2041.134 where: short stacking energy: -901.038 Base-Backbone interact. energy: 0.840 local terms energy: -896.067714 where: bonds (distance) C4'-P energy: -168.548 bonds (distance) P-C4' energy: -178.942 flat angles C4'-P-C4' energy: -203.958 flat angles P-C4'-P energy: -120.008 tors. eta vs tors. theta energy: -224.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -2787.656376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2787.656376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2787.656376 (E_RNA) where: Base-Base interactions energy: -1947.855 where: short stacking energy: -822.905 Base-Backbone interact. energy: -3.231 local terms energy: -836.569713 where: bonds (distance) C4'-P energy: -167.995 bonds (distance) P-C4' energy: -145.832 flat angles C4'-P-C4' energy: -188.722 flat angles P-C4'-P energy: -129.520 tors. eta vs tors. theta energy: -204.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -2741.284906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2741.284906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2741.284906 (E_RNA) where: Base-Base interactions energy: -1921.795 where: short stacking energy: -790.886 Base-Backbone interact. energy: -5.052 local terms energy: -814.437868 where: bonds (distance) C4'-P energy: -159.078 bonds (distance) P-C4' energy: -158.965 flat angles C4'-P-C4' energy: -189.001 flat angles P-C4'-P energy: -113.492 tors. eta vs tors. theta energy: -193.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -2387.528739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2387.528739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2387.528739 (E_RNA) where: Base-Base interactions energy: -1621.822 where: short stacking energy: -721.563 Base-Backbone interact. energy: -5.033 local terms energy: -760.674230 where: bonds (distance) C4'-P energy: -154.414 bonds (distance) P-C4' energy: -169.698 flat angles C4'-P-C4' energy: -160.267 flat angles P-C4'-P energy: -114.933 tors. eta vs tors. theta energy: -161.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -2183.640570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2183.640570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2183.640570 (E_RNA) where: Base-Base interactions energy: -1470.912 where: short stacking energy: -639.528 Base-Backbone interact. energy: -2.284 local terms energy: -710.445126 where: bonds (distance) C4'-P energy: -154.852 bonds (distance) P-C4' energy: -158.281 flat angles C4'-P-C4' energy: -176.807 flat angles P-C4'-P energy: -96.573 tors. eta vs tors. theta energy: -123.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -1936.962362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.962362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.962362 (E_RNA) where: Base-Base interactions energy: -1270.399 where: short stacking energy: -564.291 Base-Backbone interact. energy: -2.359 local terms energy: -664.204586 where: bonds (distance) C4'-P energy: -147.482 bonds (distance) P-C4' energy: -131.427 flat angles C4'-P-C4' energy: -168.001 flat angles P-C4'-P energy: -121.253 tors. eta vs tors. theta energy: -96.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -1737.135460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1737.135460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.135460 (E_RNA) where: Base-Base interactions energy: -1111.382 where: short stacking energy: -478.085 Base-Backbone interact. energy: 0.459 local terms energy: -626.212859 where: bonds (distance) C4'-P energy: -131.144 bonds (distance) P-C4' energy: -172.259 flat angles C4'-P-C4' energy: -153.561 flat angles P-C4'-P energy: -87.806 tors. eta vs tors. theta energy: -81.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -1206.850624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.850624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.850624 (E_RNA) where: Base-Base interactions energy: -636.880 where: short stacking energy: -340.275 Base-Backbone interact. energy: -0.459 local terms energy: -569.511873 where: bonds (distance) C4'-P energy: -134.245 bonds (distance) P-C4' energy: -139.849 flat angles C4'-P-C4' energy: -165.832 flat angles P-C4'-P energy: -109.728 tors. eta vs tors. theta energy: -19.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -3123.897671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3123.897671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3123.897671 (E_RNA) where: Base-Base interactions energy: -2154.292 where: short stacking energy: -977.383 Base-Backbone interact. energy: -4.484 local terms energy: -965.121785 where: bonds (distance) C4'-P energy: -178.596 bonds (distance) P-C4' energy: -182.562 flat angles C4'-P-C4' energy: -195.571 flat angles P-C4'-P energy: -145.275 tors. eta vs tors. theta energy: -263.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -3048.679426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3048.679426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3048.679426 (E_RNA) where: Base-Base interactions energy: -2115.150 where: short stacking energy: -886.273 Base-Backbone interact. energy: -0.830 local terms energy: -932.699543 where: bonds (distance) C4'-P energy: -192.030 bonds (distance) P-C4' energy: -171.235 flat angles C4'-P-C4' energy: -204.337 flat angles P-C4'-P energy: -135.403 tors. eta vs tors. theta energy: -229.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -2938.337373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2938.337373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2938.337373 (E_RNA) where: Base-Base interactions energy: -2056.553 where: short stacking energy: -871.090 Base-Backbone interact. energy: -0.146 local terms energy: -881.638052 where: bonds (distance) C4'-P energy: -168.346 bonds (distance) P-C4' energy: -185.331 flat angles C4'-P-C4' energy: -198.905 flat angles P-C4'-P energy: -99.639 tors. eta vs tors. theta energy: -229.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -2839.934394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2839.934394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2839.934394 (E_RNA) where: Base-Base interactions energy: -1946.902 where: short stacking energy: -830.874 Base-Backbone interact. energy: 2.309 local terms energy: -895.341481 where: bonds (distance) C4'-P energy: -177.154 bonds (distance) P-C4' energy: -168.587 flat angles C4'-P-C4' energy: -193.994 flat angles P-C4'-P energy: -130.584 tors. eta vs tors. theta energy: -225.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -2721.505872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2721.505872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2721.505872 (E_RNA) where: Base-Base interactions energy: -1897.061 where: short stacking energy: -807.591 Base-Backbone interact. energy: -4.770 local terms energy: -819.675064 where: bonds (distance) C4'-P energy: -156.396 bonds (distance) P-C4' energy: -157.748 flat angles C4'-P-C4' energy: -193.441 flat angles P-C4'-P energy: -107.647 tors. eta vs tors. theta energy: -204.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -2412.870768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2412.870768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2412.870768 (E_RNA) where: Base-Base interactions energy: -1633.426 where: short stacking energy: -741.712 Base-Backbone interact. energy: 0.831 local terms energy: -780.276184 where: bonds (distance) C4'-P energy: -162.188 bonds (distance) P-C4' energy: -183.460 flat angles C4'-P-C4' energy: -181.503 flat angles P-C4'-P energy: -90.887 tors. eta vs tors. theta energy: -162.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -2183.044229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2183.044229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2183.044229 (E_RNA) where: Base-Base interactions energy: -1438.061 where: short stacking energy: -660.119 Base-Backbone interact. energy: 2.057 local terms energy: -747.039665 where: bonds (distance) C4'-P energy: -137.238 bonds (distance) P-C4' energy: -183.401 flat angles C4'-P-C4' energy: -167.892 flat angles P-C4'-P energy: -116.370 tors. eta vs tors. theta energy: -142.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -1967.568167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1967.568167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1967.568167 (E_RNA) where: Base-Base interactions energy: -1274.077 where: short stacking energy: -581.233 Base-Backbone interact. energy: 0.429 local terms energy: -693.920315 where: bonds (distance) C4'-P energy: -149.547 bonds (distance) P-C4' energy: -170.304 flat angles C4'-P-C4' energy: -144.674 flat angles P-C4'-P energy: -100.050 tors. eta vs tors. theta energy: -129.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -1737.606803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1737.606803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1737.606803 (E_RNA) where: Base-Base interactions energy: -1143.848 where: short stacking energy: -507.666 Base-Backbone interact. energy: 1.760 local terms energy: -595.519188 where: bonds (distance) C4'-P energy: -144.696 bonds (distance) P-C4' energy: -140.113 flat angles C4'-P-C4' energy: -153.421 flat angles P-C4'-P energy: -85.889 tors. eta vs tors. theta energy: -71.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -1103.275595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1103.275595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1103.275595 (E_RNA) where: Base-Base interactions energy: -596.974 where: short stacking energy: -292.880 Base-Backbone interact. energy: -2.317 local terms energy: -503.984979 where: bonds (distance) C4'-P energy: -141.472 bonds (distance) P-C4' energy: -151.843 flat angles C4'-P-C4' energy: -127.479 flat angles P-C4'-P energy: -79.544 tors. eta vs tors. theta energy: -3.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 9 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 35816047 moves confirmed later: 40176477 all moves confirmed: 75992524 percent of confirmed moves: 47.495328 current total energy: -3044.638078 recalc. total energy: -3044.638078 replica 5 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 44022713 moves confirmed later: 51287169 all moves confirmed: 95309882 percent of confirmed moves: 59.568676 current total energy: -2885.074718 recalc. total energy: -2885.074718 replica 3 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 42675840 moves confirmed later: 49492915 all moves confirmed: 92168755 percent of confirmed moves: 57.605472 current total energy: -2672.028878 recalc. total energy: -2672.028878 replica 4 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 36544516 moves confirmed later: 41180869 all moves confirmed: 77725385 percent of confirmed moves: 48.578366 current total energy: -2698.597141 recalc. total energy: -2698.597141 replica 6 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 35488913 moves confirmed later: 39751667 all moves confirmed: 75240580 percent of confirmed moves: 47.025362 current total energy: -2550.374534 recalc. total energy: -2550.374534 replica 10 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 41260555 moves confirmed later: 47593750 all moves confirmed: 88854305 percent of confirmed moves: 55.533941 current total energy: -2207.733128 recalc. total energy: -2207.733128 replica 2 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 44968086 moves confirmed later: 52344062 all moves confirmed: 97312148 percent of confirmed moves: 60.820093 current total energy: -1979.782928 recalc. total energy: -1979.782928 replica 7 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 59907213 moves confirmed later: 72116672 all moves confirmed: 132023885 percent of confirmed moves: 82.514928 current total energy: -1900.056092 recalc. total energy: -1900.056092 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 55931413 moves confirmed later: 67016979 all moves confirmed: 122948392 percent of confirmed moves: 76.842745 current total energy: -1501.024053 recalc. total energy: -1501.024053 replica 1 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 59152824 moves confirmed later: 70958616 all moves confirmed: 130111440 percent of confirmed moves: 81.319650 current total energy: -948.262397 recalc. total energy: -948.262397 out arg RESULTS//1/MCL-1-delta1-300-79d74bda_01 Time of doing 1600000 iterations: 12676.784 seconds