SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/MCL-1-602-898-c43e838d/inputs/seq.fa: 1 curr_seq: _UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UCCAGACCCCGGUGGUCGUCCUUCCGCGACCUCUGGAAUGCUGCCCAACCCCUACCGCACGUCGCGUUGGUGCUCUGCCGGAAGGUUCCGUACGAAGCCUUUGACCUGUAGUUUUUGCUUCUGCUACACUUUAGCAACAGAGCUCACUACUAGGUACAAAAGUCGCUGCCGCAUUGUUUGACCCCGUCCUAACACUGAGAGUAAAGAAAACCACGGAAACACCGAUUUGUGAACUUCUGGUAUUUGGUUCUUUCGACGUAGCUUGGUAAUCGUCUUUCAUAGUGUCUGCAAGAGCAU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 297 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1490 n_atoms_counter: 1490 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 297.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -1226.071961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.071961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.071961 (E_RNA) where: Base-Base interactions energy: -70.292 where: short stacking energy: -70.292 Base-Backbone interact. energy: -0.000 local terms energy: -1155.779230 where: bonds (distance) C4'-P energy: -288.559 bonds (distance) P-C4' energy: -266.606 flat angles C4'-P-C4' energy: -218.065 flat angles P-C4'-P energy: -249.443 tors. eta vs tors. theta energy: -133.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -1450.351091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.351091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.351091 (E_RNA) where: Base-Base interactions energy: -610.139 where: short stacking energy: -601.059 Base-Backbone interact. energy: 1.032 local terms energy: -841.244314 where: bonds (distance) C4'-P energy: -197.112 bonds (distance) P-C4' energy: -184.709 flat angles C4'-P-C4' energy: -187.353 flat angles P-C4'-P energy: -116.427 tors. eta vs tors. theta energy: -155.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -1291.748872 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.748872 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1291.748872 (E_RNA) where: Base-Base interactions energy: -387.768 where: short stacking energy: -386.034 Base-Backbone interact. energy: -0.001 local terms energy: -903.979965 where: bonds (distance) C4'-P energy: -175.377 bonds (distance) P-C4' energy: -186.563 flat angles C4'-P-C4' energy: -206.990 flat angles P-C4'-P energy: -188.794 tors. eta vs tors. theta energy: -146.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -1247.313184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.313184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.313184 (E_RNA) where: Base-Base interactions energy: -490.521 where: short stacking energy: -490.521 Base-Backbone interact. energy: 0.586 local terms energy: -757.378870 where: bonds (distance) C4'-P energy: -183.273 bonds (distance) P-C4' energy: -171.110 flat angles C4'-P-C4' energy: -183.654 flat angles P-C4'-P energy: -105.727 tors. eta vs tors. theta energy: -113.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -1226.718929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.718929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.718929 (E_RNA) where: Base-Base interactions energy: -77.633 where: short stacking energy: -77.633 Base-Backbone interact. energy: -0.000 local terms energy: -1149.085241 where: bonds (distance) C4'-P energy: -287.134 bonds (distance) P-C4' energy: -260.806 flat angles C4'-P-C4' energy: -217.567 flat angles P-C4'-P energy: -248.637 tors. eta vs tors. theta energy: -134.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -1226.243438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.243438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.243438 (E_RNA) where: Base-Base interactions energy: -77.949 where: short stacking energy: -77.949 Base-Backbone interact. energy: -0.000 local terms energy: -1148.293757 where: bonds (distance) C4'-P energy: -287.134 bonds (distance) P-C4' energy: -260.015 flat angles C4'-P-C4' energy: -217.567 flat angles P-C4'-P energy: -248.637 tors. eta vs tors. theta energy: -134.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -1227.379005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.379005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1227.379005 (E_RNA) where: Base-Base interactions energy: -79.301 where: short stacking energy: -79.301 Base-Backbone interact. energy: -0.000 local terms energy: -1148.078180 where: bonds (distance) C4'-P energy: -287.134 bonds (distance) P-C4' energy: -260.015 flat angles C4'-P-C4' energy: -217.372 flat angles P-C4'-P energy: -248.637 tors. eta vs tors. theta energy: -134.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -1227.189104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.189104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1227.189104 (E_RNA) where: Base-Base interactions energy: -79.654 where: short stacking energy: -79.654 Base-Backbone interact. energy: -0.000 local terms energy: -1147.534520 where: bonds (distance) C4'-P energy: -287.134 bonds (distance) P-C4' energy: -260.015 flat angles C4'-P-C4' energy: -216.933 flat angles P-C4'-P energy: -248.637 tors. eta vs tors. theta energy: -134.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -1228.828519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.828519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.828519 (E_RNA) where: Base-Base interactions energy: -81.378 where: short stacking energy: -81.378 Base-Backbone interact. energy: -0.000 local terms energy: -1147.449836 where: bonds (distance) C4'-P energy: -287.134 bonds (distance) P-C4' energy: -260.015 flat angles C4'-P-C4' energy: -216.933 flat angles P-C4'-P energy: -248.552 tors. eta vs tors. theta energy: -134.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -1228.958622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.958622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.958622 (E_RNA) where: Base-Base interactions energy: -81.223 where: short stacking energy: -81.223 Base-Backbone interact. energy: -0.000 local terms energy: -1147.735492 where: bonds (distance) C4'-P energy: -287.134 bonds (distance) P-C4' energy: -260.015 flat angles C4'-P-C4' energy: -217.354 flat angles P-C4'-P energy: -248.552 tors. eta vs tors. theta energy: -134.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -1227.269098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1227.269098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1227.269098 (E_RNA) where: Base-Base interactions energy: -77.561 where: short stacking energy: -77.561 Base-Backbone interact. energy: -0.000 local terms energy: -1149.707490 where: bonds (distance) C4'-P energy: -287.242 bonds (distance) P-C4' energy: -261.592 flat angles C4'-P-C4' energy: -217.583 flat angles P-C4'-P energy: -248.597 tors. eta vs tors. theta energy: -134.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -1457.666344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.666344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.666344 (E_RNA) where: Base-Base interactions energy: -615.713 where: short stacking energy: -615.660 Base-Backbone interact. energy: -0.145 local terms energy: -841.808444 where: bonds (distance) C4'-P energy: -180.390 bonds (distance) P-C4' energy: -195.105 flat angles C4'-P-C4' energy: -197.000 flat angles P-C4'-P energy: -119.085 tors. eta vs tors. theta energy: -150.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -1377.809887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1377.809887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1377.809887 (E_RNA) where: Base-Base interactions energy: -590.511 where: short stacking energy: -575.905 Base-Backbone interact. energy: -0.189 local terms energy: -787.109972 where: bonds (distance) C4'-P energy: -165.547 bonds (distance) P-C4' energy: -176.501 flat angles C4'-P-C4' energy: -176.951 flat angles P-C4'-P energy: -110.344 tors. eta vs tors. theta energy: -157.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -1309.109632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.109632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.109632 (E_RNA) where: Base-Base interactions energy: -508.411 where: short stacking energy: -507.182 Base-Backbone interact. energy: 0.515 local terms energy: -801.213756 where: bonds (distance) C4'-P energy: -198.584 bonds (distance) P-C4' energy: -165.508 flat angles C4'-P-C4' energy: -180.302 flat angles P-C4'-P energy: -117.573 tors. eta vs tors. theta energy: -139.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -1190.319888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.319888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.319888 (E_RNA) where: Base-Base interactions energy: -468.768 where: short stacking energy: -460.720 Base-Backbone interact. energy: 0.367 local terms energy: -721.918335 where: bonds (distance) C4'-P energy: -163.347 bonds (distance) P-C4' energy: -166.852 flat angles C4'-P-C4' energy: -169.246 flat angles P-C4'-P energy: -102.858 tors. eta vs tors. theta energy: -119.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -1050.464887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1050.464887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.464887 (E_RNA) where: Base-Base interactions energy: -384.530 where: short stacking energy: -381.941 Base-Backbone interact. energy: -0.178 local terms energy: -665.756620 where: bonds (distance) C4'-P energy: -176.052 bonds (distance) P-C4' energy: -174.527 flat angles C4'-P-C4' energy: -157.296 flat angles P-C4'-P energy: -91.782 tors. eta vs tors. theta energy: -66.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -1009.683899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.683899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.683899 (E_RNA) where: Base-Base interactions energy: -396.231 where: short stacking energy: -389.823 Base-Backbone interact. energy: 0.312 local terms energy: -613.764630 where: bonds (distance) C4'-P energy: -144.453 bonds (distance) P-C4' energy: -174.742 flat angles C4'-P-C4' energy: -146.909 flat angles P-C4'-P energy: -81.487 tors. eta vs tors. theta energy: -66.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -897.805560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.805560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.805560 (E_RNA) where: Base-Base interactions energy: -328.748 where: short stacking energy: -306.364 Base-Backbone interact. energy: 0.490 local terms energy: -569.547311 where: bonds (distance) C4'-P energy: -146.731 bonds (distance) P-C4' energy: -157.524 flat angles C4'-P-C4' energy: -158.303 flat angles P-C4'-P energy: -76.677 tors. eta vs tors. theta energy: -30.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -836.283836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.283836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.283836 (E_RNA) where: Base-Base interactions energy: -281.749 where: short stacking energy: -274.426 Base-Backbone interact. energy: -0.436 local terms energy: -554.098657 where: bonds (distance) C4'-P energy: -127.412 bonds (distance) P-C4' energy: -156.252 flat angles C4'-P-C4' energy: -139.784 flat angles P-C4'-P energy: -98.975 tors. eta vs tors. theta energy: -31.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -789.329736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.329736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.329736 (E_RNA) where: Base-Base interactions energy: -300.905 where: short stacking energy: -290.302 Base-Backbone interact. energy: 0.757 local terms energy: -489.181830 where: bonds (distance) C4'-P energy: -121.808 bonds (distance) P-C4' energy: -147.955 flat angles C4'-P-C4' energy: -142.176 flat angles P-C4'-P energy: -73.324 tors. eta vs tors. theta energy: -3.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -710.450473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.450473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.450473 (E_RNA) where: Base-Base interactions energy: -240.450 where: short stacking energy: -227.884 Base-Backbone interact. energy: -0.481 local terms energy: -469.519232 where: bonds (distance) C4'-P energy: -146.857 bonds (distance) P-C4' energy: -151.972 flat angles C4'-P-C4' energy: -100.540 flat angles P-C4'-P energy: -71.720 tors. eta vs tors. theta energy: 1.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -1473.946522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1473.946522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.946522 (E_RNA) where: Base-Base interactions energy: -624.050 where: short stacking energy: -608.962 Base-Backbone interact. energy: -0.401 local terms energy: -849.495309 where: bonds (distance) C4'-P energy: -177.775 bonds (distance) P-C4' energy: -188.675 flat angles C4'-P-C4' energy: -185.649 flat angles P-C4'-P energy: -129.440 tors. eta vs tors. theta energy: -167.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -1375.556757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.556757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.556757 (E_RNA) where: Base-Base interactions energy: -574.828 where: short stacking energy: -558.610 Base-Backbone interact. energy: -0.680 local terms energy: -800.049158 where: bonds (distance) C4'-P energy: -171.113 bonds (distance) P-C4' energy: -181.606 flat angles C4'-P-C4' energy: -198.679 flat angles P-C4'-P energy: -112.800 tors. eta vs tors. theta energy: -135.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -1254.831104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.831104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.831104 (E_RNA) where: Base-Base interactions energy: -507.683 where: short stacking energy: -490.688 Base-Backbone interact. energy: 3.907 local terms energy: -751.055397 where: bonds (distance) C4'-P energy: -186.917 bonds (distance) P-C4' energy: -192.522 flat angles C4'-P-C4' energy: -178.461 flat angles P-C4'-P energy: -96.754 tors. eta vs tors. theta energy: -96.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -1194.320944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.320944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.320944 (E_RNA) where: Base-Base interactions energy: -484.343 where: short stacking energy: -472.788 Base-Backbone interact. energy: -0.791 local terms energy: -709.186520 where: bonds (distance) C4'-P energy: -166.280 bonds (distance) P-C4' energy: -179.823 flat angles C4'-P-C4' energy: -159.349 flat angles P-C4'-P energy: -106.803 tors. eta vs tors. theta energy: -96.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -1054.364031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1054.364031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.364031 (E_RNA) where: Base-Base interactions energy: -404.473 where: short stacking energy: -350.616 Base-Backbone interact. energy: 1.050 local terms energy: -650.941064 where: bonds (distance) C4'-P energy: -162.928 bonds (distance) P-C4' energy: -186.778 flat angles C4'-P-C4' energy: -167.701 flat angles P-C4'-P energy: -90.822 tors. eta vs tors. theta energy: -42.712 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -982.845553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -982.845553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -982.845553 (E_RNA) where: Base-Base interactions energy: -373.614 where: short stacking energy: -345.066 Base-Backbone interact. energy: -0.436 local terms energy: -608.795196 where: bonds (distance) C4'-P energy: -161.137 bonds (distance) P-C4' energy: -166.114 flat angles C4'-P-C4' energy: -148.993 flat angles P-C4'-P energy: -86.001 tors. eta vs tors. theta energy: -46.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -912.516706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.516706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.516706 (E_RNA) where: Base-Base interactions energy: -338.309 where: short stacking energy: -325.261 Base-Backbone interact. energy: 3.301 local terms energy: -577.508565 where: bonds (distance) C4'-P energy: -151.450 bonds (distance) P-C4' energy: -166.790 flat angles C4'-P-C4' energy: -136.302 flat angles P-C4'-P energy: -80.288 tors. eta vs tors. theta energy: -42.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -758.403378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -758.403378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -758.403378 (E_RNA) where: Base-Base interactions energy: -243.900 where: short stacking energy: -227.200 Base-Backbone interact. energy: 2.947 local terms energy: -517.450252 where: bonds (distance) C4'-P energy: -132.469 bonds (distance) P-C4' energy: -161.805 flat angles C4'-P-C4' energy: -140.290 flat angles P-C4'-P energy: -70.994 tors. eta vs tors. theta energy: -11.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -748.107014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -748.107014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -748.107014 (E_RNA) where: Base-Base interactions energy: -256.217 where: short stacking energy: -213.547 Base-Backbone interact. energy: -0.841 local terms energy: -491.048520 where: bonds (distance) C4'-P energy: -155.084 bonds (distance) P-C4' energy: -148.525 flat angles C4'-P-C4' energy: -110.411 flat angles P-C4'-P energy: -79.567 tors. eta vs tors. theta energy: 2.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -672.237415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.237415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.237415 (E_RNA) where: Base-Base interactions energy: -228.231 where: short stacking energy: -199.514 Base-Backbone interact. energy: -0.092 local terms energy: -443.914224 where: bonds (distance) C4'-P energy: -153.747 bonds (distance) P-C4' energy: -141.982 flat angles C4'-P-C4' energy: -127.511 flat angles P-C4'-P energy: -61.631 tors. eta vs tors. theta energy: 40.956 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -1540.393017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1540.393017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1540.393017 (E_RNA) where: Base-Base interactions energy: -652.062 where: short stacking energy: -634.550 Base-Backbone interact. energy: -0.547 local terms energy: -887.784575 where: bonds (distance) C4'-P energy: -186.477 bonds (distance) P-C4' energy: -192.983 flat angles C4'-P-C4' energy: -204.087 flat angles P-C4'-P energy: -129.248 tors. eta vs tors. theta energy: -174.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -1373.781569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1373.781569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1373.781569 (E_RNA) where: Base-Base interactions energy: -580.106 where: short stacking energy: -539.556 Base-Backbone interact. energy: -0.905 local terms energy: -792.771028 where: bonds (distance) C4'-P energy: -191.448 bonds (distance) P-C4' energy: -183.903 flat angles C4'-P-C4' energy: -181.788 flat angles P-C4'-P energy: -118.909 tors. eta vs tors. theta energy: -116.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -1321.785636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1321.785636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1321.785636 (E_RNA) where: Base-Base interactions energy: -548.114 where: short stacking energy: -518.281 Base-Backbone interact. energy: -1.781 local terms energy: -771.891159 where: bonds (distance) C4'-P energy: -194.394 bonds (distance) P-C4' energy: -169.934 flat angles C4'-P-C4' energy: -181.160 flat angles P-C4'-P energy: -109.494 tors. eta vs tors. theta energy: -116.910 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -1166.464202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1166.464202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.464202 (E_RNA) where: Base-Base interactions energy: -493.997 where: short stacking energy: -463.056 Base-Backbone interact. energy: 1.168 local terms energy: -673.634397 where: bonds (distance) C4'-P energy: -158.587 bonds (distance) P-C4' energy: -190.647 flat angles C4'-P-C4' energy: -145.109 flat angles P-C4'-P energy: -105.654 tors. eta vs tors. theta energy: -73.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -1073.044917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.044917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.044917 (E_RNA) where: Base-Base interactions energy: -423.793 where: short stacking energy: -364.032 Base-Backbone interact. energy: 0.059 local terms energy: -649.311302 where: bonds (distance) C4'-P energy: -159.237 bonds (distance) P-C4' energy: -175.368 flat angles C4'-P-C4' energy: -155.187 flat angles P-C4'-P energy: -103.799 tors. eta vs tors. theta energy: -55.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -958.252272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.252272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.252272 (E_RNA) where: Base-Base interactions energy: -394.674 where: short stacking energy: -327.741 Base-Backbone interact. energy: 5.737 local terms energy: -569.315615 where: bonds (distance) C4'-P energy: -144.570 bonds (distance) P-C4' energy: -169.030 flat angles C4'-P-C4' energy: -152.350 flat angles P-C4'-P energy: -97.120 tors. eta vs tors. theta energy: -6.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -847.256686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.256686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.256686 (E_RNA) where: Base-Base interactions energy: -329.330 where: short stacking energy: -274.125 Base-Backbone interact. energy: -3.996 local terms energy: -513.930807 where: bonds (distance) C4'-P energy: -132.773 bonds (distance) P-C4' energy: -149.956 flat angles C4'-P-C4' energy: -147.639 flat angles P-C4'-P energy: -76.152 tors. eta vs tors. theta energy: -7.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -796.161049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.161049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.161049 (E_RNA) where: Base-Base interactions energy: -279.930 where: short stacking energy: -266.352 Base-Backbone interact. energy: -2.196 local terms energy: -514.035938 where: bonds (distance) C4'-P energy: -121.283 bonds (distance) P-C4' energy: -150.711 flat angles C4'-P-C4' energy: -159.548 flat angles P-C4'-P energy: -85.138 tors. eta vs tors. theta energy: 2.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -761.338921 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.338921 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.338921 (E_RNA) where: Base-Base interactions energy: -290.382 where: short stacking energy: -224.607 Base-Backbone interact. energy: 1.974 local terms energy: -472.930643 where: bonds (distance) C4'-P energy: -160.830 bonds (distance) P-C4' energy: -126.924 flat angles C4'-P-C4' energy: -125.492 flat angles P-C4'-P energy: -66.838 tors. eta vs tors. theta energy: 7.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -726.027546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -726.027546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -726.027546 (E_RNA) where: Base-Base interactions energy: -260.082 where: short stacking energy: -240.949 Base-Backbone interact. energy: 2.911 local terms energy: -468.856606 where: bonds (distance) C4'-P energy: -136.538 bonds (distance) P-C4' energy: -166.115 flat angles C4'-P-C4' energy: -108.669 flat angles P-C4'-P energy: -79.235 tors. eta vs tors. theta energy: 21.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -1522.445916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1522.445916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1522.445916 (E_RNA) where: Base-Base interactions energy: -686.094 where: short stacking energy: -654.514 Base-Backbone interact. energy: 0.284 local terms energy: -836.636068 where: bonds (distance) C4'-P energy: -173.712 bonds (distance) P-C4' energy: -195.061 flat angles C4'-P-C4' energy: -171.648 flat angles P-C4'-P energy: -129.723 tors. eta vs tors. theta energy: -166.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -1382.120134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.120134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.120134 (E_RNA) where: Base-Base interactions energy: -589.625 where: short stacking energy: -540.635 Base-Backbone interact. energy: -0.291 local terms energy: -792.204146 where: bonds (distance) C4'-P energy: -179.094 bonds (distance) P-C4' energy: -196.140 flat angles C4'-P-C4' energy: -183.174 flat angles P-C4'-P energy: -121.881 tors. eta vs tors. theta energy: -111.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -1292.263586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.263586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.263586 (E_RNA) where: Base-Base interactions energy: -533.808 where: short stacking energy: -468.306 Base-Backbone interact. energy: 3.014 local terms energy: -761.469156 where: bonds (distance) C4'-P energy: -172.999 bonds (distance) P-C4' energy: -180.410 flat angles C4'-P-C4' energy: -188.197 flat angles P-C4'-P energy: -123.246 tors. eta vs tors. theta energy: -96.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -1173.408412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.408412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.408412 (E_RNA) where: Base-Base interactions energy: -516.321 where: short stacking energy: -409.224 Base-Backbone interact. energy: -1.262 local terms energy: -655.825870 where: bonds (distance) C4'-P energy: -176.460 bonds (distance) P-C4' energy: -180.014 flat angles C4'-P-C4' energy: -132.873 flat angles P-C4'-P energy: -101.471 tors. eta vs tors. theta energy: -65.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -1069.492390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.492390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.492390 (E_RNA) where: Base-Base interactions energy: -441.349 where: short stacking energy: -374.808 Base-Backbone interact. energy: -3.951 local terms energy: -624.191643 where: bonds (distance) C4'-P energy: -157.152 bonds (distance) P-C4' energy: -179.284 flat angles C4'-P-C4' energy: -151.250 flat angles P-C4'-P energy: -91.224 tors. eta vs tors. theta energy: -45.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -1035.046097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.046097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.046097 (E_RNA) where: Base-Base interactions energy: -425.005 where: short stacking energy: -325.465 Base-Backbone interact. energy: -0.739 local terms energy: -609.302568 where: bonds (distance) C4'-P energy: -165.790 bonds (distance) P-C4' energy: -180.568 flat angles C4'-P-C4' energy: -154.208 flat angles P-C4'-P energy: -85.773 tors. eta vs tors. theta energy: -22.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -843.263741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.263741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.263741 (E_RNA) where: Base-Base interactions energy: -279.444 where: short stacking energy: -243.637 Base-Backbone interact. energy: 0.561 local terms energy: -564.380578 where: bonds (distance) C4'-P energy: -147.787 bonds (distance) P-C4' energy: -175.201 flat angles C4'-P-C4' energy: -134.799 flat angles P-C4'-P energy: -103.791 tors. eta vs tors. theta energy: -2.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -814.834542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.834542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.834542 (E_RNA) where: Base-Base interactions energy: -297.764 where: short stacking energy: -236.030 Base-Backbone interact. energy: -1.420 local terms energy: -515.651306 where: bonds (distance) C4'-P energy: -161.014 bonds (distance) P-C4' energy: -151.477 flat angles C4'-P-C4' energy: -118.118 flat angles P-C4'-P energy: -91.320 tors. eta vs tors. theta energy: 6.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -753.873190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.873190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.873190 (E_RNA) where: Base-Base interactions energy: -264.615 where: short stacking energy: -228.987 Base-Backbone interact. energy: 0.361 local terms energy: -489.619066 where: bonds (distance) C4'-P energy: -150.559 bonds (distance) P-C4' energy: -155.052 flat angles C4'-P-C4' energy: -115.127 flat angles P-C4'-P energy: -88.146 tors. eta vs tors. theta energy: 19.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -686.760952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.760952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.760952 (E_RNA) where: Base-Base interactions energy: -264.647 where: short stacking energy: -196.539 Base-Backbone interact. energy: 3.685 local terms energy: -425.799548 where: bonds (distance) C4'-P energy: -160.756 bonds (distance) P-C4' energy: -151.051 flat angles C4'-P-C4' energy: -84.855 flat angles P-C4'-P energy: -54.641 tors. eta vs tors. theta energy: 25.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -1532.642054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1532.642054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1532.642054 (E_RNA) where: Base-Base interactions energy: -636.419 where: short stacking energy: -623.919 Base-Backbone interact. energy: -1.875 local terms energy: -894.348511 where: bonds (distance) C4'-P energy: -182.354 bonds (distance) P-C4' energy: -211.220 flat angles C4'-P-C4' energy: -191.597 flat angles P-C4'-P energy: -135.018 tors. eta vs tors. theta energy: -174.159 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -1475.721260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1475.721260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1475.721260 (E_RNA) where: Base-Base interactions energy: -656.790 where: short stacking energy: -592.940 Base-Backbone interact. energy: -0.644 local terms energy: -818.287680 where: bonds (distance) C4'-P energy: -189.230 bonds (distance) P-C4' energy: -188.566 flat angles C4'-P-C4' energy: -181.567 flat angles P-C4'-P energy: -110.965 tors. eta vs tors. theta energy: -147.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -1296.945503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.945503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.945503 (E_RNA) where: Base-Base interactions energy: -576.523 where: short stacking energy: -491.036 Base-Backbone interact. energy: 0.376 local terms energy: -720.799036 where: bonds (distance) C4'-P energy: -167.319 bonds (distance) P-C4' energy: -178.374 flat angles C4'-P-C4' energy: -165.028 flat angles P-C4'-P energy: -105.477 tors. eta vs tors. theta energy: -104.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -1184.740406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.740406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.740406 (E_RNA) where: Base-Base interactions energy: -490.776 where: short stacking energy: -415.335 Base-Backbone interact. energy: -2.194 local terms energy: -691.770392 where: bonds (distance) C4'-P energy: -167.191 bonds (distance) P-C4' energy: -159.891 flat angles C4'-P-C4' energy: -179.986 flat angles P-C4'-P energy: -105.768 tors. eta vs tors. theta energy: -78.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -1101.294045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.294045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.294045 (E_RNA) where: Base-Base interactions energy: -473.359 where: short stacking energy: -398.225 Base-Backbone interact. energy: 3.154 local terms energy: -631.088809 where: bonds (distance) C4'-P energy: -181.253 bonds (distance) P-C4' energy: -156.558 flat angles C4'-P-C4' energy: -159.059 flat angles P-C4'-P energy: -95.859 tors. eta vs tors. theta energy: -38.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -1154.738333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1154.738333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1154.738333 (E_RNA) where: Base-Base interactions energy: -537.376 where: short stacking energy: -384.891 Base-Backbone interact. energy: -3.943 local terms energy: -613.419449 where: bonds (distance) C4'-P energy: -154.580 bonds (distance) P-C4' energy: -153.561 flat angles C4'-P-C4' energy: -157.064 flat angles P-C4'-P energy: -90.884 tors. eta vs tors. theta energy: -57.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -910.775776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.775776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.775776 (E_RNA) where: Base-Base interactions energy: -365.191 where: short stacking energy: -284.421 Base-Backbone interact. energy: 3.184 local terms energy: -548.768436 where: bonds (distance) C4'-P energy: -149.608 bonds (distance) P-C4' energy: -171.504 flat angles C4'-P-C4' energy: -135.939 flat angles P-C4'-P energy: -75.158 tors. eta vs tors. theta energy: -16.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -871.234022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.234022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.234022 (E_RNA) where: Base-Base interactions energy: -356.302 where: short stacking energy: -272.491 Base-Backbone interact. energy: 0.847 local terms energy: -515.779697 where: bonds (distance) C4'-P energy: -129.798 bonds (distance) P-C4' energy: -156.299 flat angles C4'-P-C4' energy: -150.438 flat angles P-C4'-P energy: -69.514 tors. eta vs tors. theta energy: -9.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -721.955052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.955052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.955052 (E_RNA) where: Base-Base interactions energy: -253.321 where: short stacking energy: -240.693 Base-Backbone interact. energy: -1.703 local terms energy: -466.931255 where: bonds (distance) C4'-P energy: -145.598 bonds (distance) P-C4' energy: -141.647 flat angles C4'-P-C4' energy: -134.835 flat angles P-C4'-P energy: -65.540 tors. eta vs tors. theta energy: 20.689 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -682.435380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.435380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.435380 (E_RNA) where: Base-Base interactions energy: -217.220 where: short stacking energy: -188.042 Base-Backbone interact. energy: -2.206 local terms energy: -463.009652 where: bonds (distance) C4'-P energy: -119.223 bonds (distance) P-C4' energy: -183.765 flat angles C4'-P-C4' energy: -139.368 flat angles P-C4'-P energy: -45.951 tors. eta vs tors. theta energy: 25.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -1571.853215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1571.853215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1571.853215 (E_RNA) where: Base-Base interactions energy: -716.224 where: short stacking energy: -684.836 Base-Backbone interact. energy: -0.524 local terms energy: -855.104946 where: bonds (distance) C4'-P energy: -169.415 bonds (distance) P-C4' energy: -200.730 flat angles C4'-P-C4' energy: -189.275 flat angles P-C4'-P energy: -116.501 tors. eta vs tors. theta energy: -179.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -1525.957434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.957434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.957434 (E_RNA) where: Base-Base interactions energy: -718.448 where: short stacking energy: -597.707 Base-Backbone interact. energy: -1.098 local terms energy: -806.411625 where: bonds (distance) C4'-P energy: -184.853 bonds (distance) P-C4' energy: -187.879 flat angles C4'-P-C4' energy: -179.845 flat angles P-C4'-P energy: -114.692 tors. eta vs tors. theta energy: -139.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1348.465153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1348.465153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1348.465153 (E_RNA) where: Base-Base interactions energy: -613.166 where: short stacking energy: -480.456 Base-Backbone interact. energy: 0.308 local terms energy: -735.607184 where: bonds (distance) C4'-P energy: -180.098 bonds (distance) P-C4' energy: -185.360 flat angles C4'-P-C4' energy: -181.688 flat angles P-C4'-P energy: -96.241 tors. eta vs tors. theta energy: -92.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -1231.410770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.410770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.410770 (E_RNA) where: Base-Base interactions energy: -526.251 where: short stacking energy: -434.729 Base-Backbone interact. energy: 4.812 local terms energy: -709.972015 where: bonds (distance) C4'-P energy: -151.337 bonds (distance) P-C4' energy: -184.974 flat angles C4'-P-C4' energy: -179.424 flat angles P-C4'-P energy: -101.982 tors. eta vs tors. theta energy: -92.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -1244.611899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.611899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.611899 (E_RNA) where: Base-Base interactions energy: -601.831 where: short stacking energy: -402.457 Base-Backbone interact. energy: -3.832 local terms energy: -638.948116 where: bonds (distance) C4'-P energy: -177.279 bonds (distance) P-C4' energy: -162.942 flat angles C4'-P-C4' energy: -155.808 flat angles P-C4'-P energy: -92.596 tors. eta vs tors. theta energy: -50.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -1060.260032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.260032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.260032 (E_RNA) where: Base-Base interactions energy: -448.462 where: short stacking energy: -396.823 Base-Backbone interact. energy: -0.148 local terms energy: -611.650108 where: bonds (distance) C4'-P energy: -161.530 bonds (distance) P-C4' energy: -170.388 flat angles C4'-P-C4' energy: -144.692 flat angles P-C4'-P energy: -72.889 tors. eta vs tors. theta energy: -62.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -1008.260654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.260654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.260654 (E_RNA) where: Base-Base interactions energy: -436.095 where: short stacking energy: -307.039 Base-Backbone interact. energy: 1.515 local terms energy: -573.680758 where: bonds (distance) C4'-P energy: -141.321 bonds (distance) P-C4' energy: -164.201 flat angles C4'-P-C4' energy: -140.145 flat angles P-C4'-P energy: -92.009 tors. eta vs tors. theta energy: -36.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -898.626926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.626926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.626926 (E_RNA) where: Base-Base interactions energy: -394.792 where: short stacking energy: -287.419 Base-Backbone interact. energy: -3.498 local terms energy: -500.337550 where: bonds (distance) C4'-P energy: -147.948 bonds (distance) P-C4' energy: -147.549 flat angles C4'-P-C4' energy: -121.383 flat angles P-C4'-P energy: -78.912 tors. eta vs tors. theta energy: -4.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -733.728937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -733.728937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -733.728937 (E_RNA) where: Base-Base interactions energy: -239.548 where: short stacking energy: -184.154 Base-Backbone interact. energy: 1.573 local terms energy: -495.753837 where: bonds (distance) C4'-P energy: -147.830 bonds (distance) P-C4' energy: -164.423 flat angles C4'-P-C4' energy: -121.236 flat angles P-C4'-P energy: -81.967 tors. eta vs tors. theta energy: 19.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -682.518971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.518971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.518971 (E_RNA) where: Base-Base interactions energy: -235.330 where: short stacking energy: -203.261 Base-Backbone interact. energy: -0.180 local terms energy: -447.008521 where: bonds (distance) C4'-P energy: -128.634 bonds (distance) P-C4' energy: -153.128 flat angles C4'-P-C4' energy: -116.081 flat angles P-C4'-P energy: -83.782 tors. eta vs tors. theta energy: 34.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -1510.617024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.617024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.617024 (E_RNA) where: Base-Base interactions energy: -674.476 where: short stacking energy: -650.830 Base-Backbone interact. energy: -0.279 local terms energy: -835.861852 where: bonds (distance) C4'-P energy: -189.527 bonds (distance) P-C4' energy: -182.477 flat angles C4'-P-C4' energy: -197.360 flat angles P-C4'-P energy: -112.435 tors. eta vs tors. theta energy: -154.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1583.784882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.784882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.784882 (E_RNA) where: Base-Base interactions energy: -764.421 where: short stacking energy: -579.943 Base-Backbone interact. energy: -3.307 local terms energy: -816.056013 where: bonds (distance) C4'-P energy: -192.859 bonds (distance) P-C4' energy: -180.682 flat angles C4'-P-C4' energy: -184.482 flat angles P-C4'-P energy: -124.816 tors. eta vs tors. theta energy: -133.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -1437.199707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.199707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.199707 (E_RNA) where: Base-Base interactions energy: -694.634 where: short stacking energy: -531.695 Base-Backbone interact. energy: -3.665 local terms energy: -738.900674 where: bonds (distance) C4'-P energy: -168.231 bonds (distance) P-C4' energy: -166.936 flat angles C4'-P-C4' energy: -170.639 flat angles P-C4'-P energy: -121.440 tors. eta vs tors. theta energy: -111.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -1435.072859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1435.072859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1435.072859 (E_RNA) where: Base-Base interactions energy: -737.432 where: short stacking energy: -503.467 Base-Backbone interact. energy: 0.602 local terms energy: -698.243030 where: bonds (distance) C4'-P energy: -167.497 bonds (distance) P-C4' energy: -175.272 flat angles C4'-P-C4' energy: -150.529 flat angles P-C4'-P energy: -108.055 tors. eta vs tors. theta energy: -96.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -1175.983407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.983407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.983407 (E_RNA) where: Base-Base interactions energy: -538.107 where: short stacking energy: -393.976 Base-Backbone interact. energy: 1.528 local terms energy: -639.403976 where: bonds (distance) C4'-P energy: -166.240 bonds (distance) P-C4' energy: -166.508 flat angles C4'-P-C4' energy: -152.591 flat angles P-C4'-P energy: -87.993 tors. eta vs tors. theta energy: -66.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -1211.591028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.591028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.591028 (E_RNA) where: Base-Base interactions energy: -607.432 where: short stacking energy: -413.466 Base-Backbone interact. energy: 6.942 local terms energy: -611.100932 where: bonds (distance) C4'-P energy: -164.244 bonds (distance) P-C4' energy: -148.989 flat angles C4'-P-C4' energy: -149.891 flat angles P-C4'-P energy: -94.901 tors. eta vs tors. theta energy: -53.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -975.991469 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.991469 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.991469 (E_RNA) where: Base-Base interactions energy: -407.278 where: short stacking energy: -322.869 Base-Backbone interact. energy: -0.200 local terms energy: -568.513217 where: bonds (distance) C4'-P energy: -153.830 bonds (distance) P-C4' energy: -162.936 flat angles C4'-P-C4' energy: -150.372 flat angles P-C4'-P energy: -84.425 tors. eta vs tors. theta energy: -16.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -967.063263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -967.063263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -967.063263 (E_RNA) where: Base-Base interactions energy: -445.320 where: short stacking energy: -303.256 Base-Backbone interact. energy: -2.092 local terms energy: -519.650769 where: bonds (distance) C4'-P energy: -141.769 bonds (distance) P-C4' energy: -150.073 flat angles C4'-P-C4' energy: -145.722 flat angles P-C4'-P energy: -66.485 tors. eta vs tors. theta energy: -15.601 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -752.803047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.803047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.803047 (E_RNA) where: Base-Base interactions energy: -252.881 where: short stacking energy: -231.383 Base-Backbone interact. energy: 2.769 local terms energy: -502.690538 where: bonds (distance) C4'-P energy: -162.225 bonds (distance) P-C4' energy: -170.477 flat angles C4'-P-C4' energy: -92.408 flat angles P-C4'-P energy: -62.780 tors. eta vs tors. theta energy: -14.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -714.164846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.164846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.164846 (E_RNA) where: Base-Base interactions energy: -258.095 where: short stacking energy: -192.544 Base-Backbone interact. energy: 4.692 local terms energy: -460.762195 where: bonds (distance) C4'-P energy: -129.816 bonds (distance) P-C4' energy: -162.602 flat angles C4'-P-C4' energy: -126.945 flat angles P-C4'-P energy: -69.472 tors. eta vs tors. theta energy: 28.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1735.892644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1735.892644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1735.892644 (E_RNA) where: Base-Base interactions energy: -879.768 where: short stacking energy: -651.887 Base-Backbone interact. energy: -1.106 local terms energy: -855.019026 where: bonds (distance) C4'-P energy: -183.431 bonds (distance) P-C4' energy: -185.078 flat angles C4'-P-C4' energy: -192.257 flat angles P-C4'-P energy: -120.646 tors. eta vs tors. theta energy: -173.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1482.220861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1482.220861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1482.220861 (E_RNA) where: Base-Base interactions energy: -694.633 where: short stacking energy: -599.587 Base-Backbone interact. energy: -1.229 local terms energy: -786.358951 where: bonds (distance) C4'-P energy: -169.963 bonds (distance) P-C4' energy: -182.961 flat angles C4'-P-C4' energy: -194.320 flat angles P-C4'-P energy: -98.821 tors. eta vs tors. theta energy: -140.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1630.647394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.647394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.647394 (E_RNA) where: Base-Base interactions energy: -841.407 where: short stacking energy: -538.436 Base-Backbone interact. energy: -2.031 local terms energy: -787.209112 where: bonds (distance) C4'-P energy: -178.259 bonds (distance) P-C4' energy: -177.018 flat angles C4'-P-C4' energy: -189.097 flat angles P-C4'-P energy: -114.317 tors. eta vs tors. theta energy: -128.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -1311.324810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1311.324810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.324810 (E_RNA) where: Base-Base interactions energy: -574.071 where: short stacking energy: -466.730 Base-Backbone interact. energy: -0.306 local terms energy: -736.947962 where: bonds (distance) C4'-P energy: -166.860 bonds (distance) P-C4' energy: -165.148 flat angles C4'-P-C4' energy: -176.866 flat angles P-C4'-P energy: -108.270 tors. eta vs tors. theta energy: -119.804 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -1250.733100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.733100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.733100 (E_RNA) where: Base-Base interactions energy: -568.062 where: short stacking energy: -397.158 Base-Backbone interact. energy: 0.044 local terms energy: -682.715106 where: bonds (distance) C4'-P energy: -169.434 bonds (distance) P-C4' energy: -175.288 flat angles C4'-P-C4' energy: -165.850 flat angles P-C4'-P energy: -101.501 tors. eta vs tors. theta energy: -70.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -1172.181810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1172.181810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1172.181810 (E_RNA) where: Base-Base interactions energy: -549.077 where: short stacking energy: -371.699 Base-Backbone interact. energy: -1.136 local terms energy: -621.968899 where: bonds (distance) C4'-P energy: -152.463 bonds (distance) P-C4' energy: -162.560 flat angles C4'-P-C4' energy: -165.523 flat angles P-C4'-P energy: -82.159 tors. eta vs tors. theta energy: -59.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -1143.188771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.188771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.188771 (E_RNA) where: Base-Base interactions energy: -566.961 where: short stacking energy: -340.933 Base-Backbone interact. energy: -2.164 local terms energy: -574.063891 where: bonds (distance) C4'-P energy: -136.512 bonds (distance) P-C4' energy: -158.868 flat angles C4'-P-C4' energy: -151.988 flat angles P-C4'-P energy: -89.189 tors. eta vs tors. theta energy: -37.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -874.178306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -874.178306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -874.178306 (E_RNA) where: Base-Base interactions energy: -370.536 where: short stacking energy: -265.676 Base-Backbone interact. energy: -2.821 local terms energy: -500.820604 where: bonds (distance) C4'-P energy: -145.687 bonds (distance) P-C4' energy: -121.937 flat angles C4'-P-C4' energy: -137.932 flat angles P-C4'-P energy: -82.897 tors. eta vs tors. theta energy: -12.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -766.666123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.666123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.666123 (E_RNA) where: Base-Base interactions energy: -327.098 where: short stacking energy: -265.791 Base-Backbone interact. energy: -0.404 local terms energy: -439.163878 where: bonds (distance) C4'-P energy: -146.001 bonds (distance) P-C4' energy: -121.853 flat angles C4'-P-C4' energy: -124.627 flat angles P-C4'-P energy: -65.755 tors. eta vs tors. theta energy: 19.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -725.722231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -725.722231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -725.722231 (E_RNA) where: Base-Base interactions energy: -271.793 where: short stacking energy: -206.510 Base-Backbone interact. energy: -2.536 local terms energy: -451.392866 where: bonds (distance) C4'-P energy: -121.740 bonds (distance) P-C4' energy: -155.778 flat angles C4'-P-C4' energy: -136.326 flat angles P-C4'-P energy: -69.215 tors. eta vs tors. theta energy: 31.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1781.468593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1781.468593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1781.468593 (E_RNA) where: Base-Base interactions energy: -947.915 where: short stacking energy: -630.398 Base-Backbone interact. energy: 2.779 local terms energy: -836.332302 where: bonds (distance) C4'-P energy: -185.618 bonds (distance) P-C4' energy: -195.849 flat angles C4'-P-C4' energy: -188.536 flat angles P-C4'-P energy: -118.028 tors. eta vs tors. theta energy: -148.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1780.757906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1780.757906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.757906 (E_RNA) where: Base-Base interactions energy: -937.081 where: short stacking energy: -633.782 Base-Backbone interact. energy: -1.694 local terms energy: -841.983248 where: bonds (distance) C4'-P energy: -168.881 bonds (distance) P-C4' energy: -194.269 flat angles C4'-P-C4' energy: -191.361 flat angles P-C4'-P energy: -127.078 tors. eta vs tors. theta energy: -160.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -1436.575861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.575861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.575861 (E_RNA) where: Base-Base interactions energy: -687.196 where: short stacking energy: -546.648 Base-Backbone interact. energy: -0.435 local terms energy: -748.944828 where: bonds (distance) C4'-P energy: -167.545 bonds (distance) P-C4' energy: -181.935 flat angles C4'-P-C4' energy: -167.263 flat angles P-C4'-P energy: -104.187 tors. eta vs tors. theta energy: -128.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -1428.166174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1428.166174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1428.166174 (E_RNA) where: Base-Base interactions energy: -709.719 where: short stacking energy: -478.779 Base-Backbone interact. energy: 0.025 local terms energy: -718.472882 where: bonds (distance) C4'-P energy: -160.586 bonds (distance) P-C4' energy: -186.819 flat angles C4'-P-C4' energy: -157.946 flat angles P-C4'-P energy: -93.778 tors. eta vs tors. theta energy: -119.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -1168.977489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.977489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.977489 (E_RNA) where: Base-Base interactions energy: -507.408 where: short stacking energy: -404.390 Base-Backbone interact. energy: -2.593 local terms energy: -658.976661 where: bonds (distance) C4'-P energy: -164.186 bonds (distance) P-C4' energy: -171.670 flat angles C4'-P-C4' energy: -163.855 flat angles P-C4'-P energy: -95.855 tors. eta vs tors. theta energy: -63.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -1324.541674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.541674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.541674 (E_RNA) where: Base-Base interactions energy: -700.291 where: short stacking energy: -405.780 Base-Backbone interact. energy: -2.302 local terms energy: -621.948789 where: bonds (distance) C4'-P energy: -165.418 bonds (distance) P-C4' energy: -162.179 flat angles C4'-P-C4' energy: -153.300 flat angles P-C4'-P energy: -88.201 tors. eta vs tors. theta energy: -52.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -1150.263035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.263035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.263035 (E_RNA) where: Base-Base interactions energy: -559.098 where: short stacking energy: -377.564 Base-Backbone interact. energy: 4.827 local terms energy: -595.991886 where: bonds (distance) C4'-P energy: -154.784 bonds (distance) P-C4' energy: -145.120 flat angles C4'-P-C4' energy: -150.294 flat angles P-C4'-P energy: -95.505 tors. eta vs tors. theta energy: -50.288 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -772.304651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.304651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.304651 (E_RNA) where: Base-Base interactions energy: -278.217 where: short stacking energy: -233.920 Base-Backbone interact. energy: 1.570 local terms energy: -495.657016 where: bonds (distance) C4'-P energy: -137.531 bonds (distance) P-C4' energy: -157.051 flat angles C4'-P-C4' energy: -136.486 flat angles P-C4'-P energy: -85.061 tors. eta vs tors. theta energy: 20.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -817.219560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -817.219560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -817.219560 (E_RNA) where: Base-Base interactions energy: -306.071 where: short stacking energy: -262.944 Base-Backbone interact. energy: -3.546 local terms energy: -507.602993 where: bonds (distance) C4'-P energy: -139.984 bonds (distance) P-C4' energy: -175.048 flat angles C4'-P-C4' energy: -138.100 flat angles P-C4'-P energy: -62.331 tors. eta vs tors. theta energy: 7.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -678.433643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -678.433643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -678.433643 (E_RNA) where: Base-Base interactions energy: -263.501 where: short stacking energy: -194.926 Base-Backbone interact. energy: 2.320 local terms energy: -417.252828 where: bonds (distance) C4'-P energy: -149.021 bonds (distance) P-C4' energy: -159.938 flat angles C4'-P-C4' energy: -89.261 flat angles P-C4'-P energy: -58.233 tors. eta vs tors. theta energy: 39.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1858.400324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1858.400324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1858.400324 (E_RNA) where: Base-Base interactions energy: -997.170 where: short stacking energy: -693.652 Base-Backbone interact. energy: -2.077 local terms energy: -859.153247 where: bonds (distance) C4'-P energy: -194.295 bonds (distance) P-C4' energy: -182.124 flat angles C4'-P-C4' energy: -198.106 flat angles P-C4'-P energy: -112.826 tors. eta vs tors. theta energy: -171.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1759.967382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1759.967382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.967382 (E_RNA) where: Base-Base interactions energy: -939.287 where: short stacking energy: -594.860 Base-Backbone interact. energy: -4.457 local terms energy: -816.223334 where: bonds (distance) C4'-P energy: -193.340 bonds (distance) P-C4' energy: -184.594 flat angles C4'-P-C4' energy: -186.037 flat angles P-C4'-P energy: -121.729 tors. eta vs tors. theta energy: -130.523 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -1465.093243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.093243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.093243 (E_RNA) where: Base-Base interactions energy: -695.364 where: short stacking energy: -543.185 Base-Backbone interact. energy: 1.077 local terms energy: -770.806505 where: bonds (distance) C4'-P energy: -163.933 bonds (distance) P-C4' energy: -184.557 flat angles C4'-P-C4' energy: -186.100 flat angles P-C4'-P energy: -109.885 tors. eta vs tors. theta energy: -126.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -1499.550464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1499.550464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1499.550464 (E_RNA) where: Base-Base interactions energy: -786.739 where: short stacking energy: -513.211 Base-Backbone interact. energy: 1.491 local terms energy: -714.302279 where: bonds (distance) C4'-P energy: -166.629 bonds (distance) P-C4' energy: -176.791 flat angles C4'-P-C4' energy: -154.680 flat angles P-C4'-P energy: -101.778 tors. eta vs tors. theta energy: -114.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -1510.232913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.232913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.232913 (E_RNA) where: Base-Base interactions energy: -832.385 where: short stacking energy: -446.064 Base-Backbone interact. energy: 2.717 local terms energy: -680.565450 where: bonds (distance) C4'-P energy: -157.387 bonds (distance) P-C4' energy: -165.721 flat angles C4'-P-C4' energy: -174.505 flat angles P-C4'-P energy: -103.882 tors. eta vs tors. theta energy: -79.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -1065.848369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1065.848369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1065.848369 (E_RNA) where: Base-Base interactions energy: -463.424 where: short stacking energy: -321.459 Base-Backbone interact. energy: -0.304 local terms energy: -602.120855 where: bonds (distance) C4'-P energy: -177.957 bonds (distance) P-C4' energy: -176.360 flat angles C4'-P-C4' energy: -142.780 flat angles P-C4'-P energy: -87.281 tors. eta vs tors. theta energy: -17.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -1134.275959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1134.275959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.275959 (E_RNA) where: Base-Base interactions energy: -581.196 where: short stacking energy: -398.736 Base-Backbone interact. energy: 0.202 local terms energy: -553.282174 where: bonds (distance) C4'-P energy: -136.155 bonds (distance) P-C4' energy: -160.648 flat angles C4'-P-C4' energy: -138.079 flat angles P-C4'-P energy: -72.651 tors. eta vs tors. theta energy: -45.748 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -861.794926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.794926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.794926 (E_RNA) where: Base-Base interactions energy: -344.653 where: short stacking energy: -298.121 Base-Backbone interact. energy: 6.197 local terms energy: -523.339349 where: bonds (distance) C4'-P energy: -136.474 bonds (distance) P-C4' energy: -147.886 flat angles C4'-P-C4' energy: -132.415 flat angles P-C4'-P energy: -87.389 tors. eta vs tors. theta energy: -19.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -766.403287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.403287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.403287 (E_RNA) where: Base-Base interactions energy: -325.378 where: short stacking energy: -220.853 Base-Backbone interact. energy: -5.668 local terms energy: -435.357791 where: bonds (distance) C4'-P energy: -150.761 bonds (distance) P-C4' energy: -139.392 flat angles C4'-P-C4' energy: -136.812 flat angles P-C4'-P energy: -46.289 tors. eta vs tors. theta energy: 37.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -655.258142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.258142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.258142 (E_RNA) where: Base-Base interactions energy: -218.676 where: short stacking energy: -186.201 Base-Backbone interact. energy: 2.119 local terms energy: -438.700639 where: bonds (distance) C4'-P energy: -139.924 bonds (distance) P-C4' energy: -153.922 flat angles C4'-P-C4' energy: -126.917 flat angles P-C4'-P energy: -50.765 tors. eta vs tors. theta energy: 32.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1804.882585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1804.882585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1804.882585 (E_RNA) where: Base-Base interactions energy: -957.557 where: short stacking energy: -629.939 Base-Backbone interact. energy: -0.733 local terms energy: -846.593205 where: bonds (distance) C4'-P energy: -172.165 bonds (distance) P-C4' energy: -180.046 flat angles C4'-P-C4' energy: -208.746 flat angles P-C4'-P energy: -125.212 tors. eta vs tors. theta energy: -160.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1808.994482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1808.994482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1808.994482 (E_RNA) where: Base-Base interactions energy: -1031.184 where: short stacking energy: -592.345 Base-Backbone interact. energy: -0.593 local terms energy: -777.216908 where: bonds (distance) C4'-P energy: -172.607 bonds (distance) P-C4' energy: -170.252 flat angles C4'-P-C4' energy: -178.202 flat angles P-C4'-P energy: -119.018 tors. eta vs tors. theta energy: -137.137 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1564.092074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1564.092074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1564.092074 (E_RNA) where: Base-Base interactions energy: -806.141 where: short stacking energy: -537.699 Base-Backbone interact. energy: -1.183 local terms energy: -756.767692 where: bonds (distance) C4'-P energy: -176.063 bonds (distance) P-C4' energy: -178.447 flat angles C4'-P-C4' energy: -167.657 flat angles P-C4'-P energy: -121.621 tors. eta vs tors. theta energy: -112.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -1749.643671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1749.643671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1749.643671 (E_RNA) where: Base-Base interactions energy: -1016.047 where: short stacking energy: -571.976 Base-Backbone interact. energy: -2.954 local terms energy: -730.642881 where: bonds (distance) C4'-P energy: -160.944 bonds (distance) P-C4' energy: -172.875 flat angles C4'-P-C4' energy: -171.771 flat angles P-C4'-P energy: -112.887 tors. eta vs tors. theta energy: -112.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -1385.987855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.987855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.987855 (E_RNA) where: Base-Base interactions energy: -723.087 where: short stacking energy: -460.395 Base-Backbone interact. energy: -1.215 local terms energy: -661.685698 where: bonds (distance) C4'-P energy: -146.953 bonds (distance) P-C4' energy: -157.368 flat angles C4'-P-C4' energy: -171.872 flat angles P-C4'-P energy: -89.450 tors. eta vs tors. theta energy: -96.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -1174.767491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.767491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.767491 (E_RNA) where: Base-Base interactions energy: -582.532 where: short stacking energy: -349.464 Base-Backbone interact. energy: 3.800 local terms energy: -596.035077 where: bonds (distance) C4'-P energy: -154.730 bonds (distance) P-C4' energy: -157.471 flat angles C4'-P-C4' energy: -148.424 flat angles P-C4'-P energy: -83.205 tors. eta vs tors. theta energy: -52.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -983.334559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.334559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.334559 (E_RNA) where: Base-Base interactions energy: -428.360 where: short stacking energy: -322.606 Base-Backbone interact. energy: -0.014 local terms energy: -554.960958 where: bonds (distance) C4'-P energy: -168.526 bonds (distance) P-C4' energy: -145.779 flat angles C4'-P-C4' energy: -165.357 flat angles P-C4'-P energy: -81.608 tors. eta vs tors. theta energy: 6.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -850.080860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.080860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.080860 (E_RNA) where: Base-Base interactions energy: -332.891 where: short stacking energy: -219.375 Base-Backbone interact. energy: -0.408 local terms energy: -516.781535 where: bonds (distance) C4'-P energy: -170.826 bonds (distance) P-C4' energy: -168.261 flat angles C4'-P-C4' energy: -124.444 flat angles P-C4'-P energy: -63.580 tors. eta vs tors. theta energy: 10.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -772.793007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.793007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.793007 (E_RNA) where: Base-Base interactions energy: -271.867 where: short stacking energy: -220.220 Base-Backbone interact. energy: 1.433 local terms energy: -502.359434 where: bonds (distance) C4'-P energy: -150.753 bonds (distance) P-C4' energy: -144.429 flat angles C4'-P-C4' energy: -129.180 flat angles P-C4'-P energy: -91.481 tors. eta vs tors. theta energy: 13.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -761.816559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.816559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.816559 (E_RNA) where: Base-Base interactions energy: -329.738 where: short stacking energy: -235.549 Base-Backbone interact. energy: 3.192 local terms energy: -435.270193 where: bonds (distance) C4'-P energy: -131.142 bonds (distance) P-C4' energy: -146.758 flat angles C4'-P-C4' energy: -109.916 flat angles P-C4'-P energy: -61.486 tors. eta vs tors. theta energy: 14.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1980.246935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1980.246935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1980.246935 (E_RNA) where: Base-Base interactions energy: -1123.175 where: short stacking energy: -680.225 Base-Backbone interact. energy: -1.036 local terms energy: -856.036232 where: bonds (distance) C4'-P energy: -187.250 bonds (distance) P-C4' energy: -178.241 flat angles C4'-P-C4' energy: -194.019 flat angles P-C4'-P energy: -116.881 tors. eta vs tors. theta energy: -179.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1783.454206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1783.454206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.454206 (E_RNA) where: Base-Base interactions energy: -969.892 where: short stacking energy: -609.314 Base-Backbone interact. energy: -2.669 local terms energy: -810.892701 where: bonds (distance) C4'-P energy: -177.386 bonds (distance) P-C4' energy: -183.413 flat angles C4'-P-C4' energy: -187.553 flat angles P-C4'-P energy: -116.338 tors. eta vs tors. theta energy: -146.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1914.574100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1914.574100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1914.574100 (E_RNA) where: Base-Base interactions energy: -1163.713 where: short stacking energy: -600.046 Base-Backbone interact. energy: -3.489 local terms energy: -747.372016 where: bonds (distance) C4'-P energy: -148.498 bonds (distance) P-C4' energy: -180.383 flat angles C4'-P-C4' energy: -179.007 flat angles P-C4'-P energy: -126.383 tors. eta vs tors. theta energy: -113.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1471.450112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.450112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.450112 (E_RNA) where: Base-Base interactions energy: -762.069 where: short stacking energy: -484.288 Base-Backbone interact. energy: -1.264 local terms energy: -708.117781 where: bonds (distance) C4'-P energy: -172.736 bonds (distance) P-C4' energy: -171.348 flat angles C4'-P-C4' energy: -170.871 flat angles P-C4'-P energy: -93.729 tors. eta vs tors. theta energy: -99.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -1420.086395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.086395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.086395 (E_RNA) where: Base-Base interactions energy: -734.415 where: short stacking energy: -455.714 Base-Backbone interact. energy: 5.751 local terms energy: -691.422725 where: bonds (distance) C4'-P energy: -155.522 bonds (distance) P-C4' energy: -187.817 flat angles C4'-P-C4' energy: -167.373 flat angles P-C4'-P energy: -106.010 tors. eta vs tors. theta energy: -74.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -1265.320403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1265.320403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1265.320403 (E_RNA) where: Base-Base interactions energy: -653.460 where: short stacking energy: -388.485 Base-Backbone interact. energy: -0.877 local terms energy: -610.983218 where: bonds (distance) C4'-P energy: -157.311 bonds (distance) P-C4' energy: -161.209 flat angles C4'-P-C4' energy: -148.754 flat angles P-C4'-P energy: -85.302 tors. eta vs tors. theta energy: -58.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -1008.987124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.987124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.987124 (E_RNA) where: Base-Base interactions energy: -446.209 where: short stacking energy: -317.828 Base-Backbone interact. energy: 1.145 local terms energy: -563.922963 where: bonds (distance) C4'-P energy: -165.892 bonds (distance) P-C4' energy: -135.172 flat angles C4'-P-C4' energy: -128.795 flat angles P-C4'-P energy: -92.464 tors. eta vs tors. theta energy: -41.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -835.541388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.541388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.541388 (E_RNA) where: Base-Base interactions energy: -333.685 where: short stacking energy: -272.955 Base-Backbone interact. energy: 0.034 local terms energy: -501.891082 where: bonds (distance) C4'-P energy: -126.357 bonds (distance) P-C4' energy: -138.789 flat angles C4'-P-C4' energy: -164.830 flat angles P-C4'-P energy: -74.269 tors. eta vs tors. theta energy: 2.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -833.107785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.107785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.107785 (E_RNA) where: Base-Base interactions energy: -318.552 where: short stacking energy: -209.377 Base-Backbone interact. energy: -5.878 local terms energy: -508.677449 where: bonds (distance) C4'-P energy: -168.552 bonds (distance) P-C4' energy: -164.053 flat angles C4'-P-C4' energy: -136.456 flat angles P-C4'-P energy: -67.847 tors. eta vs tors. theta energy: 28.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -721.182347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -721.182347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -721.182347 (E_RNA) where: Base-Base interactions energy: -280.959 where: short stacking energy: -192.994 Base-Backbone interact. energy: -0.029 local terms energy: -440.194401 where: bonds (distance) C4'-P energy: -133.818 bonds (distance) P-C4' energy: -129.767 flat angles C4'-P-C4' energy: -138.611 flat angles P-C4'-P energy: -74.802 tors. eta vs tors. theta energy: 36.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -2000.792846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2000.792846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2000.792846 (E_RNA) where: Base-Base interactions energy: -1166.148 where: short stacking energy: -694.250 Base-Backbone interact. energy: 0.419 local terms energy: -835.064250 where: bonds (distance) C4'-P energy: -178.068 bonds (distance) P-C4' energy: -162.025 flat angles C4'-P-C4' energy: -189.512 flat angles P-C4'-P energy: -127.641 tors. eta vs tors. theta energy: -177.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -2167.129228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2167.129228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2167.129228 (E_RNA) where: Base-Base interactions energy: -1310.555 where: short stacking energy: -663.226 Base-Backbone interact. energy: -4.985 local terms energy: -851.588697 where: bonds (distance) C4'-P energy: -189.754 bonds (distance) P-C4' energy: -182.730 flat angles C4'-P-C4' energy: -191.408 flat angles P-C4'-P energy: -116.517 tors. eta vs tors. theta energy: -171.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1689.960376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1689.960376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1689.960376 (E_RNA) where: Base-Base interactions energy: -932.395 where: short stacking energy: -591.819 Base-Backbone interact. energy: -2.217 local terms energy: -755.348380 where: bonds (distance) C4'-P energy: -166.675 bonds (distance) P-C4' energy: -169.340 flat angles C4'-P-C4' energy: -167.605 flat angles P-C4'-P energy: -96.545 tors. eta vs tors. theta energy: -155.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1418.297884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.297884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.297884 (E_RNA) where: Base-Base interactions energy: -736.512 where: short stacking energy: -415.747 Base-Backbone interact. energy: -2.206 local terms energy: -679.580252 where: bonds (distance) C4'-P energy: -168.228 bonds (distance) P-C4' energy: -182.528 flat angles C4'-P-C4' energy: -173.228 flat angles P-C4'-P energy: -90.813 tors. eta vs tors. theta energy: -64.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -1515.229275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1515.229275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1515.229275 (E_RNA) where: Base-Base interactions energy: -830.960 where: short stacking energy: -481.638 Base-Backbone interact. energy: -2.806 local terms energy: -681.462918 where: bonds (distance) C4'-P energy: -164.999 bonds (distance) P-C4' energy: -171.109 flat angles C4'-P-C4' energy: -171.363 flat angles P-C4'-P energy: -88.210 tors. eta vs tors. theta energy: -85.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -1394.014510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1394.014510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1394.014510 (E_RNA) where: Base-Base interactions energy: -778.109 where: short stacking energy: -405.143 Base-Backbone interact. energy: -1.835 local terms energy: -614.070425 where: bonds (distance) C4'-P energy: -166.694 bonds (distance) P-C4' energy: -154.107 flat angles C4'-P-C4' energy: -149.304 flat angles P-C4'-P energy: -88.120 tors. eta vs tors. theta energy: -55.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -1056.502420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1056.502420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1056.502420 (E_RNA) where: Base-Base interactions energy: -492.247 where: short stacking energy: -350.906 Base-Backbone interact. energy: 2.834 local terms energy: -567.089946 where: bonds (distance) C4'-P energy: -162.361 bonds (distance) P-C4' energy: -151.825 flat angles C4'-P-C4' energy: -143.053 flat angles P-C4'-P energy: -79.614 tors. eta vs tors. theta energy: -30.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -1015.797896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.797896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.797896 (E_RNA) where: Base-Base interactions energy: -492.492 where: short stacking energy: -300.986 Base-Backbone interact. energy: -0.417 local terms energy: -522.888896 where: bonds (distance) C4'-P energy: -148.047 bonds (distance) P-C4' energy: -151.185 flat angles C4'-P-C4' energy: -150.813 flat angles P-C4'-P energy: -70.871 tors. eta vs tors. theta energy: -1.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -794.393933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -794.393933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -794.393933 (E_RNA) where: Base-Base interactions energy: -298.524 where: short stacking energy: -232.953 Base-Backbone interact. energy: 2.135 local terms energy: -498.004916 where: bonds (distance) C4'-P energy: -140.818 bonds (distance) P-C4' energy: -158.246 flat angles C4'-P-C4' energy: -134.192 flat angles P-C4'-P energy: -69.901 tors. eta vs tors. theta energy: 5.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -703.683008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.683008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.683008 (E_RNA) where: Base-Base interactions energy: -261.236 where: short stacking energy: -178.065 Base-Backbone interact. energy: 2.046 local terms energy: -444.493090 where: bonds (distance) C4'-P energy: -136.815 bonds (distance) P-C4' energy: -172.174 flat angles C4'-P-C4' energy: -114.497 flat angles P-C4'-P energy: -60.302 tors. eta vs tors. theta energy: 39.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -2418.689043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2418.689043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2418.689043 (E_RNA) where: Base-Base interactions energy: -1513.335 where: short stacking energy: -754.362 Base-Backbone interact. energy: -3.503 local terms energy: -901.851377 where: bonds (distance) C4'-P energy: -184.952 bonds (distance) P-C4' energy: -194.261 flat angles C4'-P-C4' energy: -201.572 flat angles P-C4'-P energy: -130.261 tors. eta vs tors. theta energy: -190.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -2022.583637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2022.583637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2022.583637 (E_RNA) where: Base-Base interactions energy: -1193.634 where: short stacking energy: -669.346 Base-Backbone interact. energy: 0.593 local terms energy: -829.543144 where: bonds (distance) C4'-P energy: -175.440 bonds (distance) P-C4' energy: -185.646 flat angles C4'-P-C4' energy: -181.188 flat angles P-C4'-P energy: -113.862 tors. eta vs tors. theta energy: -173.406 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1683.722629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.722629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.722629 (E_RNA) where: Base-Base interactions energy: -885.862 where: short stacking energy: -564.917 Base-Backbone interact. energy: -3.412 local terms energy: -794.448301 where: bonds (distance) C4'-P energy: -174.088 bonds (distance) P-C4' energy: -189.164 flat angles C4'-P-C4' energy: -174.432 flat angles P-C4'-P energy: -123.384 tors. eta vs tors. theta energy: -133.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1520.155772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1520.155772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1520.155772 (E_RNA) where: Base-Base interactions energy: -803.912 where: short stacking energy: -501.958 Base-Backbone interact. energy: -1.121 local terms energy: -715.122712 where: bonds (distance) C4'-P energy: -174.065 bonds (distance) P-C4' energy: -164.377 flat angles C4'-P-C4' energy: -162.876 flat angles P-C4'-P energy: -117.628 tors. eta vs tors. theta energy: -96.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1592.653142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.653142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1592.653142 (E_RNA) where: Base-Base interactions energy: -935.235 where: short stacking energy: -489.752 Base-Backbone interact. energy: -4.212 local terms energy: -653.205228 where: bonds (distance) C4'-P energy: -172.709 bonds (distance) P-C4' energy: -142.043 flat angles C4'-P-C4' energy: -138.580 flat angles P-C4'-P energy: -96.683 tors. eta vs tors. theta energy: -103.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -1386.053509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.053509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.053509 (E_RNA) where: Base-Base interactions energy: -759.708 where: short stacking energy: -416.259 Base-Backbone interact. energy: -3.450 local terms energy: -622.894801 where: bonds (distance) C4'-P energy: -145.581 bonds (distance) P-C4' energy: -162.338 flat angles C4'-P-C4' energy: -162.148 flat angles P-C4'-P energy: -102.739 tors. eta vs tors. theta energy: -50.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -1066.120816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.120816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.120816 (E_RNA) where: Base-Base interactions energy: -487.240 where: short stacking energy: -326.851 Base-Backbone interact. energy: -2.357 local terms energy: -576.522896 where: bonds (distance) C4'-P energy: -151.705 bonds (distance) P-C4' energy: -145.565 flat angles C4'-P-C4' energy: -144.427 flat angles P-C4'-P energy: -101.624 tors. eta vs tors. theta energy: -33.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -1014.641242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.641242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.641242 (E_RNA) where: Base-Base interactions energy: -476.670 where: short stacking energy: -302.358 Base-Backbone interact. energy: -2.490 local terms energy: -535.481705 where: bonds (distance) C4'-P energy: -110.153 bonds (distance) P-C4' energy: -176.324 flat angles C4'-P-C4' energy: -145.381 flat angles P-C4'-P energy: -95.735 tors. eta vs tors. theta energy: -7.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -810.138290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.138290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.138290 (E_RNA) where: Base-Base interactions energy: -346.066 where: short stacking energy: -226.871 Base-Backbone interact. energy: 3.574 local terms energy: -467.645766 where: bonds (distance) C4'-P energy: -157.666 bonds (distance) P-C4' energy: -153.188 flat angles C4'-P-C4' energy: -106.359 flat angles P-C4'-P energy: -69.992 tors. eta vs tors. theta energy: 19.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -679.770904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.770904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.770904 (E_RNA) where: Base-Base interactions energy: -201.748 where: short stacking energy: -173.046 Base-Backbone interact. energy: 5.749 local terms energy: -483.771331 where: bonds (distance) C4'-P energy: -140.536 bonds (distance) P-C4' energy: -149.074 flat angles C4'-P-C4' energy: -141.034 flat angles P-C4'-P energy: -84.178 tors. eta vs tors. theta energy: 31.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -2469.254228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2469.254228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2469.254228 (E_RNA) where: Base-Base interactions energy: -1555.314 where: short stacking energy: -761.637 Base-Backbone interact. energy: -2.256 local terms energy: -911.684095 where: bonds (distance) C4'-P energy: -182.088 bonds (distance) P-C4' energy: -189.175 flat angles C4'-P-C4' energy: -192.801 flat angles P-C4'-P energy: -137.517 tors. eta vs tors. theta energy: -210.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -2055.747565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2055.747565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2055.747565 (E_RNA) where: Base-Base interactions energy: -1258.925 where: short stacking energy: -709.301 Base-Backbone interact. energy: 5.626 local terms energy: -802.449245 where: bonds (distance) C4'-P energy: -171.202 bonds (distance) P-C4' energy: -162.799 flat angles C4'-P-C4' energy: -170.826 flat angles P-C4'-P energy: -119.061 tors. eta vs tors. theta energy: -178.560 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1681.101269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1681.101269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1681.101269 (E_RNA) where: Base-Base interactions energy: -893.380 where: short stacking energy: -597.036 Base-Backbone interact. energy: 0.907 local terms energy: -788.628637 where: bonds (distance) C4'-P energy: -162.084 bonds (distance) P-C4' energy: -170.821 flat angles C4'-P-C4' energy: -181.658 flat angles P-C4'-P energy: -115.783 tors. eta vs tors. theta energy: -158.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1659.702226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1659.702226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1659.702226 (E_RNA) where: Base-Base interactions energy: -925.497 where: short stacking energy: -516.962 Base-Backbone interact. energy: 1.101 local terms energy: -735.306340 where: bonds (distance) C4'-P energy: -156.550 bonds (distance) P-C4' energy: -182.169 flat angles C4'-P-C4' energy: -171.202 flat angles P-C4'-P energy: -110.860 tors. eta vs tors. theta energy: -114.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -1434.092274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.092274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.092274 (E_RNA) where: Base-Base interactions energy: -790.366 where: short stacking energy: -492.120 Base-Backbone interact. energy: -1.342 local terms energy: -642.384486 where: bonds (distance) C4'-P energy: -132.331 bonds (distance) P-C4' energy: -171.395 flat angles C4'-P-C4' energy: -152.068 flat angles P-C4'-P energy: -96.080 tors. eta vs tors. theta energy: -90.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -1470.272104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.272104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.272104 (E_RNA) where: Base-Base interactions energy: -822.132 where: short stacking energy: -420.550 Base-Backbone interact. energy: 0.572 local terms energy: -648.711823 where: bonds (distance) C4'-P energy: -137.131 bonds (distance) P-C4' energy: -164.722 flat angles C4'-P-C4' energy: -172.396 flat angles P-C4'-P energy: -98.107 tors. eta vs tors. theta energy: -76.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -1080.228155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.228155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.228155 (E_RNA) where: Base-Base interactions energy: -495.550 where: short stacking energy: -305.585 Base-Backbone interact. energy: 2.195 local terms energy: -586.872777 where: bonds (distance) C4'-P energy: -162.114 bonds (distance) P-C4' energy: -155.467 flat angles C4'-P-C4' energy: -140.605 flat angles P-C4'-P energy: -85.102 tors. eta vs tors. theta energy: -43.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -990.649671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.649671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.649671 (E_RNA) where: Base-Base interactions energy: -440.250 where: short stacking energy: -272.129 Base-Backbone interact. energy: -3.109 local terms energy: -547.290086 where: bonds (distance) C4'-P energy: -135.122 bonds (distance) P-C4' energy: -146.623 flat angles C4'-P-C4' energy: -155.672 flat angles P-C4'-P energy: -89.399 tors. eta vs tors. theta energy: -20.474 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -783.825414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.825414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.825414 (E_RNA) where: Base-Base interactions energy: -312.130 where: short stacking energy: -228.892 Base-Backbone interact. energy: 3.396 local terms energy: -475.091685 where: bonds (distance) C4'-P energy: -148.217 bonds (distance) P-C4' energy: -159.582 flat angles C4'-P-C4' energy: -132.288 flat angles P-C4'-P energy: -58.999 tors. eta vs tors. theta energy: 23.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -687.360175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -687.360175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -687.360175 (E_RNA) where: Base-Base interactions energy: -275.313 where: short stacking energy: -199.673 Base-Backbone interact. energy: 0.266 local terms energy: -412.313258 where: bonds (distance) C4'-P energy: -125.129 bonds (distance) P-C4' energy: -148.310 flat angles C4'-P-C4' energy: -127.726 flat angles P-C4'-P energy: -59.576 tors. eta vs tors. theta energy: 48.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -2483.743676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2483.743676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2483.743676 (E_RNA) where: Base-Base interactions energy: -1607.460 where: short stacking energy: -767.765 Base-Backbone interact. energy: -1.310 local terms energy: -874.974251 where: bonds (distance) C4'-P energy: -188.678 bonds (distance) P-C4' energy: -160.107 flat angles C4'-P-C4' energy: -190.669 flat angles P-C4'-P energy: -116.415 tors. eta vs tors. theta energy: -219.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1985.575107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1985.575107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1985.575107 (E_RNA) where: Base-Base interactions energy: -1162.711 where: short stacking energy: -644.175 Base-Backbone interact. energy: 2.977 local terms energy: -825.840704 where: bonds (distance) C4'-P energy: -172.724 bonds (distance) P-C4' energy: -186.434 flat angles C4'-P-C4' energy: -190.593 flat angles P-C4'-P energy: -126.058 tors. eta vs tors. theta energy: -150.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1710.278536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.278536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1710.278536 (E_RNA) where: Base-Base interactions energy: -942.005 where: short stacking energy: -574.114 Base-Backbone interact. energy: -3.530 local terms energy: -764.743153 where: bonds (distance) C4'-P energy: -158.505 bonds (distance) P-C4' energy: -167.867 flat angles C4'-P-C4' energy: -189.844 flat angles P-C4'-P energy: -110.703 tors. eta vs tors. theta energy: -137.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1719.767951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1719.767951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1719.767951 (E_RNA) where: Base-Base interactions energy: -1017.814 where: short stacking energy: -527.833 Base-Backbone interact. energy: -1.238 local terms energy: -700.716049 where: bonds (distance) C4'-P energy: -150.694 bonds (distance) P-C4' energy: -170.283 flat angles C4'-P-C4' energy: -148.441 flat angles P-C4'-P energy: -111.477 tors. eta vs tors. theta energy: -119.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -1605.585926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1605.585926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1605.585926 (E_RNA) where: Base-Base interactions energy: -932.623 where: short stacking energy: -474.702 Base-Backbone interact. energy: 1.996 local terms energy: -674.958637 where: bonds (distance) C4'-P energy: -164.677 bonds (distance) P-C4' energy: -175.256 flat angles C4'-P-C4' energy: -151.160 flat angles P-C4'-P energy: -105.507 tors. eta vs tors. theta energy: -78.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -1249.410326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.410326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.410326 (E_RNA) where: Base-Base interactions energy: -649.658 where: short stacking energy: -359.086 Base-Backbone interact. energy: -4.708 local terms energy: -595.044747 where: bonds (distance) C4'-P energy: -163.645 bonds (distance) P-C4' energy: -152.598 flat angles C4'-P-C4' energy: -157.633 flat angles P-C4'-P energy: -84.746 tors. eta vs tors. theta energy: -36.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -1085.523142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.523142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1085.523142 (E_RNA) where: Base-Base interactions energy: -527.365 where: short stacking energy: -355.509 Base-Backbone interact. energy: -1.782 local terms energy: -556.375326 where: bonds (distance) C4'-P energy: -142.763 bonds (distance) P-C4' energy: -150.086 flat angles C4'-P-C4' energy: -141.843 flat angles P-C4'-P energy: -79.174 tors. eta vs tors. theta energy: -42.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -1055.560471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.560471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.560471 (E_RNA) where: Base-Base interactions energy: -520.748 where: short stacking energy: -309.777 Base-Backbone interact. energy: 4.726 local terms energy: -539.539321 where: bonds (distance) C4'-P energy: -128.647 bonds (distance) P-C4' energy: -171.119 flat angles C4'-P-C4' energy: -139.149 flat angles P-C4'-P energy: -91.080 tors. eta vs tors. theta energy: -9.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -729.651864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.651864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.651864 (E_RNA) where: Base-Base interactions energy: -267.073 where: short stacking energy: -201.935 Base-Backbone interact. energy: 3.384 local terms energy: -465.963189 where: bonds (distance) C4'-P energy: -131.635 bonds (distance) P-C4' energy: -159.781 flat angles C4'-P-C4' energy: -135.756 flat angles P-C4'-P energy: -59.934 tors. eta vs tors. theta energy: 21.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -670.859553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.859553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.859553 (E_RNA) where: Base-Base interactions energy: -234.507 where: short stacking energy: -203.435 Base-Backbone interact. energy: 3.134 local terms energy: -439.485760 where: bonds (distance) C4'-P energy: -148.465 bonds (distance) P-C4' energy: -149.372 flat angles C4'-P-C4' energy: -105.250 flat angles P-C4'-P energy: -76.754 tors. eta vs tors. theta energy: 40.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -2499.551457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2499.551457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2499.551457 (E_RNA) where: Base-Base interactions energy: -1603.204 where: short stacking energy: -797.520 Base-Backbone interact. energy: -2.505 local terms energy: -893.842469 where: bonds (distance) C4'-P energy: -174.488 bonds (distance) P-C4' energy: -177.475 flat angles C4'-P-C4' energy: -188.813 flat angles P-C4'-P energy: -145.002 tors. eta vs tors. theta energy: -208.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -2034.841525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2034.841525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2034.841525 (E_RNA) where: Base-Base interactions energy: -1225.702 where: short stacking energy: -663.232 Base-Backbone interact. energy: -1.790 local terms energy: -807.348984 where: bonds (distance) C4'-P energy: -166.230 bonds (distance) P-C4' energy: -171.112 flat angles C4'-P-C4' energy: -192.829 flat angles P-C4'-P energy: -123.302 tors. eta vs tors. theta energy: -153.875 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1702.239337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1702.239337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1702.239337 (E_RNA) where: Base-Base interactions energy: -926.747 where: short stacking energy: -559.943 Base-Backbone interact. energy: -3.608 local terms energy: -771.884793 where: bonds (distance) C4'-P energy: -155.106 bonds (distance) P-C4' energy: -184.721 flat angles C4'-P-C4' energy: -185.546 flat angles P-C4'-P energy: -116.750 tors. eta vs tors. theta energy: -129.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1723.170817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1723.170817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1723.170817 (E_RNA) where: Base-Base interactions energy: -1019.278 where: short stacking energy: -512.390 Base-Backbone interact. energy: -1.300 local terms energy: -702.592887 where: bonds (distance) C4'-P energy: -187.190 bonds (distance) P-C4' energy: -161.820 flat angles C4'-P-C4' energy: -150.468 flat angles P-C4'-P energy: -104.630 tors. eta vs tors. theta energy: -98.485 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -1686.185941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1686.185941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1686.185941 (E_RNA) where: Base-Base interactions energy: -945.153 where: short stacking energy: -495.844 Base-Backbone interact. energy: 5.524 local terms energy: -746.556251 where: bonds (distance) C4'-P energy: -166.298 bonds (distance) P-C4' energy: -175.214 flat angles C4'-P-C4' energy: -174.811 flat angles P-C4'-P energy: -117.714 tors. eta vs tors. theta energy: -112.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -1254.406400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.406400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.406400 (E_RNA) where: Base-Base interactions energy: -636.642 where: short stacking energy: -381.551 Base-Backbone interact. energy: 2.625 local terms energy: -620.389969 where: bonds (distance) C4'-P energy: -162.632 bonds (distance) P-C4' energy: -158.158 flat angles C4'-P-C4' energy: -139.801 flat angles P-C4'-P energy: -104.545 tors. eta vs tors. theta energy: -55.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -1215.610541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.610541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.610541 (E_RNA) where: Base-Base interactions energy: -648.061 where: short stacking energy: -388.685 Base-Backbone interact. energy: 1.089 local terms energy: -568.638195 where: bonds (distance) C4'-P energy: -137.544 bonds (distance) P-C4' energy: -165.137 flat angles C4'-P-C4' energy: -143.663 flat angles P-C4'-P energy: -92.872 tors. eta vs tors. theta energy: -29.424 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -1024.887090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1024.887090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1024.887090 (E_RNA) where: Base-Base interactions energy: -480.106 where: short stacking energy: -302.321 Base-Backbone interact. energy: 1.929 local terms energy: -546.710068 where: bonds (distance) C4'-P energy: -134.315 bonds (distance) P-C4' energy: -174.879 flat angles C4'-P-C4' energy: -133.705 flat angles P-C4'-P energy: -94.590 tors. eta vs tors. theta energy: -9.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -751.985566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.985566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.985566 (E_RNA) where: Base-Base interactions energy: -296.336 where: short stacking energy: -194.301 Base-Backbone interact. energy: -3.802 local terms energy: -451.847338 where: bonds (distance) C4'-P energy: -126.938 bonds (distance) P-C4' energy: -162.649 flat angles C4'-P-C4' energy: -106.803 flat angles P-C4'-P energy: -82.645 tors. eta vs tors. theta energy: 27.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -693.029270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.029270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.029270 (E_RNA) where: Base-Base interactions energy: -242.218 where: short stacking energy: -202.958 Base-Backbone interact. energy: 1.427 local terms energy: -452.238502 where: bonds (distance) C4'-P energy: -144.530 bonds (distance) P-C4' energy: -135.190 flat angles C4'-P-C4' energy: -121.114 flat angles P-C4'-P energy: -70.981 tors. eta vs tors. theta energy: 19.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -2497.798129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2497.798129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2497.798129 (E_RNA) where: Base-Base interactions energy: -1619.132 where: short stacking energy: -758.245 Base-Backbone interact. energy: -2.546 local terms energy: -876.119510 where: bonds (distance) C4'-P energy: -189.782 bonds (distance) P-C4' energy: -189.666 flat angles C4'-P-C4' energy: -181.736 flat angles P-C4'-P energy: -120.140 tors. eta vs tors. theta energy: -194.795 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -2058.729393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2058.729393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2058.729393 (E_RNA) where: Base-Base interactions energy: -1259.946 where: short stacking energy: -655.655 Base-Backbone interact. energy: 3.807 local terms energy: -802.591134 where: bonds (distance) C4'-P energy: -161.408 bonds (distance) P-C4' energy: -175.185 flat angles C4'-P-C4' energy: -191.364 flat angles P-C4'-P energy: -120.251 tors. eta vs tors. theta energy: -154.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1876.923275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1876.923275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1876.923275 (E_RNA) where: Base-Base interactions energy: -1086.997 where: short stacking energy: -565.321 Base-Backbone interact. energy: -2.883 local terms energy: -787.043412 where: bonds (distance) C4'-P energy: -163.954 bonds (distance) P-C4' energy: -166.059 flat angles C4'-P-C4' energy: -181.542 flat angles P-C4'-P energy: -130.508 tors. eta vs tors. theta energy: -144.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1734.040519 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1734.040519 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1734.040519 (E_RNA) where: Base-Base interactions energy: -949.537 where: short stacking energy: -544.622 Base-Backbone interact. energy: -0.320 local terms energy: -784.183294 where: bonds (distance) C4'-P energy: -173.829 bonds (distance) P-C4' energy: -184.644 flat angles C4'-P-C4' energy: -180.435 flat angles P-C4'-P energy: -111.592 tors. eta vs tors. theta energy: -133.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1617.013423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1617.013423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1617.013423 (E_RNA) where: Base-Base interactions energy: -915.382 where: short stacking energy: -500.803 Base-Backbone interact. energy: -1.489 local terms energy: -700.142338 where: bonds (distance) C4'-P energy: -146.298 bonds (distance) P-C4' energy: -173.561 flat angles C4'-P-C4' energy: -168.568 flat angles P-C4'-P energy: -108.007 tors. eta vs tors. theta energy: -103.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -1204.837108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.837108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.837108 (E_RNA) where: Base-Base interactions energy: -576.113 where: short stacking energy: -378.544 Base-Backbone interact. energy: 0.242 local terms energy: -628.966468 where: bonds (distance) C4'-P energy: -164.609 bonds (distance) P-C4' energy: -159.798 flat angles C4'-P-C4' energy: -154.835 flat angles P-C4'-P energy: -102.812 tors. eta vs tors. theta energy: -46.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -1291.152271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.152271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1291.152271 (E_RNA) where: Base-Base interactions energy: -683.631 where: short stacking energy: -322.865 Base-Backbone interact. energy: 6.338 local terms energy: -613.859019 where: bonds (distance) C4'-P energy: -165.772 bonds (distance) P-C4' energy: -170.737 flat angles C4'-P-C4' energy: -152.829 flat angles P-C4'-P energy: -92.307 tors. eta vs tors. theta energy: -32.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -1043.846553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.846553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.846553 (E_RNA) where: Base-Base interactions energy: -481.223 where: short stacking energy: -291.448 Base-Backbone interact. energy: 1.082 local terms energy: -563.704794 where: bonds (distance) C4'-P energy: -160.811 bonds (distance) P-C4' energy: -166.157 flat angles C4'-P-C4' energy: -138.210 flat angles P-C4'-P energy: -75.085 tors. eta vs tors. theta energy: -23.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -789.937311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.937311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.937311 (E_RNA) where: Base-Base interactions energy: -281.431 where: short stacking energy: -244.083 Base-Backbone interact. energy: -2.948 local terms energy: -505.558190 where: bonds (distance) C4'-P energy: -138.242 bonds (distance) P-C4' energy: -168.345 flat angles C4'-P-C4' energy: -133.648 flat angles P-C4'-P energy: -67.363 tors. eta vs tors. theta energy: 2.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -671.033467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -671.033467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -671.033467 (E_RNA) where: Base-Base interactions energy: -236.754 where: short stacking energy: -189.967 Base-Backbone interact. energy: -0.822 local terms energy: -433.456525 where: bonds (distance) C4'-P energy: -122.587 bonds (distance) P-C4' energy: -152.816 flat angles C4'-P-C4' energy: -127.428 flat angles P-C4'-P energy: -60.441 tors. eta vs tors. theta energy: 29.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -2487.124824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2487.124824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2487.124824 (E_RNA) where: Base-Base interactions energy: -1617.967 where: short stacking energy: -725.694 Base-Backbone interact. energy: -4.449 local terms energy: -864.708963 where: bonds (distance) C4'-P energy: -195.006 bonds (distance) P-C4' energy: -171.274 flat angles C4'-P-C4' energy: -185.587 flat angles P-C4'-P energy: -118.343 tors. eta vs tors. theta energy: -194.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -2054.753290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2054.753290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2054.753290 (E_RNA) where: Base-Base interactions energy: -1245.254 where: short stacking energy: -682.031 Base-Backbone interact. energy: 2.297 local terms energy: -811.797246 where: bonds (distance) C4'-P energy: -165.346 bonds (distance) P-C4' energy: -174.099 flat angles C4'-P-C4' energy: -195.994 flat angles P-C4'-P energy: -109.124 tors. eta vs tors. theta energy: -167.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1910.724909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1910.724909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1910.724909 (E_RNA) where: Base-Base interactions energy: -1142.423 where: short stacking energy: -635.793 Base-Backbone interact. energy: -1.070 local terms energy: -767.232271 where: bonds (distance) C4'-P energy: -165.219 bonds (distance) P-C4' energy: -171.579 flat angles C4'-P-C4' energy: -193.764 flat angles P-C4'-P energy: -88.158 tors. eta vs tors. theta energy: -148.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1668.786104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1668.786104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1668.786104 (E_RNA) where: Base-Base interactions energy: -965.654 where: short stacking energy: -534.983 Base-Backbone interact. energy: 0.323 local terms energy: -703.455508 where: bonds (distance) C4'-P energy: -149.502 bonds (distance) P-C4' energy: -173.275 flat angles C4'-P-C4' energy: -169.656 flat angles P-C4'-P energy: -96.638 tors. eta vs tors. theta energy: -114.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1661.680384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1661.680384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1661.680384 (E_RNA) where: Base-Base interactions energy: -934.235 where: short stacking energy: -466.517 Base-Backbone interact. energy: -5.455 local terms energy: -721.990568 where: bonds (distance) C4'-P energy: -176.283 bonds (distance) P-C4' energy: -173.126 flat angles C4'-P-C4' energy: -176.967 flat angles P-C4'-P energy: -95.189 tors. eta vs tors. theta energy: -100.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -1419.727497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.727497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.727497 (E_RNA) where: Base-Base interactions energy: -784.231 where: short stacking energy: -385.262 Base-Backbone interact. energy: -5.195 local terms energy: -630.301693 where: bonds (distance) C4'-P energy: -159.306 bonds (distance) P-C4' energy: -151.622 flat angles C4'-P-C4' energy: -158.798 flat angles P-C4'-P energy: -101.837 tors. eta vs tors. theta energy: -58.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -1066.047939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1066.047939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1066.047939 (E_RNA) where: Base-Base interactions energy: -488.453 where: short stacking energy: -291.527 Base-Backbone interact. energy: -1.373 local terms energy: -576.221814 where: bonds (distance) C4'-P energy: -152.950 bonds (distance) P-C4' energy: -171.866 flat angles C4'-P-C4' energy: -149.157 flat angles P-C4'-P energy: -80.142 tors. eta vs tors. theta energy: -22.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -1006.885164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1006.885164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1006.885164 (E_RNA) where: Base-Base interactions energy: -482.241 where: short stacking energy: -320.137 Base-Backbone interact. energy: -2.072 local terms energy: -522.571990 where: bonds (distance) C4'-P energy: -150.090 bonds (distance) P-C4' energy: -165.734 flat angles C4'-P-C4' energy: -133.346 flat angles P-C4'-P energy: -54.873 tors. eta vs tors. theta energy: -18.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -812.218547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.218547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.218547 (E_RNA) where: Base-Base interactions energy: -351.776 where: short stacking energy: -248.048 Base-Backbone interact. energy: 0.519 local terms energy: -460.962052 where: bonds (distance) C4'-P energy: -132.000 bonds (distance) P-C4' energy: -143.821 flat angles C4'-P-C4' energy: -109.959 flat angles P-C4'-P energy: -95.497 tors. eta vs tors. theta energy: 20.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -686.863023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.863023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.863023 (E_RNA) where: Base-Base interactions energy: -239.721 where: short stacking energy: -216.336 Base-Backbone interact. energy: 14.253 local terms energy: -461.395571 where: bonds (distance) C4'-P energy: -122.484 bonds (distance) P-C4' energy: -139.755 flat angles C4'-P-C4' energy: -130.109 flat angles P-C4'-P energy: -93.598 tors. eta vs tors. theta energy: 24.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -2526.723850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.723850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.723850 (E_RNA) where: Base-Base interactions energy: -1643.079 where: short stacking energy: -785.492 Base-Backbone interact. energy: -0.666 local terms energy: -882.978902 where: bonds (distance) C4'-P energy: -175.577 bonds (distance) P-C4' energy: -190.135 flat angles C4'-P-C4' energy: -183.551 flat angles P-C4'-P energy: -132.784 tors. eta vs tors. theta energy: -200.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -2110.526515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2110.526515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2110.526515 (E_RNA) where: Base-Base interactions energy: -1234.443 where: short stacking energy: -712.020 Base-Backbone interact. energy: -1.931 local terms energy: -874.152284 where: bonds (distance) C4'-P energy: -180.768 bonds (distance) P-C4' energy: -195.592 flat angles C4'-P-C4' energy: -190.705 flat angles P-C4'-P energy: -120.807 tors. eta vs tors. theta energy: -186.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1936.155514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.155514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.155514 (E_RNA) where: Base-Base interactions energy: -1109.085 where: short stacking energy: -596.277 Base-Backbone interact. energy: -0.454 local terms energy: -826.616397 where: bonds (distance) C4'-P energy: -181.071 bonds (distance) P-C4' energy: -181.674 flat angles C4'-P-C4' energy: -191.683 flat angles P-C4'-P energy: -129.361 tors. eta vs tors. theta energy: -142.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1706.286806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1706.286806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1706.286806 (E_RNA) where: Base-Base interactions energy: -958.344 where: short stacking energy: -560.749 Base-Backbone interact. energy: 2.135 local terms energy: -750.078717 where: bonds (distance) C4'-P energy: -159.586 bonds (distance) P-C4' energy: -183.534 flat angles C4'-P-C4' energy: -186.097 flat angles P-C4'-P energy: -103.757 tors. eta vs tors. theta energy: -117.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1712.060765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1712.060765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1712.060765 (E_RNA) where: Base-Base interactions energy: -1051.105 where: short stacking energy: -520.737 Base-Backbone interact. energy: 2.961 local terms energy: -663.916744 where: bonds (distance) C4'-P energy: -155.316 bonds (distance) P-C4' energy: -167.582 flat angles C4'-P-C4' energy: -149.927 flat angles P-C4'-P energy: -89.256 tors. eta vs tors. theta energy: -101.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -1494.413672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1494.413672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1494.413672 (E_RNA) where: Base-Base interactions energy: -858.123 where: short stacking energy: -458.926 Base-Backbone interact. energy: 0.153 local terms energy: -636.443415 where: bonds (distance) C4'-P energy: -170.163 bonds (distance) P-C4' energy: -147.591 flat angles C4'-P-C4' energy: -156.694 flat angles P-C4'-P energy: -83.665 tors. eta vs tors. theta energy: -78.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -1083.254545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.254545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.254545 (E_RNA) where: Base-Base interactions energy: -501.393 where: short stacking energy: -322.664 Base-Backbone interact. energy: -0.616 local terms energy: -581.245371 where: bonds (distance) C4'-P energy: -166.323 bonds (distance) P-C4' energy: -147.669 flat angles C4'-P-C4' energy: -133.298 flat angles P-C4'-P energy: -101.258 tors. eta vs tors. theta energy: -32.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -1023.644155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.644155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.644155 (E_RNA) where: Base-Base interactions energy: -478.946 where: short stacking energy: -296.188 Base-Backbone interact. energy: 1.953 local terms energy: -546.650935 where: bonds (distance) C4'-P energy: -157.554 bonds (distance) P-C4' energy: -152.519 flat angles C4'-P-C4' energy: -126.386 flat angles P-C4'-P energy: -90.744 tors. eta vs tors. theta energy: -19.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -835.644103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.644103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.644103 (E_RNA) where: Base-Base interactions energy: -386.660 where: short stacking energy: -272.112 Base-Backbone interact. energy: -0.076 local terms energy: -448.907773 where: bonds (distance) C4'-P energy: -124.096 bonds (distance) P-C4' energy: -149.372 flat angles C4'-P-C4' energy: -113.132 flat angles P-C4'-P energy: -53.374 tors. eta vs tors. theta energy: -8.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -679.202950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.202950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.202950 (E_RNA) where: Base-Base interactions energy: -234.932 where: short stacking energy: -185.271 Base-Backbone interact. energy: 2.822 local terms energy: -447.093408 where: bonds (distance) C4'-P energy: -152.496 bonds (distance) P-C4' energy: -159.410 flat angles C4'-P-C4' energy: -91.497 flat angles P-C4'-P energy: -68.006 tors. eta vs tors. theta energy: 24.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -2587.408262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2587.408262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2587.408262 (E_RNA) where: Base-Base interactions energy: -1659.541 where: short stacking energy: -746.683 Base-Backbone interact. energy: -0.522 local terms energy: -927.344586 where: bonds (distance) C4'-P energy: -181.978 bonds (distance) P-C4' energy: -203.816 flat angles C4'-P-C4' energy: -202.708 flat angles P-C4'-P energy: -132.063 tors. eta vs tors. theta energy: -206.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -2112.958102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.958102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.958102 (E_RNA) where: Base-Base interactions energy: -1256.204 where: short stacking energy: -720.282 Base-Backbone interact. energy: -0.893 local terms energy: -855.860336 where: bonds (distance) C4'-P energy: -174.755 bonds (distance) P-C4' energy: -191.946 flat angles C4'-P-C4' energy: -177.465 flat angles P-C4'-P energy: -122.939 tors. eta vs tors. theta energy: -188.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1965.237440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1965.237440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1965.237440 (E_RNA) where: Base-Base interactions energy: -1201.115 where: short stacking energy: -627.474 Base-Backbone interact. energy: -1.653 local terms energy: -762.469195 where: bonds (distance) C4'-P energy: -173.440 bonds (distance) P-C4' energy: -169.225 flat angles C4'-P-C4' energy: -170.270 flat angles P-C4'-P energy: -107.862 tors. eta vs tors. theta energy: -141.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1826.095030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1826.095030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1826.095030 (E_RNA) where: Base-Base interactions energy: -1085.243 where: short stacking energy: -551.243 Base-Backbone interact. energy: -1.469 local terms energy: -739.382999 where: bonds (distance) C4'-P energy: -155.143 bonds (distance) P-C4' energy: -182.221 flat angles C4'-P-C4' energy: -167.964 flat angles P-C4'-P energy: -112.879 tors. eta vs tors. theta energy: -121.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -1525.329133 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1525.329133 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1525.329133 (E_RNA) where: Base-Base interactions energy: -874.991 where: short stacking energy: -472.264 Base-Backbone interact. energy: 4.303 local terms energy: -654.641233 where: bonds (distance) C4'-P energy: -142.201 bonds (distance) P-C4' energy: -159.510 flat angles C4'-P-C4' energy: -161.316 flat angles P-C4'-P energy: -95.946 tors. eta vs tors. theta energy: -95.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -1530.177698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1530.177698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1530.177698 (E_RNA) where: Base-Base interactions energy: -859.147 where: short stacking energy: -457.235 Base-Backbone interact. energy: 5.617 local terms energy: -676.648265 where: bonds (distance) C4'-P energy: -154.985 bonds (distance) P-C4' energy: -161.913 flat angles C4'-P-C4' energy: -178.891 flat angles P-C4'-P energy: -104.635 tors. eta vs tors. theta energy: -76.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -1031.326757 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.326757 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.326757 (E_RNA) where: Base-Base interactions energy: -445.825 where: short stacking energy: -316.896 Base-Backbone interact. energy: 0.568 local terms energy: -586.069595 where: bonds (distance) C4'-P energy: -148.081 bonds (distance) P-C4' energy: -162.837 flat angles C4'-P-C4' energy: -153.065 flat angles P-C4'-P energy: -102.383 tors. eta vs tors. theta energy: -19.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -1017.399665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.399665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.399665 (E_RNA) where: Base-Base interactions energy: -480.714 where: short stacking energy: -293.625 Base-Backbone interact. energy: -0.250 local terms energy: -536.436265 where: bonds (distance) C4'-P energy: -139.083 bonds (distance) P-C4' energy: -162.105 flat angles C4'-P-C4' energy: -136.283 flat angles P-C4'-P energy: -77.018 tors. eta vs tors. theta energy: -21.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -882.766075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.766075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.766075 (E_RNA) where: Base-Base interactions energy: -395.876 where: short stacking energy: -247.016 Base-Backbone interact. energy: 3.727 local terms energy: -490.617432 where: bonds (distance) C4'-P energy: -137.824 bonds (distance) P-C4' energy: -147.060 flat angles C4'-P-C4' energy: -147.272 flat angles P-C4'-P energy: -60.197 tors. eta vs tors. theta energy: 1.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -677.086814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.086814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.086814 (E_RNA) where: Base-Base interactions energy: -251.866 where: short stacking energy: -204.519 Base-Backbone interact. energy: 1.516 local terms energy: -426.737026 where: bonds (distance) C4'-P energy: -123.011 bonds (distance) P-C4' energy: -165.157 flat angles C4'-P-C4' energy: -103.220 flat angles P-C4'-P energy: -63.172 tors. eta vs tors. theta energy: 27.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -2549.455946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2549.455946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2549.455946 (E_RNA) where: Base-Base interactions energy: -1668.657 where: short stacking energy: -782.422 Base-Backbone interact. energy: -0.883 local terms energy: -879.916160 where: bonds (distance) C4'-P energy: -166.205 bonds (distance) P-C4' energy: -185.308 flat angles C4'-P-C4' energy: -191.553 flat angles P-C4'-P energy: -122.609 tors. eta vs tors. theta energy: -214.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -2111.278038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2111.278038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2111.278038 (E_RNA) where: Base-Base interactions energy: -1252.758 where: short stacking energy: -706.400 Base-Backbone interact. energy: -1.362 local terms energy: -857.158657 where: bonds (distance) C4'-P energy: -181.061 bonds (distance) P-C4' energy: -166.266 flat angles C4'-P-C4' energy: -197.120 flat angles P-C4'-P energy: -131.560 tors. eta vs tors. theta energy: -181.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1990.551635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1990.551635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1990.551635 (E_RNA) where: Base-Base interactions energy: -1197.997 where: short stacking energy: -626.742 Base-Backbone interact. energy: 2.313 local terms energy: -794.867239 where: bonds (distance) C4'-P energy: -167.161 bonds (distance) P-C4' energy: -181.935 flat angles C4'-P-C4' energy: -185.505 flat angles P-C4'-P energy: -123.267 tors. eta vs tors. theta energy: -137.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1865.423439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1865.423439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1865.423439 (E_RNA) where: Base-Base interactions energy: -1091.628 where: short stacking energy: -567.728 Base-Backbone interact. energy: 0.923 local terms energy: -774.718317 where: bonds (distance) C4'-P energy: -172.550 bonds (distance) P-C4' energy: -179.370 flat angles C4'-P-C4' energy: -162.731 flat angles P-C4'-P energy: -125.468 tors. eta vs tors. theta energy: -134.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -1604.137567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1604.137567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1604.137567 (E_RNA) where: Base-Base interactions energy: -878.435 where: short stacking energy: -493.159 Base-Backbone interact. energy: -4.371 local terms energy: -721.332032 where: bonds (distance) C4'-P energy: -167.362 bonds (distance) P-C4' energy: -176.314 flat angles C4'-P-C4' energy: -181.553 flat angles P-C4'-P energy: -99.831 tors. eta vs tors. theta energy: -96.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -1535.468077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1535.468077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1535.468077 (E_RNA) where: Base-Base interactions energy: -896.379 where: short stacking energy: -451.887 Base-Backbone interact. energy: -4.033 local terms energy: -635.055428 where: bonds (distance) C4'-P energy: -159.802 bonds (distance) P-C4' energy: -160.039 flat angles C4'-P-C4' energy: -152.128 flat angles P-C4'-P energy: -87.777 tors. eta vs tors. theta energy: -75.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -1062.611080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.611080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1062.611080 (E_RNA) where: Base-Base interactions energy: -508.608 where: short stacking energy: -304.452 Base-Backbone interact. energy: 2.823 local terms energy: -556.825773 where: bonds (distance) C4'-P energy: -151.355 bonds (distance) P-C4' energy: -168.267 flat angles C4'-P-C4' energy: -134.412 flat angles P-C4'-P energy: -89.568 tors. eta vs tors. theta energy: -13.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -928.534845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.534845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.534845 (E_RNA) where: Base-Base interactions energy: -399.135 where: short stacking energy: -275.547 Base-Backbone interact. energy: 1.002 local terms energy: -530.402258 where: bonds (distance) C4'-P energy: -145.093 bonds (distance) P-C4' energy: -154.241 flat angles C4'-P-C4' energy: -144.279 flat angles P-C4'-P energy: -91.360 tors. eta vs tors. theta energy: 4.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -904.325801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.325801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.325801 (E_RNA) where: Base-Base interactions energy: -432.475 where: short stacking energy: -221.277 Base-Backbone interact. energy: 2.792 local terms energy: -474.642146 where: bonds (distance) C4'-P energy: -163.875 bonds (distance) P-C4' energy: -134.514 flat angles C4'-P-C4' energy: -106.633 flat angles P-C4'-P energy: -69.750 tors. eta vs tors. theta energy: 0.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -666.075910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.075910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.075910 (E_RNA) where: Base-Base interactions energy: -241.128 where: short stacking energy: -195.199 Base-Backbone interact. energy: -0.203 local terms energy: -424.744988 where: bonds (distance) C4'-P energy: -139.931 bonds (distance) P-C4' energy: -152.641 flat angles C4'-P-C4' energy: -112.267 flat angles P-C4'-P energy: -55.508 tors. eta vs tors. theta energy: 35.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -2588.004350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2588.004350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2588.004350 (E_RNA) where: Base-Base interactions energy: -1678.319 where: short stacking energy: -799.258 Base-Backbone interact. energy: -2.356 local terms energy: -907.329015 where: bonds (distance) C4'-P energy: -174.378 bonds (distance) P-C4' energy: -186.799 flat angles C4'-P-C4' energy: -203.126 flat angles P-C4'-P energy: -136.078 tors. eta vs tors. theta energy: -206.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -2146.054270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2146.054270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2146.054270 (E_RNA) where: Base-Base interactions energy: -1273.363 where: short stacking energy: -696.237 Base-Backbone interact. energy: -2.691 local terms energy: -870.000511 where: bonds (distance) C4'-P energy: -193.275 bonds (distance) P-C4' energy: -182.036 flat angles C4'-P-C4' energy: -183.489 flat angles P-C4'-P energy: -116.615 tors. eta vs tors. theta energy: -194.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -2012.443694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.443694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.443694 (E_RNA) where: Base-Base interactions energy: -1184.810 where: short stacking energy: -611.811 Base-Backbone interact. energy: -5.852 local terms energy: -821.781259 where: bonds (distance) C4'-P energy: -175.200 bonds (distance) P-C4' energy: -179.013 flat angles C4'-P-C4' energy: -190.357 flat angles P-C4'-P energy: -126.109 tors. eta vs tors. theta energy: -151.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1875.189497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1875.189497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1875.189497 (E_RNA) where: Base-Base interactions energy: -1094.922 where: short stacking energy: -600.158 Base-Backbone interact. energy: 0.618 local terms energy: -780.886029 where: bonds (distance) C4'-P energy: -163.941 bonds (distance) P-C4' energy: -172.678 flat angles C4'-P-C4' energy: -175.921 flat angles P-C4'-P energy: -107.842 tors. eta vs tors. theta energy: -160.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1551.896930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1551.896930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1551.896930 (E_RNA) where: Base-Base interactions energy: -864.465 where: short stacking energy: -489.014 Base-Backbone interact. energy: -4.673 local terms energy: -682.758666 where: bonds (distance) C4'-P energy: -148.212 bonds (distance) P-C4' energy: -159.128 flat angles C4'-P-C4' energy: -153.527 flat angles P-C4'-P energy: -119.748 tors. eta vs tors. theta energy: -102.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -1572.898169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1572.898169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1572.898169 (E_RNA) where: Base-Base interactions energy: -908.910 where: short stacking energy: -476.117 Base-Backbone interact. energy: 0.745 local terms energy: -664.732635 where: bonds (distance) C4'-P energy: -165.964 bonds (distance) P-C4' energy: -167.293 flat angles C4'-P-C4' energy: -151.430 flat angles P-C4'-P energy: -87.422 tors. eta vs tors. theta energy: -92.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -1120.042702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.042702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.042702 (E_RNA) where: Base-Base interactions energy: -532.747 where: short stacking energy: -353.522 Base-Backbone interact. energy: -1.968 local terms energy: -585.328113 where: bonds (distance) C4'-P energy: -134.002 bonds (distance) P-C4' energy: -167.654 flat angles C4'-P-C4' energy: -146.350 flat angles P-C4'-P energy: -88.497 tors. eta vs tors. theta energy: -48.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -980.693068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.693068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.693068 (E_RNA) where: Base-Base interactions energy: -450.006 where: short stacking energy: -282.410 Base-Backbone interact. energy: -1.204 local terms energy: -529.483384 where: bonds (distance) C4'-P energy: -158.741 bonds (distance) P-C4' energy: -152.263 flat angles C4'-P-C4' energy: -124.585 flat angles P-C4'-P energy: -80.294 tors. eta vs tors. theta energy: -13.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -892.042433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -892.042433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.042433 (E_RNA) where: Base-Base interactions energy: -439.266 where: short stacking energy: -228.507 Base-Backbone interact. energy: -5.127 local terms energy: -447.649923 where: bonds (distance) C4'-P energy: -142.776 bonds (distance) P-C4' energy: -144.777 flat angles C4'-P-C4' energy: -99.798 flat angles P-C4'-P energy: -71.272 tors. eta vs tors. theta energy: 10.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -651.484797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -651.484797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -651.484797 (E_RNA) where: Base-Base interactions energy: -235.585 where: short stacking energy: -215.073 Base-Backbone interact. energy: 0.914 local terms energy: -416.813794 where: bonds (distance) C4'-P energy: -128.307 bonds (distance) P-C4' energy: -126.217 flat angles C4'-P-C4' energy: -114.551 flat angles P-C4'-P energy: -76.537 tors. eta vs tors. theta energy: 28.799 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -2596.461767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2596.461767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2596.461767 (E_RNA) where: Base-Base interactions energy: -1696.518 where: short stacking energy: -799.460 Base-Backbone interact. energy: -2.735 local terms energy: -897.209051 where: bonds (distance) C4'-P energy: -171.029 bonds (distance) P-C4' energy: -200.410 flat angles C4'-P-C4' energy: -206.559 flat angles P-C4'-P energy: -111.390 tors. eta vs tors. theta energy: -207.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -2209.486169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2209.486169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2209.486169 (E_RNA) where: Base-Base interactions energy: -1360.160 where: short stacking energy: -728.810 Base-Backbone interact. energy: -2.371 local terms energy: -846.955568 where: bonds (distance) C4'-P energy: -168.424 bonds (distance) P-C4' energy: -177.110 flat angles C4'-P-C4' energy: -180.177 flat angles P-C4'-P energy: -124.614 tors. eta vs tors. theta energy: -196.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -2021.058684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2021.058684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2021.058684 (E_RNA) where: Base-Base interactions energy: -1220.427 where: short stacking energy: -620.495 Base-Backbone interact. energy: -0.886 local terms energy: -799.745972 where: bonds (distance) C4'-P energy: -168.763 bonds (distance) P-C4' energy: -193.757 flat angles C4'-P-C4' energy: -180.832 flat angles P-C4'-P energy: -109.336 tors. eta vs tors. theta energy: -147.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1815.986234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1815.986234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1815.986234 (E_RNA) where: Base-Base interactions energy: -1113.876 where: short stacking energy: -561.729 Base-Backbone interact. energy: 4.541 local terms energy: -706.650338 where: bonds (distance) C4'-P energy: -137.805 bonds (distance) P-C4' energy: -168.148 flat angles C4'-P-C4' energy: -177.722 flat angles P-C4'-P energy: -100.228 tors. eta vs tors. theta energy: -122.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1739.926064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1739.926064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1739.926064 (E_RNA) where: Base-Base interactions energy: -1024.359 where: short stacking energy: -500.816 Base-Backbone interact. energy: 0.956 local terms energy: -716.522701 where: bonds (distance) C4'-P energy: -161.417 bonds (distance) P-C4' energy: -173.942 flat angles C4'-P-C4' energy: -171.587 flat angles P-C4'-P energy: -100.628 tors. eta vs tors. theta energy: -108.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -1367.526464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.526464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.526464 (E_RNA) where: Base-Base interactions energy: -765.460 where: short stacking energy: -441.372 Base-Backbone interact. energy: -1.277 local terms energy: -600.789631 where: bonds (distance) C4'-P energy: -143.221 bonds (distance) P-C4' energy: -153.299 flat angles C4'-P-C4' energy: -148.424 flat angles P-C4'-P energy: -100.674 tors. eta vs tors. theta energy: -55.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -1091.782056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1091.782056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1091.782056 (E_RNA) where: Base-Base interactions energy: -548.755 where: short stacking energy: -351.755 Base-Backbone interact. energy: 11.523 local terms energy: -554.550085 where: bonds (distance) C4'-P energy: -121.890 bonds (distance) P-C4' energy: -159.422 flat angles C4'-P-C4' energy: -165.372 flat angles P-C4'-P energy: -92.161 tors. eta vs tors. theta energy: -15.705 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -999.374128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -999.374128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -999.374128 (E_RNA) where: Base-Base interactions energy: -490.218 where: short stacking energy: -316.116 Base-Backbone interact. energy: 1.250 local terms energy: -510.406721 where: bonds (distance) C4'-P energy: -140.262 bonds (distance) P-C4' energy: -156.164 flat angles C4'-P-C4' energy: -130.506 flat angles P-C4'-P energy: -82.027 tors. eta vs tors. theta energy: -1.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -847.386685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.386685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.386685 (E_RNA) where: Base-Base interactions energy: -384.317 where: short stacking energy: -230.282 Base-Backbone interact. energy: 5.961 local terms energy: -469.030308 where: bonds (distance) C4'-P energy: -159.037 bonds (distance) P-C4' energy: -147.477 flat angles C4'-P-C4' energy: -123.826 flat angles P-C4'-P energy: -57.886 tors. eta vs tors. theta energy: 19.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -655.711315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -655.711315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -655.711315 (E_RNA) where: Base-Base interactions energy: -213.052 where: short stacking energy: -178.989 Base-Backbone interact. energy: -0.548 local terms energy: -442.111796 where: bonds (distance) C4'-P energy: -143.875 bonds (distance) P-C4' energy: -153.715 flat angles C4'-P-C4' energy: -105.270 flat angles P-C4'-P energy: -72.707 tors. eta vs tors. theta energy: 33.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -2578.302027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2578.302027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2578.302027 (E_RNA) where: Base-Base interactions energy: -1672.454 where: short stacking energy: -781.052 Base-Backbone interact. energy: -2.254 local terms energy: -903.593281 where: bonds (distance) C4'-P energy: -173.711 bonds (distance) P-C4' energy: -188.694 flat angles C4'-P-C4' energy: -202.239 flat angles P-C4'-P energy: -133.457 tors. eta vs tors. theta energy: -205.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -2183.994699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2183.994699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2183.994699 (E_RNA) where: Base-Base interactions energy: -1330.603 where: short stacking energy: -674.425 Base-Backbone interact. energy: -1.704 local terms energy: -851.687511 where: bonds (distance) C4'-P energy: -184.400 bonds (distance) P-C4' energy: -176.579 flat angles C4'-P-C4' energy: -181.110 flat angles P-C4'-P energy: -116.167 tors. eta vs tors. theta energy: -193.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -2033.572191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2033.572191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2033.572191 (E_RNA) where: Base-Base interactions energy: -1225.638 where: short stacking energy: -603.490 Base-Backbone interact. energy: 0.035 local terms energy: -807.969485 where: bonds (distance) C4'-P energy: -168.834 bonds (distance) P-C4' energy: -178.032 flat angles C4'-P-C4' energy: -171.331 flat angles P-C4'-P energy: -132.427 tors. eta vs tors. theta energy: -157.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1934.741660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1934.741660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1934.741660 (E_RNA) where: Base-Base interactions energy: -1180.206 where: short stacking energy: -596.823 Base-Backbone interact. energy: -4.353 local terms energy: -750.182633 where: bonds (distance) C4'-P energy: -168.485 bonds (distance) P-C4' energy: -174.281 flat angles C4'-P-C4' energy: -155.670 flat angles P-C4'-P energy: -105.592 tors. eta vs tors. theta energy: -146.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1733.942274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1733.942274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1733.942274 (E_RNA) where: Base-Base interactions energy: -988.119 where: short stacking energy: -524.463 Base-Backbone interact. energy: -0.141 local terms energy: -745.682160 where: bonds (distance) C4'-P energy: -174.383 bonds (distance) P-C4' energy: -178.649 flat angles C4'-P-C4' energy: -162.197 flat angles P-C4'-P energy: -103.432 tors. eta vs tors. theta energy: -127.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -1414.686480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.686480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.686480 (E_RNA) where: Base-Base interactions energy: -760.274 where: short stacking energy: -424.085 Base-Backbone interact. energy: 1.864 local terms energy: -656.276993 where: bonds (distance) C4'-P energy: -149.917 bonds (distance) P-C4' energy: -166.723 flat angles C4'-P-C4' energy: -147.235 flat angles P-C4'-P energy: -111.632 tors. eta vs tors. theta energy: -80.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -1031.870570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.870570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.870570 (E_RNA) where: Base-Base interactions energy: -424.386 where: short stacking energy: -307.741 Base-Backbone interact. energy: 2.590 local terms energy: -610.074151 where: bonds (distance) C4'-P energy: -148.974 bonds (distance) P-C4' energy: -174.516 flat angles C4'-P-C4' energy: -135.733 flat angles P-C4'-P energy: -103.616 tors. eta vs tors. theta energy: -47.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -930.415027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.415027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.415027 (E_RNA) where: Base-Base interactions energy: -419.559 where: short stacking energy: -288.089 Base-Backbone interact. energy: -0.386 local terms energy: -510.470109 where: bonds (distance) C4'-P energy: -139.771 bonds (distance) P-C4' energy: -138.295 flat angles C4'-P-C4' energy: -138.412 flat angles P-C4'-P energy: -88.792 tors. eta vs tors. theta energy: -5.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -871.363438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.363438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.363438 (E_RNA) where: Base-Base interactions energy: -374.688 where: short stacking energy: -245.924 Base-Backbone interact. energy: -2.196 local terms energy: -494.479438 where: bonds (distance) C4'-P energy: -124.177 bonds (distance) P-C4' energy: -156.774 flat angles C4'-P-C4' energy: -132.517 flat angles P-C4'-P energy: -78.263 tors. eta vs tors. theta energy: -2.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -675.895416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -675.895416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -675.895416 (E_RNA) where: Base-Base interactions energy: -192.290 where: short stacking energy: -162.267 Base-Backbone interact. energy: 1.915 local terms energy: -485.520235 where: bonds (distance) C4'-P energy: -161.423 bonds (distance) P-C4' energy: -157.095 flat angles C4'-P-C4' energy: -122.508 flat angles P-C4'-P energy: -87.697 tors. eta vs tors. theta energy: 43.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -2618.272971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2618.272971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2618.272971 (E_RNA) where: Base-Base interactions energy: -1716.474 where: short stacking energy: -791.296 Base-Backbone interact. energy: -2.779 local terms energy: -899.020074 where: bonds (distance) C4'-P energy: -188.228 bonds (distance) P-C4' energy: -179.907 flat angles C4'-P-C4' energy: -186.023 flat angles P-C4'-P energy: -129.541 tors. eta vs tors. theta energy: -215.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -2209.305979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2209.305979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2209.305979 (E_RNA) where: Base-Base interactions energy: -1332.841 where: short stacking energy: -700.580 Base-Backbone interact. energy: 1.156 local terms energy: -877.620836 where: bonds (distance) C4'-P energy: -181.503 bonds (distance) P-C4' energy: -188.099 flat angles C4'-P-C4' energy: -199.435 flat angles P-C4'-P energy: -127.041 tors. eta vs tors. theta energy: -181.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -2078.820905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2078.820905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2078.820905 (E_RNA) where: Base-Base interactions energy: -1297.445 where: short stacking energy: -658.682 Base-Backbone interact. energy: -3.014 local terms energy: -778.361902 where: bonds (distance) C4'-P energy: -168.711 bonds (distance) P-C4' energy: -164.810 flat angles C4'-P-C4' energy: -185.106 flat angles P-C4'-P energy: -102.615 tors. eta vs tors. theta energy: -157.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1964.551792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.551792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.551792 (E_RNA) where: Base-Base interactions energy: -1213.688 where: short stacking energy: -601.574 Base-Backbone interact. energy: -0.149 local terms energy: -750.714226 where: bonds (distance) C4'-P energy: -160.848 bonds (distance) P-C4' energy: -166.247 flat angles C4'-P-C4' energy: -188.080 flat angles P-C4'-P energy: -95.486 tors. eta vs tors. theta energy: -140.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1783.374893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1783.374893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1783.374893 (E_RNA) where: Base-Base interactions energy: -1077.855 where: short stacking energy: -509.430 Base-Backbone interact. energy: -0.114 local terms energy: -705.405750 where: bonds (distance) C4'-P energy: -167.573 bonds (distance) P-C4' energy: -178.770 flat angles C4'-P-C4' energy: -150.141 flat angles P-C4'-P energy: -98.454 tors. eta vs tors. theta energy: -110.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1389.343762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.343762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.343762 (E_RNA) where: Base-Base interactions energy: -731.967 where: short stacking energy: -383.295 Base-Backbone interact. energy: 0.689 local terms energy: -658.065545 where: bonds (distance) C4'-P energy: -176.349 bonds (distance) P-C4' energy: -160.062 flat angles C4'-P-C4' energy: -166.742 flat angles P-C4'-P energy: -94.758 tors. eta vs tors. theta energy: -60.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -1102.876668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.876668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.876668 (E_RNA) where: Base-Base interactions energy: -494.279 where: short stacking energy: -316.663 Base-Backbone interact. energy: -1.713 local terms energy: -606.884381 where: bonds (distance) C4'-P energy: -167.349 bonds (distance) P-C4' energy: -179.747 flat angles C4'-P-C4' energy: -120.136 flat angles P-C4'-P energy: -102.296 tors. eta vs tors. theta energy: -37.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -1005.958138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.958138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.958138 (E_RNA) where: Base-Base interactions energy: -423.043 where: short stacking energy: -307.268 Base-Backbone interact. energy: -1.521 local terms energy: -581.394132 where: bonds (distance) C4'-P energy: -142.584 bonds (distance) P-C4' energy: -171.594 flat angles C4'-P-C4' energy: -162.672 flat angles P-C4'-P energy: -85.079 tors. eta vs tors. theta energy: -19.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -819.495859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.495859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.495859 (E_RNA) where: Base-Base interactions energy: -326.053 where: short stacking energy: -225.482 Base-Backbone interact. energy: -3.789 local terms energy: -489.654077 where: bonds (distance) C4'-P energy: -125.375 bonds (distance) P-C4' energy: -154.139 flat angles C4'-P-C4' energy: -134.371 flat angles P-C4'-P energy: -88.710 tors. eta vs tors. theta energy: 12.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -673.574037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.574037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.574037 (E_RNA) where: Base-Base interactions energy: -245.901 where: short stacking energy: -196.527 Base-Backbone interact. energy: 3.627 local terms energy: -431.299587 where: bonds (distance) C4'-P energy: -153.577 bonds (distance) P-C4' energy: -160.104 flat angles C4'-P-C4' energy: -98.934 flat angles P-C4'-P energy: -50.509 tors. eta vs tors. theta energy: 31.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -2584.300878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2584.300878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2584.300878 (E_RNA) where: Base-Base interactions energy: -1657.424 where: short stacking energy: -749.422 Base-Backbone interact. energy: -1.402 local terms energy: -925.475726 where: bonds (distance) C4'-P energy: -189.297 bonds (distance) P-C4' energy: -197.147 flat angles C4'-P-C4' energy: -207.968 flat angles P-C4'-P energy: -119.891 tors. eta vs tors. theta energy: -211.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -2220.626426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2220.626426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2220.626426 (E_RNA) where: Base-Base interactions energy: -1374.094 where: short stacking energy: -700.540 Base-Backbone interact. energy: 1.445 local terms energy: -847.977174 where: bonds (distance) C4'-P energy: -188.278 bonds (distance) P-C4' energy: -182.525 flat angles C4'-P-C4' energy: -190.342 flat angles P-C4'-P energy: -109.679 tors. eta vs tors. theta energy: -177.152 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -2089.424776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2089.424776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2089.424776 (E_RNA) where: Base-Base interactions energy: -1252.130 where: short stacking energy: -643.759 Base-Backbone interact. energy: -3.958 local terms energy: -833.336869 where: bonds (distance) C4'-P energy: -176.251 bonds (distance) P-C4' energy: -183.401 flat angles C4'-P-C4' energy: -174.103 flat angles P-C4'-P energy: -125.035 tors. eta vs tors. theta energy: -174.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -2026.850877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2026.850877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2026.850877 (E_RNA) where: Base-Base interactions energy: -1240.366 where: short stacking energy: -608.835 Base-Backbone interact. energy: -0.321 local terms energy: -786.163300 where: bonds (distance) C4'-P energy: -153.044 bonds (distance) P-C4' energy: -169.731 flat angles C4'-P-C4' energy: -185.070 flat angles P-C4'-P energy: -113.083 tors. eta vs tors. theta energy: -165.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1797.486683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1797.486683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1797.486683 (E_RNA) where: Base-Base interactions energy: -1079.119 where: short stacking energy: -550.689 Base-Backbone interact. energy: 2.301 local terms energy: -720.668651 where: bonds (distance) C4'-P energy: -173.733 bonds (distance) P-C4' energy: -168.414 flat angles C4'-P-C4' energy: -175.008 flat angles P-C4'-P energy: -81.620 tors. eta vs tors. theta energy: -121.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1368.033283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1368.033283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1368.033283 (E_RNA) where: Base-Base interactions energy: -753.166 where: short stacking energy: -424.276 Base-Backbone interact. energy: -1.897 local terms energy: -612.970032 where: bonds (distance) C4'-P energy: -144.889 bonds (distance) P-C4' energy: -153.130 flat angles C4'-P-C4' energy: -161.429 flat angles P-C4'-P energy: -83.463 tors. eta vs tors. theta energy: -70.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -1190.943181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.943181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.943181 (E_RNA) where: Base-Base interactions energy: -578.236 where: short stacking energy: -376.711 Base-Backbone interact. energy: 0.004 local terms energy: -612.711119 where: bonds (distance) C4'-P energy: -181.567 bonds (distance) P-C4' energy: -137.496 flat angles C4'-P-C4' energy: -149.181 flat angles P-C4'-P energy: -95.959 tors. eta vs tors. theta energy: -48.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -998.908448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.908448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.908448 (E_RNA) where: Base-Base interactions energy: -473.843 where: short stacking energy: -272.109 Base-Backbone interact. energy: 6.175 local terms energy: -531.240451 where: bonds (distance) C4'-P energy: -139.299 bonds (distance) P-C4' energy: -155.822 flat angles C4'-P-C4' energy: -175.537 flat angles P-C4'-P energy: -68.229 tors. eta vs tors. theta energy: 7.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -815.875220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.875220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.875220 (E_RNA) where: Base-Base interactions energy: -332.430 where: short stacking energy: -242.829 Base-Backbone interact. energy: 2.891 local terms energy: -486.336389 where: bonds (distance) C4'-P energy: -143.744 bonds (distance) P-C4' energy: -136.345 flat angles C4'-P-C4' energy: -131.662 flat angles P-C4'-P energy: -75.217 tors. eta vs tors. theta energy: 0.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -695.686583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.686583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.686583 (E_RNA) where: Base-Base interactions energy: -199.333 where: short stacking energy: -110.300 Base-Backbone interact. energy: 2.770 local terms energy: -499.123254 where: bonds (distance) C4'-P energy: -149.044 bonds (distance) P-C4' energy: -166.399 flat angles C4'-P-C4' energy: -134.224 flat angles P-C4'-P energy: -99.289 tors. eta vs tors. theta energy: 49.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -2603.323431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2603.323431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2603.323431 (E_RNA) where: Base-Base interactions energy: -1701.598 where: short stacking energy: -790.001 Base-Backbone interact. energy: -0.078 local terms energy: -901.647550 where: bonds (distance) C4'-P energy: -172.967 bonds (distance) P-C4' energy: -183.997 flat angles C4'-P-C4' energy: -193.882 flat angles P-C4'-P energy: -137.166 tors. eta vs tors. theta energy: -213.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -2236.471768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.471768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2236.471768 (E_RNA) where: Base-Base interactions energy: -1358.776 where: short stacking energy: -708.358 Base-Backbone interact. energy: -0.078 local terms energy: -877.617947 where: bonds (distance) C4'-P energy: -188.554 bonds (distance) P-C4' energy: -190.026 flat angles C4'-P-C4' energy: -198.910 flat angles P-C4'-P energy: -115.503 tors. eta vs tors. theta energy: -184.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -2101.855825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.855825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.855825 (E_RNA) where: Base-Base interactions energy: -1298.685 where: short stacking energy: -651.254 Base-Backbone interact. energy: 1.397 local terms energy: -804.568103 where: bonds (distance) C4'-P energy: -166.688 bonds (distance) P-C4' energy: -186.674 flat angles C4'-P-C4' energy: -166.559 flat angles P-C4'-P energy: -117.084 tors. eta vs tors. theta energy: -167.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1963.375991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1963.375991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1963.375991 (E_RNA) where: Base-Base interactions energy: -1205.357 where: short stacking energy: -621.992 Base-Backbone interact. energy: -2.620 local terms energy: -755.399071 where: bonds (distance) C4'-P energy: -172.481 bonds (distance) P-C4' energy: -161.415 flat angles C4'-P-C4' energy: -166.841 flat angles P-C4'-P energy: -109.025 tors. eta vs tors. theta energy: -145.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1823.740696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1823.740696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1823.740696 (E_RNA) where: Base-Base interactions energy: -1059.572 where: short stacking energy: -552.349 Base-Backbone interact. energy: -2.824 local terms energy: -761.345386 where: bonds (distance) C4'-P energy: -172.748 bonds (distance) P-C4' energy: -161.920 flat angles C4'-P-C4' energy: -183.373 flat angles P-C4'-P energy: -104.544 tors. eta vs tors. theta energy: -138.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1391.642303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1391.642303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1391.642303 (E_RNA) where: Base-Base interactions energy: -723.851 where: short stacking energy: -436.154 Base-Backbone interact. energy: 3.431 local terms energy: -671.222389 where: bonds (distance) C4'-P energy: -154.854 bonds (distance) P-C4' energy: -164.907 flat angles C4'-P-C4' energy: -166.765 flat angles P-C4'-P energy: -116.728 tors. eta vs tors. theta energy: -67.968 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -1175.637664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.637664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.637664 (E_RNA) where: Base-Base interactions energy: -602.755 where: short stacking energy: -357.063 Base-Backbone interact. energy: -1.046 local terms energy: -571.836787 where: bonds (distance) C4'-P energy: -136.507 bonds (distance) P-C4' energy: -163.541 flat angles C4'-P-C4' energy: -151.310 flat angles P-C4'-P energy: -89.879 tors. eta vs tors. theta energy: -30.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -1076.133025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.133025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.133025 (E_RNA) where: Base-Base interactions energy: -571.869 where: short stacking energy: -316.975 Base-Backbone interact. energy: 5.810 local terms energy: -510.074326 where: bonds (distance) C4'-P energy: -137.704 bonds (distance) P-C4' energy: -162.451 flat angles C4'-P-C4' energy: -148.466 flat angles P-C4'-P energy: -72.710 tors. eta vs tors. theta energy: 11.257 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -789.713370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -789.713370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -789.713370 (E_RNA) where: Base-Base interactions energy: -334.012 where: short stacking energy: -241.904 Base-Backbone interact. energy: -1.079 local terms energy: -454.622178 where: bonds (distance) C4'-P energy: -134.661 bonds (distance) P-C4' energy: -139.743 flat angles C4'-P-C4' energy: -113.468 flat angles P-C4'-P energy: -73.703 tors. eta vs tors. theta energy: 6.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -659.196224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -659.196224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -659.196224 (E_RNA) where: Base-Base interactions energy: -232.734 where: short stacking energy: -201.775 Base-Backbone interact. energy: -1.472 local terms energy: -424.989484 where: bonds (distance) C4'-P energy: -128.711 bonds (distance) P-C4' energy: -150.131 flat angles C4'-P-C4' energy: -105.201 flat angles P-C4'-P energy: -75.494 tors. eta vs tors. theta energy: 34.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -2650.219281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2650.219281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2650.219281 (E_RNA) where: Base-Base interactions energy: -1741.005 where: short stacking energy: -815.509 Base-Backbone interact. energy: -0.090 local terms energy: -909.124779 where: bonds (distance) C4'-P energy: -185.878 bonds (distance) P-C4' energy: -167.033 flat angles C4'-P-C4' energy: -204.260 flat angles P-C4'-P energy: -121.344 tors. eta vs tors. theta energy: -230.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -2218.868589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2218.868589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2218.868589 (E_RNA) where: Base-Base interactions energy: -1383.316 where: short stacking energy: -711.661 Base-Backbone interact. energy: 3.688 local terms energy: -839.240258 where: bonds (distance) C4'-P energy: -185.422 bonds (distance) P-C4' energy: -177.837 flat angles C4'-P-C4' energy: -187.438 flat angles P-C4'-P energy: -115.340 tors. eta vs tors. theta energy: -173.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -2236.005596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2236.005596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2236.005596 (E_RNA) where: Base-Base interactions energy: -1423.228 where: short stacking energy: -678.743 Base-Backbone interact. energy: -0.570 local terms energy: -812.207285 where: bonds (distance) C4'-P energy: -166.623 bonds (distance) P-C4' energy: -171.046 flat angles C4'-P-C4' energy: -181.197 flat angles P-C4'-P energy: -115.414 tors. eta vs tors. theta energy: -177.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1977.407624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1977.407624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1977.407624 (E_RNA) where: Base-Base interactions energy: -1180.382 where: short stacking energy: -584.983 Base-Backbone interact. energy: -4.395 local terms energy: -792.630029 where: bonds (distance) C4'-P energy: -169.276 bonds (distance) P-C4' energy: -176.747 flat angles C4'-P-C4' energy: -175.716 flat angles P-C4'-P energy: -115.403 tors. eta vs tors. theta energy: -155.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1807.790642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1807.790642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1807.790642 (E_RNA) where: Base-Base interactions energy: -1095.217 where: short stacking energy: -512.051 Base-Backbone interact. energy: 2.816 local terms energy: -715.389969 where: bonds (distance) C4'-P energy: -170.930 bonds (distance) P-C4' energy: -167.020 flat angles C4'-P-C4' energy: -160.311 flat angles P-C4'-P energy: -110.247 tors. eta vs tors. theta energy: -106.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1386.572327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.572327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.572327 (E_RNA) where: Base-Base interactions energy: -787.587 where: short stacking energy: -426.287 Base-Backbone interact. energy: 0.913 local terms energy: -599.898421 where: bonds (distance) C4'-P energy: -143.815 bonds (distance) P-C4' energy: -167.624 flat angles C4'-P-C4' energy: -159.699 flat angles P-C4'-P energy: -69.127 tors. eta vs tors. theta energy: -59.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -1195.177093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.177093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.177093 (E_RNA) where: Base-Base interactions energy: -595.930 where: short stacking energy: -331.470 Base-Backbone interact. energy: -6.086 local terms energy: -593.160551 where: bonds (distance) C4'-P energy: -163.748 bonds (distance) P-C4' energy: -160.996 flat angles C4'-P-C4' energy: -138.378 flat angles P-C4'-P energy: -91.566 tors. eta vs tors. theta energy: -38.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -1136.756280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.756280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.756280 (E_RNA) where: Base-Base interactions energy: -584.576 where: short stacking energy: -340.349 Base-Backbone interact. energy: -3.895 local terms energy: -548.284443 where: bonds (distance) C4'-P energy: -140.631 bonds (distance) P-C4' energy: -149.774 flat angles C4'-P-C4' energy: -147.192 flat angles P-C4'-P energy: -78.237 tors. eta vs tors. theta energy: -32.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -843.576188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -843.576188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -843.576188 (E_RNA) where: Base-Base interactions energy: -367.286 where: short stacking energy: -231.667 Base-Backbone interact. energy: -1.495 local terms energy: -474.795031 where: bonds (distance) C4'-P energy: -133.642 bonds (distance) P-C4' energy: -170.847 flat angles C4'-P-C4' energy: -121.252 flat angles P-C4'-P energy: -59.165 tors. eta vs tors. theta energy: 10.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -674.801107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.801107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.801107 (E_RNA) where: Base-Base interactions energy: -231.124 where: short stacking energy: -175.482 Base-Backbone interact. energy: 0.923 local terms energy: -444.600439 where: bonds (distance) C4'-P energy: -150.181 bonds (distance) P-C4' energy: -151.312 flat angles C4'-P-C4' energy: -114.660 flat angles P-C4'-P energy: -67.784 tors. eta vs tors. theta energy: 39.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -2669.530993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2669.530993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2669.530993 (E_RNA) where: Base-Base interactions energy: -1737.286 where: short stacking energy: -808.373 Base-Backbone interact. energy: -2.279 local terms energy: -929.965829 where: bonds (distance) C4'-P energy: -177.311 bonds (distance) P-C4' energy: -184.769 flat angles C4'-P-C4' energy: -191.544 flat angles P-C4'-P energy: -145.741 tors. eta vs tors. theta energy: -230.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -2159.676110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2159.676110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2159.676110 (E_RNA) where: Base-Base interactions energy: -1337.456 where: short stacking energy: -680.998 Base-Backbone interact. energy: -0.483 local terms energy: -821.736916 where: bonds (distance) C4'-P energy: -179.684 bonds (distance) P-C4' energy: -194.032 flat angles C4'-P-C4' energy: -182.218 flat angles P-C4'-P energy: -103.411 tors. eta vs tors. theta energy: -162.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -2274.804404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2274.804404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2274.804404 (E_RNA) where: Base-Base interactions energy: -1473.306 where: short stacking energy: -687.445 Base-Backbone interact. energy: -3.342 local terms energy: -798.156368 where: bonds (distance) C4'-P energy: -171.223 bonds (distance) P-C4' energy: -176.972 flat angles C4'-P-C4' energy: -174.486 flat angles P-C4'-P energy: -112.631 tors. eta vs tors. theta energy: -162.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1913.911478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1913.911478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1913.911478 (E_RNA) where: Base-Base interactions energy: -1140.641 where: short stacking energy: -553.174 Base-Backbone interact. energy: 1.324 local terms energy: -774.593942 where: bonds (distance) C4'-P energy: -167.352 bonds (distance) P-C4' energy: -166.465 flat angles C4'-P-C4' energy: -174.546 flat angles P-C4'-P energy: -114.835 tors. eta vs tors. theta energy: -151.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1993.752538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.752538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1993.752538 (E_RNA) where: Base-Base interactions energy: -1266.224 where: short stacking energy: -601.250 Base-Backbone interact. energy: -1.753 local terms energy: -725.775893 where: bonds (distance) C4'-P energy: -152.563 bonds (distance) P-C4' energy: -130.088 flat angles C4'-P-C4' energy: -175.189 flat angles P-C4'-P energy: -120.051 tors. eta vs tors. theta energy: -147.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -1285.837261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.837261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.837261 (E_RNA) where: Base-Base interactions energy: -655.802 where: short stacking energy: -382.428 Base-Backbone interact. energy: -4.422 local terms energy: -625.612793 where: bonds (distance) C4'-P energy: -163.238 bonds (distance) P-C4' energy: -183.920 flat angles C4'-P-C4' energy: -143.856 flat angles P-C4'-P energy: -81.959 tors. eta vs tors. theta energy: -52.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -1225.450503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.450503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.450503 (E_RNA) where: Base-Base interactions energy: -649.074 where: short stacking energy: -379.172 Base-Backbone interact. energy: 4.935 local terms energy: -581.311549 where: bonds (distance) C4'-P energy: -139.761 bonds (distance) P-C4' energy: -175.664 flat angles C4'-P-C4' energy: -146.563 flat angles P-C4'-P energy: -71.276 tors. eta vs tors. theta energy: -48.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -1059.570716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.570716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.570716 (E_RNA) where: Base-Base interactions energy: -507.860 where: short stacking energy: -312.367 Base-Backbone interact. energy: 9.535 local terms energy: -561.245358 where: bonds (distance) C4'-P energy: -138.858 bonds (distance) P-C4' energy: -158.079 flat angles C4'-P-C4' energy: -146.507 flat angles P-C4'-P energy: -94.976 tors. eta vs tors. theta energy: -22.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -931.461567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -931.461567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -931.461567 (E_RNA) where: Base-Base interactions energy: -415.069 where: short stacking energy: -283.238 Base-Backbone interact. energy: -1.253 local terms energy: -515.140393 where: bonds (distance) C4'-P energy: -131.718 bonds (distance) P-C4' energy: -154.458 flat angles C4'-P-C4' energy: -134.936 flat angles P-C4'-P energy: -88.847 tors. eta vs tors. theta energy: -5.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -673.377355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -673.377355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.377355 (E_RNA) where: Base-Base interactions energy: -243.215 where: short stacking energy: -171.512 Base-Backbone interact. energy: 7.830 local terms energy: -437.992689 where: bonds (distance) C4'-P energy: -155.658 bonds (distance) P-C4' energy: -150.845 flat angles C4'-P-C4' energy: -108.636 flat angles P-C4'-P energy: -54.696 tors. eta vs tors. theta energy: 31.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -2628.629455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2628.629455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2628.629455 (E_RNA) where: Base-Base interactions energy: -1737.053 where: short stacking energy: -781.843 Base-Backbone interact. energy: -2.108 local terms energy: -889.468160 where: bonds (distance) C4'-P energy: -169.436 bonds (distance) P-C4' energy: -195.378 flat angles C4'-P-C4' energy: -195.276 flat angles P-C4'-P energy: -111.814 tors. eta vs tors. theta energy: -217.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -2359.771226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2359.771226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2359.771226 (E_RNA) where: Base-Base interactions energy: -1525.352 where: short stacking energy: -707.492 Base-Backbone interact. energy: -1.469 local terms energy: -832.950234 where: bonds (distance) C4'-P energy: -174.077 bonds (distance) P-C4' energy: -164.891 flat angles C4'-P-C4' energy: -196.390 flat angles P-C4'-P energy: -122.124 tors. eta vs tors. theta energy: -175.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -2121.792003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2121.792003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2121.792003 (E_RNA) where: Base-Base interactions energy: -1290.193 where: short stacking energy: -677.001 Base-Backbone interact. energy: -0.824 local terms energy: -830.774988 where: bonds (distance) C4'-P energy: -159.247 bonds (distance) P-C4' energy: -173.643 flat angles C4'-P-C4' energy: -190.036 flat angles P-C4'-P energy: -122.966 tors. eta vs tors. theta energy: -184.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1911.216580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1911.216580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1911.216580 (E_RNA) where: Base-Base interactions energy: -1171.281 where: short stacking energy: -587.797 Base-Backbone interact. energy: -6.511 local terms energy: -733.424946 where: bonds (distance) C4'-P energy: -171.662 bonds (distance) P-C4' energy: -165.510 flat angles C4'-P-C4' energy: -171.947 flat angles P-C4'-P energy: -99.439 tors. eta vs tors. theta energy: -124.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1932.823641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.823641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1932.823641 (E_RNA) where: Base-Base interactions energy: -1211.860 where: short stacking energy: -554.257 Base-Backbone interact. energy: -0.689 local terms energy: -720.274257 where: bonds (distance) C4'-P energy: -162.525 bonds (distance) P-C4' energy: -155.084 flat angles C4'-P-C4' energy: -159.053 flat angles P-C4'-P energy: -105.142 tors. eta vs tors. theta energy: -138.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -1399.065334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.065334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.065334 (E_RNA) where: Base-Base interactions energy: -757.106 where: short stacking energy: -408.546 Base-Backbone interact. energy: -0.834 local terms energy: -641.126028 where: bonds (distance) C4'-P energy: -148.424 bonds (distance) P-C4' energy: -153.989 flat angles C4'-P-C4' energy: -158.754 flat angles P-C4'-P energy: -100.763 tors. eta vs tors. theta energy: -79.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -1238.937745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.937745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.937745 (E_RNA) where: Base-Base interactions energy: -685.589 where: short stacking energy: -410.726 Base-Backbone interact. energy: -1.181 local terms energy: -552.167337 where: bonds (distance) C4'-P energy: -140.409 bonds (distance) P-C4' energy: -152.749 flat angles C4'-P-C4' energy: -133.540 flat angles P-C4'-P energy: -63.706 tors. eta vs tors. theta energy: -61.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -1121.846056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.846056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.846056 (E_RNA) where: Base-Base interactions energy: -583.879 where: short stacking energy: -308.658 Base-Backbone interact. energy: -4.191 local terms energy: -533.776248 where: bonds (distance) C4'-P energy: -149.975 bonds (distance) P-C4' energy: -157.103 flat angles C4'-P-C4' energy: -122.470 flat angles P-C4'-P energy: -78.572 tors. eta vs tors. theta energy: -25.656 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -881.312273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.312273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.312273 (E_RNA) where: Base-Base interactions energy: -394.414 where: short stacking energy: -274.302 Base-Backbone interact. energy: 0.829 local terms energy: -487.727127 where: bonds (distance) C4'-P energy: -134.616 bonds (distance) P-C4' energy: -164.125 flat angles C4'-P-C4' energy: -129.199 flat angles P-C4'-P energy: -64.989 tors. eta vs tors. theta energy: 5.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -679.334604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -679.334604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -679.334604 (E_RNA) where: Base-Base interactions energy: -201.356 where: short stacking energy: -181.245 Base-Backbone interact. energy: 3.410 local terms energy: -481.388727 where: bonds (distance) C4'-P energy: -147.951 bonds (distance) P-C4' energy: -151.791 flat angles C4'-P-C4' energy: -109.367 flat angles P-C4'-P energy: -92.898 tors. eta vs tors. theta energy: 20.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -2627.153149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2627.153149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2627.153149 (E_RNA) where: Base-Base interactions energy: -1741.529 where: short stacking energy: -766.342 Base-Backbone interact. energy: -0.490 local terms energy: -885.133926 where: bonds (distance) C4'-P energy: -179.750 bonds (distance) P-C4' energy: -181.476 flat angles C4'-P-C4' energy: -197.469 flat angles P-C4'-P energy: -116.250 tors. eta vs tors. theta energy: -210.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -2488.533000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2488.533000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2488.533000 (E_RNA) where: Base-Base interactions energy: -1586.801 where: short stacking energy: -735.489 Base-Backbone interact. energy: 0.835 local terms energy: -902.566529 where: bonds (distance) C4'-P energy: -187.941 bonds (distance) P-C4' energy: -179.986 flat angles C4'-P-C4' energy: -199.086 flat angles P-C4'-P energy: -131.671 tors. eta vs tors. theta energy: -203.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -2162.906901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.906901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2162.906901 (E_RNA) where: Base-Base interactions energy: -1313.989 where: short stacking energy: -687.122 Base-Backbone interact. energy: 1.269 local terms energy: -850.186260 where: bonds (distance) C4'-P energy: -189.855 bonds (distance) P-C4' energy: -173.917 flat angles C4'-P-C4' energy: -184.921 flat angles P-C4'-P energy: -125.300 tors. eta vs tors. theta energy: -176.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1915.857958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.857958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.857958 (E_RNA) where: Base-Base interactions energy: -1166.672 where: short stacking energy: -617.417 Base-Backbone interact. energy: -1.419 local terms energy: -747.767085 where: bonds (distance) C4'-P energy: -143.697 bonds (distance) P-C4' energy: -165.982 flat angles C4'-P-C4' energy: -161.902 flat angles P-C4'-P energy: -122.899 tors. eta vs tors. theta energy: -153.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1991.172978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1991.172978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1991.172978 (E_RNA) where: Base-Base interactions energy: -1251.970 where: short stacking energy: -622.950 Base-Backbone interact. energy: -0.981 local terms energy: -738.222074 where: bonds (distance) C4'-P energy: -148.283 bonds (distance) P-C4' energy: -153.926 flat angles C4'-P-C4' energy: -177.223 flat angles P-C4'-P energy: -105.913 tors. eta vs tors. theta energy: -152.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -1415.394997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.394997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.394997 (E_RNA) where: Base-Base interactions energy: -760.761 where: short stacking energy: -395.034 Base-Backbone interact. energy: -2.556 local terms energy: -652.077862 where: bonds (distance) C4'-P energy: -120.868 bonds (distance) P-C4' energy: -193.417 flat angles C4'-P-C4' energy: -165.760 flat angles P-C4'-P energy: -107.522 tors. eta vs tors. theta energy: -64.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -1298.324295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.324295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.324295 (E_RNA) where: Base-Base interactions energy: -692.693 where: short stacking energy: -388.285 Base-Backbone interact. energy: 1.937 local terms energy: -607.567804 where: bonds (distance) C4'-P energy: -144.499 bonds (distance) P-C4' energy: -156.464 flat angles C4'-P-C4' energy: -157.219 flat angles P-C4'-P energy: -90.498 tors. eta vs tors. theta energy: -58.888 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -1138.791265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1138.791265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.791265 (E_RNA) where: Base-Base interactions energy: -563.022 where: short stacking energy: -311.984 Base-Backbone interact. energy: 3.080 local terms energy: -578.849742 where: bonds (distance) C4'-P energy: -152.103 bonds (distance) P-C4' energy: -159.726 flat angles C4'-P-C4' energy: -149.610 flat angles P-C4'-P energy: -100.106 tors. eta vs tors. theta energy: -17.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -875.714034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -875.714034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -875.714034 (E_RNA) where: Base-Base interactions energy: -425.142 where: short stacking energy: -235.526 Base-Backbone interact. energy: 4.741 local terms energy: -455.313496 where: bonds (distance) C4'-P energy: -138.327 bonds (distance) P-C4' energy: -147.538 flat angles C4'-P-C4' energy: -132.574 flat angles P-C4'-P energy: -57.517 tors. eta vs tors. theta energy: 20.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -661.811888 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -661.811888 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -661.811888 (E_RNA) where: Base-Base interactions energy: -223.749 where: short stacking energy: -181.672 Base-Backbone interact. energy: 2.189 local terms energy: -440.252256 where: bonds (distance) C4'-P energy: -133.263 bonds (distance) P-C4' energy: -144.467 flat angles C4'-P-C4' energy: -109.478 flat angles P-C4'-P energy: -90.441 tors. eta vs tors. theta energy: 37.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -2650.573013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2650.573013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2650.573013 (E_RNA) where: Base-Base interactions energy: -1731.659 where: short stacking energy: -776.795 Base-Backbone interact. energy: -2.053 local terms energy: -916.861246 where: bonds (distance) C4'-P energy: -185.929 bonds (distance) P-C4' energy: -193.475 flat angles C4'-P-C4' energy: -194.805 flat angles P-C4'-P energy: -129.334 tors. eta vs tors. theta energy: -213.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -2535.018870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2535.018870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2535.018870 (E_RNA) where: Base-Base interactions energy: -1645.439 where: short stacking energy: -790.501 Base-Backbone interact. energy: 0.265 local terms energy: -889.844746 where: bonds (distance) C4'-P energy: -165.476 bonds (distance) P-C4' energy: -167.317 flat angles C4'-P-C4' energy: -211.021 flat angles P-C4'-P energy: -133.530 tors. eta vs tors. theta energy: -212.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -2114.270521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2114.270521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2114.270521 (E_RNA) where: Base-Base interactions energy: -1288.971 where: short stacking energy: -657.876 Base-Backbone interact. energy: -2.694 local terms energy: -822.605077 where: bonds (distance) C4'-P energy: -172.665 bonds (distance) P-C4' energy: -181.373 flat angles C4'-P-C4' energy: -191.336 flat angles P-C4'-P energy: -123.491 tors. eta vs tors. theta energy: -153.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -2017.457098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2017.457098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2017.457098 (E_RNA) where: Base-Base interactions energy: -1229.066 where: short stacking energy: -590.968 Base-Backbone interact. energy: -4.258 local terms energy: -784.134011 where: bonds (distance) C4'-P energy: -164.827 bonds (distance) P-C4' energy: -174.593 flat angles C4'-P-C4' energy: -173.896 flat angles P-C4'-P energy: -123.534 tors. eta vs tors. theta energy: -147.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1845.933020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1845.933020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1845.933020 (E_RNA) where: Base-Base interactions energy: -1119.055 where: short stacking energy: -542.640 Base-Backbone interact. energy: -0.019 local terms energy: -726.859611 where: bonds (distance) C4'-P energy: -156.628 bonds (distance) P-C4' energy: -157.982 flat angles C4'-P-C4' energy: -167.109 flat angles P-C4'-P energy: -107.126 tors. eta vs tors. theta energy: -138.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -1414.665749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.665749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.665749 (E_RNA) where: Base-Base interactions energy: -776.529 where: short stacking energy: -399.583 Base-Backbone interact. energy: 1.914 local terms energy: -640.050646 where: bonds (distance) C4'-P energy: -149.982 bonds (distance) P-C4' energy: -167.885 flat angles C4'-P-C4' energy: -165.839 flat angles P-C4'-P energy: -91.235 tors. eta vs tors. theta energy: -65.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -1358.469906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.469906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.469906 (E_RNA) where: Base-Base interactions energy: -730.910 where: short stacking energy: -389.972 Base-Backbone interact. energy: 2.138 local terms energy: -629.698457 where: bonds (distance) C4'-P energy: -149.431 bonds (distance) P-C4' energy: -175.231 flat angles C4'-P-C4' energy: -162.204 flat angles P-C4'-P energy: -105.731 tors. eta vs tors. theta energy: -37.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -1063.236014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.236014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.236014 (E_RNA) where: Base-Base interactions energy: -556.615 where: short stacking energy: -338.187 Base-Backbone interact. energy: 5.568 local terms energy: -512.189565 where: bonds (distance) C4'-P energy: -135.181 bonds (distance) P-C4' energy: -143.365 flat angles C4'-P-C4' energy: -126.359 flat angles P-C4'-P energy: -93.193 tors. eta vs tors. theta energy: -14.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -898.087517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.087517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.087517 (E_RNA) where: Base-Base interactions energy: -400.778 where: short stacking energy: -230.763 Base-Backbone interact. energy: 3.756 local terms energy: -501.065231 where: bonds (distance) C4'-P energy: -143.988 bonds (distance) P-C4' energy: -155.148 flat angles C4'-P-C4' energy: -128.500 flat angles P-C4'-P energy: -94.800 tors. eta vs tors. theta energy: 21.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -690.570830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.570830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.570830 (E_RNA) where: Base-Base interactions energy: -253.522 where: short stacking energy: -172.116 Base-Backbone interact. energy: -1.854 local terms energy: -435.194331 where: bonds (distance) C4'-P energy: -137.841 bonds (distance) P-C4' energy: -145.746 flat angles C4'-P-C4' energy: -124.057 flat angles P-C4'-P energy: -61.179 tors. eta vs tors. theta energy: 33.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -2701.818946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2701.818946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2701.818946 (E_RNA) where: Base-Base interactions energy: -1786.721 where: short stacking energy: -790.931 Base-Backbone interact. energy: -2.037 local terms energy: -913.061144 where: bonds (distance) C4'-P energy: -174.445 bonds (distance) P-C4' energy: -173.254 flat angles C4'-P-C4' energy: -206.245 flat angles P-C4'-P energy: -137.222 tors. eta vs tors. theta energy: -221.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -2573.106192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2573.106192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2573.106192 (E_RNA) where: Base-Base interactions energy: -1673.767 where: short stacking energy: -767.581 Base-Backbone interact. energy: -3.444 local terms energy: -895.895236 where: bonds (distance) C4'-P energy: -190.856 bonds (distance) P-C4' energy: -172.352 flat angles C4'-P-C4' energy: -202.413 flat angles P-C4'-P energy: -126.658 tors. eta vs tors. theta energy: -203.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -2176.857070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2176.857070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2176.857070 (E_RNA) where: Base-Base interactions energy: -1382.630 where: short stacking energy: -666.654 Base-Backbone interact. energy: -1.394 local terms energy: -792.832245 where: bonds (distance) C4'-P energy: -178.492 bonds (distance) P-C4' energy: -178.423 flat angles C4'-P-C4' energy: -185.137 flat angles P-C4'-P energy: -96.445 tors. eta vs tors. theta energy: -154.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -2052.947286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2052.947286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2052.947286 (E_RNA) where: Base-Base interactions energy: -1279.278 where: short stacking energy: -617.280 Base-Backbone interact. energy: -1.943 local terms energy: -771.726565 where: bonds (distance) C4'-P energy: -146.008 bonds (distance) P-C4' energy: -176.634 flat angles C4'-P-C4' energy: -188.946 flat angles P-C4'-P energy: -97.663 tors. eta vs tors. theta energy: -162.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1822.186993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1822.186993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1822.186993 (E_RNA) where: Base-Base interactions energy: -1080.110 where: short stacking energy: -533.501 Base-Backbone interact. energy: -0.073 local terms energy: -742.003335 where: bonds (distance) C4'-P energy: -168.928 bonds (distance) P-C4' energy: -179.293 flat angles C4'-P-C4' energy: -178.361 flat angles P-C4'-P energy: -104.804 tors. eta vs tors. theta energy: -110.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1511.561197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1511.561197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1511.561197 (E_RNA) where: Base-Base interactions energy: -836.519 where: short stacking energy: -439.615 Base-Backbone interact. energy: 1.704 local terms energy: -676.746607 where: bonds (distance) C4'-P energy: -152.406 bonds (distance) P-C4' energy: -174.853 flat angles C4'-P-C4' energy: -164.844 flat angles P-C4'-P energy: -104.376 tors. eta vs tors. theta energy: -80.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -1386.956820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.956820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.956820 (E_RNA) where: Base-Base interactions energy: -787.257 where: short stacking energy: -386.890 Base-Backbone interact. energy: 1.389 local terms energy: -601.088545 where: bonds (distance) C4'-P energy: -160.650 bonds (distance) P-C4' energy: -152.242 flat angles C4'-P-C4' energy: -159.399 flat angles P-C4'-P energy: -82.945 tors. eta vs tors. theta energy: -45.854 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -1121.833223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1121.833223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1121.833223 (E_RNA) where: Base-Base interactions energy: -607.977 where: short stacking energy: -344.443 Base-Backbone interact. energy: 0.273 local terms energy: -514.129298 where: bonds (distance) C4'-P energy: -125.675 bonds (distance) P-C4' energy: -146.498 flat angles C4'-P-C4' energy: -124.303 flat angles P-C4'-P energy: -79.558 tors. eta vs tors. theta energy: -38.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -893.026172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -893.026172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -893.026172 (E_RNA) where: Base-Base interactions energy: -399.706 where: short stacking energy: -257.183 Base-Backbone interact. energy: 3.491 local terms energy: -496.810710 where: bonds (distance) C4'-P energy: -130.102 bonds (distance) P-C4' energy: -154.977 flat angles C4'-P-C4' energy: -113.632 flat angles P-C4'-P energy: -90.732 tors. eta vs tors. theta energy: -7.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -677.081958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -677.081958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -677.081958 (E_RNA) where: Base-Base interactions energy: -216.264 where: short stacking energy: -183.362 Base-Backbone interact. energy: 6.653 local terms energy: -467.470146 where: bonds (distance) C4'-P energy: -137.955 bonds (distance) P-C4' energy: -167.885 flat angles C4'-P-C4' energy: -125.522 flat angles P-C4'-P energy: -57.313 tors. eta vs tors. theta energy: 21.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -2655.516546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2655.516546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2655.516546 (E_RNA) where: Base-Base interactions energy: -1731.903 where: short stacking energy: -775.077 Base-Backbone interact. energy: -1.048 local terms energy: -922.565260 where: bonds (distance) C4'-P energy: -182.349 bonds (distance) P-C4' energy: -188.109 flat angles C4'-P-C4' energy: -206.283 flat angles P-C4'-P energy: -123.757 tors. eta vs tors. theta energy: -222.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -2542.542465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2542.542465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2542.542465 (E_RNA) where: Base-Base interactions energy: -1633.913 where: short stacking energy: -754.115 Base-Backbone interact. energy: -2.890 local terms energy: -905.739586 where: bonds (distance) C4'-P energy: -169.585 bonds (distance) P-C4' energy: -190.551 flat angles C4'-P-C4' energy: -197.667 flat angles P-C4'-P energy: -127.348 tors. eta vs tors. theta energy: -220.589 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -2207.567276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2207.567276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2207.567276 (E_RNA) where: Base-Base interactions energy: -1392.827 where: short stacking energy: -691.798 Base-Backbone interact. energy: -0.071 local terms energy: -814.669327 where: bonds (distance) C4'-P energy: -159.695 bonds (distance) P-C4' energy: -154.933 flat angles C4'-P-C4' energy: -201.818 flat angles P-C4'-P energy: -119.440 tors. eta vs tors. theta energy: -178.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -2058.851499 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2058.851499 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2058.851499 (E_RNA) where: Base-Base interactions energy: -1280.945 where: short stacking energy: -610.354 Base-Backbone interact. energy: -0.909 local terms energy: -776.998213 where: bonds (distance) C4'-P energy: -173.774 bonds (distance) P-C4' energy: -167.091 flat angles C4'-P-C4' energy: -174.941 flat angles P-C4'-P energy: -111.755 tors. eta vs tors. theta energy: -149.437 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1787.623243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1787.623243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1787.623243 (E_RNA) where: Base-Base interactions energy: -1109.207 where: short stacking energy: -519.504 Base-Backbone interact. energy: 6.231 local terms energy: -684.646798 where: bonds (distance) C4'-P energy: -147.343 bonds (distance) P-C4' energy: -169.516 flat angles C4'-P-C4' energy: -177.362 flat angles P-C4'-P energy: -80.766 tors. eta vs tors. theta energy: -109.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1583.567099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.567099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.567099 (E_RNA) where: Base-Base interactions energy: -916.499 where: short stacking energy: -445.640 Base-Backbone interact. energy: 1.988 local terms energy: -669.056223 where: bonds (distance) C4'-P energy: -164.730 bonds (distance) P-C4' energy: -173.046 flat angles C4'-P-C4' energy: -164.916 flat angles P-C4'-P energy: -87.799 tors. eta vs tors. theta energy: -78.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -1385.408753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.408753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.408753 (E_RNA) where: Base-Base interactions energy: -773.700 where: short stacking energy: -414.045 Base-Backbone interact. energy: 0.147 local terms energy: -611.856356 where: bonds (distance) C4'-P energy: -140.984 bonds (distance) P-C4' energy: -170.730 flat angles C4'-P-C4' energy: -133.317 flat angles P-C4'-P energy: -98.790 tors. eta vs tors. theta energy: -68.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -1035.862305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.862305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.862305 (E_RNA) where: Base-Base interactions energy: -479.877 where: short stacking energy: -270.057 Base-Backbone interact. energy: -0.498 local terms energy: -555.486471 where: bonds (distance) C4'-P energy: -159.132 bonds (distance) P-C4' energy: -161.495 flat angles C4'-P-C4' energy: -138.177 flat angles P-C4'-P energy: -88.180 tors. eta vs tors. theta energy: -8.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -908.894022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -908.894022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -908.894022 (E_RNA) where: Base-Base interactions energy: -426.419 where: short stacking energy: -268.083 Base-Backbone interact. energy: 2.803 local terms energy: -485.277391 where: bonds (distance) C4'-P energy: -153.013 bonds (distance) P-C4' energy: -130.749 flat angles C4'-P-C4' energy: -116.537 flat angles P-C4'-P energy: -96.963 tors. eta vs tors. theta energy: 11.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -674.718813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -674.718813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -674.718813 (E_RNA) where: Base-Base interactions energy: -230.071 where: short stacking energy: -202.476 Base-Backbone interact. energy: -0.572 local terms energy: -444.076153 where: bonds (distance) C4'-P energy: -139.230 bonds (distance) P-C4' energy: -131.707 flat angles C4'-P-C4' energy: -149.979 flat angles P-C4'-P energy: -48.382 tors. eta vs tors. theta energy: 25.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -2649.726870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2649.726870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2649.726870 (E_RNA) where: Base-Base interactions energy: -1722.432 where: short stacking energy: -781.797 Base-Backbone interact. energy: -3.141 local terms energy: -924.153091 where: bonds (distance) C4'-P energy: -187.669 bonds (distance) P-C4' energy: -189.888 flat angles C4'-P-C4' energy: -213.108 flat angles P-C4'-P energy: -112.038 tors. eta vs tors. theta energy: -221.450 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -2546.543985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2546.543985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2546.543985 (E_RNA) where: Base-Base interactions energy: -1646.065 where: short stacking energy: -751.259 Base-Backbone interact. energy: -3.699 local terms energy: -896.780273 where: bonds (distance) C4'-P energy: -176.197 bonds (distance) P-C4' energy: -193.869 flat angles C4'-P-C4' energy: -182.328 flat angles P-C4'-P energy: -127.351 tors. eta vs tors. theta energy: -217.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -2199.369956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2199.369956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2199.369956 (E_RNA) where: Base-Base interactions energy: -1335.893 where: short stacking energy: -655.752 Base-Backbone interact. energy: -2.670 local terms energy: -860.807285 where: bonds (distance) C4'-P energy: -193.019 bonds (distance) P-C4' energy: -184.988 flat angles C4'-P-C4' energy: -176.562 flat angles P-C4'-P energy: -123.978 tors. eta vs tors. theta energy: -182.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -2086.155174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2086.155174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2086.155174 (E_RNA) where: Base-Base interactions energy: -1308.121 where: short stacking energy: -613.288 Base-Backbone interact. energy: -2.441 local terms energy: -775.592985 where: bonds (distance) C4'-P energy: -169.023 bonds (distance) P-C4' energy: -159.509 flat angles C4'-P-C4' energy: -167.343 flat angles P-C4'-P energy: -112.524 tors. eta vs tors. theta energy: -167.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1837.732623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1837.732623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1837.732623 (E_RNA) where: Base-Base interactions energy: -1115.523 where: short stacking energy: -576.149 Base-Backbone interact. energy: 4.020 local terms energy: -726.229489 where: bonds (distance) C4'-P energy: -154.363 bonds (distance) P-C4' energy: -167.116 flat angles C4'-P-C4' energy: -179.771 flat angles P-C4'-P energy: -110.866 tors. eta vs tors. theta energy: -114.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1638.292028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.292028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.292028 (E_RNA) where: Base-Base interactions energy: -996.408 where: short stacking energy: -511.671 Base-Backbone interact. energy: -1.245 local terms energy: -640.638491 where: bonds (distance) C4'-P energy: -123.581 bonds (distance) P-C4' energy: -155.987 flat angles C4'-P-C4' energy: -153.687 flat angles P-C4'-P energy: -107.486 tors. eta vs tors. theta energy: -99.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -1448.502109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.502109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.502109 (E_RNA) where: Base-Base interactions energy: -807.757 where: short stacking energy: -425.668 Base-Backbone interact. energy: -1.699 local terms energy: -639.045468 where: bonds (distance) C4'-P energy: -168.476 bonds (distance) P-C4' energy: -164.590 flat angles C4'-P-C4' energy: -148.566 flat angles P-C4'-P energy: -102.133 tors. eta vs tors. theta energy: -55.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -1151.582084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1151.582084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1151.582084 (E_RNA) where: Base-Base interactions energy: -587.805 where: short stacking energy: -321.486 Base-Backbone interact. energy: 0.663 local terms energy: -564.440785 where: bonds (distance) C4'-P energy: -167.710 bonds (distance) P-C4' energy: -165.791 flat angles C4'-P-C4' energy: -129.227 flat angles P-C4'-P energy: -76.940 tors. eta vs tors. theta energy: -24.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -910.857194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -910.857194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -910.857194 (E_RNA) where: Base-Base interactions energy: -436.416 where: short stacking energy: -258.735 Base-Backbone interact. energy: 2.574 local terms energy: -477.014775 where: bonds (distance) C4'-P energy: -138.597 bonds (distance) P-C4' energy: -143.961 flat angles C4'-P-C4' energy: -129.117 flat angles P-C4'-P energy: -71.848 tors. eta vs tors. theta energy: 6.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -690.190502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -690.190502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -690.190502 (E_RNA) where: Base-Base interactions energy: -229.295 where: short stacking energy: -188.108 Base-Backbone interact. energy: -0.518 local terms energy: -460.376852 where: bonds (distance) C4'-P energy: -157.695 bonds (distance) P-C4' energy: -143.176 flat angles C4'-P-C4' energy: -126.765 flat angles P-C4'-P energy: -67.295 tors. eta vs tors. theta energy: 34.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -2661.871605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2661.871605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2661.871605 (E_RNA) where: Base-Base interactions energy: -1758.893 where: short stacking energy: -792.953 Base-Backbone interact. energy: -1.582 local terms energy: -901.395945 where: bonds (distance) C4'-P energy: -170.353 bonds (distance) P-C4' energy: -190.346 flat angles C4'-P-C4' energy: -193.260 flat angles P-C4'-P energy: -129.946 tors. eta vs tors. theta energy: -217.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -2588.846149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2588.846149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2588.846149 (E_RNA) where: Base-Base interactions energy: -1716.099 where: short stacking energy: -774.157 Base-Backbone interact. energy: -3.968 local terms energy: -868.778806 where: bonds (distance) C4'-P energy: -171.705 bonds (distance) P-C4' energy: -144.140 flat angles C4'-P-C4' energy: -207.203 flat angles P-C4'-P energy: -132.678 tors. eta vs tors. theta energy: -213.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -2197.956787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2197.956787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2197.956787 (E_RNA) where: Base-Base interactions energy: -1394.214 where: short stacking energy: -651.732 Base-Backbone interact. energy: -3.539 local terms energy: -800.204046 where: bonds (distance) C4'-P energy: -166.999 bonds (distance) P-C4' energy: -163.873 flat angles C4'-P-C4' energy: -179.887 flat angles P-C4'-P energy: -133.896 tors. eta vs tors. theta energy: -155.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -2120.833265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2120.833265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2120.833265 (E_RNA) where: Base-Base interactions energy: -1292.208 where: short stacking energy: -598.676 Base-Backbone interact. energy: -0.592 local terms energy: -828.033451 where: bonds (distance) C4'-P energy: -176.581 bonds (distance) P-C4' energy: -186.071 flat angles C4'-P-C4' energy: -189.608 flat angles P-C4'-P energy: -108.852 tors. eta vs tors. theta energy: -166.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1829.706043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1829.706043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1829.706043 (E_RNA) where: Base-Base interactions energy: -1107.676 where: short stacking energy: -564.405 Base-Backbone interact. energy: -2.279 local terms energy: -719.750996 where: bonds (distance) C4'-P energy: -161.839 bonds (distance) P-C4' energy: -171.243 flat angles C4'-P-C4' energy: -161.198 flat angles P-C4'-P energy: -110.063 tors. eta vs tors. theta energy: -115.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1598.393366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1598.393366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.393366 (E_RNA) where: Base-Base interactions energy: -911.192 where: short stacking energy: -443.906 Base-Backbone interact. energy: -2.891 local terms energy: -684.311080 where: bonds (distance) C4'-P energy: -160.933 bonds (distance) P-C4' energy: -169.386 flat angles C4'-P-C4' energy: -179.437 flat angles P-C4'-P energy: -105.542 tors. eta vs tors. theta energy: -69.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -1510.601733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1510.601733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1510.601733 (E_RNA) where: Base-Base interactions energy: -871.896 where: short stacking energy: -395.503 Base-Backbone interact. energy: 4.998 local terms energy: -643.703477 where: bonds (distance) C4'-P energy: -166.188 bonds (distance) P-C4' energy: -159.147 flat angles C4'-P-C4' energy: -150.131 flat angles P-C4'-P energy: -107.344 tors. eta vs tors. theta energy: -60.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -1165.789260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.789260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.789260 (E_RNA) where: Base-Base interactions energy: -621.586 where: short stacking energy: -330.861 Base-Backbone interact. energy: -0.930 local terms energy: -543.273319 where: bonds (distance) C4'-P energy: -144.457 bonds (distance) P-C4' energy: -137.658 flat angles C4'-P-C4' energy: -142.776 flat angles P-C4'-P energy: -100.254 tors. eta vs tors. theta energy: -18.128 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -883.122080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.122080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.122080 (E_RNA) where: Base-Base interactions energy: -360.527 where: short stacking energy: -250.244 Base-Backbone interact. energy: 1.922 local terms energy: -524.517036 where: bonds (distance) C4'-P energy: -147.316 bonds (distance) P-C4' energy: -158.728 flat angles C4'-P-C4' energy: -134.392 flat angles P-C4'-P energy: -81.815 tors. eta vs tors. theta energy: -2.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -686.775012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -686.775012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -686.775012 (E_RNA) where: Base-Base interactions energy: -238.447 where: short stacking energy: -187.197 Base-Backbone interact. energy: 3.225 local terms energy: -451.552852 where: bonds (distance) C4'-P energy: -126.040 bonds (distance) P-C4' energy: -163.184 flat angles C4'-P-C4' energy: -134.065 flat angles P-C4'-P energy: -63.037 tors. eta vs tors. theta energy: 34.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -2643.760973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2643.760973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2643.760973 (E_RNA) where: Base-Base interactions energy: -1742.701 where: short stacking energy: -787.583 Base-Backbone interact. energy: -4.392 local terms energy: -896.667804 where: bonds (distance) C4'-P energy: -180.951 bonds (distance) P-C4' energy: -191.609 flat angles C4'-P-C4' energy: -192.760 flat angles P-C4'-P energy: -107.451 tors. eta vs tors. theta energy: -223.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -2596.249974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2596.249974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2596.249974 (E_RNA) where: Base-Base interactions energy: -1724.906 where: short stacking energy: -758.788 Base-Backbone interact. energy: -2.037 local terms energy: -869.307831 where: bonds (distance) C4'-P energy: -166.676 bonds (distance) P-C4' energy: -170.736 flat angles C4'-P-C4' energy: -196.164 flat angles P-C4'-P energy: -137.435 tors. eta vs tors. theta energy: -198.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -2196.312400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.312400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.312400 (E_RNA) where: Base-Base interactions energy: -1382.694 where: short stacking energy: -690.201 Base-Backbone interact. energy: -5.861 local terms energy: -807.757294 where: bonds (distance) C4'-P energy: -157.930 bonds (distance) P-C4' energy: -170.777 flat angles C4'-P-C4' energy: -185.267 flat angles P-C4'-P energy: -115.908 tors. eta vs tors. theta energy: -177.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -2087.297818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2087.297818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2087.297818 (E_RNA) where: Base-Base interactions energy: -1299.045 where: short stacking energy: -631.274 Base-Backbone interact. energy: -0.341 local terms energy: -787.911857 where: bonds (distance) C4'-P energy: -160.684 bonds (distance) P-C4' energy: -171.338 flat angles C4'-P-C4' energy: -180.513 flat angles P-C4'-P energy: -106.677 tors. eta vs tors. theta energy: -168.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1825.367100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1825.367100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1825.367100 (E_RNA) where: Base-Base interactions energy: -1108.488 where: short stacking energy: -528.898 Base-Backbone interact. energy: -2.468 local terms energy: -714.411196 where: bonds (distance) C4'-P energy: -160.487 bonds (distance) P-C4' energy: -157.794 flat angles C4'-P-C4' energy: -177.455 flat angles P-C4'-P energy: -103.106 tors. eta vs tors. theta energy: -115.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1593.173087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1593.173087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.173087 (E_RNA) where: Base-Base interactions energy: -937.674 where: short stacking energy: -474.112 Base-Backbone interact. energy: 2.124 local terms energy: -657.622463 where: bonds (distance) C4'-P energy: -142.991 bonds (distance) P-C4' energy: -187.422 flat angles C4'-P-C4' energy: -161.339 flat angles P-C4'-P energy: -95.966 tors. eta vs tors. theta energy: -69.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -1527.517364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1527.517364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1527.517364 (E_RNA) where: Base-Base interactions energy: -916.275 where: short stacking energy: -465.518 Base-Backbone interact. energy: 4.434 local terms energy: -615.676091 where: bonds (distance) C4'-P energy: -140.742 bonds (distance) P-C4' energy: -144.368 flat angles C4'-P-C4' energy: -135.671 flat angles P-C4'-P energy: -106.024 tors. eta vs tors. theta energy: -88.871 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -1165.748351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.748351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.748351 (E_RNA) where: Base-Base interactions energy: -628.184 where: short stacking energy: -314.208 Base-Backbone interact. energy: -5.374 local terms energy: -532.190443 where: bonds (distance) C4'-P energy: -141.294 bonds (distance) P-C4' energy: -154.663 flat angles C4'-P-C4' energy: -145.227 flat angles P-C4'-P energy: -74.238 tors. eta vs tors. theta energy: -16.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -902.335463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -902.335463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -902.335463 (E_RNA) where: Base-Base interactions energy: -412.433 where: short stacking energy: -253.203 Base-Backbone interact. energy: -0.863 local terms energy: -489.040044 where: bonds (distance) C4'-P energy: -140.265 bonds (distance) P-C4' energy: -152.581 flat angles C4'-P-C4' energy: -133.686 flat angles P-C4'-P energy: -72.833 tors. eta vs tors. theta energy: 10.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -771.998483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.998483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.998483 (E_RNA) where: Base-Base interactions energy: -321.457 where: short stacking energy: -200.832 Base-Backbone interact. energy: 1.695 local terms energy: -452.235605 where: bonds (distance) C4'-P energy: -151.279 bonds (distance) P-C4' energy: -135.883 flat angles C4'-P-C4' energy: -135.966 flat angles P-C4'-P energy: -63.869 tors. eta vs tors. theta energy: 34.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -2646.466742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2646.466742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2646.466742 (E_RNA) where: Base-Base interactions energy: -1739.125 where: short stacking energy: -794.339 Base-Backbone interact. energy: -3.193 local terms energy: -904.148817 where: bonds (distance) C4'-P energy: -173.696 bonds (distance) P-C4' energy: -188.519 flat angles C4'-P-C4' energy: -202.920 flat angles P-C4'-P energy: -120.632 tors. eta vs tors. theta energy: -218.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -2574.254050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2574.254050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2574.254050 (E_RNA) where: Base-Base interactions energy: -1723.998 where: short stacking energy: -783.282 Base-Backbone interact. energy: -4.644 local terms energy: -845.612468 where: bonds (distance) C4'-P energy: -160.771 bonds (distance) P-C4' energy: -183.530 flat angles C4'-P-C4' energy: -181.761 flat angles P-C4'-P energy: -108.943 tors. eta vs tors. theta energy: -210.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -2211.168014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2211.168014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2211.168014 (E_RNA) where: Base-Base interactions energy: -1387.249 where: short stacking energy: -682.266 Base-Backbone interact. energy: -2.016 local terms energy: -821.903033 where: bonds (distance) C4'-P energy: -168.370 bonds (distance) P-C4' energy: -174.824 flat angles C4'-P-C4' energy: -188.963 flat angles P-C4'-P energy: -127.521 tors. eta vs tors. theta energy: -162.225 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -2133.921968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2133.921968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2133.921968 (E_RNA) where: Base-Base interactions energy: -1351.857 where: short stacking energy: -654.342 Base-Backbone interact. energy: 0.882 local terms energy: -782.946964 where: bonds (distance) C4'-P energy: -152.383 bonds (distance) P-C4' energy: -172.969 flat angles C4'-P-C4' energy: -179.024 flat angles P-C4'-P energy: -116.115 tors. eta vs tors. theta energy: -162.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1855.100660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1855.100660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1855.100660 (E_RNA) where: Base-Base interactions energy: -1132.065 where: short stacking energy: -567.146 Base-Backbone interact. energy: 1.375 local terms energy: -724.411018 where: bonds (distance) C4'-P energy: -152.607 bonds (distance) P-C4' energy: -146.737 flat angles C4'-P-C4' energy: -177.736 flat angles P-C4'-P energy: -113.525 tors. eta vs tors. theta energy: -133.806 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1536.311965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.311965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.311965 (E_RNA) where: Base-Base interactions energy: -883.647 where: short stacking energy: -440.880 Base-Backbone interact. energy: 5.212 local terms energy: -657.877229 where: bonds (distance) C4'-P energy: -153.888 bonds (distance) P-C4' energy: -179.109 flat angles C4'-P-C4' energy: -146.568 flat angles P-C4'-P energy: -101.386 tors. eta vs tors. theta energy: -76.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -1459.977300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.977300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.977300 (E_RNA) where: Base-Base interactions energy: -837.948 where: short stacking energy: -377.205 Base-Backbone interact. energy: -1.443 local terms energy: -620.586333 where: bonds (distance) C4'-P energy: -144.391 bonds (distance) P-C4' energy: -176.849 flat angles C4'-P-C4' energy: -145.714 flat angles P-C4'-P energy: -92.894 tors. eta vs tors. theta energy: -60.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -1148.072118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1148.072118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1148.072118 (E_RNA) where: Base-Base interactions energy: -611.671 where: short stacking energy: -342.727 Base-Backbone interact. energy: 8.776 local terms energy: -545.177573 where: bonds (distance) C4'-P energy: -151.538 bonds (distance) P-C4' energy: -165.215 flat angles C4'-P-C4' energy: -132.806 flat angles P-C4'-P energy: -68.079 tors. eta vs tors. theta energy: -27.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -943.100847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.100847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.100847 (E_RNA) where: Base-Base interactions energy: -464.769 where: short stacking energy: -266.240 Base-Backbone interact. energy: 5.136 local terms energy: -483.467571 where: bonds (distance) C4'-P energy: -143.744 bonds (distance) P-C4' energy: -135.248 flat angles C4'-P-C4' energy: -119.097 flat angles P-C4'-P energy: -91.148 tors. eta vs tors. theta energy: 5.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -700.512172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.512172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.512172 (E_RNA) where: Base-Base interactions energy: -259.790 where: short stacking energy: -215.147 Base-Backbone interact. energy: -1.113 local terms energy: -439.608732 where: bonds (distance) C4'-P energy: -145.445 bonds (distance) P-C4' energy: -136.410 flat angles C4'-P-C4' energy: -134.963 flat angles P-C4'-P energy: -54.853 tors. eta vs tors. theta energy: 32.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -2661.148862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2661.148862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2661.148862 (E_RNA) where: Base-Base interactions energy: -1744.196 where: short stacking energy: -808.843 Base-Backbone interact. energy: 0.271 local terms energy: -917.224046 where: bonds (distance) C4'-P energy: -163.891 bonds (distance) P-C4' energy: -177.856 flat angles C4'-P-C4' energy: -203.358 flat angles P-C4'-P energy: -133.796 tors. eta vs tors. theta energy: -238.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -2615.092928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2615.092928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2615.092928 (E_RNA) where: Base-Base interactions energy: -1732.531 where: short stacking energy: -799.845 Base-Backbone interact. energy: -6.707 local terms energy: -875.854840 where: bonds (distance) C4'-P energy: -162.102 bonds (distance) P-C4' energy: -168.272 flat angles C4'-P-C4' energy: -187.731 flat angles P-C4'-P energy: -127.417 tors. eta vs tors. theta energy: -230.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -2264.258017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2264.258017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2264.258017 (E_RNA) where: Base-Base interactions energy: -1473.993 where: short stacking energy: -682.290 Base-Backbone interact. energy: 0.229 local terms energy: -790.494926 where: bonds (distance) C4'-P energy: -154.198 bonds (distance) P-C4' energy: -179.708 flat angles C4'-P-C4' energy: -173.291 flat angles P-C4'-P energy: -110.142 tors. eta vs tors. theta energy: -173.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -2118.372204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2118.372204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2118.372204 (E_RNA) where: Base-Base interactions energy: -1352.234 where: short stacking energy: -639.345 Base-Backbone interact. energy: -2.696 local terms energy: -763.442525 where: bonds (distance) C4'-P energy: -149.584 bonds (distance) P-C4' energy: -168.301 flat angles C4'-P-C4' energy: -176.001 flat angles P-C4'-P energy: -118.377 tors. eta vs tors. theta energy: -151.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1871.564939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.564939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.564939 (E_RNA) where: Base-Base interactions energy: -1139.966 where: short stacking energy: -580.167 Base-Backbone interact. energy: -2.636 local terms energy: -728.963039 where: bonds (distance) C4'-P energy: -140.395 bonds (distance) P-C4' energy: -170.277 flat angles C4'-P-C4' energy: -174.623 flat angles P-C4'-P energy: -114.151 tors. eta vs tors. theta energy: -129.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1560.308771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1560.308771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1560.308771 (E_RNA) where: Base-Base interactions energy: -943.009 where: short stacking energy: -464.933 Base-Backbone interact. energy: 2.630 local terms energy: -619.930238 where: bonds (distance) C4'-P energy: -139.393 bonds (distance) P-C4' energy: -148.608 flat angles C4'-P-C4' energy: -158.627 flat angles P-C4'-P energy: -100.443 tors. eta vs tors. theta energy: -72.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -1463.565584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.565584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.565584 (E_RNA) where: Base-Base interactions energy: -846.575 where: short stacking energy: -415.005 Base-Backbone interact. energy: 2.691 local terms energy: -619.681708 where: bonds (distance) C4'-P energy: -153.552 bonds (distance) P-C4' energy: -162.826 flat angles C4'-P-C4' energy: -144.415 flat angles P-C4'-P energy: -95.271 tors. eta vs tors. theta energy: -63.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -1147.428134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.428134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.428134 (E_RNA) where: Base-Base interactions energy: -581.330 where: short stacking energy: -314.454 Base-Backbone interact. energy: -0.197 local terms energy: -565.901510 where: bonds (distance) C4'-P energy: -163.600 bonds (distance) P-C4' energy: -151.712 flat angles C4'-P-C4' energy: -157.831 flat angles P-C4'-P energy: -84.079 tors. eta vs tors. theta energy: -8.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -958.853624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.853624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.853624 (E_RNA) where: Base-Base interactions energy: -484.676 where: short stacking energy: -279.911 Base-Backbone interact. energy: 0.501 local terms energy: -474.678257 where: bonds (distance) C4'-P energy: -122.316 bonds (distance) P-C4' energy: -144.061 flat angles C4'-P-C4' energy: -122.296 flat angles P-C4'-P energy: -79.361 tors. eta vs tors. theta energy: -6.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -635.868222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -635.868222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -635.868222 (E_RNA) where: Base-Base interactions energy: -189.581 where: short stacking energy: -143.860 Base-Backbone interact. energy: 2.813 local terms energy: -449.099454 where: bonds (distance) C4'-P energy: -146.108 bonds (distance) P-C4' energy: -153.444 flat angles C4'-P-C4' energy: -122.734 flat angles P-C4'-P energy: -79.278 tors. eta vs tors. theta energy: 52.464 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -2665.010172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2665.010172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2665.010172 (E_RNA) where: Base-Base interactions energy: -1763.415 where: short stacking energy: -833.249 Base-Backbone interact. energy: -0.278 local terms energy: -901.316345 where: bonds (distance) C4'-P energy: -178.833 bonds (distance) P-C4' energy: -180.522 flat angles C4'-P-C4' energy: -200.488 flat angles P-C4'-P energy: -115.031 tors. eta vs tors. theta energy: -226.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -2628.470252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2628.470252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2628.470252 (E_RNA) where: Base-Base interactions energy: -1730.581 where: short stacking energy: -753.218 Base-Backbone interact. energy: -7.479 local terms energy: -890.410525 where: bonds (distance) C4'-P energy: -168.661 bonds (distance) P-C4' energy: -193.609 flat angles C4'-P-C4' energy: -185.202 flat angles P-C4'-P energy: -117.447 tors. eta vs tors. theta energy: -225.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -2315.047685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2315.047685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2315.047685 (E_RNA) where: Base-Base interactions energy: -1501.211 where: short stacking energy: -702.338 Base-Backbone interact. energy: -2.013 local terms energy: -811.823553 where: bonds (distance) C4'-P energy: -183.084 bonds (distance) P-C4' energy: -158.918 flat angles C4'-P-C4' energy: -180.512 flat angles P-C4'-P energy: -94.910 tors. eta vs tors. theta energy: -194.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -2079.000372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2079.000372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2079.000372 (E_RNA) where: Base-Base interactions energy: -1285.818 where: short stacking energy: -615.687 Base-Backbone interact. energy: -0.626 local terms energy: -792.556226 where: bonds (distance) C4'-P energy: -158.343 bonds (distance) P-C4' energy: -180.161 flat angles C4'-P-C4' energy: -176.902 flat angles P-C4'-P energy: -109.967 tors. eta vs tors. theta energy: -167.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1932.298399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1932.298399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1932.298399 (E_RNA) where: Base-Base interactions energy: -1199.578 where: short stacking energy: -580.893 Base-Backbone interact. energy: -1.515 local terms energy: -731.205796 where: bonds (distance) C4'-P energy: -160.573 bonds (distance) P-C4' energy: -150.010 flat angles C4'-P-C4' energy: -157.853 flat angles P-C4'-P energy: -117.997 tors. eta vs tors. theta energy: -144.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1486.549536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.549536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.549536 (E_RNA) where: Base-Base interactions energy: -863.030 where: short stacking energy: -437.094 Base-Backbone interact. energy: 0.455 local terms energy: -623.974359 where: bonds (distance) C4'-P energy: -163.955 bonds (distance) P-C4' energy: -168.040 flat angles C4'-P-C4' energy: -141.135 flat angles P-C4'-P energy: -90.032 tors. eta vs tors. theta energy: -60.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1566.623594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.623594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.623594 (E_RNA) where: Base-Base interactions energy: -926.843 where: short stacking energy: -440.181 Base-Backbone interact. energy: 0.476 local terms energy: -640.256611 where: bonds (distance) C4'-P energy: -163.297 bonds (distance) P-C4' energy: -133.308 flat angles C4'-P-C4' energy: -167.972 flat angles P-C4'-P energy: -110.128 tors. eta vs tors. theta energy: -65.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -1176.705994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.705994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.705994 (E_RNA) where: Base-Base interactions energy: -654.586 where: short stacking energy: -351.333 Base-Backbone interact. energy: 6.104 local terms energy: -528.224689 where: bonds (distance) C4'-P energy: -135.396 bonds (distance) P-C4' energy: -144.923 flat angles C4'-P-C4' energy: -142.499 flat angles P-C4'-P energy: -86.056 tors. eta vs tors. theta energy: -19.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -959.816614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -959.816614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -959.816614 (E_RNA) where: Base-Base interactions energy: -480.886 where: short stacking energy: -249.295 Base-Backbone interact. energy: -1.163 local terms energy: -477.767810 where: bonds (distance) C4'-P energy: -147.780 bonds (distance) P-C4' energy: -154.969 flat angles C4'-P-C4' energy: -131.490 flat angles P-C4'-P energy: -64.653 tors. eta vs tors. theta energy: 21.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -693.883234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.883234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.883234 (E_RNA) where: Base-Base interactions energy: -244.983 where: short stacking energy: -153.326 Base-Backbone interact. energy: -3.122 local terms energy: -445.777644 where: bonds (distance) C4'-P energy: -134.313 bonds (distance) P-C4' energy: -181.399 flat angles C4'-P-C4' energy: -115.726 flat angles P-C4'-P energy: -56.004 tors. eta vs tors. theta energy: 41.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -2734.179665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2734.179665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2734.179665 (E_RNA) where: Base-Base interactions energy: -1837.668 where: short stacking energy: -819.310 Base-Backbone interact. energy: -8.833 local terms energy: -887.678329 where: bonds (distance) C4'-P energy: -167.829 bonds (distance) P-C4' energy: -181.647 flat angles C4'-P-C4' energy: -188.708 flat angles P-C4'-P energy: -115.419 tors. eta vs tors. theta energy: -234.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -2569.098444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2569.098444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2569.098444 (E_RNA) where: Base-Base interactions energy: -1665.889 where: short stacking energy: -759.876 Base-Backbone interact. energy: -5.457 local terms energy: -897.752530 where: bonds (distance) C4'-P energy: -181.090 bonds (distance) P-C4' energy: -182.791 flat angles C4'-P-C4' energy: -196.030 flat angles P-C4'-P energy: -116.857 tors. eta vs tors. theta energy: -220.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -2377.019495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2377.019495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2377.019495 (E_RNA) where: Base-Base interactions energy: -1517.458 where: short stacking energy: -695.168 Base-Backbone interact. energy: -1.128 local terms energy: -858.433989 where: bonds (distance) C4'-P energy: -184.672 bonds (distance) P-C4' energy: -172.427 flat angles C4'-P-C4' energy: -181.534 flat angles P-C4'-P energy: -131.452 tors. eta vs tors. theta energy: -188.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -2029.343433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2029.343433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2029.343433 (E_RNA) where: Base-Base interactions energy: -1264.582 where: short stacking energy: -606.655 Base-Backbone interact. energy: -0.279 local terms energy: -764.483251 where: bonds (distance) C4'-P energy: -161.193 bonds (distance) P-C4' energy: -153.307 flat angles C4'-P-C4' energy: -165.132 flat angles P-C4'-P energy: -121.842 tors. eta vs tors. theta energy: -163.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1888.271759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1888.271759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1888.271759 (E_RNA) where: Base-Base interactions energy: -1196.338 where: short stacking energy: -563.228 Base-Backbone interact. energy: -3.805 local terms energy: -688.128782 where: bonds (distance) C4'-P energy: -142.367 bonds (distance) P-C4' energy: -151.644 flat angles C4'-P-C4' energy: -167.390 flat angles P-C4'-P energy: -105.995 tors. eta vs tors. theta energy: -120.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1489.846117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.846117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.846117 (E_RNA) where: Base-Base interactions energy: -841.602 where: short stacking energy: -455.192 Base-Backbone interact. energy: 0.372 local terms energy: -648.616322 where: bonds (distance) C4'-P energy: -152.301 bonds (distance) P-C4' energy: -173.339 flat angles C4'-P-C4' energy: -160.912 flat angles P-C4'-P energy: -100.850 tors. eta vs tors. theta energy: -61.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1595.685439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1595.685439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1595.685439 (E_RNA) where: Base-Base interactions energy: -929.330 where: short stacking energy: -457.486 Base-Backbone interact. energy: 1.889 local terms energy: -668.244683 where: bonds (distance) C4'-P energy: -154.945 bonds (distance) P-C4' energy: -155.901 flat angles C4'-P-C4' energy: -170.666 flat angles P-C4'-P energy: -102.380 tors. eta vs tors. theta energy: -84.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -1250.485051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1250.485051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1250.485051 (E_RNA) where: Base-Base interactions energy: -688.376 where: short stacking energy: -382.111 Base-Backbone interact. energy: 3.656 local terms energy: -565.765580 where: bonds (distance) C4'-P energy: -124.220 bonds (distance) P-C4' energy: -163.102 flat angles C4'-P-C4' energy: -150.885 flat angles P-C4'-P energy: -74.894 tors. eta vs tors. theta energy: -52.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -905.459431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -905.459431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -905.459431 (E_RNA) where: Base-Base interactions energy: -427.009 where: short stacking energy: -240.537 Base-Backbone interact. energy: 1.239 local terms energy: -479.689606 where: bonds (distance) C4'-P energy: -135.363 bonds (distance) P-C4' energy: -148.822 flat angles C4'-P-C4' energy: -122.712 flat angles P-C4'-P energy: -91.731 tors. eta vs tors. theta energy: 18.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -682.213015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -682.213015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -682.213015 (E_RNA) where: Base-Base interactions energy: -242.075 where: short stacking energy: -207.963 Base-Backbone interact. energy: 8.864 local terms energy: -449.002070 where: bonds (distance) C4'-P energy: -149.680 bonds (distance) P-C4' energy: -149.864 flat angles C4'-P-C4' energy: -103.660 flat angles P-C4'-P energy: -73.376 tors. eta vs tors. theta energy: 27.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -2767.797706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2767.797706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2767.797706 (E_RNA) where: Base-Base interactions energy: -1830.174 where: short stacking energy: -820.136 Base-Backbone interact. energy: -5.396 local terms energy: -932.227856 where: bonds (distance) C4'-P energy: -169.613 bonds (distance) P-C4' energy: -184.234 flat angles C4'-P-C4' energy: -205.328 flat angles P-C4'-P energy: -132.152 tors. eta vs tors. theta energy: -240.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -2586.775396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2586.775396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2586.775396 (E_RNA) where: Base-Base interactions energy: -1719.463 where: short stacking energy: -748.821 Base-Backbone interact. energy: -4.410 local terms energy: -862.902062 where: bonds (distance) C4'-P energy: -183.899 bonds (distance) P-C4' energy: -172.971 flat angles C4'-P-C4' energy: -190.852 flat angles P-C4'-P energy: -108.898 tors. eta vs tors. theta energy: -206.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -2318.558756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2318.558756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2318.558756 (E_RNA) where: Base-Base interactions energy: -1495.865 where: short stacking energy: -683.082 Base-Backbone interact. energy: -4.540 local terms energy: -818.153671 where: bonds (distance) C4'-P energy: -171.071 bonds (distance) P-C4' energy: -167.809 flat angles C4'-P-C4' energy: -175.446 flat angles P-C4'-P energy: -123.397 tors. eta vs tors. theta energy: -180.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -2035.655418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2035.655418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2035.655418 (E_RNA) where: Base-Base interactions energy: -1290.619 where: short stacking energy: -652.932 Base-Backbone interact. energy: -0.262 local terms energy: -744.774036 where: bonds (distance) C4'-P energy: -153.453 bonds (distance) P-C4' energy: -155.901 flat angles C4'-P-C4' energy: -181.021 flat angles P-C4'-P energy: -102.297 tors. eta vs tors. theta energy: -152.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1881.725176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1881.725176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1881.725176 (E_RNA) where: Base-Base interactions energy: -1117.763 where: short stacking energy: -581.324 Base-Backbone interact. energy: -1.275 local terms energy: -762.686940 where: bonds (distance) C4'-P energy: -158.692 bonds (distance) P-C4' energy: -174.646 flat angles C4'-P-C4' energy: -180.902 flat angles P-C4'-P energy: -102.229 tors. eta vs tors. theta energy: -146.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1653.173256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.173256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.173256 (E_RNA) where: Base-Base interactions energy: -972.000 where: short stacking energy: -495.313 Base-Backbone interact. energy: 1.533 local terms energy: -682.706629 where: bonds (distance) C4'-P energy: -148.091 bonds (distance) P-C4' energy: -172.028 flat angles C4'-P-C4' energy: -159.370 flat angles P-C4'-P energy: -111.082 tors. eta vs tors. theta energy: -92.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -1452.243337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.243337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.243337 (E_RNA) where: Base-Base interactions energy: -825.740 where: short stacking energy: -430.843 Base-Backbone interact. energy: -0.584 local terms energy: -625.918652 where: bonds (distance) C4'-P energy: -154.149 bonds (distance) P-C4' energy: -154.248 flat angles C4'-P-C4' energy: -139.888 flat angles P-C4'-P energy: -103.209 tors. eta vs tors. theta energy: -74.425 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -1201.249817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.249817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1201.249817 (E_RNA) where: Base-Base interactions energy: -654.400 where: short stacking energy: -343.864 Base-Backbone interact. energy: -0.413 local terms energy: -546.437028 where: bonds (distance) C4'-P energy: -139.764 bonds (distance) P-C4' energy: -161.199 flat angles C4'-P-C4' energy: -137.956 flat angles P-C4'-P energy: -81.299 tors. eta vs tors. theta energy: -26.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -947.029451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.029451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.029451 (E_RNA) where: Base-Base interactions energy: -409.052 where: short stacking energy: -267.881 Base-Backbone interact. energy: 5.413 local terms energy: -543.389984 where: bonds (distance) C4'-P energy: -139.995 bonds (distance) P-C4' energy: -182.670 flat angles C4'-P-C4' energy: -146.342 flat angles P-C4'-P energy: -80.139 tors. eta vs tors. theta energy: 5.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -778.105005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.105005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.105005 (E_RNA) where: Base-Base interactions energy: -304.677 where: short stacking energy: -205.546 Base-Backbone interact. energy: -1.495 local terms energy: -471.932819 where: bonds (distance) C4'-P energy: -150.173 bonds (distance) P-C4' energy: -131.778 flat angles C4'-P-C4' energy: -133.470 flat angles P-C4'-P energy: -60.843 tors. eta vs tors. theta energy: 4.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -2749.872786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2749.872786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2749.872786 (E_RNA) where: Base-Base interactions energy: -1833.843 where: short stacking energy: -801.734 Base-Backbone interact. energy: -6.439 local terms energy: -909.591613 where: bonds (distance) C4'-P energy: -189.756 bonds (distance) P-C4' energy: -165.791 flat angles C4'-P-C4' energy: -193.329 flat angles P-C4'-P energy: -134.994 tors. eta vs tors. theta energy: -225.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -2547.587515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2547.587515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2547.587515 (E_RNA) where: Base-Base interactions energy: -1688.965 where: short stacking energy: -738.069 Base-Backbone interact. energy: -1.124 local terms energy: -857.498469 where: bonds (distance) C4'-P energy: -175.003 bonds (distance) P-C4' energy: -178.605 flat angles C4'-P-C4' energy: -198.125 flat angles P-C4'-P energy: -108.864 tors. eta vs tors. theta energy: -196.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -2301.640664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.640664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.640664 (E_RNA) where: Base-Base interactions energy: -1479.885 where: short stacking energy: -690.533 Base-Backbone interact. energy: -2.311 local terms energy: -819.445151 where: bonds (distance) C4'-P energy: -186.662 bonds (distance) P-C4' energy: -152.847 flat angles C4'-P-C4' energy: -178.525 flat angles P-C4'-P energy: -106.069 tors. eta vs tors. theta energy: -195.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1964.796795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.796795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.796795 (E_RNA) where: Base-Base interactions energy: -1191.509 where: short stacking energy: -587.653 Base-Backbone interact. energy: -2.217 local terms energy: -771.070073 where: bonds (distance) C4'-P energy: -180.792 bonds (distance) P-C4' energy: -183.998 flat angles C4'-P-C4' energy: -184.930 flat angles P-C4'-P energy: -105.243 tors. eta vs tors. theta energy: -116.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1844.119332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1844.119332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1844.119332 (E_RNA) where: Base-Base interactions energy: -1093.809 where: short stacking energy: -540.281 Base-Backbone interact. energy: 0.565 local terms energy: -750.875913 where: bonds (distance) C4'-P energy: -180.106 bonds (distance) P-C4' energy: -143.877 flat angles C4'-P-C4' energy: -184.437 flat angles P-C4'-P energy: -109.796 tors. eta vs tors. theta energy: -132.660 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1658.432056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1658.432056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1658.432056 (E_RNA) where: Base-Base interactions energy: -955.728 where: short stacking energy: -512.728 Base-Backbone interact. energy: 0.534 local terms energy: -703.238319 where: bonds (distance) C4'-P energy: -156.722 bonds (distance) P-C4' energy: -179.600 flat angles C4'-P-C4' energy: -159.604 flat angles P-C4'-P energy: -98.127 tors. eta vs tors. theta energy: -109.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1408.745402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.745402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.745402 (E_RNA) where: Base-Base interactions energy: -815.461 where: short stacking energy: -415.338 Base-Backbone interact. energy: 1.812 local terms energy: -595.095949 where: bonds (distance) C4'-P energy: -146.945 bonds (distance) P-C4' energy: -154.608 flat angles C4'-P-C4' energy: -131.834 flat angles P-C4'-P energy: -101.970 tors. eta vs tors. theta energy: -59.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -1196.997254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.997254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.997254 (E_RNA) where: Base-Base interactions energy: -646.566 where: short stacking energy: -344.476 Base-Backbone interact. energy: 0.862 local terms energy: -551.292812 where: bonds (distance) C4'-P energy: -129.457 bonds (distance) P-C4' energy: -170.688 flat angles C4'-P-C4' energy: -131.866 flat angles P-C4'-P energy: -76.149 tors. eta vs tors. theta energy: -43.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -880.514590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.514590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.514590 (E_RNA) where: Base-Base interactions energy: -414.426 where: short stacking energy: -228.174 Base-Backbone interact. energy: 4.448 local terms energy: -470.537333 where: bonds (distance) C4'-P energy: -134.240 bonds (distance) P-C4' energy: -131.475 flat angles C4'-P-C4' energy: -119.739 flat angles P-C4'-P energy: -88.711 tors. eta vs tors. theta energy: 3.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -668.223224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -668.223224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -668.223224 (E_RNA) where: Base-Base interactions energy: -271.375 where: short stacking energy: -191.427 Base-Backbone interact. energy: 4.346 local terms energy: -401.193914 where: bonds (distance) C4'-P energy: -119.279 bonds (distance) P-C4' energy: -152.900 flat angles C4'-P-C4' energy: -107.346 flat angles P-C4'-P energy: -66.064 tors. eta vs tors. theta energy: 44.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -2758.239568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2758.239568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2758.239568 (E_RNA) where: Base-Base interactions energy: -1828.646 where: short stacking energy: -810.261 Base-Backbone interact. energy: -5.719 local terms energy: -923.874501 where: bonds (distance) C4'-P energy: -173.173 bonds (distance) P-C4' energy: -204.776 flat angles C4'-P-C4' energy: -193.813 flat angles P-C4'-P energy: -124.336 tors. eta vs tors. theta energy: -227.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -2540.756400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2540.756400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2540.756400 (E_RNA) where: Base-Base interactions energy: -1661.721 where: short stacking energy: -697.393 Base-Backbone interact. energy: -1.566 local terms energy: -877.469563 where: bonds (distance) C4'-P energy: -187.689 bonds (distance) P-C4' energy: -186.838 flat angles C4'-P-C4' energy: -200.601 flat angles P-C4'-P energy: -111.709 tors. eta vs tors. theta energy: -190.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -2340.886645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2340.886645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.886645 (E_RNA) where: Base-Base interactions energy: -1492.252 where: short stacking energy: -711.582 Base-Backbone interact. energy: -2.803 local terms energy: -845.832010 where: bonds (distance) C4'-P energy: -183.054 bonds (distance) P-C4' energy: -163.179 flat angles C4'-P-C4' energy: -187.957 flat angles P-C4'-P energy: -115.743 tors. eta vs tors. theta energy: -195.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -2026.728432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2026.728432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2026.728432 (E_RNA) where: Base-Base interactions energy: -1282.704 where: short stacking energy: -624.166 Base-Backbone interact. energy: -0.491 local terms energy: -743.534152 where: bonds (distance) C4'-P energy: -149.889 bonds (distance) P-C4' energy: -161.781 flat angles C4'-P-C4' energy: -164.873 flat angles P-C4'-P energy: -116.476 tors. eta vs tors. theta energy: -150.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1803.894588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1803.894588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1803.894588 (E_RNA) where: Base-Base interactions energy: -1074.234 where: short stacking energy: -544.141 Base-Backbone interact. energy: -0.924 local terms energy: -728.737453 where: bonds (distance) C4'-P energy: -162.158 bonds (distance) P-C4' energy: -167.447 flat angles C4'-P-C4' energy: -183.654 flat angles P-C4'-P energy: -84.962 tors. eta vs tors. theta energy: -130.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1757.973212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1757.973212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1757.973212 (E_RNA) where: Base-Base interactions energy: -1059.889 where: short stacking energy: -529.945 Base-Backbone interact. energy: -2.815 local terms energy: -695.269181 where: bonds (distance) C4'-P energy: -157.011 bonds (distance) P-C4' energy: -154.415 flat angles C4'-P-C4' energy: -173.849 flat angles P-C4'-P energy: -101.119 tors. eta vs tors. theta energy: -108.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1385.446355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1385.446355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1385.446355 (E_RNA) where: Base-Base interactions energy: -777.943 where: short stacking energy: -439.774 Base-Backbone interact. energy: -1.083 local terms energy: -606.420897 where: bonds (distance) C4'-P energy: -157.921 bonds (distance) P-C4' energy: -134.419 flat angles C4'-P-C4' energy: -158.875 flat angles P-C4'-P energy: -80.651 tors. eta vs tors. theta energy: -74.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -1218.130876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.130876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.130876 (E_RNA) where: Base-Base interactions energy: -655.977 where: short stacking energy: -339.995 Base-Backbone interact. energy: -2.100 local terms energy: -560.053960 where: bonds (distance) C4'-P energy: -136.964 bonds (distance) P-C4' energy: -166.975 flat angles C4'-P-C4' energy: -154.715 flat angles P-C4'-P energy: -94.797 tors. eta vs tors. theta energy: -6.604 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -916.516576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -916.516576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -916.516576 (E_RNA) where: Base-Base interactions energy: -428.169 where: short stacking energy: -251.038 Base-Backbone interact. energy: 2.346 local terms energy: -490.693298 where: bonds (distance) C4'-P energy: -147.475 bonds (distance) P-C4' energy: -147.664 flat angles C4'-P-C4' energy: -142.603 flat angles P-C4'-P energy: -65.527 tors. eta vs tors. theta energy: 12.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -708.962655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -708.962655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -708.962655 (E_RNA) where: Base-Base interactions energy: -260.737 where: short stacking energy: -189.424 Base-Backbone interact. energy: 0.028 local terms energy: -448.253582 where: bonds (distance) C4'-P energy: -146.479 bonds (distance) P-C4' energy: -145.612 flat angles C4'-P-C4' energy: -131.373 flat angles P-C4'-P energy: -67.607 tors. eta vs tors. theta energy: 42.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -2771.827116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2771.827116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2771.827116 (E_RNA) where: Base-Base interactions energy: -1826.898 where: short stacking energy: -810.014 Base-Backbone interact. energy: -5.139 local terms energy: -939.790656 where: bonds (distance) C4'-P energy: -192.643 bonds (distance) P-C4' energy: -184.619 flat angles C4'-P-C4' energy: -204.969 flat angles P-C4'-P energy: -126.784 tors. eta vs tors. theta energy: -230.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -2564.890831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2564.890831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2564.890831 (E_RNA) where: Base-Base interactions energy: -1699.035 where: short stacking energy: -752.819 Base-Backbone interact. energy: 3.190 local terms energy: -869.046330 where: bonds (distance) C4'-P energy: -174.177 bonds (distance) P-C4' energy: -169.131 flat angles C4'-P-C4' energy: -203.348 flat angles P-C4'-P energy: -120.658 tors. eta vs tors. theta energy: -201.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -2340.944887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2340.944887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.944887 (E_RNA) where: Base-Base interactions energy: -1485.203 where: short stacking energy: -743.760 Base-Backbone interact. energy: -0.902 local terms energy: -854.839442 where: bonds (distance) C4'-P energy: -169.611 bonds (distance) P-C4' energy: -164.175 flat angles C4'-P-C4' energy: -195.106 flat angles P-C4'-P energy: -131.087 tors. eta vs tors. theta energy: -194.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -2005.716614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2005.716614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2005.716614 (E_RNA) where: Base-Base interactions energy: -1248.401 where: short stacking energy: -630.384 Base-Backbone interact. energy: 1.242 local terms energy: -758.557896 where: bonds (distance) C4'-P energy: -171.956 bonds (distance) P-C4' energy: -160.390 flat angles C4'-P-C4' energy: -174.258 flat angles P-C4'-P energy: -104.396 tors. eta vs tors. theta energy: -147.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1818.880373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1818.880373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1818.880373 (E_RNA) where: Base-Base interactions energy: -1095.620 where: short stacking energy: -530.893 Base-Backbone interact. energy: -1.839 local terms energy: -721.420841 where: bonds (distance) C4'-P energy: -152.197 bonds (distance) P-C4' energy: -183.476 flat angles C4'-P-C4' energy: -169.101 flat angles P-C4'-P energy: -109.322 tors. eta vs tors. theta energy: -107.325 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1767.019995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1767.019995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1767.019995 (E_RNA) where: Base-Base interactions energy: -1064.242 where: short stacking energy: -530.160 Base-Backbone interact. energy: 2.899 local terms energy: -705.677101 where: bonds (distance) C4'-P energy: -160.909 bonds (distance) P-C4' energy: -161.801 flat angles C4'-P-C4' energy: -178.182 flat angles P-C4'-P energy: -90.166 tors. eta vs tors. theta energy: -114.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1335.081071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1335.081071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.081071 (E_RNA) where: Base-Base interactions energy: -746.799 where: short stacking energy: -393.723 Base-Backbone interact. energy: 3.307 local terms energy: -591.589867 where: bonds (distance) C4'-P energy: -154.642 bonds (distance) P-C4' energy: -145.084 flat angles C4'-P-C4' energy: -165.688 flat angles P-C4'-P energy: -87.360 tors. eta vs tors. theta energy: -38.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -1198.693744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1198.693744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1198.693744 (E_RNA) where: Base-Base interactions energy: -642.831 where: short stacking energy: -360.809 Base-Backbone interact. energy: -1.952 local terms energy: -553.910628 where: bonds (distance) C4'-P energy: -138.024 bonds (distance) P-C4' energy: -165.345 flat angles C4'-P-C4' energy: -139.767 flat angles P-C4'-P energy: -77.834 tors. eta vs tors. theta energy: -32.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -898.863564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.863564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.863564 (E_RNA) where: Base-Base interactions energy: -423.561 where: short stacking energy: -273.682 Base-Backbone interact. energy: 0.143 local terms energy: -475.445485 where: bonds (distance) C4'-P energy: -149.149 bonds (distance) P-C4' energy: -124.773 flat angles C4'-P-C4' energy: -127.804 flat angles P-C4'-P energy: -64.256 tors. eta vs tors. theta energy: -9.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -781.124613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.124613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.124613 (E_RNA) where: Base-Base interactions energy: -345.584 where: short stacking energy: -236.103 Base-Backbone interact. energy: 0.246 local terms energy: -435.787494 where: bonds (distance) C4'-P energy: -145.355 bonds (distance) P-C4' energy: -157.041 flat angles C4'-P-C4' energy: -95.684 flat angles P-C4'-P energy: -79.290 tors. eta vs tors. theta energy: 41.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -2732.790770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2732.790770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2732.790770 (E_RNA) where: Base-Base interactions energy: -1789.658 where: short stacking energy: -784.933 Base-Backbone interact. energy: -2.174 local terms energy: -940.958382 where: bonds (distance) C4'-P energy: -184.591 bonds (distance) P-C4' energy: -196.551 flat angles C4'-P-C4' energy: -199.753 flat angles P-C4'-P energy: -136.024 tors. eta vs tors. theta energy: -224.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -2547.526497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2547.526497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2547.526497 (E_RNA) where: Base-Base interactions energy: -1695.086 where: short stacking energy: -759.033 Base-Backbone interact. energy: 5.408 local terms energy: -857.848788 where: bonds (distance) C4'-P energy: -170.536 bonds (distance) P-C4' energy: -186.687 flat angles C4'-P-C4' energy: -191.460 flat angles P-C4'-P energy: -107.396 tors. eta vs tors. theta energy: -201.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -2383.396438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2383.396438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2383.396438 (E_RNA) where: Base-Base interactions energy: -1562.955 where: short stacking energy: -693.577 Base-Backbone interact. energy: -5.764 local terms energy: -814.677882 where: bonds (distance) C4'-P energy: -156.392 bonds (distance) P-C4' energy: -167.409 flat angles C4'-P-C4' energy: -196.077 flat angles P-C4'-P energy: -121.354 tors. eta vs tors. theta energy: -173.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -2059.952539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2059.952539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2059.952539 (E_RNA) where: Base-Base interactions energy: -1270.096 where: short stacking energy: -616.110 Base-Backbone interact. energy: 1.816 local terms energy: -791.672816 where: bonds (distance) C4'-P energy: -159.558 bonds (distance) P-C4' energy: -179.066 flat angles C4'-P-C4' energy: -173.598 flat angles P-C4'-P energy: -124.061 tors. eta vs tors. theta energy: -155.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1828.458034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1828.458034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1828.458034 (E_RNA) where: Base-Base interactions energy: -1108.200 where: short stacking energy: -535.752 Base-Backbone interact. energy: 0.979 local terms energy: -721.236876 where: bonds (distance) C4'-P energy: -153.547 bonds (distance) P-C4' energy: -177.856 flat angles C4'-P-C4' energy: -173.281 flat angles P-C4'-P energy: -99.047 tors. eta vs tors. theta energy: -117.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1755.486510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1755.486510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1755.486510 (E_RNA) where: Base-Base interactions energy: -1069.149 where: short stacking energy: -515.501 Base-Backbone interact. energy: -0.315 local terms energy: -686.022040 where: bonds (distance) C4'-P energy: -133.276 bonds (distance) P-C4' energy: -156.279 flat angles C4'-P-C4' energy: -164.430 flat angles P-C4'-P energy: -101.226 tors. eta vs tors. theta energy: -130.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -1295.789292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.789292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.789292 (E_RNA) where: Base-Base interactions energy: -688.529 where: short stacking energy: -353.329 Base-Backbone interact. energy: 3.056 local terms energy: -610.315819 where: bonds (distance) C4'-P energy: -163.453 bonds (distance) P-C4' energy: -145.515 flat angles C4'-P-C4' energy: -152.271 flat angles P-C4'-P energy: -109.068 tors. eta vs tors. theta energy: -40.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -1149.322883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.322883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.322883 (E_RNA) where: Base-Base interactions energy: -617.601 where: short stacking energy: -315.119 Base-Backbone interact. energy: -1.091 local terms energy: -530.630246 where: bonds (distance) C4'-P energy: -147.397 bonds (distance) P-C4' energy: -150.018 flat angles C4'-P-C4' energy: -140.815 flat angles P-C4'-P energy: -76.031 tors. eta vs tors. theta energy: -16.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -954.713653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.713653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.713653 (E_RNA) where: Base-Base interactions energy: -505.041 where: short stacking energy: -300.556 Base-Backbone interact. energy: -1.286 local terms energy: -448.386740 where: bonds (distance) C4'-P energy: -116.777 bonds (distance) P-C4' energy: -132.337 flat angles C4'-P-C4' energy: -121.248 flat angles P-C4'-P energy: -71.949 tors. eta vs tors. theta energy: -6.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -796.818817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -796.818817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -796.818817 (E_RNA) where: Base-Base interactions energy: -336.185 where: short stacking energy: -221.648 Base-Backbone interact. energy: 12.433 local terms energy: -473.067254 where: bonds (distance) C4'-P energy: -147.694 bonds (distance) P-C4' energy: -151.828 flat angles C4'-P-C4' energy: -124.918 flat angles P-C4'-P energy: -68.915 tors. eta vs tors. theta energy: 20.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -2754.848601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2754.848601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2754.848601 (E_RNA) where: Base-Base interactions energy: -1824.523 where: short stacking energy: -808.492 Base-Backbone interact. energy: 1.253 local terms energy: -931.578919 where: bonds (distance) C4'-P energy: -186.772 bonds (distance) P-C4' energy: -185.289 flat angles C4'-P-C4' energy: -214.204 flat angles P-C4'-P energy: -123.570 tors. eta vs tors. theta energy: -221.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -2568.582509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2568.582509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2568.582509 (E_RNA) where: Base-Base interactions energy: -1691.977 where: short stacking energy: -779.719 Base-Backbone interact. energy: -0.470 local terms energy: -876.135640 where: bonds (distance) C4'-P energy: -174.243 bonds (distance) P-C4' energy: -184.700 flat angles C4'-P-C4' energy: -199.469 flat angles P-C4'-P energy: -117.887 tors. eta vs tors. theta energy: -199.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -2448.038674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2448.038674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2448.038674 (E_RNA) where: Base-Base interactions energy: -1573.174 where: short stacking energy: -756.250 Base-Backbone interact. energy: -0.311 local terms energy: -874.554094 where: bonds (distance) C4'-P energy: -165.508 bonds (distance) P-C4' energy: -185.485 flat angles C4'-P-C4' energy: -182.245 flat angles P-C4'-P energy: -118.945 tors. eta vs tors. theta energy: -222.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -2070.667644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2070.667644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2070.667644 (E_RNA) where: Base-Base interactions energy: -1289.984 where: short stacking energy: -610.420 Base-Backbone interact. energy: -3.349 local terms energy: -777.333922 where: bonds (distance) C4'-P energy: -175.280 bonds (distance) P-C4' energy: -171.207 flat angles C4'-P-C4' energy: -151.036 flat angles P-C4'-P energy: -117.079 tors. eta vs tors. theta energy: -162.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1825.248111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1825.248111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1825.248111 (E_RNA) where: Base-Base interactions energy: -1102.371 where: short stacking energy: -530.703 Base-Backbone interact. energy: -2.196 local terms energy: -720.681129 where: bonds (distance) C4'-P energy: -160.205 bonds (distance) P-C4' energy: -174.374 flat angles C4'-P-C4' energy: -167.506 flat angles P-C4'-P energy: -109.816 tors. eta vs tors. theta energy: -108.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1806.174715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1806.174715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1806.174715 (E_RNA) where: Base-Base interactions energy: -1109.718 where: short stacking energy: -518.912 Base-Backbone interact. energy: -2.691 local terms energy: -693.765366 where: bonds (distance) C4'-P energy: -161.209 bonds (distance) P-C4' energy: -160.658 flat angles C4'-P-C4' energy: -168.877 flat angles P-C4'-P energy: -86.439 tors. eta vs tors. theta energy: -116.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1357.170707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.170707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.170707 (E_RNA) where: Base-Base interactions energy: -744.478 where: short stacking energy: -417.047 Base-Backbone interact. energy: 1.425 local terms energy: -614.118127 where: bonds (distance) C4'-P energy: -153.904 bonds (distance) P-C4' energy: -163.277 flat angles C4'-P-C4' energy: -140.960 flat angles P-C4'-P energy: -94.702 tors. eta vs tors. theta energy: -61.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -1174.501553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.501553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.501553 (E_RNA) where: Base-Base interactions energy: -622.344 where: short stacking energy: -333.242 Base-Backbone interact. energy: -3.591 local terms energy: -548.567120 where: bonds (distance) C4'-P energy: -126.735 bonds (distance) P-C4' energy: -177.392 flat angles C4'-P-C4' energy: -133.465 flat angles P-C4'-P energy: -108.622 tors. eta vs tors. theta energy: -2.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -922.974532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.974532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.974532 (E_RNA) where: Base-Base interactions energy: -454.052 where: short stacking energy: -256.160 Base-Backbone interact. energy: -0.640 local terms energy: -468.282792 where: bonds (distance) C4'-P energy: -172.807 bonds (distance) P-C4' energy: -135.697 flat angles C4'-P-C4' energy: -110.097 flat angles P-C4'-P energy: -69.343 tors. eta vs tors. theta energy: 19.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -760.528584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.528584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.528584 (E_RNA) where: Base-Base interactions energy: -297.811 where: short stacking energy: -187.944 Base-Backbone interact. energy: -1.773 local terms energy: -460.944192 where: bonds (distance) C4'-P energy: -155.562 bonds (distance) P-C4' energy: -138.670 flat angles C4'-P-C4' energy: -115.695 flat angles P-C4'-P energy: -76.264 tors. eta vs tors. theta energy: 25.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -2709.721448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2709.721448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2709.721448 (E_RNA) where: Base-Base interactions energy: -1795.223 where: short stacking energy: -807.813 Base-Backbone interact. energy: -2.878 local terms energy: -911.619911 where: bonds (distance) C4'-P energy: -183.509 bonds (distance) P-C4' energy: -173.786 flat angles C4'-P-C4' energy: -202.878 flat angles P-C4'-P energy: -132.185 tors. eta vs tors. theta energy: -219.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -2581.093478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2581.093478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2581.093478 (E_RNA) where: Base-Base interactions energy: -1681.776 where: short stacking energy: -737.988 Base-Backbone interact. energy: -1.892 local terms energy: -897.425191 where: bonds (distance) C4'-P energy: -182.248 bonds (distance) P-C4' energy: -192.159 flat angles C4'-P-C4' energy: -194.548 flat angles P-C4'-P energy: -119.764 tors. eta vs tors. theta energy: -208.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -2374.651891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2374.651891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2374.651891 (E_RNA) where: Base-Base interactions energy: -1552.142 where: short stacking energy: -692.208 Base-Backbone interact. energy: -0.520 local terms energy: -821.989868 where: bonds (distance) C4'-P energy: -170.070 bonds (distance) P-C4' energy: -174.043 flat angles C4'-P-C4' energy: -178.769 flat angles P-C4'-P energy: -105.282 tors. eta vs tors. theta energy: -193.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -2086.046923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2086.046923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2086.046923 (E_RNA) where: Base-Base interactions energy: -1293.457 where: short stacking energy: -622.213 Base-Backbone interact. energy: -5.298 local terms energy: -787.292178 where: bonds (distance) C4'-P energy: -163.299 bonds (distance) P-C4' energy: -182.695 flat angles C4'-P-C4' energy: -185.076 flat angles P-C4'-P energy: -99.772 tors. eta vs tors. theta energy: -156.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1858.205374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1858.205374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1858.205374 (E_RNA) where: Base-Base interactions energy: -1107.719 where: short stacking energy: -555.536 Base-Backbone interact. energy: 2.563 local terms energy: -753.049343 where: bonds (distance) C4'-P energy: -182.693 bonds (distance) P-C4' energy: -177.813 flat angles C4'-P-C4' energy: -175.155 flat angles P-C4'-P energy: -87.648 tors. eta vs tors. theta energy: -129.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1868.443620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1868.443620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1868.443620 (E_RNA) where: Base-Base interactions energy: -1160.426 where: short stacking energy: -556.244 Base-Backbone interact. energy: -1.796 local terms energy: -706.221365 where: bonds (distance) C4'-P energy: -156.756 bonds (distance) P-C4' energy: -157.826 flat angles C4'-P-C4' energy: -154.878 flat angles P-C4'-P energy: -96.561 tors. eta vs tors. theta energy: -140.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -1414.050684 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.050684 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.050684 (E_RNA) where: Base-Base interactions energy: -844.835 where: short stacking energy: -423.816 Base-Backbone interact. energy: -0.614 local terms energy: -568.601588 where: bonds (distance) C4'-P energy: -137.850 bonds (distance) P-C4' energy: -147.172 flat angles C4'-P-C4' energy: -138.734 flat angles P-C4'-P energy: -77.454 tors. eta vs tors. theta energy: -67.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -1272.019643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.019643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.019643 (E_RNA) where: Base-Base interactions energy: -730.513 where: short stacking energy: -375.894 Base-Backbone interact. energy: 1.476 local terms energy: -542.982482 where: bonds (distance) C4'-P energy: -139.481 bonds (distance) P-C4' energy: -154.818 flat angles C4'-P-C4' energy: -133.429 flat angles P-C4'-P energy: -88.858 tors. eta vs tors. theta energy: -26.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -872.814417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.814417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.814417 (E_RNA) where: Base-Base interactions energy: -378.301 where: short stacking energy: -229.251 Base-Backbone interact. energy: -2.464 local terms energy: -492.048603 where: bonds (distance) C4'-P energy: -133.932 bonds (distance) P-C4' energy: -154.897 flat angles C4'-P-C4' energy: -145.068 flat angles P-C4'-P energy: -64.609 tors. eta vs tors. theta energy: 6.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -763.623599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -763.623599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -763.623599 (E_RNA) where: Base-Base interactions energy: -297.415 where: short stacking energy: -238.174 Base-Backbone interact. energy: 2.738 local terms energy: -468.946770 where: bonds (distance) C4'-P energy: -168.283 bonds (distance) P-C4' energy: -149.034 flat angles C4'-P-C4' energy: -114.254 flat angles P-C4'-P energy: -57.011 tors. eta vs tors. theta energy: 19.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -2799.591873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2799.591873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2799.591873 (E_RNA) where: Base-Base interactions energy: -1863.591 where: short stacking energy: -832.646 Base-Backbone interact. energy: -5.912 local terms energy: -930.088492 where: bonds (distance) C4'-P energy: -181.927 bonds (distance) P-C4' energy: -193.686 flat angles C4'-P-C4' energy: -198.250 flat angles P-C4'-P energy: -127.045 tors. eta vs tors. theta energy: -229.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -2579.461929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2579.461929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2579.461929 (E_RNA) where: Base-Base interactions energy: -1716.219 where: short stacking energy: -736.640 Base-Backbone interact. energy: 4.006 local terms energy: -867.248675 where: bonds (distance) C4'-P energy: -188.389 bonds (distance) P-C4' energy: -187.140 flat angles C4'-P-C4' energy: -166.163 flat angles P-C4'-P energy: -123.681 tors. eta vs tors. theta energy: -201.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -2368.933932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2368.933932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2368.933932 (E_RNA) where: Base-Base interactions energy: -1544.087 where: short stacking energy: -691.853 Base-Backbone interact. energy: 2.172 local terms energy: -827.019222 where: bonds (distance) C4'-P energy: -163.291 bonds (distance) P-C4' energy: -169.632 flat angles C4'-P-C4' energy: -189.705 flat angles P-C4'-P energy: -119.903 tors. eta vs tors. theta energy: -184.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -2112.040402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2112.040402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2112.040402 (E_RNA) where: Base-Base interactions energy: -1314.242 where: short stacking energy: -636.950 Base-Backbone interact. energy: -3.158 local terms energy: -794.639802 where: bonds (distance) C4'-P energy: -172.312 bonds (distance) P-C4' energy: -178.020 flat angles C4'-P-C4' energy: -179.188 flat angles P-C4'-P energy: -104.518 tors. eta vs tors. theta energy: -160.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1980.118948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1980.118948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1980.118948 (E_RNA) where: Base-Base interactions energy: -1190.707 where: short stacking energy: -557.704 Base-Backbone interact. energy: -1.328 local terms energy: -788.083176 where: bonds (distance) C4'-P energy: -178.473 bonds (distance) P-C4' energy: -162.793 flat angles C4'-P-C4' energy: -196.509 flat angles P-C4'-P energy: -98.790 tors. eta vs tors. theta energy: -151.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1723.636311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1723.636311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1723.636311 (E_RNA) where: Base-Base interactions energy: -1053.312 where: short stacking energy: -493.026 Base-Backbone interact. energy: 1.368 local terms energy: -671.692387 where: bonds (distance) C4'-P energy: -155.505 bonds (distance) P-C4' energy: -147.733 flat angles C4'-P-C4' energy: -163.937 flat angles P-C4'-P energy: -110.112 tors. eta vs tors. theta energy: -94.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -1387.656994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1387.656994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1387.656994 (E_RNA) where: Base-Base interactions energy: -805.772 where: short stacking energy: -420.910 Base-Backbone interact. energy: 0.088 local terms energy: -581.973093 where: bonds (distance) C4'-P energy: -129.003 bonds (distance) P-C4' energy: -156.549 flat angles C4'-P-C4' energy: -146.302 flat angles P-C4'-P energy: -92.608 tors. eta vs tors. theta energy: -57.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -1274.554402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.554402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.554402 (E_RNA) where: Base-Base interactions energy: -707.998 where: short stacking energy: -363.910 Base-Backbone interact. energy: 5.773 local terms energy: -572.329546 where: bonds (distance) C4'-P energy: -132.305 bonds (distance) P-C4' energy: -136.239 flat angles C4'-P-C4' energy: -179.756 flat angles P-C4'-P energy: -64.982 tors. eta vs tors. theta energy: -59.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -876.705925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.705925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.705925 (E_RNA) where: Base-Base interactions energy: -386.590 where: short stacking energy: -255.709 Base-Backbone interact. energy: 16.391 local terms energy: -506.506001 where: bonds (distance) C4'-P energy: -146.143 bonds (distance) P-C4' energy: -155.254 flat angles C4'-P-C4' energy: -130.789 flat angles P-C4'-P energy: -79.900 tors. eta vs tors. theta energy: 5.581 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -764.190528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.190528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.190528 (E_RNA) where: Base-Base interactions energy: -315.568 where: short stacking energy: -208.187 Base-Backbone interact. energy: -4.098 local terms energy: -444.524510 where: bonds (distance) C4'-P energy: -144.423 bonds (distance) P-C4' energy: -122.078 flat angles C4'-P-C4' energy: -111.937 flat angles P-C4'-P energy: -72.270 tors. eta vs tors. theta energy: 6.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -2769.871155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2769.871155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2769.871155 (E_RNA) where: Base-Base interactions energy: -1845.304 where: short stacking energy: -833.205 Base-Backbone interact. energy: -3.998 local terms energy: -920.568978 where: bonds (distance) C4'-P energy: -179.416 bonds (distance) P-C4' energy: -176.284 flat angles C4'-P-C4' energy: -192.010 flat angles P-C4'-P energy: -142.978 tors. eta vs tors. theta energy: -229.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -2580.885260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2580.885260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2580.885260 (E_RNA) where: Base-Base interactions energy: -1694.404 where: short stacking energy: -744.368 Base-Backbone interact. energy: -1.693 local terms energy: -884.788282 where: bonds (distance) C4'-P energy: -185.189 bonds (distance) P-C4' energy: -196.718 flat angles C4'-P-C4' energy: -183.310 flat angles P-C4'-P energy: -118.579 tors. eta vs tors. theta energy: -200.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -2395.907871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2395.907871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2395.907871 (E_RNA) where: Base-Base interactions energy: -1546.698 where: short stacking energy: -728.775 Base-Backbone interact. energy: -4.096 local terms energy: -845.113969 where: bonds (distance) C4'-P energy: -180.350 bonds (distance) P-C4' energy: -171.680 flat angles C4'-P-C4' energy: -182.906 flat angles P-C4'-P energy: -110.375 tors. eta vs tors. theta energy: -199.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -2087.411925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2087.411925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2087.411925 (E_RNA) where: Base-Base interactions energy: -1336.010 where: short stacking energy: -644.111 Base-Backbone interact. energy: -4.331 local terms energy: -747.070857 where: bonds (distance) C4'-P energy: -139.905 bonds (distance) P-C4' energy: -167.847 flat angles C4'-P-C4' energy: -174.614 flat angles P-C4'-P energy: -109.468 tors. eta vs tors. theta energy: -155.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -2012.454736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.454736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.454736 (E_RNA) where: Base-Base interactions energy: -1259.382 where: short stacking energy: -607.607 Base-Backbone interact. energy: -0.252 local terms energy: -752.820581 where: bonds (distance) C4'-P energy: -166.470 bonds (distance) P-C4' energy: -155.841 flat angles C4'-P-C4' energy: -178.278 flat angles P-C4'-P energy: -117.389 tors. eta vs tors. theta energy: -134.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1714.137270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1714.137270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1714.137270 (E_RNA) where: Base-Base interactions energy: -1057.208 where: short stacking energy: -506.112 Base-Backbone interact. energy: -1.454 local terms energy: -655.474980 where: bonds (distance) C4'-P energy: -159.832 bonds (distance) P-C4' energy: -151.141 flat angles C4'-P-C4' energy: -155.231 flat angles P-C4'-P energy: -92.342 tors. eta vs tors. theta energy: -96.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -1360.490427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.490427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.490427 (E_RNA) where: Base-Base interactions energy: -748.696 where: short stacking energy: -385.263 Base-Backbone interact. energy: 3.119 local terms energy: -614.913096 where: bonds (distance) C4'-P energy: -155.201 bonds (distance) P-C4' energy: -177.421 flat angles C4'-P-C4' energy: -137.864 flat angles P-C4'-P energy: -89.212 tors. eta vs tors. theta energy: -55.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -1350.761222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.761222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.761222 (E_RNA) where: Base-Base interactions energy: -806.849 where: short stacking energy: -383.629 Base-Backbone interact. energy: 2.351 local terms energy: -546.263942 where: bonds (distance) C4'-P energy: -149.625 bonds (distance) P-C4' energy: -146.659 flat angles C4'-P-C4' energy: -137.513 flat angles P-C4'-P energy: -70.200 tors. eta vs tors. theta energy: -42.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -882.984754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.984754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.984754 (E_RNA) where: Base-Base interactions energy: -399.769 where: short stacking energy: -278.885 Base-Backbone interact. energy: 8.867 local terms energy: -492.082488 where: bonds (distance) C4'-P energy: -142.299 bonds (distance) P-C4' energy: -152.568 flat angles C4'-P-C4' energy: -123.855 flat angles P-C4'-P energy: -71.497 tors. eta vs tors. theta energy: -1.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -776.734403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.734403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.734403 (E_RNA) where: Base-Base interactions energy: -276.244 where: short stacking energy: -205.481 Base-Backbone interact. energy: 1.104 local terms energy: -501.594039 where: bonds (distance) C4'-P energy: -143.485 bonds (distance) P-C4' energy: -155.673 flat angles C4'-P-C4' energy: -135.555 flat angles P-C4'-P energy: -89.234 tors. eta vs tors. theta energy: 22.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -2749.869008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2749.869008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2749.869008 (E_RNA) where: Base-Base interactions energy: -1811.572 where: short stacking energy: -790.868 Base-Backbone interact. energy: -5.126 local terms energy: -933.171071 where: bonds (distance) C4'-P energy: -194.221 bonds (distance) P-C4' energy: -172.918 flat angles C4'-P-C4' energy: -200.257 flat angles P-C4'-P energy: -140.074 tors. eta vs tors. theta energy: -225.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -2610.335622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2610.335622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2610.335622 (E_RNA) where: Base-Base interactions energy: -1732.065 where: short stacking energy: -754.798 Base-Backbone interact. energy: 0.447 local terms energy: -878.717671 where: bonds (distance) C4'-P energy: -174.595 bonds (distance) P-C4' energy: -183.890 flat angles C4'-P-C4' energy: -207.882 flat angles P-C4'-P energy: -121.046 tors. eta vs tors. theta energy: -191.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -2349.666802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2349.666802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2349.666802 (E_RNA) where: Base-Base interactions energy: -1529.806 where: short stacking energy: -713.110 Base-Backbone interact. energy: 0.997 local terms energy: -820.858502 where: bonds (distance) C4'-P energy: -181.757 bonds (distance) P-C4' energy: -170.009 flat angles C4'-P-C4' energy: -184.862 flat angles P-C4'-P energy: -96.877 tors. eta vs tors. theta energy: -187.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -2101.937072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2101.937072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2101.937072 (E_RNA) where: Base-Base interactions energy: -1331.303 where: short stacking energy: -612.292 Base-Backbone interact. energy: 0.757 local terms energy: -771.390616 where: bonds (distance) C4'-P energy: -158.971 bonds (distance) P-C4' energy: -173.628 flat angles C4'-P-C4' energy: -176.815 flat angles P-C4'-P energy: -114.341 tors. eta vs tors. theta energy: -147.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -2030.149282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2030.149282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2030.149282 (E_RNA) where: Base-Base interactions energy: -1271.241 where: short stacking energy: -587.207 Base-Backbone interact. energy: -3.268 local terms energy: -755.640137 where: bonds (distance) C4'-P energy: -154.104 bonds (distance) P-C4' energy: -182.986 flat angles C4'-P-C4' energy: -167.438 flat angles P-C4'-P energy: -109.084 tors. eta vs tors. theta energy: -142.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1776.963708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1776.963708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1776.963708 (E_RNA) where: Base-Base interactions energy: -1085.407 where: short stacking energy: -558.039 Base-Backbone interact. energy: -0.016 local terms energy: -691.540465 where: bonds (distance) C4'-P energy: -146.951 bonds (distance) P-C4' energy: -164.924 flat angles C4'-P-C4' energy: -168.339 flat angles P-C4'-P energy: -101.988 tors. eta vs tors. theta energy: -109.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -1480.859198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.859198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.859198 (E_RNA) where: Base-Base interactions energy: -862.834 where: short stacking energy: -383.341 Base-Backbone interact. energy: -3.178 local terms energy: -614.847813 where: bonds (distance) C4'-P energy: -150.069 bonds (distance) P-C4' energy: -149.011 flat angles C4'-P-C4' energy: -141.368 flat angles P-C4'-P energy: -102.878 tors. eta vs tors. theta energy: -71.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -1325.834256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.834256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.834256 (E_RNA) where: Base-Base interactions energy: -758.468 where: short stacking energy: -385.538 Base-Backbone interact. energy: -2.697 local terms energy: -564.669373 where: bonds (distance) C4'-P energy: -139.652 bonds (distance) P-C4' energy: -136.600 flat angles C4'-P-C4' energy: -145.772 flat angles P-C4'-P energy: -95.882 tors. eta vs tors. theta energy: -46.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -879.026677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.026677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.026677 (E_RNA) where: Base-Base interactions energy: -394.313 where: short stacking energy: -245.562 Base-Backbone interact. energy: 13.901 local terms energy: -498.614724 where: bonds (distance) C4'-P energy: -157.717 bonds (distance) P-C4' energy: -158.274 flat angles C4'-P-C4' energy: -127.593 flat angles P-C4'-P energy: -71.392 tors. eta vs tors. theta energy: 16.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -784.780312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.780312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.780312 (E_RNA) where: Base-Base interactions energy: -361.903 where: short stacking energy: -243.325 Base-Backbone interact. energy: 1.157 local terms energy: -424.033914 where: bonds (distance) C4'-P energy: -132.507 bonds (distance) P-C4' energy: -138.881 flat angles C4'-P-C4' energy: -131.106 flat angles P-C4'-P energy: -40.700 tors. eta vs tors. theta energy: 19.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -2746.978366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2746.978366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2746.978366 (E_RNA) where: Base-Base interactions energy: -1810.267 where: short stacking energy: -797.300 Base-Backbone interact. energy: 0.042 local terms energy: -936.753524 where: bonds (distance) C4'-P energy: -179.164 bonds (distance) P-C4' energy: -189.584 flat angles C4'-P-C4' energy: -202.721 flat angles P-C4'-P energy: -131.607 tors. eta vs tors. theta energy: -233.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -2620.540138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2620.540138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2620.540138 (E_RNA) where: Base-Base interactions energy: -1745.987 where: short stacking energy: -756.922 Base-Backbone interact. energy: -2.621 local terms energy: -871.932356 where: bonds (distance) C4'-P energy: -167.379 bonds (distance) P-C4' energy: -184.471 flat angles C4'-P-C4' energy: -180.752 flat angles P-C4'-P energy: -128.795 tors. eta vs tors. theta energy: -210.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -2365.775740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2365.775740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2365.775740 (E_RNA) where: Base-Base interactions energy: -1536.662 where: short stacking energy: -763.697 Base-Backbone interact. energy: 2.460 local terms energy: -831.573272 where: bonds (distance) C4'-P energy: -164.711 bonds (distance) P-C4' energy: -179.069 flat angles C4'-P-C4' energy: -187.374 flat angles P-C4'-P energy: -109.414 tors. eta vs tors. theta energy: -191.006 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -2150.745535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2150.745535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2150.745535 (E_RNA) where: Base-Base interactions energy: -1358.818 where: short stacking energy: -620.691 Base-Backbone interact. energy: -3.861 local terms energy: -788.066288 where: bonds (distance) C4'-P energy: -165.444 bonds (distance) P-C4' energy: -166.038 flat angles C4'-P-C4' energy: -176.273 flat angles P-C4'-P energy: -119.301 tors. eta vs tors. theta energy: -161.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -2054.725038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2054.725038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2054.725038 (E_RNA) where: Base-Base interactions energy: -1333.408 where: short stacking energy: -600.583 Base-Backbone interact. energy: -3.638 local terms energy: -717.679051 where: bonds (distance) C4'-P energy: -147.963 bonds (distance) P-C4' energy: -157.448 flat angles C4'-P-C4' energy: -164.993 flat angles P-C4'-P energy: -96.306 tors. eta vs tors. theta energy: -150.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1721.604484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1721.604484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1721.604484 (E_RNA) where: Base-Base interactions energy: -1039.776 where: short stacking energy: -525.479 Base-Backbone interact. energy: 3.099 local terms energy: -684.927382 where: bonds (distance) C4'-P energy: -155.079 bonds (distance) P-C4' energy: -146.748 flat angles C4'-P-C4' energy: -181.358 flat angles P-C4'-P energy: -91.165 tors. eta vs tors. theta energy: -110.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -1491.397037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.397037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.397037 (E_RNA) where: Base-Base interactions energy: -858.327 where: short stacking energy: -428.142 Base-Backbone interact. energy: -0.811 local terms energy: -632.259368 where: bonds (distance) C4'-P energy: -152.912 bonds (distance) P-C4' energy: -157.733 flat angles C4'-P-C4' energy: -170.516 flat angles P-C4'-P energy: -91.985 tors. eta vs tors. theta energy: -59.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -1272.909518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.909518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.909518 (E_RNA) where: Base-Base interactions energy: -685.497 where: short stacking energy: -364.316 Base-Backbone interact. energy: 0.405 local terms energy: -587.817615 where: bonds (distance) C4'-P energy: -159.858 bonds (distance) P-C4' energy: -170.182 flat angles C4'-P-C4' energy: -143.765 flat angles P-C4'-P energy: -84.519 tors. eta vs tors. theta energy: -29.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -978.864206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.864206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.864206 (E_RNA) where: Base-Base interactions energy: -472.194 where: short stacking energy: -273.900 Base-Backbone interact. energy: -5.167 local terms energy: -501.503704 where: bonds (distance) C4'-P energy: -124.653 bonds (distance) P-C4' energy: -132.565 flat angles C4'-P-C4' energy: -129.859 flat angles P-C4'-P energy: -101.248 tors. eta vs tors. theta energy: -13.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -760.863255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.863255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.863255 (E_RNA) where: Base-Base interactions energy: -266.103 where: short stacking energy: -159.191 Base-Backbone interact. energy: -0.471 local terms energy: -494.289150 where: bonds (distance) C4'-P energy: -147.099 bonds (distance) P-C4' energy: -156.196 flat angles C4'-P-C4' energy: -142.903 flat angles P-C4'-P energy: -97.446 tors. eta vs tors. theta energy: 49.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -2765.691223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2765.691223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2765.691223 (E_RNA) where: Base-Base interactions energy: -1852.581 where: short stacking energy: -834.418 Base-Backbone interact. energy: -4.772 local terms energy: -908.338103 where: bonds (distance) C4'-P energy: -175.230 bonds (distance) P-C4' energy: -181.812 flat angles C4'-P-C4' energy: -199.165 flat angles P-C4'-P energy: -123.754 tors. eta vs tors. theta energy: -228.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -2571.476298 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2571.476298 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2571.476298 (E_RNA) where: Base-Base interactions energy: -1698.231 where: short stacking energy: -750.392 Base-Backbone interact. energy: -1.875 local terms energy: -871.370236 where: bonds (distance) C4'-P energy: -185.796 bonds (distance) P-C4' energy: -175.334 flat angles C4'-P-C4' energy: -193.059 flat angles P-C4'-P energy: -118.135 tors. eta vs tors. theta energy: -199.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -2383.747032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2383.747032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2383.747032 (E_RNA) where: Base-Base interactions energy: -1521.006 where: short stacking energy: -691.555 Base-Backbone interact. energy: -5.501 local terms energy: -857.239873 where: bonds (distance) C4'-P energy: -171.744 bonds (distance) P-C4' energy: -179.226 flat angles C4'-P-C4' energy: -185.283 flat angles P-C4'-P energy: -131.158 tors. eta vs tors. theta energy: -189.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -2138.273710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2138.273710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2138.273710 (E_RNA) where: Base-Base interactions energy: -1359.765 where: short stacking energy: -623.898 Base-Backbone interact. energy: -0.097 local terms energy: -778.411723 where: bonds (distance) C4'-P energy: -155.489 bonds (distance) P-C4' energy: -169.817 flat angles C4'-P-C4' energy: -196.340 flat angles P-C4'-P energy: -118.349 tors. eta vs tors. theta energy: -138.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -2196.226476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2196.226476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2196.226476 (E_RNA) where: Base-Base interactions energy: -1441.379 where: short stacking energy: -665.504 Base-Backbone interact. energy: -0.315 local terms energy: -754.532239 where: bonds (distance) C4'-P energy: -139.519 bonds (distance) P-C4' energy: -162.634 flat angles C4'-P-C4' energy: -167.665 flat angles P-C4'-P energy: -113.932 tors. eta vs tors. theta energy: -170.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1777.892233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1777.892233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1777.892233 (E_RNA) where: Base-Base interactions energy: -1064.797 where: short stacking energy: -504.856 Base-Backbone interact. energy: -6.172 local terms energy: -706.922408 where: bonds (distance) C4'-P energy: -152.537 bonds (distance) P-C4' energy: -158.846 flat angles C4'-P-C4' energy: -167.824 flat angles P-C4'-P energy: -115.950 tors. eta vs tors. theta energy: -111.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -1566.618800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1566.618800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1566.618800 (E_RNA) where: Base-Base interactions energy: -935.822 where: short stacking energy: -453.889 Base-Backbone interact. energy: -6.476 local terms energy: -624.320320 where: bonds (distance) C4'-P energy: -149.220 bonds (distance) P-C4' energy: -130.160 flat angles C4'-P-C4' energy: -158.683 flat angles P-C4'-P energy: -89.277 tors. eta vs tors. theta energy: -96.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -1217.384320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.384320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.384320 (E_RNA) where: Base-Base interactions energy: -694.133 where: short stacking energy: -382.209 Base-Backbone interact. energy: 3.779 local terms energy: -527.029726 where: bonds (distance) C4'-P energy: -138.402 bonds (distance) P-C4' energy: -161.866 flat angles C4'-P-C4' energy: -125.743 flat angles P-C4'-P energy: -53.283 tors. eta vs tors. theta energy: -47.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -1008.181677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.181677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.181677 (E_RNA) where: Base-Base interactions energy: -461.306 where: short stacking energy: -273.858 Base-Backbone interact. energy: -1.851 local terms energy: -545.024574 where: bonds (distance) C4'-P energy: -135.896 bonds (distance) P-C4' energy: -163.900 flat angles C4'-P-C4' energy: -138.539 flat angles P-C4'-P energy: -89.635 tors. eta vs tors. theta energy: -17.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -771.683945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.683945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.683945 (E_RNA) where: Base-Base interactions energy: -326.915 where: short stacking energy: -223.386 Base-Backbone interact. energy: 2.888 local terms energy: -447.656025 where: bonds (distance) C4'-P energy: -119.681 bonds (distance) P-C4' energy: -154.798 flat angles C4'-P-C4' energy: -136.931 flat angles P-C4'-P energy: -71.521 tors. eta vs tors. theta energy: 35.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -2754.762514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2754.762514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2754.762514 (E_RNA) where: Base-Base interactions energy: -1860.795 where: short stacking energy: -804.406 Base-Backbone interact. energy: -0.669 local terms energy: -893.298970 where: bonds (distance) C4'-P energy: -157.968 bonds (distance) P-C4' energy: -170.207 flat angles C4'-P-C4' energy: -197.880 flat angles P-C4'-P energy: -125.897 tors. eta vs tors. theta energy: -241.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -2590.358536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2590.358536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2590.358536 (E_RNA) where: Base-Base interactions energy: -1712.974 where: short stacking energy: -706.811 Base-Backbone interact. energy: -4.956 local terms energy: -872.428727 where: bonds (distance) C4'-P energy: -185.232 bonds (distance) P-C4' energy: -172.545 flat angles C4'-P-C4' energy: -205.726 flat angles P-C4'-P energy: -110.503 tors. eta vs tors. theta energy: -198.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -2399.914224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2399.914224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2399.914224 (E_RNA) where: Base-Base interactions energy: -1538.091 where: short stacking energy: -686.061 Base-Backbone interact. energy: -1.855 local terms energy: -859.968510 where: bonds (distance) C4'-P energy: -184.186 bonds (distance) P-C4' energy: -179.754 flat angles C4'-P-C4' energy: -175.480 flat angles P-C4'-P energy: -116.941 tors. eta vs tors. theta energy: -203.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -2274.303557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2274.303557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2274.303557 (E_RNA) where: Base-Base interactions energy: -1496.993 where: short stacking energy: -689.932 Base-Backbone interact. energy: -3.823 local terms energy: -773.487569 where: bonds (distance) C4'-P energy: -153.876 bonds (distance) P-C4' energy: -172.755 flat angles C4'-P-C4' energy: -175.229 flat angles P-C4'-P energy: -90.767 tors. eta vs tors. theta energy: -180.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -2088.218104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2088.218104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2088.218104 (E_RNA) where: Base-Base interactions energy: -1309.256 where: short stacking energy: -613.916 Base-Backbone interact. energy: 2.531 local terms energy: -781.493712 where: bonds (distance) C4'-P energy: -178.956 bonds (distance) P-C4' energy: -172.934 flat angles C4'-P-C4' energy: -182.127 flat angles P-C4'-P energy: -104.087 tors. eta vs tors. theta energy: -143.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1736.854733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1736.854733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1736.854733 (E_RNA) where: Base-Base interactions energy: -1052.321 where: short stacking energy: -488.149 Base-Backbone interact. energy: 2.702 local terms energy: -687.235975 where: bonds (distance) C4'-P energy: -149.830 bonds (distance) P-C4' energy: -173.317 flat angles C4'-P-C4' energy: -161.259 flat angles P-C4'-P energy: -95.613 tors. eta vs tors. theta energy: -107.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1543.095352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1543.095352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1543.095352 (E_RNA) where: Base-Base interactions energy: -930.455 where: short stacking energy: -437.144 Base-Backbone interact. energy: -1.550 local terms energy: -611.090399 where: bonds (distance) C4'-P energy: -151.058 bonds (distance) P-C4' energy: -140.482 flat angles C4'-P-C4' energy: -151.246 flat angles P-C4'-P energy: -93.358 tors. eta vs tors. theta energy: -74.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -1383.858650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1383.858650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1383.858650 (E_RNA) where: Base-Base interactions energy: -823.933 where: short stacking energy: -382.253 Base-Backbone interact. energy: -2.741 local terms energy: -557.184672 where: bonds (distance) C4'-P energy: -132.102 bonds (distance) P-C4' energy: -158.696 flat angles C4'-P-C4' energy: -143.716 flat angles P-C4'-P energy: -81.386 tors. eta vs tors. theta energy: -41.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -1000.059406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1000.059406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1000.059406 (E_RNA) where: Base-Base interactions energy: -481.847 where: short stacking energy: -296.813 Base-Backbone interact. energy: -0.296 local terms energy: -517.915975 where: bonds (distance) C4'-P energy: -144.737 bonds (distance) P-C4' energy: -137.596 flat angles C4'-P-C4' energy: -156.516 flat angles P-C4'-P energy: -65.632 tors. eta vs tors. theta energy: -13.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -810.378186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.378186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.378186 (E_RNA) where: Base-Base interactions energy: -348.150 where: short stacking energy: -237.389 Base-Backbone interact. energy: 4.234 local terms energy: -466.461954 where: bonds (distance) C4'-P energy: -151.516 bonds (distance) P-C4' energy: -143.127 flat angles C4'-P-C4' energy: -129.131 flat angles P-C4'-P energy: -81.270 tors. eta vs tors. theta energy: 38.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -2740.916242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2740.916242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2740.916242 (E_RNA) where: Base-Base interactions energy: -1814.451 where: short stacking energy: -805.853 Base-Backbone interact. energy: -5.834 local terms energy: -920.631767 where: bonds (distance) C4'-P energy: -166.368 bonds (distance) P-C4' energy: -191.659 flat angles C4'-P-C4' energy: -202.364 flat angles P-C4'-P energy: -129.012 tors. eta vs tors. theta energy: -231.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -2599.325566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2599.325566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2599.325566 (E_RNA) where: Base-Base interactions energy: -1704.100 where: short stacking energy: -765.826 Base-Backbone interact. energy: -3.651 local terms energy: -891.573919 where: bonds (distance) C4'-P energy: -192.239 bonds (distance) P-C4' energy: -175.991 flat angles C4'-P-C4' energy: -196.837 flat angles P-C4'-P energy: -115.059 tors. eta vs tors. theta energy: -211.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -2427.982002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2427.982002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2427.982002 (E_RNA) where: Base-Base interactions energy: -1579.327 where: short stacking energy: -715.738 Base-Backbone interact. energy: -3.767 local terms energy: -844.887573 where: bonds (distance) C4'-P energy: -158.972 bonds (distance) P-C4' energy: -172.524 flat angles C4'-P-C4' energy: -188.712 flat angles P-C4'-P energy: -130.438 tors. eta vs tors. theta energy: -194.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -2339.712269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2339.712269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2339.712269 (E_RNA) where: Base-Base interactions energy: -1528.975 where: short stacking energy: -710.938 Base-Backbone interact. energy: -4.092 local terms energy: -806.644784 where: bonds (distance) C4'-P energy: -166.932 bonds (distance) P-C4' energy: -149.743 flat angles C4'-P-C4' energy: -174.925 flat angles P-C4'-P energy: -108.423 tors. eta vs tors. theta energy: -206.621 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1994.684351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1994.684351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1994.684351 (E_RNA) where: Base-Base interactions energy: -1245.077 where: short stacking energy: -586.571 Base-Backbone interact. energy: -0.424 local terms energy: -749.183206 where: bonds (distance) C4'-P energy: -160.873 bonds (distance) P-C4' energy: -167.792 flat angles C4'-P-C4' energy: -164.953 flat angles P-C4'-P energy: -110.824 tors. eta vs tors. theta energy: -144.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1752.003567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1752.003567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1752.003567 (E_RNA) where: Base-Base interactions energy: -1074.679 where: short stacking energy: -514.537 Base-Backbone interact. energy: 2.340 local terms energy: -679.664453 where: bonds (distance) C4'-P energy: -136.513 bonds (distance) P-C4' energy: -171.747 flat angles C4'-P-C4' energy: -165.454 flat angles P-C4'-P energy: -98.364 tors. eta vs tors. theta energy: -107.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1569.838476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1569.838476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1569.838476 (E_RNA) where: Base-Base interactions energy: -936.769 where: short stacking energy: -440.539 Base-Backbone interact. energy: -7.606 local terms energy: -625.462994 where: bonds (distance) C4'-P energy: -146.085 bonds (distance) P-C4' energy: -164.157 flat angles C4'-P-C4' energy: -140.850 flat angles P-C4'-P energy: -104.477 tors. eta vs tors. theta energy: -69.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -1518.396158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1518.396158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1518.396158 (E_RNA) where: Base-Base interactions energy: -934.007 where: short stacking energy: -428.740 Base-Backbone interact. energy: 5.202 local terms energy: -589.590785 where: bonds (distance) C4'-P energy: -132.659 bonds (distance) P-C4' energy: -148.253 flat angles C4'-P-C4' energy: -151.706 flat angles P-C4'-P energy: -91.518 tors. eta vs tors. theta energy: -65.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -987.161717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.161717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.161717 (E_RNA) where: Base-Base interactions energy: -485.526 where: short stacking energy: -285.498 Base-Backbone interact. energy: -3.685 local terms energy: -497.950804 where: bonds (distance) C4'-P energy: -147.461 bonds (distance) P-C4' energy: -115.478 flat angles C4'-P-C4' energy: -126.921 flat angles P-C4'-P energy: -98.977 tors. eta vs tors. theta energy: -9.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -777.133118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.133118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.133118 (E_RNA) where: Base-Base interactions energy: -322.800 where: short stacking energy: -229.290 Base-Backbone interact. energy: 7.903 local terms energy: -462.235439 where: bonds (distance) C4'-P energy: -118.086 bonds (distance) P-C4' energy: -163.705 flat angles C4'-P-C4' energy: -132.489 flat angles P-C4'-P energy: -77.493 tors. eta vs tors. theta energy: 29.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -2760.602690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2760.602690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2760.602690 (E_RNA) where: Base-Base interactions energy: -1849.779 where: short stacking energy: -860.840 Base-Backbone interact. energy: -5.160 local terms energy: -905.663425 where: bonds (distance) C4'-P energy: -164.199 bonds (distance) P-C4' energy: -167.770 flat angles C4'-P-C4' energy: -193.366 flat angles P-C4'-P energy: -133.616 tors. eta vs tors. theta energy: -246.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -2599.922796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2599.922796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2599.922796 (E_RNA) where: Base-Base interactions energy: -1713.966 where: short stacking energy: -762.081 Base-Backbone interact. energy: -5.394 local terms energy: -880.563092 where: bonds (distance) C4'-P energy: -167.591 bonds (distance) P-C4' energy: -179.982 flat angles C4'-P-C4' energy: -208.888 flat angles P-C4'-P energy: -121.135 tors. eta vs tors. theta energy: -202.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -2352.640962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2352.640962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2352.640962 (E_RNA) where: Base-Base interactions energy: -1505.690 where: short stacking energy: -697.996 Base-Backbone interact. energy: -1.240 local terms energy: -845.710802 where: bonds (distance) C4'-P energy: -183.367 bonds (distance) P-C4' energy: -172.768 flat angles C4'-P-C4' energy: -184.681 flat angles P-C4'-P energy: -117.461 tors. eta vs tors. theta energy: -187.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -2350.821642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2350.821642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2350.821642 (E_RNA) where: Base-Base interactions energy: -1551.840 where: short stacking energy: -690.563 Base-Backbone interact. energy: -3.000 local terms energy: -795.981879 where: bonds (distance) C4'-P energy: -162.184 bonds (distance) P-C4' energy: -163.224 flat angles C4'-P-C4' energy: -182.373 flat angles P-C4'-P energy: -112.075 tors. eta vs tors. theta energy: -176.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -2017.373371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2017.373371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2017.373371 (E_RNA) where: Base-Base interactions energy: -1290.209 where: short stacking energy: -632.670 Base-Backbone interact. energy: -2.427 local terms energy: -724.738072 where: bonds (distance) C4'-P energy: -138.966 bonds (distance) P-C4' energy: -147.493 flat angles C4'-P-C4' energy: -179.161 flat angles P-C4'-P energy: -109.540 tors. eta vs tors. theta energy: -149.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1766.745344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1766.745344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1766.745344 (E_RNA) where: Base-Base interactions energy: -1057.105 where: short stacking energy: -494.519 Base-Backbone interact. energy: -3.680 local terms energy: -705.960058 where: bonds (distance) C4'-P energy: -172.629 bonds (distance) P-C4' energy: -168.226 flat angles C4'-P-C4' energy: -163.447 flat angles P-C4'-P energy: -92.272 tors. eta vs tors. theta energy: -109.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1589.319734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1589.319734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1589.319734 (E_RNA) where: Base-Base interactions energy: -978.830 where: short stacking energy: -471.549 Base-Backbone interact. energy: -3.908 local terms energy: -606.581181 where: bonds (distance) C4'-P energy: -141.131 bonds (distance) P-C4' energy: -136.741 flat angles C4'-P-C4' energy: -153.017 flat angles P-C4'-P energy: -95.333 tors. eta vs tors. theta energy: -80.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -1480.614358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1480.614358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.614358 (E_RNA) where: Base-Base interactions energy: -872.687 where: short stacking energy: -400.821 Base-Backbone interact. energy: -2.920 local terms energy: -605.006752 where: bonds (distance) C4'-P energy: -138.994 bonds (distance) P-C4' energy: -157.664 flat angles C4'-P-C4' energy: -161.325 flat angles P-C4'-P energy: -91.035 tors. eta vs tors. theta energy: -55.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -990.763755 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -990.763755 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -990.763755 (E_RNA) where: Base-Base interactions energy: -492.032 where: short stacking energy: -275.627 Base-Backbone interact. energy: 3.569 local terms energy: -502.300664 where: bonds (distance) C4'-P energy: -147.737 bonds (distance) P-C4' energy: -142.594 flat angles C4'-P-C4' energy: -146.281 flat angles P-C4'-P energy: -74.485 tors. eta vs tors. theta energy: 8.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -730.551699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.551699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.551699 (E_RNA) where: Base-Base interactions energy: -312.708 where: short stacking energy: -218.017 Base-Backbone interact. energy: 11.506 local terms energy: -429.349467 where: bonds (distance) C4'-P energy: -113.710 bonds (distance) P-C4' energy: -139.992 flat angles C4'-P-C4' energy: -123.771 flat angles P-C4'-P energy: -59.791 tors. eta vs tors. theta energy: 7.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -2775.755504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2775.755504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2775.755504 (E_RNA) where: Base-Base interactions energy: -1825.577 where: short stacking energy: -835.319 Base-Backbone interact. energy: -1.593 local terms energy: -948.585104 where: bonds (distance) C4'-P energy: -182.552 bonds (distance) P-C4' energy: -178.295 flat angles C4'-P-C4' energy: -204.903 flat angles P-C4'-P energy: -141.649 tors. eta vs tors. theta energy: -241.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -2610.877761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2610.877761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2610.877761 (E_RNA) where: Base-Base interactions energy: -1754.167 where: short stacking energy: -757.599 Base-Backbone interact. energy: -5.057 local terms energy: -851.654369 where: bonds (distance) C4'-P energy: -175.453 bonds (distance) P-C4' energy: -172.327 flat angles C4'-P-C4' energy: -196.806 flat angles P-C4'-P energy: -95.490 tors. eta vs tors. theta energy: -211.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -2508.134596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2508.134596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2508.134596 (E_RNA) where: Base-Base interactions energy: -1666.723 where: short stacking energy: -736.007 Base-Backbone interact. energy: -2.217 local terms energy: -839.195168 where: bonds (distance) C4'-P energy: -165.806 bonds (distance) P-C4' energy: -178.164 flat angles C4'-P-C4' energy: -175.036 flat angles P-C4'-P energy: -119.790 tors. eta vs tors. theta energy: -200.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -2324.434585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2324.434585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2324.434585 (E_RNA) where: Base-Base interactions energy: -1482.540 where: short stacking energy: -696.200 Base-Backbone interact. energy: 1.264 local terms energy: -843.159010 where: bonds (distance) C4'-P energy: -147.676 bonds (distance) P-C4' energy: -168.518 flat angles C4'-P-C4' energy: -185.807 flat angles P-C4'-P energy: -139.929 tors. eta vs tors. theta energy: -201.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -2006.183295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2006.183295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2006.183295 (E_RNA) where: Base-Base interactions energy: -1237.354 where: short stacking energy: -589.574 Base-Backbone interact. energy: -1.511 local terms energy: -767.318791 where: bonds (distance) C4'-P energy: -142.688 bonds (distance) P-C4' energy: -185.343 flat angles C4'-P-C4' energy: -179.822 flat angles P-C4'-P energy: -112.256 tors. eta vs tors. theta energy: -147.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1853.616439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1853.616439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1853.616439 (E_RNA) where: Base-Base interactions energy: -1154.766 where: short stacking energy: -538.647 Base-Backbone interact. energy: -1.593 local terms energy: -697.258101 where: bonds (distance) C4'-P energy: -159.609 bonds (distance) P-C4' energy: -164.515 flat angles C4'-P-C4' energy: -156.963 flat angles P-C4'-P energy: -101.525 tors. eta vs tors. theta energy: -114.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1568.960414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1568.960414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1568.960414 (E_RNA) where: Base-Base interactions energy: -904.786 where: short stacking energy: -445.096 Base-Backbone interact. energy: 7.611 local terms energy: -671.785087 where: bonds (distance) C4'-P energy: -173.882 bonds (distance) P-C4' energy: -146.008 flat angles C4'-P-C4' energy: -151.333 flat angles P-C4'-P energy: -102.507 tors. eta vs tors. theta energy: -98.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -1491.362497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1491.362497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1491.362497 (E_RNA) where: Base-Base interactions energy: -916.980 where: short stacking energy: -444.432 Base-Backbone interact. energy: -0.625 local terms energy: -573.757397 where: bonds (distance) C4'-P energy: -140.532 bonds (distance) P-C4' energy: -128.233 flat angles C4'-P-C4' energy: -152.028 flat angles P-C4'-P energy: -83.032 tors. eta vs tors. theta energy: -69.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -1057.594462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1057.594462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1057.594462 (E_RNA) where: Base-Base interactions energy: -525.881 where: short stacking energy: -302.085 Base-Backbone interact. energy: -0.403 local terms energy: -531.311000 where: bonds (distance) C4'-P energy: -134.291 bonds (distance) P-C4' energy: -159.302 flat angles C4'-P-C4' energy: -144.070 flat angles P-C4'-P energy: -79.253 tors. eta vs tors. theta energy: -14.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -711.440462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -711.440462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -711.440462 (E_RNA) where: Base-Base interactions energy: -315.909 where: short stacking energy: -222.067 Base-Backbone interact. energy: -0.865 local terms energy: -394.666761 where: bonds (distance) C4'-P energy: -139.038 bonds (distance) P-C4' energy: -128.402 flat angles C4'-P-C4' energy: -124.991 flat angles P-C4'-P energy: -51.364 tors. eta vs tors. theta energy: 49.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -2757.385181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2757.385181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2757.385181 (E_RNA) where: Base-Base interactions energy: -1833.291 where: short stacking energy: -813.287 Base-Backbone interact. energy: -6.073 local terms energy: -918.021159 where: bonds (distance) C4'-P energy: -175.033 bonds (distance) P-C4' energy: -169.811 flat angles C4'-P-C4' energy: -203.707 flat angles P-C4'-P energy: -129.891 tors. eta vs tors. theta energy: -239.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -2641.518106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2641.518106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2641.518106 (E_RNA) where: Base-Base interactions energy: -1757.436 where: short stacking energy: -781.370 Base-Backbone interact. energy: -4.362 local terms energy: -879.720485 where: bonds (distance) C4'-P energy: -182.484 bonds (distance) P-C4' energy: -174.599 flat angles C4'-P-C4' energy: -193.071 flat angles P-C4'-P energy: -122.412 tors. eta vs tors. theta energy: -207.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -2561.538966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2561.538966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2561.538966 (E_RNA) where: Base-Base interactions energy: -1683.010 where: short stacking energy: -773.811 Base-Backbone interact. energy: 1.331 local terms energy: -879.859194 where: bonds (distance) C4'-P energy: -173.309 bonds (distance) P-C4' energy: -185.227 flat angles C4'-P-C4' energy: -193.183 flat angles P-C4'-P energy: -99.848 tors. eta vs tors. theta energy: -228.292 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -2311.415717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2311.415717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.415717 (E_RNA) where: Base-Base interactions energy: -1471.749 where: short stacking energy: -689.040 Base-Backbone interact. energy: 0.698 local terms energy: -840.363995 where: bonds (distance) C4'-P energy: -175.095 bonds (distance) P-C4' energy: -178.714 flat angles C4'-P-C4' energy: -190.007 flat angles P-C4'-P energy: -109.186 tors. eta vs tors. theta energy: -187.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1882.109621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1882.109621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1882.109621 (E_RNA) where: Base-Base interactions energy: -1157.043 where: short stacking energy: -529.522 Base-Backbone interact. energy: 2.498 local terms energy: -727.564589 where: bonds (distance) C4'-P energy: -170.226 bonds (distance) P-C4' energy: -168.046 flat angles C4'-P-C4' energy: -160.867 flat angles P-C4'-P energy: -101.310 tors. eta vs tors. theta energy: -127.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1741.148157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1741.148157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.148157 (E_RNA) where: Base-Base interactions energy: -1032.208 where: short stacking energy: -515.905 Base-Backbone interact. energy: 2.124 local terms energy: -711.063925 where: bonds (distance) C4'-P energy: -158.303 bonds (distance) P-C4' energy: -173.639 flat angles C4'-P-C4' energy: -164.511 flat angles P-C4'-P energy: -116.312 tors. eta vs tors. theta energy: -98.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -1573.687190 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.687190 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1573.687190 (E_RNA) where: Base-Base interactions energy: -919.369 where: short stacking energy: -458.861 Base-Backbone interact. energy: 2.404 local terms energy: -656.722030 where: bonds (distance) C4'-P energy: -158.337 bonds (distance) P-C4' energy: -165.048 flat angles C4'-P-C4' energy: -145.487 flat angles P-C4'-P energy: -98.593 tors. eta vs tors. theta energy: -89.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -1419.344583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1419.344583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1419.344583 (E_RNA) where: Base-Base interactions energy: -807.873 where: short stacking energy: -362.739 Base-Backbone interact. energy: 9.060 local terms energy: -620.531762 where: bonds (distance) C4'-P energy: -159.597 bonds (distance) P-C4' energy: -162.888 flat angles C4'-P-C4' energy: -142.011 flat angles P-C4'-P energy: -105.507 tors. eta vs tors. theta energy: -50.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -975.665375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -975.665375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -975.665375 (E_RNA) where: Base-Base interactions energy: -507.047 where: short stacking energy: -270.964 Base-Backbone interact. energy: 5.149 local terms energy: -473.767089 where: bonds (distance) C4'-P energy: -130.792 bonds (distance) P-C4' energy: -157.836 flat angles C4'-P-C4' energy: -119.212 flat angles P-C4'-P energy: -73.349 tors. eta vs tors. theta energy: 7.421 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -762.158947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.158947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.158947 (E_RNA) where: Base-Base interactions energy: -304.731 where: short stacking energy: -220.659 Base-Backbone interact. energy: -0.725 local terms energy: -456.703587 where: bonds (distance) C4'-P energy: -116.714 bonds (distance) P-C4' energy: -161.764 flat angles C4'-P-C4' energy: -151.214 flat angles P-C4'-P energy: -40.110 tors. eta vs tors. theta energy: 13.098 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -2734.035768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2734.035768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2734.035768 (E_RNA) where: Base-Base interactions energy: -1812.403 where: short stacking energy: -822.302 Base-Backbone interact. energy: -6.800 local terms energy: -914.832990 where: bonds (distance) C4'-P energy: -172.622 bonds (distance) P-C4' energy: -184.466 flat angles C4'-P-C4' energy: -191.320 flat angles P-C4'-P energy: -129.356 tors. eta vs tors. theta energy: -237.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -2607.958101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2607.958101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2607.958101 (E_RNA) where: Base-Base interactions energy: -1708.101 where: short stacking energy: -738.476 Base-Backbone interact. energy: -6.689 local terms energy: -893.167867 where: bonds (distance) C4'-P energy: -180.675 bonds (distance) P-C4' energy: -184.215 flat angles C4'-P-C4' energy: -203.314 flat angles P-C4'-P energy: -123.504 tors. eta vs tors. theta energy: -201.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -2558.192947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2558.192947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2558.192947 (E_RNA) where: Base-Base interactions energy: -1659.043 where: short stacking energy: -757.122 Base-Backbone interact. energy: -6.104 local terms energy: -893.045542 where: bonds (distance) C4'-P energy: -164.138 bonds (distance) P-C4' energy: -181.803 flat angles C4'-P-C4' energy: -194.778 flat angles P-C4'-P energy: -125.300 tors. eta vs tors. theta energy: -227.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -2259.081694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2259.081694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2259.081694 (E_RNA) where: Base-Base interactions energy: -1441.799 where: short stacking energy: -679.802 Base-Backbone interact. energy: 1.735 local terms energy: -819.017857 where: bonds (distance) C4'-P energy: -148.908 bonds (distance) P-C4' energy: -176.850 flat angles C4'-P-C4' energy: -182.724 flat angles P-C4'-P energy: -133.002 tors. eta vs tors. theta energy: -177.535 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1975.703527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1975.703527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1975.703527 (E_RNA) where: Base-Base interactions energy: -1257.225 where: short stacking energy: -593.358 Base-Backbone interact. energy: 0.606 local terms energy: -719.084251 where: bonds (distance) C4'-P energy: -157.551 bonds (distance) P-C4' energy: -166.216 flat angles C4'-P-C4' energy: -152.715 flat angles P-C4'-P energy: -96.146 tors. eta vs tors. theta energy: -146.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1688.215200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1688.215200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1688.215200 (E_RNA) where: Base-Base interactions energy: -986.624 where: short stacking energy: -508.835 Base-Backbone interact. energy: 0.747 local terms energy: -702.338795 where: bonds (distance) C4'-P energy: -156.224 bonds (distance) P-C4' energy: -177.799 flat angles C4'-P-C4' energy: -166.294 flat angles P-C4'-P energy: -105.085 tors. eta vs tors. theta energy: -96.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -1576.697002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1576.697002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1576.697002 (E_RNA) where: Base-Base interactions energy: -947.864 where: short stacking energy: -445.410 Base-Backbone interact. energy: -0.172 local terms energy: -628.660940 where: bonds (distance) C4'-P energy: -147.143 bonds (distance) P-C4' energy: -169.998 flat angles C4'-P-C4' energy: -135.589 flat angles P-C4'-P energy: -90.754 tors. eta vs tors. theta energy: -85.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1304.326226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.326226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1304.326226 (E_RNA) where: Base-Base interactions energy: -743.309 where: short stacking energy: -347.871 Base-Backbone interact. energy: 1.709 local terms energy: -562.726294 where: bonds (distance) C4'-P energy: -150.449 bonds (distance) P-C4' energy: -146.428 flat angles C4'-P-C4' energy: -153.065 flat angles P-C4'-P energy: -85.201 tors. eta vs tors. theta energy: -27.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -1022.928295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1022.928295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1022.928295 (E_RNA) where: Base-Base interactions energy: -535.743 where: short stacking energy: -297.381 Base-Backbone interact. energy: 0.710 local terms energy: -487.894892 where: bonds (distance) C4'-P energy: -128.329 bonds (distance) P-C4' energy: -143.278 flat angles C4'-P-C4' energy: -113.926 flat angles P-C4'-P energy: -86.501 tors. eta vs tors. theta energy: -15.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -751.928785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -751.928785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -751.928785 (E_RNA) where: Base-Base interactions energy: -304.636 where: short stacking energy: -201.699 Base-Backbone interact. energy: -3.508 local terms energy: -443.785044 where: bonds (distance) C4'-P energy: -120.699 bonds (distance) P-C4' energy: -154.583 flat angles C4'-P-C4' energy: -119.447 flat angles P-C4'-P energy: -79.291 tors. eta vs tors. theta energy: 30.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -2758.651558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2758.651558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2758.651558 (E_RNA) where: Base-Base interactions energy: -1824.643 where: short stacking energy: -846.366 Base-Backbone interact. energy: -3.192 local terms energy: -930.817418 where: bonds (distance) C4'-P energy: -176.618 bonds (distance) P-C4' energy: -200.124 flat angles C4'-P-C4' energy: -193.243 flat angles P-C4'-P energy: -115.620 tors. eta vs tors. theta energy: -245.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -2620.546213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2620.546213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2620.546213 (E_RNA) where: Base-Base interactions energy: -1769.987 where: short stacking energy: -775.906 Base-Backbone interact. energy: -4.476 local terms energy: -846.083541 where: bonds (distance) C4'-P energy: -177.101 bonds (distance) P-C4' energy: -155.346 flat angles C4'-P-C4' energy: -186.740 flat angles P-C4'-P energy: -116.529 tors. eta vs tors. theta energy: -210.367 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -2593.989683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2593.989683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2593.989683 (E_RNA) where: Base-Base interactions energy: -1722.498 where: short stacking energy: -761.943 Base-Backbone interact. energy: 1.057 local terms energy: -872.548510 where: bonds (distance) C4'-P energy: -147.475 bonds (distance) P-C4' energy: -171.358 flat angles C4'-P-C4' energy: -193.568 flat angles P-C4'-P energy: -129.035 tors. eta vs tors. theta energy: -231.112 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -2252.173794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2252.173794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2252.173794 (E_RNA) where: Base-Base interactions energy: -1432.671 where: short stacking energy: -653.753 Base-Backbone interact. energy: -1.315 local terms energy: -818.188380 where: bonds (distance) C4'-P energy: -177.749 bonds (distance) P-C4' energy: -171.515 flat angles C4'-P-C4' energy: -188.124 flat angles P-C4'-P energy: -125.579 tors. eta vs tors. theta energy: -155.221 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -2002.567648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2002.567648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2002.567648 (E_RNA) where: Base-Base interactions energy: -1290.250 where: short stacking energy: -586.602 Base-Backbone interact. energy: -1.976 local terms energy: -710.341654 where: bonds (distance) C4'-P energy: -133.751 bonds (distance) P-C4' energy: -169.889 flat angles C4'-P-C4' energy: -170.682 flat angles P-C4'-P energy: -108.591 tors. eta vs tors. theta energy: -127.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1772.864847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1772.864847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1772.864847 (E_RNA) where: Base-Base interactions energy: -1101.226 where: short stacking energy: -553.743 Base-Backbone interact. energy: -1.191 local terms energy: -670.447236 where: bonds (distance) C4'-P energy: -146.647 bonds (distance) P-C4' energy: -139.738 flat angles C4'-P-C4' energy: -179.844 flat angles P-C4'-P energy: -93.404 tors. eta vs tors. theta energy: -110.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -1602.067596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1602.067596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1602.067596 (E_RNA) where: Base-Base interactions energy: -945.332 where: short stacking energy: -458.569 Base-Backbone interact. energy: 0.475 local terms energy: -657.209797 where: bonds (distance) C4'-P energy: -142.963 bonds (distance) P-C4' energy: -180.480 flat angles C4'-P-C4' energy: -157.961 flat angles P-C4'-P energy: -88.767 tors. eta vs tors. theta energy: -87.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -1356.603106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.603106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.603106 (E_RNA) where: Base-Base interactions energy: -790.420 where: short stacking energy: -376.860 Base-Backbone interact. energy: -1.361 local terms energy: -564.822601 where: bonds (distance) C4'-P energy: -132.121 bonds (distance) P-C4' energy: -174.273 flat angles C4'-P-C4' energy: -114.299 flat angles P-C4'-P energy: -85.960 tors. eta vs tors. theta energy: -58.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -1053.073473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.073473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.073473 (E_RNA) where: Base-Base interactions energy: -558.870 where: short stacking energy: -290.407 Base-Backbone interact. energy: -3.966 local terms energy: -490.237769 where: bonds (distance) C4'-P energy: -134.731 bonds (distance) P-C4' energy: -124.864 flat angles C4'-P-C4' energy: -143.200 flat angles P-C4'-P energy: -78.096 tors. eta vs tors. theta energy: -9.347 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -729.413019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.413019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.413019 (E_RNA) where: Base-Base interactions energy: -310.748 where: short stacking energy: -230.908 Base-Backbone interact. energy: 6.075 local terms energy: -424.740248 where: bonds (distance) C4'-P energy: -132.910 bonds (distance) P-C4' energy: -140.340 flat angles C4'-P-C4' energy: -103.563 flat angles P-C4'-P energy: -70.796 tors. eta vs tors. theta energy: 22.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -2762.134589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2762.134589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2762.134589 (E_RNA) where: Base-Base interactions energy: -1837.452 where: short stacking energy: -841.742 Base-Backbone interact. energy: -3.965 local terms energy: -920.717935 where: bonds (distance) C4'-P energy: -172.818 bonds (distance) P-C4' energy: -182.644 flat angles C4'-P-C4' energy: -201.239 flat angles P-C4'-P energy: -127.929 tors. eta vs tors. theta energy: -236.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -2625.408754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2625.408754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2625.408754 (E_RNA) where: Base-Base interactions energy: -1753.652 where: short stacking energy: -761.534 Base-Backbone interact. energy: -3.116 local terms energy: -868.641178 where: bonds (distance) C4'-P energy: -170.358 bonds (distance) P-C4' energy: -183.911 flat angles C4'-P-C4' energy: -183.960 flat angles P-C4'-P energy: -120.946 tors. eta vs tors. theta energy: -209.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -2591.893166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2591.893166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2591.893166 (E_RNA) where: Base-Base interactions energy: -1731.331 where: short stacking energy: -751.645 Base-Backbone interact. energy: -4.065 local terms energy: -856.497659 where: bonds (distance) C4'-P energy: -167.217 bonds (distance) P-C4' energy: -157.493 flat angles C4'-P-C4' energy: -185.739 flat angles P-C4'-P energy: -112.307 tors. eta vs tors. theta energy: -233.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -2257.009948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2257.009948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2257.009948 (E_RNA) where: Base-Base interactions energy: -1438.276 where: short stacking energy: -652.698 Base-Backbone interact. energy: -3.470 local terms energy: -815.263773 where: bonds (distance) C4'-P energy: -154.387 bonds (distance) P-C4' energy: -182.418 flat angles C4'-P-C4' energy: -182.496 flat angles P-C4'-P energy: -123.625 tors. eta vs tors. theta energy: -172.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1993.005903 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1993.005903 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1993.005903 (E_RNA) where: Base-Base interactions energy: -1262.830 where: short stacking energy: -604.618 Base-Backbone interact. energy: -5.254 local terms energy: -724.921574 where: bonds (distance) C4'-P energy: -150.305 bonds (distance) P-C4' energy: -161.991 flat angles C4'-P-C4' energy: -177.420 flat angles P-C4'-P energy: -95.454 tors. eta vs tors. theta energy: -139.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1784.686460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1784.686460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1784.686460 (E_RNA) where: Base-Base interactions energy: -1057.766 where: short stacking energy: -531.462 Base-Backbone interact. energy: -2.934 local terms energy: -723.986404 where: bonds (distance) C4'-P energy: -172.182 bonds (distance) P-C4' energy: -175.465 flat angles C4'-P-C4' energy: -161.236 flat angles P-C4'-P energy: -95.525 tors. eta vs tors. theta energy: -119.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1657.920654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.920654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.920654 (E_RNA) where: Base-Base interactions energy: -1018.089 where: short stacking energy: -456.918 Base-Backbone interact. energy: 4.554 local terms energy: -644.385183 where: bonds (distance) C4'-P energy: -128.050 bonds (distance) P-C4' energy: -148.146 flat angles C4'-P-C4' energy: -172.638 flat angles P-C4'-P energy: -90.025 tors. eta vs tors. theta energy: -105.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -1303.893801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.893801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.893801 (E_RNA) where: Base-Base interactions energy: -736.424 where: short stacking energy: -374.219 Base-Backbone interact. energy: 1.529 local terms energy: -568.998925 where: bonds (distance) C4'-P energy: -137.945 bonds (distance) P-C4' energy: -159.262 flat angles C4'-P-C4' energy: -141.523 flat angles P-C4'-P energy: -91.942 tors. eta vs tors. theta energy: -38.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -1031.943460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.943460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.943460 (E_RNA) where: Base-Base interactions energy: -521.434 where: short stacking energy: -280.701 Base-Backbone interact. energy: 5.444 local terms energy: -515.953663 where: bonds (distance) C4'-P energy: -149.726 bonds (distance) P-C4' energy: -159.016 flat angles C4'-P-C4' energy: -132.224 flat angles P-C4'-P energy: -69.619 tors. eta vs tors. theta energy: -5.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -765.865356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.865356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.865356 (E_RNA) where: Base-Base interactions energy: -335.005 where: short stacking energy: -189.706 Base-Backbone interact. energy: 3.678 local terms energy: -434.537430 where: bonds (distance) C4'-P energy: -143.686 bonds (distance) P-C4' energy: -156.618 flat angles C4'-P-C4' energy: -104.469 flat angles P-C4'-P energy: -74.256 tors. eta vs tors. theta energy: 44.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -2746.218163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2746.218163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2746.218163 (E_RNA) where: Base-Base interactions energy: -1809.356 where: short stacking energy: -826.274 Base-Backbone interact. energy: -2.575 local terms energy: -934.286583 where: bonds (distance) C4'-P energy: -189.748 bonds (distance) P-C4' energy: -180.117 flat angles C4'-P-C4' energy: -191.184 flat angles P-C4'-P energy: -134.941 tors. eta vs tors. theta energy: -238.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -2712.080274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2712.080274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2712.080274 (E_RNA) where: Base-Base interactions energy: -1811.720 where: short stacking energy: -803.643 Base-Backbone interact. energy: -1.169 local terms energy: -899.191021 where: bonds (distance) C4'-P energy: -168.643 bonds (distance) P-C4' energy: -182.491 flat angles C4'-P-C4' energy: -198.623 flat angles P-C4'-P energy: -126.711 tors. eta vs tors. theta energy: -222.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -2520.186468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2520.186468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2520.186468 (E_RNA) where: Base-Base interactions energy: -1691.283 where: short stacking energy: -718.641 Base-Backbone interact. energy: -2.794 local terms energy: -826.110187 where: bonds (distance) C4'-P energy: -165.114 bonds (distance) P-C4' energy: -178.340 flat angles C4'-P-C4' energy: -179.484 flat angles P-C4'-P energy: -110.563 tors. eta vs tors. theta energy: -192.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -2305.938953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2305.938953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2305.938953 (E_RNA) where: Base-Base interactions energy: -1487.835 where: short stacking energy: -679.313 Base-Backbone interact. energy: 2.384 local terms energy: -820.487622 where: bonds (distance) C4'-P energy: -157.341 bonds (distance) P-C4' energy: -166.358 flat angles C4'-P-C4' energy: -193.716 flat angles P-C4'-P energy: -116.319 tors. eta vs tors. theta energy: -186.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -2000.826077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2000.826077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2000.826077 (E_RNA) where: Base-Base interactions energy: -1280.160 where: short stacking energy: -605.517 Base-Backbone interact. energy: -3.707 local terms energy: -716.959658 where: bonds (distance) C4'-P energy: -161.090 bonds (distance) P-C4' energy: -149.742 flat angles C4'-P-C4' energy: -172.813 flat angles P-C4'-P energy: -90.834 tors. eta vs tors. theta energy: -142.479 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1747.350568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1747.350568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1747.350568 (E_RNA) where: Base-Base interactions energy: -1040.093 where: short stacking energy: -485.650 Base-Backbone interact. energy: -1.681 local terms energy: -705.576632 where: bonds (distance) C4'-P energy: -156.375 bonds (distance) P-C4' energy: -173.610 flat angles C4'-P-C4' energy: -154.456 flat angles P-C4'-P energy: -118.074 tors. eta vs tors. theta energy: -103.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1728.506504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.506504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.506504 (E_RNA) where: Base-Base interactions energy: -1034.576 where: short stacking energy: -508.316 Base-Backbone interact. energy: -0.034 local terms energy: -693.896392 where: bonds (distance) C4'-P energy: -161.558 bonds (distance) P-C4' energy: -149.317 flat angles C4'-P-C4' energy: -175.082 flat angles P-C4'-P energy: -101.159 tors. eta vs tors. theta energy: -106.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -1344.925928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.925928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.925928 (E_RNA) where: Base-Base interactions energy: -769.533 where: short stacking energy: -375.061 Base-Backbone interact. energy: -1.897 local terms energy: -573.496089 where: bonds (distance) C4'-P energy: -151.652 bonds (distance) P-C4' energy: -135.684 flat angles C4'-P-C4' energy: -158.897 flat angles P-C4'-P energy: -89.291 tors. eta vs tors. theta energy: -37.972 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -1080.346940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1080.346940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.346940 (E_RNA) where: Base-Base interactions energy: -587.719 where: short stacking energy: -300.882 Base-Backbone interact. energy: 0.825 local terms energy: -493.453172 where: bonds (distance) C4'-P energy: -147.628 bonds (distance) P-C4' energy: -147.202 flat angles C4'-P-C4' energy: -143.253 flat angles P-C4'-P energy: -54.108 tors. eta vs tors. theta energy: -1.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -755.139202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.139202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.139202 (E_RNA) where: Base-Base interactions energy: -278.097 where: short stacking energy: -206.011 Base-Backbone interact. energy: -4.763 local terms energy: -472.279132 where: bonds (distance) C4'-P energy: -141.497 bonds (distance) P-C4' energy: -153.910 flat angles C4'-P-C4' energy: -135.848 flat angles P-C4'-P energy: -74.181 tors. eta vs tors. theta energy: 33.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -2795.130363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2795.130363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2795.130363 (E_RNA) where: Base-Base interactions energy: -1851.768 where: short stacking energy: -801.754 Base-Backbone interact. energy: -5.500 local terms energy: -937.862288 where: bonds (distance) C4'-P energy: -182.249 bonds (distance) P-C4' energy: -194.323 flat angles C4'-P-C4' energy: -203.958 flat angles P-C4'-P energy: -132.112 tors. eta vs tors. theta energy: -225.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -2767.255844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2767.255844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2767.255844 (E_RNA) where: Base-Base interactions energy: -1857.841 where: short stacking energy: -820.464 Base-Backbone interact. energy: -0.011 local terms energy: -909.403691 where: bonds (distance) C4'-P energy: -186.381 bonds (distance) P-C4' energy: -181.996 flat angles C4'-P-C4' energy: -193.687 flat angles P-C4'-P energy: -114.470 tors. eta vs tors. theta energy: -232.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -2561.454233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2561.454233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2561.454233 (E_RNA) where: Base-Base interactions energy: -1714.566 where: short stacking energy: -706.865 Base-Backbone interact. energy: -3.960 local terms energy: -842.927612 where: bonds (distance) C4'-P energy: -182.595 bonds (distance) P-C4' energy: -176.270 flat angles C4'-P-C4' energy: -174.395 flat angles P-C4'-P energy: -118.433 tors. eta vs tors. theta energy: -191.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -2301.967120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2301.967120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2301.967120 (E_RNA) where: Base-Base interactions energy: -1479.087 where: short stacking energy: -684.690 Base-Backbone interact. energy: -1.386 local terms energy: -821.494597 where: bonds (distance) C4'-P energy: -162.183 bonds (distance) P-C4' energy: -173.508 flat angles C4'-P-C4' energy: -187.998 flat angles P-C4'-P energy: -113.979 tors. eta vs tors. theta energy: -183.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1975.966578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1975.966578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1975.966578 (E_RNA) where: Base-Base interactions energy: -1234.175 where: short stacking energy: -565.717 Base-Backbone interact. energy: 0.340 local terms energy: -742.131785 where: bonds (distance) C4'-P energy: -157.857 bonds (distance) P-C4' energy: -179.115 flat angles C4'-P-C4' energy: -170.517 flat angles P-C4'-P energy: -115.204 tors. eta vs tors. theta energy: -119.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1727.315502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1727.315502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1727.315502 (E_RNA) where: Base-Base interactions energy: -1045.536 where: short stacking energy: -533.213 Base-Backbone interact. energy: 3.200 local terms energy: -684.978799 where: bonds (distance) C4'-P energy: -154.429 bonds (distance) P-C4' energy: -155.193 flat angles C4'-P-C4' energy: -167.222 flat angles P-C4'-P energy: -89.969 tors. eta vs tors. theta energy: -118.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1682.191953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1682.191953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1682.191953 (E_RNA) where: Base-Base interactions energy: -1028.606 where: short stacking energy: -503.427 Base-Backbone interact. energy: -2.072 local terms energy: -651.513607 where: bonds (distance) C4'-P energy: -140.353 bonds (distance) P-C4' energy: -153.408 flat angles C4'-P-C4' energy: -152.854 flat angles P-C4'-P energy: -102.387 tors. eta vs tors. theta energy: -102.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -1342.659720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1342.659720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1342.659720 (E_RNA) where: Base-Base interactions energy: -777.520 where: short stacking energy: -392.938 Base-Backbone interact. energy: 12.593 local terms energy: -577.732961 where: bonds (distance) C4'-P energy: -137.163 bonds (distance) P-C4' energy: -161.470 flat angles C4'-P-C4' energy: -138.227 flat angles P-C4'-P energy: -84.086 tors. eta vs tors. theta energy: -56.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -1128.182884 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1128.182884 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1128.182884 (E_RNA) where: Base-Base interactions energy: -642.154 where: short stacking energy: -318.674 Base-Backbone interact. energy: 1.474 local terms energy: -487.503510 where: bonds (distance) C4'-P energy: -157.373 bonds (distance) P-C4' energy: -147.097 flat angles C4'-P-C4' energy: -101.652 flat angles P-C4'-P energy: -58.606 tors. eta vs tors. theta energy: -22.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -759.511527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.511527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.511527 (E_RNA) where: Base-Base interactions energy: -314.734 where: short stacking energy: -225.799 Base-Backbone interact. energy: 4.091 local terms energy: -448.868234 where: bonds (distance) C4'-P energy: -144.047 bonds (distance) P-C4' energy: -146.844 flat angles C4'-P-C4' energy: -103.737 flat angles P-C4'-P energy: -72.224 tors. eta vs tors. theta energy: 17.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -2770.013728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2770.013728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2770.013728 (E_RNA) where: Base-Base interactions energy: -1874.353 where: short stacking energy: -786.104 Base-Backbone interact. energy: -5.333 local terms energy: -890.327811 where: bonds (distance) C4'-P energy: -163.092 bonds (distance) P-C4' energy: -185.084 flat angles C4'-P-C4' energy: -186.960 flat angles P-C4'-P energy: -137.026 tors. eta vs tors. theta energy: -218.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -2768.197101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2768.197101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2768.197101 (E_RNA) where: Base-Base interactions energy: -1874.491 where: short stacking energy: -813.427 Base-Backbone interact. energy: -2.334 local terms energy: -891.372247 where: bonds (distance) C4'-P energy: -159.913 bonds (distance) P-C4' energy: -169.746 flat angles C4'-P-C4' energy: -193.080 flat angles P-C4'-P energy: -132.022 tors. eta vs tors. theta energy: -236.612 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -2536.600417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2536.600417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2536.600417 (E_RNA) where: Base-Base interactions energy: -1681.746 where: short stacking energy: -718.327 Base-Backbone interact. energy: -2.934 local terms energy: -851.920298 where: bonds (distance) C4'-P energy: -169.432 bonds (distance) P-C4' energy: -180.028 flat angles C4'-P-C4' energy: -191.066 flat angles P-C4'-P energy: -122.505 tors. eta vs tors. theta energy: -188.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -2311.786894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2311.786894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2311.786894 (E_RNA) where: Base-Base interactions energy: -1486.753 where: short stacking energy: -699.561 Base-Backbone interact. energy: 1.581 local terms energy: -826.614957 where: bonds (distance) C4'-P energy: -165.555 bonds (distance) P-C4' energy: -184.413 flat angles C4'-P-C4' energy: -183.478 flat angles P-C4'-P energy: -119.094 tors. eta vs tors. theta energy: -174.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1959.484422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1959.484422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1959.484422 (E_RNA) where: Base-Base interactions energy: -1227.957 where: short stacking energy: -559.084 Base-Backbone interact. energy: -4.062 local terms energy: -727.466015 where: bonds (distance) C4'-P energy: -137.859 bonds (distance) P-C4' energy: -152.782 flat angles C4'-P-C4' energy: -181.782 flat angles P-C4'-P energy: -113.384 tors. eta vs tors. theta energy: -141.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1782.038238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1782.038238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1782.038238 (E_RNA) where: Base-Base interactions energy: -1076.480 where: short stacking energy: -518.649 Base-Backbone interact. energy: -1.130 local terms energy: -704.428625 where: bonds (distance) C4'-P energy: -143.873 bonds (distance) P-C4' energy: -169.821 flat angles C4'-P-C4' energy: -171.798 flat angles P-C4'-P energy: -103.805 tors. eta vs tors. theta energy: -115.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1626.701385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1626.701385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1626.701385 (E_RNA) where: Base-Base interactions energy: -1004.367 where: short stacking energy: -481.198 Base-Backbone interact. energy: 0.265 local terms energy: -622.599219 where: bonds (distance) C4'-P energy: -128.485 bonds (distance) P-C4' energy: -162.349 flat angles C4'-P-C4' energy: -156.134 flat angles P-C4'-P energy: -89.890 tors. eta vs tors. theta energy: -85.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -1425.073730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1425.073730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1425.073730 (E_RNA) where: Base-Base interactions energy: -858.385 where: short stacking energy: -416.058 Base-Backbone interact. energy: 2.603 local terms energy: -569.292403 where: bonds (distance) C4'-P energy: -145.559 bonds (distance) P-C4' energy: -148.685 flat angles C4'-P-C4' energy: -141.414 flat angles P-C4'-P energy: -72.222 tors. eta vs tors. theta energy: -61.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -1098.775808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.775808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.775808 (E_RNA) where: Base-Base interactions energy: -590.948 where: short stacking energy: -301.637 Base-Backbone interact. energy: -3.007 local terms energy: -504.821131 where: bonds (distance) C4'-P energy: -154.397 bonds (distance) P-C4' energy: -155.121 flat angles C4'-P-C4' energy: -130.986 flat angles P-C4'-P energy: -78.301 tors. eta vs tors. theta energy: 13.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -777.341815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.341815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.341815 (E_RNA) where: Base-Base interactions energy: -330.518 where: short stacking energy: -208.355 Base-Backbone interact. energy: -2.689 local terms energy: -444.135624 where: bonds (distance) C4'-P energy: -153.856 bonds (distance) P-C4' energy: -147.189 flat angles C4'-P-C4' energy: -127.561 flat angles P-C4'-P energy: -65.622 tors. eta vs tors. theta energy: 50.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -2837.828582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2837.828582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2837.828582 (E_RNA) where: Base-Base interactions energy: -1889.216 where: short stacking energy: -837.314 Base-Backbone interact. energy: -2.011 local terms energy: -946.601544 where: bonds (distance) C4'-P energy: -177.677 bonds (distance) P-C4' energy: -180.662 flat angles C4'-P-C4' energy: -203.148 flat angles P-C4'-P energy: -141.604 tors. eta vs tors. theta energy: -243.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -2692.523752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2692.523752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2692.523752 (E_RNA) where: Base-Base interactions energy: -1800.504 where: short stacking energy: -809.817 Base-Backbone interact. energy: -1.055 local terms energy: -890.964902 where: bonds (distance) C4'-P energy: -176.786 bonds (distance) P-C4' energy: -181.033 flat angles C4'-P-C4' energy: -194.121 flat angles P-C4'-P energy: -116.063 tors. eta vs tors. theta energy: -222.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -2526.688161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2526.688161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2526.688161 (E_RNA) where: Base-Base interactions energy: -1713.636 where: short stacking energy: -732.059 Base-Backbone interact. energy: -4.336 local terms energy: -808.716164 where: bonds (distance) C4'-P energy: -156.733 bonds (distance) P-C4' energy: -172.557 flat angles C4'-P-C4' energy: -184.311 flat angles P-C4'-P energy: -106.918 tors. eta vs tors. theta energy: -188.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -2367.713130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2367.713130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2367.713130 (E_RNA) where: Base-Base interactions energy: -1540.154 where: short stacking energy: -726.265 Base-Backbone interact. energy: -0.690 local terms energy: -826.868764 where: bonds (distance) C4'-P energy: -163.592 bonds (distance) P-C4' energy: -166.788 flat angles C4'-P-C4' energy: -192.110 flat angles P-C4'-P energy: -114.885 tors. eta vs tors. theta energy: -189.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1990.244919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1990.244919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1990.244919 (E_RNA) where: Base-Base interactions energy: -1300.498 where: short stacking energy: -573.917 Base-Backbone interact. energy: -1.493 local terms energy: -688.253969 where: bonds (distance) C4'-P energy: -155.020 bonds (distance) P-C4' energy: -160.677 flat angles C4'-P-C4' energy: -174.343 flat angles P-C4'-P energy: -81.803 tors. eta vs tors. theta energy: -116.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1657.399966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1657.399966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1657.399966 (E_RNA) where: Base-Base interactions energy: -999.477 where: short stacking energy: -504.625 Base-Backbone interact. energy: 1.559 local terms energy: -659.481230 where: bonds (distance) C4'-P energy: -157.406 bonds (distance) P-C4' energy: -167.749 flat angles C4'-P-C4' energy: -139.925 flat angles P-C4'-P energy: -87.625 tors. eta vs tors. theta energy: -106.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1684.739030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1684.739030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1684.739030 (E_RNA) where: Base-Base interactions energy: -1061.099 where: short stacking energy: -462.110 Base-Backbone interact. energy: -0.054 local terms energy: -623.586006 where: bonds (distance) C4'-P energy: -142.801 bonds (distance) P-C4' energy: -160.976 flat angles C4'-P-C4' energy: -143.664 flat angles P-C4'-P energy: -87.235 tors. eta vs tors. theta energy: -88.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -1386.755560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1386.755560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1386.755560 (E_RNA) where: Base-Base interactions energy: -786.829 where: short stacking energy: -399.409 Base-Backbone interact. energy: 2.819 local terms energy: -602.745824 where: bonds (distance) C4'-P energy: -128.869 bonds (distance) P-C4' energy: -152.534 flat angles C4'-P-C4' energy: -167.974 flat angles P-C4'-P energy: -87.441 tors. eta vs tors. theta energy: -65.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -1060.414248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.414248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.414248 (E_RNA) where: Base-Base interactions energy: -568.094 where: short stacking energy: -265.254 Base-Backbone interact. energy: 2.639 local terms energy: -494.959350 where: bonds (distance) C4'-P energy: -140.493 bonds (distance) P-C4' energy: -148.829 flat angles C4'-P-C4' energy: -135.634 flat angles P-C4'-P energy: -82.013 tors. eta vs tors. theta energy: 12.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -738.552312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -738.552312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -738.552312 (E_RNA) where: Base-Base interactions energy: -311.337 where: short stacking energy: -209.137 Base-Backbone interact. energy: 0.873 local terms energy: -428.089275 where: bonds (distance) C4'-P energy: -130.072 bonds (distance) P-C4' energy: -167.679 flat angles C4'-P-C4' energy: -110.245 flat angles P-C4'-P energy: -52.772 tors. eta vs tors. theta energy: 32.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -2900.356959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2900.356959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2900.356959 (E_RNA) where: Base-Base interactions energy: -1953.031 where: short stacking energy: -853.911 Base-Backbone interact. energy: 0.332 local terms energy: -947.657778 where: bonds (distance) C4'-P energy: -187.534 bonds (distance) P-C4' energy: -173.912 flat angles C4'-P-C4' energy: -204.132 flat angles P-C4'-P energy: -135.415 tors. eta vs tors. theta energy: -246.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -2656.050100 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2656.050100 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2656.050100 (E_RNA) where: Base-Base interactions energy: -1751.719 where: short stacking energy: -782.445 Base-Backbone interact. energy: -2.196 local terms energy: -902.135571 where: bonds (distance) C4'-P energy: -184.864 bonds (distance) P-C4' energy: -179.087 flat angles C4'-P-C4' energy: -201.316 flat angles P-C4'-P energy: -118.274 tors. eta vs tors. theta energy: -218.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -2525.120290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2525.120290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2525.120290 (E_RNA) where: Base-Base interactions energy: -1700.884 where: short stacking energy: -738.465 Base-Backbone interact. energy: -0.451 local terms energy: -823.785316 where: bonds (distance) C4'-P energy: -171.387 bonds (distance) P-C4' energy: -168.950 flat angles C4'-P-C4' energy: -167.384 flat angles P-C4'-P energy: -121.052 tors. eta vs tors. theta energy: -195.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -2321.662657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2321.662657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2321.662657 (E_RNA) where: Base-Base interactions energy: -1489.557 where: short stacking energy: -664.578 Base-Backbone interact. energy: -1.353 local terms energy: -830.752831 where: bonds (distance) C4'-P energy: -175.895 bonds (distance) P-C4' energy: -168.013 flat angles C4'-P-C4' energy: -190.209 flat angles P-C4'-P energy: -111.930 tors. eta vs tors. theta energy: -184.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -2086.634422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2086.634422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2086.634422 (E_RNA) where: Base-Base interactions energy: -1321.616 where: short stacking energy: -621.169 Base-Backbone interact. energy: -0.125 local terms energy: -764.892783 where: bonds (distance) C4'-P energy: -166.506 bonds (distance) P-C4' energy: -165.652 flat angles C4'-P-C4' energy: -177.802 flat angles P-C4'-P energy: -103.604 tors. eta vs tors. theta energy: -151.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1839.523195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1839.523195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1839.523195 (E_RNA) where: Base-Base interactions energy: -1137.207 where: short stacking energy: -487.076 Base-Backbone interact. energy: -5.696 local terms energy: -696.620196 where: bonds (distance) C4'-P energy: -133.447 bonds (distance) P-C4' energy: -179.056 flat angles C4'-P-C4' energy: -145.948 flat angles P-C4'-P energy: -114.354 tors. eta vs tors. theta energy: -123.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1536.082453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1536.082453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.082453 (E_RNA) where: Base-Base interactions energy: -924.131 where: short stacking energy: -478.134 Base-Backbone interact. energy: 3.943 local terms energy: -615.894234 where: bonds (distance) C4'-P energy: -144.601 bonds (distance) P-C4' energy: -154.516 flat angles C4'-P-C4' energy: -152.053 flat angles P-C4'-P energy: -88.704 tors. eta vs tors. theta energy: -76.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -1388.099802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.099802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.099802 (E_RNA) where: Base-Base interactions energy: -812.625 where: short stacking energy: -394.938 Base-Backbone interact. energy: 2.581 local terms energy: -578.055750 where: bonds (distance) C4'-P energy: -147.409 bonds (distance) P-C4' energy: -151.164 flat angles C4'-P-C4' energy: -147.664 flat angles P-C4'-P energy: -73.270 tors. eta vs tors. theta energy: -58.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -996.117302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.117302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.117302 (E_RNA) where: Base-Base interactions energy: -504.476 where: short stacking energy: -304.475 Base-Backbone interact. energy: 1.899 local terms energy: -493.540828 where: bonds (distance) C4'-P energy: -144.734 bonds (distance) P-C4' energy: -149.173 flat angles C4'-P-C4' energy: -121.353 flat angles P-C4'-P energy: -61.966 tors. eta vs tors. theta energy: -16.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -786.381564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -786.381564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -786.381564 (E_RNA) where: Base-Base interactions energy: -341.225 where: short stacking energy: -212.894 Base-Backbone interact. energy: 4.260 local terms energy: -449.416459 where: bonds (distance) C4'-P energy: -153.171 bonds (distance) P-C4' energy: -127.624 flat angles C4'-P-C4' energy: -123.528 flat angles P-C4'-P energy: -64.650 tors. eta vs tors. theta energy: 19.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -2895.754089 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2895.754089 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2895.754089 (E_RNA) where: Base-Base interactions energy: -1942.641 where: short stacking energy: -879.329 Base-Backbone interact. energy: -4.292 local terms energy: -948.821574 where: bonds (distance) C4'-P energy: -184.201 bonds (distance) P-C4' energy: -187.723 flat angles C4'-P-C4' energy: -199.429 flat angles P-C4'-P energy: -131.573 tors. eta vs tors. theta energy: -245.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -2684.150300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2684.150300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2684.150300 (E_RNA) where: Base-Base interactions energy: -1761.790 where: short stacking energy: -804.787 Base-Backbone interact. energy: -6.127 local terms energy: -916.233814 where: bonds (distance) C4'-P energy: -190.025 bonds (distance) P-C4' energy: -176.739 flat angles C4'-P-C4' energy: -196.033 flat angles P-C4'-P energy: -134.909 tors. eta vs tors. theta energy: -218.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -2503.221142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2503.221142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2503.221142 (E_RNA) where: Base-Base interactions energy: -1633.769 where: short stacking energy: -754.222 Base-Backbone interact. energy: -0.584 local terms energy: -868.868232 where: bonds (distance) C4'-P energy: -162.595 bonds (distance) P-C4' energy: -181.047 flat angles C4'-P-C4' energy: -200.311 flat angles P-C4'-P energy: -118.779 tors. eta vs tors. theta energy: -206.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -2340.011643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2340.011643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.011643 (E_RNA) where: Base-Base interactions energy: -1494.703 where: short stacking energy: -673.483 Base-Backbone interact. energy: -5.778 local terms energy: -839.531156 where: bonds (distance) C4'-P energy: -159.766 bonds (distance) P-C4' energy: -179.194 flat angles C4'-P-C4' energy: -183.475 flat angles P-C4'-P energy: -126.969 tors. eta vs tors. theta energy: -190.127 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -2057.735123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2057.735123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2057.735123 (E_RNA) where: Base-Base interactions energy: -1300.447 where: short stacking energy: -601.532 Base-Backbone interact. energy: 0.030 local terms energy: -757.317917 where: bonds (distance) C4'-P energy: -141.085 bonds (distance) P-C4' energy: -174.170 flat angles C4'-P-C4' energy: -179.599 flat angles P-C4'-P energy: -117.152 tors. eta vs tors. theta energy: -145.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1971.536760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.536760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.536760 (E_RNA) where: Base-Base interactions energy: -1262.371 where: short stacking energy: -591.866 Base-Backbone interact. energy: 2.701 local terms energy: -711.866648 where: bonds (distance) C4'-P energy: -156.157 bonds (distance) P-C4' energy: -164.760 flat angles C4'-P-C4' energy: -152.603 flat angles P-C4'-P energy: -111.531 tors. eta vs tors. theta energy: -126.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1578.306601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.306601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1578.306601 (E_RNA) where: Base-Base interactions energy: -943.677 where: short stacking energy: -484.152 Base-Backbone interact. energy: 1.610 local terms energy: -636.239498 where: bonds (distance) C4'-P energy: -153.987 bonds (distance) P-C4' energy: -164.893 flat angles C4'-P-C4' energy: -144.342 flat angles P-C4'-P energy: -75.933 tors. eta vs tors. theta energy: -97.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -1379.458439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.458439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.458439 (E_RNA) where: Base-Base interactions energy: -799.942 where: short stacking energy: -378.907 Base-Backbone interact. energy: 2.118 local terms energy: -581.635223 where: bonds (distance) C4'-P energy: -137.055 bonds (distance) P-C4' energy: -144.733 flat angles C4'-P-C4' energy: -138.907 flat angles P-C4'-P energy: -91.426 tors. eta vs tors. theta energy: -69.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -983.029463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.029463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.029463 (E_RNA) where: Base-Base interactions energy: -464.368 where: short stacking energy: -286.520 Base-Backbone interact. energy: 0.951 local terms energy: -519.612645 where: bonds (distance) C4'-P energy: -140.866 bonds (distance) P-C4' energy: -156.549 flat angles C4'-P-C4' energy: -134.430 flat angles P-C4'-P energy: -82.053 tors. eta vs tors. theta energy: -5.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -761.075468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -761.075468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -761.075468 (E_RNA) where: Base-Base interactions energy: -280.177 where: short stacking energy: -192.363 Base-Backbone interact. energy: 1.052 local terms energy: -481.950919 where: bonds (distance) C4'-P energy: -142.466 bonds (distance) P-C4' energy: -147.814 flat angles C4'-P-C4' energy: -133.912 flat angles P-C4'-P energy: -79.163 tors. eta vs tors. theta energy: 21.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -2919.812881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2919.812881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2919.812881 (E_RNA) where: Base-Base interactions energy: -1949.955 where: short stacking energy: -863.042 Base-Backbone interact. energy: -2.851 local terms energy: -967.007186 where: bonds (distance) C4'-P energy: -171.328 bonds (distance) P-C4' energy: -209.412 flat angles C4'-P-C4' energy: -203.357 flat angles P-C4'-P energy: -128.855 tors. eta vs tors. theta energy: -254.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -2699.630055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2699.630055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2699.630055 (E_RNA) where: Base-Base interactions energy: -1787.235 where: short stacking energy: -825.748 Base-Backbone interact. energy: -1.604 local terms energy: -910.791253 where: bonds (distance) C4'-P energy: -193.085 bonds (distance) P-C4' energy: -174.429 flat angles C4'-P-C4' energy: -201.182 flat angles P-C4'-P energy: -109.976 tors. eta vs tors. theta energy: -232.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -2490.420805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2490.420805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2490.420805 (E_RNA) where: Base-Base interactions energy: -1644.754 where: short stacking energy: -741.114 Base-Backbone interact. energy: 0.598 local terms energy: -846.263988 where: bonds (distance) C4'-P energy: -165.909 bonds (distance) P-C4' energy: -171.929 flat angles C4'-P-C4' energy: -185.545 flat angles P-C4'-P energy: -119.767 tors. eta vs tors. theta energy: -203.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -2329.112435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2329.112435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2329.112435 (E_RNA) where: Base-Base interactions energy: -1548.231 where: short stacking energy: -680.794 Base-Backbone interact. energy: 3.942 local terms energy: -784.823218 where: bonds (distance) C4'-P energy: -157.982 bonds (distance) P-C4' energy: -171.183 flat angles C4'-P-C4' energy: -188.254 flat angles P-C4'-P energy: -100.940 tors. eta vs tors. theta energy: -166.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -2051.690013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2051.690013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2051.690013 (E_RNA) where: Base-Base interactions energy: -1301.183 where: short stacking energy: -625.485 Base-Backbone interact. energy: -1.798 local terms energy: -748.709224 where: bonds (distance) C4'-P energy: -145.858 bonds (distance) P-C4' energy: -150.692 flat angles C4'-P-C4' energy: -175.532 flat angles P-C4'-P energy: -110.470 tors. eta vs tors. theta energy: -166.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1929.558022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.558022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.558022 (E_RNA) where: Base-Base interactions energy: -1248.114 where: short stacking energy: -559.313 Base-Backbone interact. energy: -2.418 local terms energy: -679.025598 where: bonds (distance) C4'-P energy: -143.541 bonds (distance) P-C4' energy: -167.821 flat angles C4'-P-C4' energy: -155.526 flat angles P-C4'-P energy: -98.917 tors. eta vs tors. theta energy: -113.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1563.420259 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1563.420259 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1563.420259 (E_RNA) where: Base-Base interactions energy: -923.870 where: short stacking energy: -490.642 Base-Backbone interact. energy: 0.509 local terms energy: -640.059194 where: bonds (distance) C4'-P energy: -146.208 bonds (distance) P-C4' energy: -149.545 flat angles C4'-P-C4' energy: -153.741 flat angles P-C4'-P energy: -94.414 tors. eta vs tors. theta energy: -96.151 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -1426.766814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.766814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.766814 (E_RNA) where: Base-Base interactions energy: -799.734 where: short stacking energy: -419.392 Base-Backbone interact. energy: -1.454 local terms energy: -625.579213 where: bonds (distance) C4'-P energy: -168.299 bonds (distance) P-C4' energy: -143.610 flat angles C4'-P-C4' energy: -150.938 flat angles P-C4'-P energy: -95.333 tors. eta vs tors. theta energy: -67.400 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -940.740498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -940.740498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -940.740498 (E_RNA) where: Base-Base interactions energy: -452.261 where: short stacking energy: -284.034 Base-Backbone interact. energy: 4.578 local terms energy: -493.056883 where: bonds (distance) C4'-P energy: -130.789 bonds (distance) P-C4' energy: -149.363 flat angles C4'-P-C4' energy: -120.681 flat angles P-C4'-P energy: -89.394 tors. eta vs tors. theta energy: -2.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -759.781640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.781640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.781640 (E_RNA) where: Base-Base interactions energy: -299.847 where: short stacking energy: -206.370 Base-Backbone interact. energy: 1.388 local terms energy: -461.322335 where: bonds (distance) C4'-P energy: -155.572 bonds (distance) P-C4' energy: -150.853 flat angles C4'-P-C4' energy: -129.912 flat angles P-C4'-P energy: -77.419 tors. eta vs tors. theta energy: 52.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -2900.550162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2900.550162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2900.550162 (E_RNA) where: Base-Base interactions energy: -1955.305 where: short stacking energy: -893.825 Base-Backbone interact. energy: 1.349 local terms energy: -946.594681 where: bonds (distance) C4'-P energy: -176.406 bonds (distance) P-C4' energy: -187.998 flat angles C4'-P-C4' energy: -202.923 flat angles P-C4'-P energy: -138.192 tors. eta vs tors. theta energy: -241.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -2699.555256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2699.555256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2699.555256 (E_RNA) where: Base-Base interactions energy: -1804.511 where: short stacking energy: -797.083 Base-Backbone interact. energy: -4.225 local terms energy: -890.818609 where: bonds (distance) C4'-P energy: -162.953 bonds (distance) P-C4' energy: -172.898 flat angles C4'-P-C4' energy: -187.891 flat angles P-C4'-P energy: -135.937 tors. eta vs tors. theta energy: -231.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -2493.004189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2493.004189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2493.004189 (E_RNA) where: Base-Base interactions energy: -1629.512 where: short stacking energy: -756.469 Base-Backbone interact. energy: -2.489 local terms energy: -861.002540 where: bonds (distance) C4'-P energy: -170.699 bonds (distance) P-C4' energy: -165.871 flat angles C4'-P-C4' energy: -202.845 flat angles P-C4'-P energy: -125.238 tors. eta vs tors. theta energy: -196.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -2303.348116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2303.348116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2303.348116 (E_RNA) where: Base-Base interactions energy: -1515.893 where: short stacking energy: -680.034 Base-Backbone interact. energy: -2.602 local terms energy: -784.853204 where: bonds (distance) C4'-P energy: -168.883 bonds (distance) P-C4' energy: -153.855 flat angles C4'-P-C4' energy: -182.022 flat angles P-C4'-P energy: -105.070 tors. eta vs tors. theta energy: -175.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -2052.756370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2052.756370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2052.756370 (E_RNA) where: Base-Base interactions energy: -1312.855 where: short stacking energy: -636.006 Base-Backbone interact. energy: -0.465 local terms energy: -739.436595 where: bonds (distance) C4'-P energy: -158.235 bonds (distance) P-C4' energy: -164.193 flat angles C4'-P-C4' energy: -169.917 flat angles P-C4'-P energy: -101.862 tors. eta vs tors. theta energy: -145.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1915.551937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1915.551937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1915.551937 (E_RNA) where: Base-Base interactions energy: -1241.488 where: short stacking energy: -573.292 Base-Backbone interact. energy: -2.033 local terms energy: -672.031128 where: bonds (distance) C4'-P energy: -142.698 bonds (distance) P-C4' energy: -172.922 flat angles C4'-P-C4' energy: -152.969 flat angles P-C4'-P energy: -79.075 tors. eta vs tors. theta energy: -124.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -1488.943625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.943625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.943625 (E_RNA) where: Base-Base interactions energy: -861.420 where: short stacking energy: -443.764 Base-Backbone interact. energy: -3.306 local terms energy: -624.217689 where: bonds (distance) C4'-P energy: -160.709 bonds (distance) P-C4' energy: -161.429 flat angles C4'-P-C4' energy: -150.974 flat angles P-C4'-P energy: -80.893 tors. eta vs tors. theta energy: -70.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -1426.960685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.960685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.960685 (E_RNA) where: Base-Base interactions energy: -840.321 where: short stacking energy: -422.018 Base-Backbone interact. energy: -3.484 local terms energy: -583.155609 where: bonds (distance) C4'-P energy: -132.458 bonds (distance) P-C4' energy: -150.695 flat angles C4'-P-C4' energy: -146.210 flat angles P-C4'-P energy: -91.626 tors. eta vs tors. theta energy: -62.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -984.334289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.334289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.334289 (E_RNA) where: Base-Base interactions energy: -484.073 where: short stacking energy: -302.792 Base-Backbone interact. energy: 2.032 local terms energy: -502.293527 where: bonds (distance) C4'-P energy: -159.792 bonds (distance) P-C4' energy: -131.206 flat angles C4'-P-C4' energy: -138.593 flat angles P-C4'-P energy: -65.660 tors. eta vs tors. theta energy: -7.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -771.138491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -771.138491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -771.138491 (E_RNA) where: Base-Base interactions energy: -317.981 where: short stacking energy: -178.830 Base-Backbone interact. energy: 3.239 local terms energy: -456.396126 where: bonds (distance) C4'-P energy: -151.411 bonds (distance) P-C4' energy: -149.234 flat angles C4'-P-C4' energy: -110.668 flat angles P-C4'-P energy: -78.779 tors. eta vs tors. theta energy: 33.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -2924.460360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2924.460360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2924.460360 (E_RNA) where: Base-Base interactions energy: -1967.300 where: short stacking energy: -869.540 Base-Backbone interact. energy: -2.191 local terms energy: -954.969451 where: bonds (distance) C4'-P energy: -177.461 bonds (distance) P-C4' energy: -186.936 flat angles C4'-P-C4' energy: -200.664 flat angles P-C4'-P energy: -130.575 tors. eta vs tors. theta energy: -259.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -2696.973864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2696.973864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2696.973864 (E_RNA) where: Base-Base interactions energy: -1806.311 where: short stacking energy: -831.956 Base-Backbone interact. energy: 2.775 local terms energy: -893.437845 where: bonds (distance) C4'-P energy: -165.054 bonds (distance) P-C4' energy: -171.720 flat angles C4'-P-C4' energy: -204.614 flat angles P-C4'-P energy: -118.173 tors. eta vs tors. theta energy: -233.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -2494.061416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2494.061416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2494.061416 (E_RNA) where: Base-Base interactions energy: -1607.199 where: short stacking energy: -721.324 Base-Backbone interact. energy: 4.146 local terms energy: -891.008648 where: bonds (distance) C4'-P energy: -180.877 bonds (distance) P-C4' energy: -194.906 flat angles C4'-P-C4' energy: -192.704 flat angles P-C4'-P energy: -129.307 tors. eta vs tors. theta energy: -193.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -2343.814083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2343.814083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2343.814083 (E_RNA) where: Base-Base interactions energy: -1549.914 where: short stacking energy: -698.636 Base-Backbone interact. energy: -0.649 local terms energy: -793.250745 where: bonds (distance) C4'-P energy: -162.570 bonds (distance) P-C4' energy: -175.982 flat angles C4'-P-C4' energy: -177.072 flat angles P-C4'-P energy: -111.498 tors. eta vs tors. theta energy: -166.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -2074.049769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2074.049769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2074.049769 (E_RNA) where: Base-Base interactions energy: -1323.610 where: short stacking energy: -618.568 Base-Backbone interact. energy: 1.621 local terms energy: -752.060827 where: bonds (distance) C4'-P energy: -149.378 bonds (distance) P-C4' energy: -175.292 flat angles C4'-P-C4' energy: -171.036 flat angles P-C4'-P energy: -119.676 tors. eta vs tors. theta energy: -136.678 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -2023.139520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2023.139520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2023.139520 (E_RNA) where: Base-Base interactions energy: -1301.246 where: short stacking energy: -592.198 Base-Backbone interact. energy: 1.556 local terms energy: -723.449300 where: bonds (distance) C4'-P energy: -138.186 bonds (distance) P-C4' energy: -160.304 flat angles C4'-P-C4' energy: -160.500 flat angles P-C4'-P energy: -124.622 tors. eta vs tors. theta energy: -139.838 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -1488.573817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1488.573817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1488.573817 (E_RNA) where: Base-Base interactions energy: -863.634 where: short stacking energy: -440.143 Base-Backbone interact. energy: 3.386 local terms energy: -628.325957 where: bonds (distance) C4'-P energy: -170.721 bonds (distance) P-C4' energy: -152.210 flat angles C4'-P-C4' energy: -138.133 flat angles P-C4'-P energy: -90.152 tors. eta vs tors. theta energy: -77.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -1402.181881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.181881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.181881 (E_RNA) where: Base-Base interactions energy: -844.003 where: short stacking energy: -414.748 Base-Backbone interact. energy: 0.777 local terms energy: -558.955893 where: bonds (distance) C4'-P energy: -118.200 bonds (distance) P-C4' energy: -147.218 flat angles C4'-P-C4' energy: -131.259 flat angles P-C4'-P energy: -96.981 tors. eta vs tors. theta energy: -65.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -987.827106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.827106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.827106 (E_RNA) where: Base-Base interactions energy: -466.080 where: short stacking energy: -273.304 Base-Backbone interact. energy: 0.548 local terms energy: -522.295157 where: bonds (distance) C4'-P energy: -141.123 bonds (distance) P-C4' energy: -169.996 flat angles C4'-P-C4' energy: -109.857 flat angles P-C4'-P energy: -77.852 tors. eta vs tors. theta energy: -23.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -784.751317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.751317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.751317 (E_RNA) where: Base-Base interactions energy: -318.326 where: short stacking energy: -234.573 Base-Backbone interact. energy: 4.137 local terms energy: -470.561964 where: bonds (distance) C4'-P energy: -127.685 bonds (distance) P-C4' energy: -152.956 flat angles C4'-P-C4' energy: -103.650 flat angles P-C4'-P energy: -96.879 tors. eta vs tors. theta energy: 10.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -2921.243787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2921.243787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2921.243787 (E_RNA) where: Base-Base interactions energy: -1958.188 where: short stacking energy: -872.675 Base-Backbone interact. energy: -5.267 local terms energy: -957.789135 where: bonds (distance) C4'-P energy: -172.582 bonds (distance) P-C4' energy: -174.966 flat angles C4'-P-C4' energy: -208.225 flat angles P-C4'-P energy: -135.768 tors. eta vs tors. theta energy: -266.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -2676.571858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2676.571858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2676.571858 (E_RNA) where: Base-Base interactions energy: -1776.119 where: short stacking energy: -775.242 Base-Backbone interact. energy: -5.702 local terms energy: -894.750966 where: bonds (distance) C4'-P energy: -183.753 bonds (distance) P-C4' energy: -177.551 flat angles C4'-P-C4' energy: -189.140 flat angles P-C4'-P energy: -130.835 tors. eta vs tors. theta energy: -213.473 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -2542.843231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2542.843231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2542.843231 (E_RNA) where: Base-Base interactions energy: -1703.988 where: short stacking energy: -725.974 Base-Backbone interact. energy: -3.416 local terms energy: -835.439096 where: bonds (distance) C4'-P energy: -174.605 bonds (distance) P-C4' energy: -177.969 flat angles C4'-P-C4' energy: -194.890 flat angles P-C4'-P energy: -106.004 tors. eta vs tors. theta energy: -181.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -2340.617043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2340.617043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2340.617043 (E_RNA) where: Base-Base interactions energy: -1523.478 where: short stacking energy: -705.877 Base-Backbone interact. energy: -1.141 local terms energy: -815.997930 where: bonds (distance) C4'-P energy: -174.504 bonds (distance) P-C4' energy: -165.728 flat angles C4'-P-C4' energy: -183.709 flat angles P-C4'-P energy: -111.164 tors. eta vs tors. theta energy: -180.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -2091.651511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2091.651511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2091.651511 (E_RNA) where: Base-Base interactions energy: -1335.104 where: short stacking energy: -637.675 Base-Backbone interact. energy: -0.575 local terms energy: -755.972368 where: bonds (distance) C4'-P energy: -138.105 bonds (distance) P-C4' energy: -168.188 flat angles C4'-P-C4' energy: -185.330 flat angles P-C4'-P energy: -119.576 tors. eta vs tors. theta energy: -144.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1970.553382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1970.553382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1970.553382 (E_RNA) where: Base-Base interactions energy: -1261.010 where: short stacking energy: -502.973 Base-Backbone interact. energy: -2.066 local terms energy: -707.477684 where: bonds (distance) C4'-P energy: -166.310 bonds (distance) P-C4' energy: -159.337 flat angles C4'-P-C4' energy: -167.460 flat angles P-C4'-P energy: -106.388 tors. eta vs tors. theta energy: -107.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1445.784136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.784136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.784136 (E_RNA) where: Base-Base interactions energy: -815.296 where: short stacking energy: -425.952 Base-Backbone interact. energy: 1.520 local terms energy: -632.008258 where: bonds (distance) C4'-P energy: -152.959 bonds (distance) P-C4' energy: -177.086 flat angles C4'-P-C4' energy: -141.486 flat angles P-C4'-P energy: -101.726 tors. eta vs tors. theta energy: -58.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -1376.037440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.037440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.037440 (E_RNA) where: Base-Base interactions energy: -795.804 where: short stacking energy: -379.004 Base-Backbone interact. energy: 1.733 local terms energy: -581.966958 where: bonds (distance) C4'-P energy: -149.924 bonds (distance) P-C4' energy: -153.312 flat angles C4'-P-C4' energy: -150.000 flat angles P-C4'-P energy: -85.395 tors. eta vs tors. theta energy: -43.336 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -938.373060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.373060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -938.373060 (E_RNA) where: Base-Base interactions energy: -458.517 where: short stacking energy: -290.461 Base-Backbone interact. energy: 1.458 local terms energy: -481.313792 where: bonds (distance) C4'-P energy: -136.958 bonds (distance) P-C4' energy: -146.000 flat angles C4'-P-C4' energy: -113.798 flat angles P-C4'-P energy: -90.149 tors. eta vs tors. theta energy: 5.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -791.912141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -791.912141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -791.912141 (E_RNA) where: Base-Base interactions energy: -315.897 where: short stacking energy: -232.168 Base-Backbone interact. energy: 3.789 local terms energy: -479.804193 where: bonds (distance) C4'-P energy: -139.634 bonds (distance) P-C4' energy: -150.517 flat angles C4'-P-C4' energy: -113.429 flat angles P-C4'-P energy: -75.229 tors. eta vs tors. theta energy: -0.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -2912.390656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2912.390656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2912.390656 (E_RNA) where: Base-Base interactions energy: -1949.569 where: short stacking energy: -865.330 Base-Backbone interact. energy: -0.791 local terms energy: -962.030613 where: bonds (distance) C4'-P energy: -177.435 bonds (distance) P-C4' energy: -192.909 flat angles C4'-P-C4' energy: -199.255 flat angles P-C4'-P energy: -134.946 tors. eta vs tors. theta energy: -257.487 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -2654.813990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2654.813990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2654.813990 (E_RNA) where: Base-Base interactions energy: -1765.930 where: short stacking energy: -771.351 Base-Backbone interact. energy: -7.438 local terms energy: -881.445527 where: bonds (distance) C4'-P energy: -168.715 bonds (distance) P-C4' energy: -165.220 flat angles C4'-P-C4' energy: -195.456 flat angles P-C4'-P energy: -132.935 tors. eta vs tors. theta energy: -219.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -2528.219135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2528.219135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2528.219135 (E_RNA) where: Base-Base interactions energy: -1687.456 where: short stacking energy: -741.947 Base-Backbone interact. energy: -1.214 local terms energy: -839.549289 where: bonds (distance) C4'-P energy: -161.263 bonds (distance) P-C4' energy: -160.197 flat angles C4'-P-C4' energy: -198.194 flat angles P-C4'-P energy: -116.987 tors. eta vs tors. theta energy: -202.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -2349.159954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2349.159954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2349.159954 (E_RNA) where: Base-Base interactions energy: -1517.004 where: short stacking energy: -696.878 Base-Backbone interact. energy: -1.682 local terms energy: -830.473638 where: bonds (distance) C4'-P energy: -159.053 bonds (distance) P-C4' energy: -170.603 flat angles C4'-P-C4' energy: -201.707 flat angles P-C4'-P energy: -114.668 tors. eta vs tors. theta energy: -184.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -2082.936503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2082.936503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2082.936503 (E_RNA) where: Base-Base interactions energy: -1348.405 where: short stacking energy: -617.366 Base-Backbone interact. energy: -2.334 local terms energy: -732.197395 where: bonds (distance) C4'-P energy: -160.628 bonds (distance) P-C4' energy: -162.646 flat angles C4'-P-C4' energy: -167.869 flat angles P-C4'-P energy: -91.148 tors. eta vs tors. theta energy: -149.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1936.864242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.864242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.864242 (E_RNA) where: Base-Base interactions energy: -1253.527 where: short stacking energy: -513.796 Base-Backbone interact. energy: -2.609 local terms energy: -680.728764 where: bonds (distance) C4'-P energy: -146.619 bonds (distance) P-C4' energy: -164.909 flat angles C4'-P-C4' energy: -186.068 flat angles P-C4'-P energy: -75.052 tors. eta vs tors. theta energy: -108.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1447.332566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.332566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1447.332566 (E_RNA) where: Base-Base interactions energy: -860.211 where: short stacking energy: -434.184 Base-Backbone interact. energy: -2.067 local terms energy: -585.054614 where: bonds (distance) C4'-P energy: -133.334 bonds (distance) P-C4' energy: -138.276 flat angles C4'-P-C4' energy: -139.868 flat angles P-C4'-P energy: -94.178 tors. eta vs tors. theta energy: -79.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -1382.672956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1382.672956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1382.672956 (E_RNA) where: Base-Base interactions energy: -782.832 where: short stacking energy: -394.758 Base-Backbone interact. energy: -3.705 local terms energy: -596.136306 where: bonds (distance) C4'-P energy: -149.631 bonds (distance) P-C4' energy: -153.035 flat angles C4'-P-C4' energy: -144.243 flat angles P-C4'-P energy: -85.207 tors. eta vs tors. theta energy: -64.020 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -960.802124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.802124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.802124 (E_RNA) where: Base-Base interactions energy: -441.977 where: short stacking energy: -251.405 Base-Backbone interact. energy: -2.258 local terms energy: -516.567469 where: bonds (distance) C4'-P energy: -135.553 bonds (distance) P-C4' energy: -161.497 flat angles C4'-P-C4' energy: -148.277 flat angles P-C4'-P energy: -91.536 tors. eta vs tors. theta energy: 20.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -766.669523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.669523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.669523 (E_RNA) where: Base-Base interactions energy: -323.056 where: short stacking energy: -207.276 Base-Backbone interact. energy: 5.531 local terms energy: -449.144367 where: bonds (distance) C4'-P energy: -147.374 bonds (distance) P-C4' energy: -138.470 flat angles C4'-P-C4' energy: -141.995 flat angles P-C4'-P energy: -67.315 tors. eta vs tors. theta energy: 46.009 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -2877.991685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2877.991685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2877.991685 (E_RNA) where: Base-Base interactions energy: -1934.195 where: short stacking energy: -838.403 Base-Backbone interact. energy: -3.672 local terms energy: -940.124830 where: bonds (distance) C4'-P energy: -160.202 bonds (distance) P-C4' energy: -180.868 flat angles C4'-P-C4' energy: -214.333 flat angles P-C4'-P energy: -139.719 tors. eta vs tors. theta energy: -245.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -2680.389112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2680.389112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2680.389112 (E_RNA) where: Base-Base interactions energy: -1821.184 where: short stacking energy: -782.129 Base-Backbone interact. energy: -0.641 local terms energy: -858.564282 where: bonds (distance) C4'-P energy: -170.942 bonds (distance) P-C4' energy: -171.526 flat angles C4'-P-C4' energy: -195.038 flat angles P-C4'-P energy: -114.853 tors. eta vs tors. theta energy: -206.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -2505.912987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2505.912987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2505.912987 (E_RNA) where: Base-Base interactions energy: -1683.972 where: short stacking energy: -744.701 Base-Backbone interact. energy: -4.074 local terms energy: -817.866496 where: bonds (distance) C4'-P energy: -156.166 bonds (distance) P-C4' energy: -181.099 flat angles C4'-P-C4' energy: -176.484 flat angles P-C4'-P energy: -101.923 tors. eta vs tors. theta energy: -202.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -2424.431480 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2424.431480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2424.431480 (E_RNA) where: Base-Base interactions energy: -1603.747 where: short stacking energy: -733.310 Base-Backbone interact. energy: -2.533 local terms energy: -818.151773 where: bonds (distance) C4'-P energy: -153.775 bonds (distance) P-C4' energy: -155.081 flat angles C4'-P-C4' energy: -198.455 flat angles P-C4'-P energy: -113.435 tors. eta vs tors. theta energy: -197.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -2116.853827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2116.853827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2116.853827 (E_RNA) where: Base-Base interactions energy: -1368.254 where: short stacking energy: -626.830 Base-Backbone interact. energy: 1.204 local terms energy: -749.803722 where: bonds (distance) C4'-P energy: -145.450 bonds (distance) P-C4' energy: -159.152 flat angles C4'-P-C4' energy: -157.029 flat angles P-C4'-P energy: -111.412 tors. eta vs tors. theta energy: -176.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -2034.350772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2034.350772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2034.350772 (E_RNA) where: Base-Base interactions energy: -1315.245 where: short stacking energy: -577.678 Base-Backbone interact. energy: -2.555 local terms energy: -716.550805 where: bonds (distance) C4'-P energy: -167.358 bonds (distance) P-C4' energy: -170.275 flat angles C4'-P-C4' energy: -162.435 flat angles P-C4'-P energy: -82.028 tors. eta vs tors. theta energy: -134.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1534.553119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1534.553119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1534.553119 (E_RNA) where: Base-Base interactions energy: -913.054 where: short stacking energy: -446.981 Base-Backbone interact. energy: -0.274 local terms energy: -621.224806 where: bonds (distance) C4'-P energy: -147.287 bonds (distance) P-C4' energy: -136.307 flat angles C4'-P-C4' energy: -171.893 flat angles P-C4'-P energy: -95.057 tors. eta vs tors. theta energy: -70.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -1388.435273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.435273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.435273 (E_RNA) where: Base-Base interactions energy: -813.977 where: short stacking energy: -397.911 Base-Backbone interact. energy: -1.281 local terms energy: -573.177876 where: bonds (distance) C4'-P energy: -156.982 bonds (distance) P-C4' energy: -156.590 flat angles C4'-P-C4' energy: -144.562 flat angles P-C4'-P energy: -67.207 tors. eta vs tors. theta energy: -47.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -963.557643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.557643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.557643 (E_RNA) where: Base-Base interactions energy: -443.702 where: short stacking energy: -256.790 Base-Backbone interact. energy: -2.311 local terms energy: -517.545346 where: bonds (distance) C4'-P energy: -141.310 bonds (distance) P-C4' energy: -148.931 flat angles C4'-P-C4' energy: -148.091 flat angles P-C4'-P energy: -82.277 tors. eta vs tors. theta energy: 3.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -762.414728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.414728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.414728 (E_RNA) where: Base-Base interactions energy: -322.080 where: short stacking energy: -218.385 Base-Backbone interact. energy: 1.064 local terms energy: -441.398839 where: bonds (distance) C4'-P energy: -133.548 bonds (distance) P-C4' energy: -149.755 flat angles C4'-P-C4' energy: -121.381 flat angles P-C4'-P energy: -56.801 tors. eta vs tors. theta energy: 20.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -2902.193067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2902.193067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2902.193067 (E_RNA) where: Base-Base interactions energy: -1946.627 where: short stacking energy: -859.498 Base-Backbone interact. energy: -4.504 local terms energy: -951.061927 where: bonds (distance) C4'-P energy: -175.098 bonds (distance) P-C4' energy: -180.920 flat angles C4'-P-C4' energy: -202.007 flat angles P-C4'-P energy: -132.388 tors. eta vs tors. theta energy: -260.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -2692.572669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2692.572669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2692.572669 (E_RNA) where: Base-Base interactions energy: -1799.240 where: short stacking energy: -802.428 Base-Backbone interact. energy: -4.028 local terms energy: -889.304659 where: bonds (distance) C4'-P energy: -176.520 bonds (distance) P-C4' energy: -172.426 flat angles C4'-P-C4' energy: -196.992 flat angles P-C4'-P energy: -128.500 tors. eta vs tors. theta energy: -214.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -2521.135787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2521.135787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2521.135787 (E_RNA) where: Base-Base interactions energy: -1690.267 where: short stacking energy: -749.036 Base-Backbone interact. energy: 1.892 local terms energy: -832.760862 where: bonds (distance) C4'-P energy: -152.099 bonds (distance) P-C4' energy: -169.969 flat angles C4'-P-C4' energy: -186.814 flat angles P-C4'-P energy: -118.641 tors. eta vs tors. theta energy: -205.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -2390.343731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2390.343731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2390.343731 (E_RNA) where: Base-Base interactions energy: -1563.701 where: short stacking energy: -697.789 Base-Backbone interact. energy: -3.258 local terms energy: -823.384649 where: bonds (distance) C4'-P energy: -171.754 bonds (distance) P-C4' energy: -170.577 flat angles C4'-P-C4' energy: -182.262 flat angles P-C4'-P energy: -119.484 tors. eta vs tors. theta energy: -179.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -2118.218503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2118.218503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2118.218503 (E_RNA) where: Base-Base interactions energy: -1341.319 where: short stacking energy: -604.698 Base-Backbone interact. energy: 2.387 local terms energy: -779.286801 where: bonds (distance) C4'-P energy: -161.552 bonds (distance) P-C4' energy: -189.550 flat angles C4'-P-C4' energy: -168.832 flat angles P-C4'-P energy: -122.820 tors. eta vs tors. theta energy: -136.532 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -2056.042962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2056.042962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2056.042962 (E_RNA) where: Base-Base interactions energy: -1323.881 where: short stacking energy: -573.699 Base-Backbone interact. energy: -3.797 local terms energy: -728.365144 where: bonds (distance) C4'-P energy: -164.397 bonds (distance) P-C4' energy: -175.228 flat angles C4'-P-C4' energy: -166.506 flat angles P-C4'-P energy: -88.681 tors. eta vs tors. theta energy: -133.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1708.257712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1708.257712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1708.257712 (E_RNA) where: Base-Base interactions energy: -1036.297 where: short stacking energy: -447.852 Base-Backbone interact. energy: -2.497 local terms energy: -669.463856 where: bonds (distance) C4'-P energy: -169.707 bonds (distance) P-C4' energy: -168.390 flat angles C4'-P-C4' energy: -150.783 flat angles P-C4'-P energy: -93.221 tors. eta vs tors. theta energy: -87.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -1316.782201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1316.782201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1316.782201 (E_RNA) where: Base-Base interactions energy: -763.259 where: short stacking energy: -375.884 Base-Backbone interact. energy: -4.038 local terms energy: -549.485945 where: bonds (distance) C4'-P energy: -131.465 bonds (distance) P-C4' energy: -137.896 flat angles C4'-P-C4' energy: -150.584 flat angles P-C4'-P energy: -82.053 tors. eta vs tors. theta energy: -47.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -960.771004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.771004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.771004 (E_RNA) where: Base-Base interactions energy: -457.757 where: short stacking energy: -277.401 Base-Backbone interact. energy: -3.545 local terms energy: -499.468752 where: bonds (distance) C4'-P energy: -144.626 bonds (distance) P-C4' energy: -154.130 flat angles C4'-P-C4' energy: -138.880 flat angles P-C4'-P energy: -67.210 tors. eta vs tors. theta energy: 5.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -784.682644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.682644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.682644 (E_RNA) where: Base-Base interactions energy: -316.617 where: short stacking energy: -198.807 Base-Backbone interact. energy: 5.410 local terms energy: -473.475570 where: bonds (distance) C4'-P energy: -142.910 bonds (distance) P-C4' energy: -166.906 flat angles C4'-P-C4' energy: -109.248 flat angles P-C4'-P energy: -65.353 tors. eta vs tors. theta energy: 10.941 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -2923.898500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2923.898500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2923.898500 (E_RNA) where: Base-Base interactions energy: -1978.556 where: short stacking energy: -881.640 Base-Backbone interact. energy: -2.460 local terms energy: -942.882616 where: bonds (distance) C4'-P energy: -168.134 bonds (distance) P-C4' energy: -171.274 flat angles C4'-P-C4' energy: -202.168 flat angles P-C4'-P energy: -135.050 tors. eta vs tors. theta energy: -266.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -2689.660087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2689.660087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2689.660087 (E_RNA) where: Base-Base interactions energy: -1783.455 where: short stacking energy: -794.466 Base-Backbone interact. energy: -3.197 local terms energy: -903.008223 where: bonds (distance) C4'-P energy: -180.641 bonds (distance) P-C4' energy: -193.149 flat angles C4'-P-C4' energy: -199.548 flat angles P-C4'-P energy: -111.243 tors. eta vs tors. theta energy: -218.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -2522.455871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2522.455871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2522.455871 (E_RNA) where: Base-Base interactions energy: -1672.718 where: short stacking energy: -778.997 Base-Backbone interact. energy: 0.891 local terms energy: -850.628453 where: bonds (distance) C4'-P energy: -165.145 bonds (distance) P-C4' energy: -167.030 flat angles C4'-P-C4' energy: -196.218 flat angles P-C4'-P energy: -110.225 tors. eta vs tors. theta energy: -212.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -2355.697180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2355.697180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2355.697180 (E_RNA) where: Base-Base interactions energy: -1542.208 where: short stacking energy: -703.809 Base-Backbone interact. energy: -2.511 local terms energy: -810.977954 where: bonds (distance) C4'-P energy: -170.651 bonds (distance) P-C4' energy: -160.856 flat angles C4'-P-C4' energy: -186.491 flat angles P-C4'-P energy: -110.330 tors. eta vs tors. theta energy: -182.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -2205.781976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2205.781976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2205.781976 (E_RNA) where: Base-Base interactions energy: -1433.390 where: short stacking energy: -658.124 Base-Backbone interact. energy: 2.799 local terms energy: -775.190608 where: bonds (distance) C4'-P energy: -149.179 bonds (distance) P-C4' energy: -173.593 flat angles C4'-P-C4' energy: -166.164 flat angles P-C4'-P energy: -115.426 tors. eta vs tors. theta energy: -170.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -2012.632037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2012.632037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2012.632037 (E_RNA) where: Base-Base interactions energy: -1332.258 where: short stacking energy: -558.787 Base-Backbone interact. energy: -1.339 local terms energy: -679.034849 where: bonds (distance) C4'-P energy: -143.402 bonds (distance) P-C4' energy: -145.499 flat angles C4'-P-C4' energy: -170.357 flat angles P-C4'-P energy: -101.972 tors. eta vs tors. theta energy: -117.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -1728.376465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1728.376465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.376465 (E_RNA) where: Base-Base interactions energy: -1076.819 where: short stacking energy: -488.470 Base-Backbone interact. energy: -1.470 local terms energy: -650.087195 where: bonds (distance) C4'-P energy: -150.037 bonds (distance) P-C4' energy: -162.598 flat angles C4'-P-C4' energy: -162.434 flat angles P-C4'-P energy: -84.247 tors. eta vs tors. theta energy: -90.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -1253.854634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.854634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.854634 (E_RNA) where: Base-Base interactions energy: -717.092 where: short stacking energy: -385.298 Base-Backbone interact. energy: 3.056 local terms energy: -539.819079 where: bonds (distance) C4'-P energy: -128.320 bonds (distance) P-C4' energy: -157.318 flat angles C4'-P-C4' energy: -128.263 flat angles P-C4'-P energy: -90.959 tors. eta vs tors. theta energy: -34.959 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -852.969055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -852.969055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -852.969055 (E_RNA) where: Base-Base interactions energy: -415.700 where: short stacking energy: -264.830 Base-Backbone interact. energy: 2.257 local terms energy: -439.526148 where: bonds (distance) C4'-P energy: -123.866 bonds (distance) P-C4' energy: -148.837 flat angles C4'-P-C4' energy: -125.420 flat angles P-C4'-P energy: -57.681 tors. eta vs tors. theta energy: 16.278 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -864.921224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.921224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.921224 (E_RNA) where: Base-Base interactions energy: -376.685 where: short stacking energy: -214.182 Base-Backbone interact. energy: 4.897 local terms energy: -493.133429 where: bonds (distance) C4'-P energy: -158.587 bonds (distance) P-C4' energy: -146.471 flat angles C4'-P-C4' energy: -129.372 flat angles P-C4'-P energy: -80.133 tors. eta vs tors. theta energy: 21.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -2946.061082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2946.061082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2946.061082 (E_RNA) where: Base-Base interactions energy: -1955.917 where: short stacking energy: -874.362 Base-Backbone interact. energy: -5.048 local terms energy: -985.096230 where: bonds (distance) C4'-P energy: -188.086 bonds (distance) P-C4' energy: -199.615 flat angles C4'-P-C4' energy: -207.219 flat angles P-C4'-P energy: -127.215 tors. eta vs tors. theta energy: -262.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -2627.953061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2627.953061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2627.953061 (E_RNA) where: Base-Base interactions energy: -1771.734 where: short stacking energy: -773.885 Base-Backbone interact. energy: 4.466 local terms energy: -860.684472 where: bonds (distance) C4'-P energy: -177.543 bonds (distance) P-C4' energy: -172.778 flat angles C4'-P-C4' energy: -178.504 flat angles P-C4'-P energy: -120.013 tors. eta vs tors. theta energy: -211.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -2509.687132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2509.687132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2509.687132 (E_RNA) where: Base-Base interactions energy: -1658.402 where: short stacking energy: -734.572 Base-Backbone interact. energy: -1.731 local terms energy: -849.553580 where: bonds (distance) C4'-P energy: -159.272 bonds (distance) P-C4' energy: -186.860 flat angles C4'-P-C4' energy: -187.040 flat angles P-C4'-P energy: -114.898 tors. eta vs tors. theta energy: -201.483 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -2339.375322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2339.375322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2339.375322 (E_RNA) where: Base-Base interactions energy: -1522.832 where: short stacking energy: -705.533 Base-Backbone interact. energy: -4.565 local terms energy: -811.978145 where: bonds (distance) C4'-P energy: -167.128 bonds (distance) P-C4' energy: -162.643 flat angles C4'-P-C4' energy: -181.172 flat angles P-C4'-P energy: -111.940 tors. eta vs tors. theta energy: -189.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -2157.678014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2157.678014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2157.678014 (E_RNA) where: Base-Base interactions energy: -1423.620 where: short stacking energy: -640.398 Base-Backbone interact. energy: 8.915 local terms energy: -742.972678 where: bonds (distance) C4'-P energy: -163.111 bonds (distance) P-C4' energy: -157.218 flat angles C4'-P-C4' energy: -173.645 flat angles P-C4'-P energy: -113.394 tors. eta vs tors. theta energy: -135.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -2084.219356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2084.219356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2084.219356 (E_RNA) where: Base-Base interactions energy: -1324.319 where: short stacking energy: -597.119 Base-Backbone interact. energy: -2.888 local terms energy: -757.012949 where: bonds (distance) C4'-P energy: -149.485 bonds (distance) P-C4' energy: -175.201 flat angles C4'-P-C4' energy: -141.013 flat angles P-C4'-P energy: -137.146 tors. eta vs tors. theta energy: -154.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1675.460654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1675.460654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.460654 (E_RNA) where: Base-Base interactions energy: -991.760 where: short stacking energy: -470.779 Base-Backbone interact. energy: -2.057 local terms energy: -681.643100 where: bonds (distance) C4'-P energy: -155.026 bonds (distance) P-C4' energy: -158.198 flat angles C4'-P-C4' energy: -167.210 flat angles P-C4'-P energy: -111.652 tors. eta vs tors. theta energy: -89.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -1309.637182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.637182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.637182 (E_RNA) where: Base-Base interactions energy: -745.688 where: short stacking energy: -393.243 Base-Backbone interact. energy: 6.903 local terms energy: -570.852306 where: bonds (distance) C4'-P energy: -135.441 bonds (distance) P-C4' energy: -137.532 flat angles C4'-P-C4' energy: -147.774 flat angles P-C4'-P energy: -92.595 tors. eta vs tors. theta energy: -57.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -823.192309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.192309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.192309 (E_RNA) where: Base-Base interactions energy: -375.893 where: short stacking energy: -260.906 Base-Backbone interact. energy: -0.177 local terms energy: -447.122626 where: bonds (distance) C4'-P energy: -148.017 bonds (distance) P-C4' energy: -130.308 flat angles C4'-P-C4' energy: -116.610 flat angles P-C4'-P energy: -68.112 tors. eta vs tors. theta energy: 15.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -879.421922 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.421922 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.421922 (E_RNA) where: Base-Base interactions energy: -422.942 where: short stacking energy: -261.222 Base-Backbone interact. energy: 0.225 local terms energy: -456.704951 where: bonds (distance) C4'-P energy: -150.478 bonds (distance) P-C4' energy: -123.951 flat angles C4'-P-C4' energy: -116.076 flat angles P-C4'-P energy: -63.977 tors. eta vs tors. theta energy: -2.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -2905.841205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2905.841205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2905.841205 (E_RNA) where: Base-Base interactions energy: -1960.451 where: short stacking energy: -874.561 Base-Backbone interact. energy: -4.278 local terms energy: -941.112042 where: bonds (distance) C4'-P energy: -174.457 bonds (distance) P-C4' energy: -170.283 flat angles C4'-P-C4' energy: -204.135 flat angles P-C4'-P energy: -129.404 tors. eta vs tors. theta energy: -262.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -2625.997486 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2625.997486 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2625.997486 (E_RNA) where: Base-Base interactions energy: -1766.353 where: short stacking energy: -789.420 Base-Backbone interact. energy: -2.268 local terms energy: -857.375739 where: bonds (distance) C4'-P energy: -176.016 bonds (distance) P-C4' energy: -169.148 flat angles C4'-P-C4' energy: -194.708 flat angles P-C4'-P energy: -111.169 tors. eta vs tors. theta energy: -206.335 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -2520.482548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2520.482548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2520.482548 (E_RNA) where: Base-Base interactions energy: -1672.029 where: short stacking energy: -755.472 Base-Backbone interact. energy: -0.307 local terms energy: -848.146562 where: bonds (distance) C4'-P energy: -173.309 bonds (distance) P-C4' energy: -171.260 flat angles C4'-P-C4' energy: -176.408 flat angles P-C4'-P energy: -116.271 tors. eta vs tors. theta energy: -210.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -2347.122535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2347.122535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2347.122535 (E_RNA) where: Base-Base interactions energy: -1544.162 where: short stacking energy: -702.048 Base-Backbone interact. energy: -1.491 local terms energy: -801.469524 where: bonds (distance) C4'-P energy: -160.835 bonds (distance) P-C4' energy: -158.501 flat angles C4'-P-C4' energy: -169.999 flat angles P-C4'-P energy: -129.129 tors. eta vs tors. theta energy: -183.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -2205.001820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2205.001820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2205.001820 (E_RNA) where: Base-Base interactions energy: -1416.679 where: short stacking energy: -682.054 Base-Backbone interact. energy: -2.456 local terms energy: -785.866727 where: bonds (distance) C4'-P energy: -162.641 bonds (distance) P-C4' energy: -171.049 flat angles C4'-P-C4' energy: -168.139 flat angles P-C4'-P energy: -108.984 tors. eta vs tors. theta energy: -175.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -2088.919328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2088.919328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2088.919328 (E_RNA) where: Base-Base interactions energy: -1370.941 where: short stacking energy: -603.372 Base-Backbone interact. energy: -5.399 local terms energy: -712.578946 where: bonds (distance) C4'-P energy: -158.689 bonds (distance) P-C4' energy: -142.896 flat angles C4'-P-C4' energy: -165.453 flat angles P-C4'-P energy: -101.861 tors. eta vs tors. theta energy: -143.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1653.663737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1653.663737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1653.663737 (E_RNA) where: Base-Base interactions energy: -1022.840 where: short stacking energy: -474.040 Base-Backbone interact. energy: -0.545 local terms energy: -630.278848 where: bonds (distance) C4'-P energy: -155.430 bonds (distance) P-C4' energy: -147.352 flat angles C4'-P-C4' energy: -156.685 flat angles P-C4'-P energy: -91.150 tors. eta vs tors. theta energy: -79.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -1215.878157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.878157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.878157 (E_RNA) where: Base-Base interactions energy: -643.397 where: short stacking energy: -331.086 Base-Backbone interact. energy: 0.454 local terms energy: -572.935340 where: bonds (distance) C4'-P energy: -146.380 bonds (distance) P-C4' energy: -164.055 flat angles C4'-P-C4' energy: -129.659 flat angles P-C4'-P energy: -78.303 tors. eta vs tors. theta energy: -54.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -983.727269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.727269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.727269 (E_RNA) where: Base-Base interactions energy: -497.141 where: short stacking energy: -272.234 Base-Backbone interact. energy: -3.128 local terms energy: -483.458260 where: bonds (distance) C4'-P energy: -127.841 bonds (distance) P-C4' energy: -151.829 flat angles C4'-P-C4' energy: -150.464 flat angles P-C4'-P energy: -67.947 tors. eta vs tors. theta energy: 14.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -760.446454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -760.446454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -760.446454 (E_RNA) where: Base-Base interactions energy: -310.868 where: short stacking energy: -212.062 Base-Backbone interact. energy: 4.968 local terms energy: -454.547266 where: bonds (distance) C4'-P energy: -137.982 bonds (distance) P-C4' energy: -132.113 flat angles C4'-P-C4' energy: -136.710 flat angles P-C4'-P energy: -71.199 tors. eta vs tors. theta energy: 23.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -2960.288953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2960.288953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2960.288953 (E_RNA) where: Base-Base interactions energy: -2008.799 where: short stacking energy: -893.304 Base-Backbone interact. energy: -1.591 local terms energy: -949.898771 where: bonds (distance) C4'-P energy: -185.669 bonds (distance) P-C4' energy: -167.031 flat angles C4'-P-C4' energy: -202.345 flat angles P-C4'-P energy: -130.692 tors. eta vs tors. theta energy: -264.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -2703.263326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2703.263326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2703.263326 (E_RNA) where: Base-Base interactions energy: -1765.649 where: short stacking energy: -780.159 Base-Backbone interact. energy: -3.507 local terms energy: -934.107533 where: bonds (distance) C4'-P energy: -177.434 bonds (distance) P-C4' energy: -194.118 flat angles C4'-P-C4' energy: -210.127 flat angles P-C4'-P energy: -128.149 tors. eta vs tors. theta energy: -224.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -2576.871011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2576.871011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2576.871011 (E_RNA) where: Base-Base interactions energy: -1677.220 where: short stacking energy: -738.928 Base-Backbone interact. energy: 2.974 local terms energy: -902.625206 where: bonds (distance) C4'-P energy: -185.487 bonds (distance) P-C4' energy: -175.485 flat angles C4'-P-C4' energy: -198.141 flat angles P-C4'-P energy: -131.623 tors. eta vs tors. theta energy: -211.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -2361.239718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2361.239718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2361.239718 (E_RNA) where: Base-Base interactions energy: -1557.808 where: short stacking energy: -667.274 Base-Backbone interact. energy: -3.388 local terms energy: -800.043488 where: bonds (distance) C4'-P energy: -168.847 bonds (distance) P-C4' energy: -158.355 flat angles C4'-P-C4' energy: -191.881 flat angles P-C4'-P energy: -117.757 tors. eta vs tors. theta energy: -163.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -2162.729302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2162.729302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2162.729302 (E_RNA) where: Base-Base interactions energy: -1383.438 where: short stacking energy: -616.077 Base-Backbone interact. energy: 2.292 local terms energy: -781.584161 where: bonds (distance) C4'-P energy: -175.141 bonds (distance) P-C4' energy: -171.115 flat angles C4'-P-C4' energy: -178.193 flat angles P-C4'-P energy: -107.092 tors. eta vs tors. theta energy: -150.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -2003.469747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2003.469747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2003.469747 (E_RNA) where: Base-Base interactions energy: -1295.262 where: short stacking energy: -558.350 Base-Backbone interact. energy: 0.303 local terms energy: -708.510471 where: bonds (distance) C4'-P energy: -143.018 bonds (distance) P-C4' energy: -158.915 flat angles C4'-P-C4' energy: -168.170 flat angles P-C4'-P energy: -106.142 tors. eta vs tors. theta energy: -132.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1741.724614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1741.724614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1741.724614 (E_RNA) where: Base-Base interactions energy: -1085.266 where: short stacking energy: -489.500 Base-Backbone interact. energy: 2.454 local terms energy: -658.913010 where: bonds (distance) C4'-P energy: -145.217 bonds (distance) P-C4' energy: -162.764 flat angles C4'-P-C4' energy: -159.073 flat angles P-C4'-P energy: -95.837 tors. eta vs tors. theta energy: -96.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -1202.352703 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1202.352703 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1202.352703 (E_RNA) where: Base-Base interactions energy: -644.361 where: short stacking energy: -339.610 Base-Backbone interact. energy: 0.378 local terms energy: -558.369897 where: bonds (distance) C4'-P energy: -149.252 bonds (distance) P-C4' energy: -157.049 flat angles C4'-P-C4' energy: -133.787 flat angles P-C4'-P energy: -87.351 tors. eta vs tors. theta energy: -30.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -1039.901718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.901718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.901718 (E_RNA) where: Base-Base interactions energy: -555.957 where: short stacking energy: -272.750 Base-Backbone interact. energy: 1.920 local terms energy: -485.864317 where: bonds (distance) C4'-P energy: -139.545 bonds (distance) P-C4' energy: -131.769 flat angles C4'-P-C4' energy: -138.795 flat angles P-C4'-P energy: -79.259 tors. eta vs tors. theta energy: 3.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -849.579146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.579146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.579146 (E_RNA) where: Base-Base interactions energy: -359.220 where: short stacking energy: -239.762 Base-Backbone interact. energy: -3.660 local terms energy: -486.698459 where: bonds (distance) C4'-P energy: -126.626 bonds (distance) P-C4' energy: -163.619 flat angles C4'-P-C4' energy: -150.892 flat angles P-C4'-P energy: -65.671 tors. eta vs tors. theta energy: 20.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -2903.773330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2903.773330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2903.773330 (E_RNA) where: Base-Base interactions energy: -1929.697 where: short stacking energy: -861.835 Base-Backbone interact. energy: 6.132 local terms energy: -980.209271 where: bonds (distance) C4'-P energy: -195.942 bonds (distance) P-C4' energy: -183.030 flat angles C4'-P-C4' energy: -210.163 flat angles P-C4'-P energy: -138.352 tors. eta vs tors. theta energy: -252.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -2726.402959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2726.402959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2726.402959 (E_RNA) where: Base-Base interactions energy: -1813.609 where: short stacking energy: -770.199 Base-Backbone interact. energy: -3.373 local terms energy: -909.421756 where: bonds (distance) C4'-P energy: -186.380 bonds (distance) P-C4' energy: -195.402 flat angles C4'-P-C4' energy: -190.496 flat angles P-C4'-P energy: -108.183 tors. eta vs tors. theta energy: -228.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -2532.787962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2532.787962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2532.787962 (E_RNA) where: Base-Base interactions energy: -1675.430 where: short stacking energy: -721.621 Base-Backbone interact. energy: -2.644 local terms energy: -854.713680 where: bonds (distance) C4'-P energy: -170.584 bonds (distance) P-C4' energy: -169.502 flat angles C4'-P-C4' energy: -177.511 flat angles P-C4'-P energy: -129.938 tors. eta vs tors. theta energy: -207.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -2376.620341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2376.620341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2376.620341 (E_RNA) where: Base-Base interactions energy: -1576.279 where: short stacking energy: -700.198 Base-Backbone interact. energy: -2.421 local terms energy: -797.920145 where: bonds (distance) C4'-P energy: -177.392 bonds (distance) P-C4' energy: -158.466 flat angles C4'-P-C4' energy: -186.597 flat angles P-C4'-P energy: -101.598 tors. eta vs tors. theta energy: -173.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -2127.237294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2127.237294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2127.237294 (E_RNA) where: Base-Base interactions energy: -1374.588 where: short stacking energy: -633.796 Base-Backbone interact. energy: -0.655 local terms energy: -751.994458 where: bonds (distance) C4'-P energy: -153.490 bonds (distance) P-C4' energy: -163.563 flat angles C4'-P-C4' energy: -164.101 flat angles P-C4'-P energy: -116.660 tors. eta vs tors. theta energy: -154.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1986.416222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1986.416222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1986.416222 (E_RNA) where: Base-Base interactions energy: -1232.243 where: short stacking energy: -549.957 Base-Backbone interact. energy: -0.936 local terms energy: -753.237015 where: bonds (distance) C4'-P energy: -162.639 bonds (distance) P-C4' energy: -181.356 flat angles C4'-P-C4' energy: -177.265 flat angles P-C4'-P energy: -95.098 tors. eta vs tors. theta energy: -136.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1738.958693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1738.958693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1738.958693 (E_RNA) where: Base-Base interactions energy: -1093.502 where: short stacking energy: -507.981 Base-Backbone interact. energy: -3.221 local terms energy: -642.235879 where: bonds (distance) C4'-P energy: -157.763 bonds (distance) P-C4' energy: -152.705 flat angles C4'-P-C4' energy: -147.527 flat angles P-C4'-P energy: -90.630 tors. eta vs tors. theta energy: -93.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -1187.184211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.184211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.184211 (E_RNA) where: Base-Base interactions energy: -623.947 where: short stacking energy: -362.338 Base-Backbone interact. energy: 2.552 local terms energy: -565.789282 where: bonds (distance) C4'-P energy: -147.282 bonds (distance) P-C4' energy: -151.847 flat angles C4'-P-C4' energy: -145.347 flat angles P-C4'-P energy: -83.239 tors. eta vs tors. theta energy: -38.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -1026.577855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.577855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.577855 (E_RNA) where: Base-Base interactions energy: -520.300 where: short stacking energy: -289.121 Base-Backbone interact. energy: -1.307 local terms energy: -504.970861 where: bonds (distance) C4'-P energy: -145.020 bonds (distance) P-C4' energy: -153.981 flat angles C4'-P-C4' energy: -132.531 flat angles P-C4'-P energy: -84.655 tors. eta vs tors. theta energy: 11.215 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -820.445972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -820.445972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -820.445972 (E_RNA) where: Base-Base interactions energy: -378.242 where: short stacking energy: -236.013 Base-Backbone interact. energy: 1.904 local terms energy: -444.107209 where: bonds (distance) C4'-P energy: -136.477 bonds (distance) P-C4' energy: -152.023 flat angles C4'-P-C4' energy: -108.387 flat angles P-C4'-P energy: -76.068 tors. eta vs tors. theta energy: 28.847 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -2883.936142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2883.936142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2883.936142 (E_RNA) where: Base-Base interactions energy: -1968.970 where: short stacking energy: -846.955 Base-Backbone interact. energy: 0.754 local terms energy: -915.719888 where: bonds (distance) C4'-P energy: -169.722 bonds (distance) P-C4' energy: -191.325 flat angles C4'-P-C4' energy: -188.542 flat angles P-C4'-P energy: -126.961 tors. eta vs tors. theta energy: -239.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -2735.964338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2735.964338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2735.964338 (E_RNA) where: Base-Base interactions energy: -1857.093 where: short stacking energy: -792.153 Base-Backbone interact. energy: 1.390 local terms energy: -880.261717 where: bonds (distance) C4'-P energy: -176.423 bonds (distance) P-C4' energy: -161.047 flat angles C4'-P-C4' energy: -186.096 flat angles P-C4'-P energy: -133.630 tors. eta vs tors. theta energy: -223.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -2523.702741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2523.702741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2523.702741 (E_RNA) where: Base-Base interactions energy: -1624.948 where: short stacking energy: -742.449 Base-Backbone interact. energy: -4.639 local terms energy: -894.115605 where: bonds (distance) C4'-P energy: -172.622 bonds (distance) P-C4' energy: -189.197 flat angles C4'-P-C4' energy: -196.533 flat angles P-C4'-P energy: -120.282 tors. eta vs tors. theta energy: -215.482 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -2405.765533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2405.765533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2405.765533 (E_RNA) where: Base-Base interactions energy: -1610.670 where: short stacking energy: -732.116 Base-Backbone interact. energy: -0.559 local terms energy: -794.536306 where: bonds (distance) C4'-P energy: -154.325 bonds (distance) P-C4' energy: -162.649 flat angles C4'-P-C4' energy: -183.672 flat angles P-C4'-P energy: -114.462 tors. eta vs tors. theta energy: -179.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -2207.002108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2207.002108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2207.002108 (E_RNA) where: Base-Base interactions energy: -1443.032 where: short stacking energy: -667.771 Base-Backbone interact. energy: 3.871 local terms energy: -767.840819 where: bonds (distance) C4'-P energy: -159.577 bonds (distance) P-C4' energy: -140.063 flat angles C4'-P-C4' energy: -190.318 flat angles P-C4'-P energy: -112.873 tors. eta vs tors. theta energy: -165.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1958.934621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1958.934621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1958.934621 (E_RNA) where: Base-Base interactions energy: -1262.556 where: short stacking energy: -555.111 Base-Backbone interact. energy: 2.831 local terms energy: -699.209619 where: bonds (distance) C4'-P energy: -158.753 bonds (distance) P-C4' energy: -148.934 flat angles C4'-P-C4' energy: -164.572 flat angles P-C4'-P energy: -106.907 tors. eta vs tors. theta energy: -120.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1742.835716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1742.835716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1742.835716 (E_RNA) where: Base-Base interactions energy: -1078.914 where: short stacking energy: -487.079 Base-Backbone interact. energy: -0.136 local terms energy: -663.784848 where: bonds (distance) C4'-P energy: -146.491 bonds (distance) P-C4' energy: -159.316 flat angles C4'-P-C4' energy: -157.936 flat angles P-C4'-P energy: -100.223 tors. eta vs tors. theta energy: -99.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -1311.339109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1311.339109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.339109 (E_RNA) where: Base-Base interactions energy: -713.703 where: short stacking energy: -380.190 Base-Backbone interact. energy: 0.111 local terms energy: -597.746931 where: bonds (distance) C4'-P energy: -144.139 bonds (distance) P-C4' energy: -151.917 flat angles C4'-P-C4' energy: -141.360 flat angles P-C4'-P energy: -105.228 tors. eta vs tors. theta energy: -55.103 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -1069.419562 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.419562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.419562 (E_RNA) where: Base-Base interactions energy: -557.075 where: short stacking energy: -296.654 Base-Backbone interact. energy: -1.662 local terms energy: -510.682794 where: bonds (distance) C4'-P energy: -140.771 bonds (distance) P-C4' energy: -161.959 flat angles C4'-P-C4' energy: -125.034 flat angles P-C4'-P energy: -61.847 tors. eta vs tors. theta energy: -21.071 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -788.828554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.828554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.828554 (E_RNA) where: Base-Base interactions energy: -343.738 where: short stacking energy: -218.339 Base-Backbone interact. energy: 9.914 local terms energy: -455.004020 where: bonds (distance) C4'-P energy: -139.046 bonds (distance) P-C4' energy: -142.744 flat angles C4'-P-C4' energy: -105.614 flat angles P-C4'-P energy: -77.872 tors. eta vs tors. theta energy: 10.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -2913.839098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2913.839098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2913.839098 (E_RNA) where: Base-Base interactions energy: -1968.749 where: short stacking energy: -848.241 Base-Backbone interact. energy: -4.309 local terms energy: -940.781220 where: bonds (distance) C4'-P energy: -185.866 bonds (distance) P-C4' energy: -180.958 flat angles C4'-P-C4' energy: -184.422 flat angles P-C4'-P energy: -138.345 tors. eta vs tors. theta energy: -251.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -2728.626304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2728.626304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2728.626304 (E_RNA) where: Base-Base interactions energy: -1846.493 where: short stacking energy: -765.513 Base-Backbone interact. energy: 1.773 local terms energy: -883.905620 where: bonds (distance) C4'-P energy: -161.366 bonds (distance) P-C4' energy: -176.573 flat angles C4'-P-C4' energy: -200.129 flat angles P-C4'-P energy: -123.828 tors. eta vs tors. theta energy: -222.010 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -2522.638466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2522.638466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2522.638466 (E_RNA) where: Base-Base interactions energy: -1665.241 where: short stacking energy: -726.044 Base-Backbone interact. energy: -3.046 local terms energy: -854.351523 where: bonds (distance) C4'-P energy: -171.473 bonds (distance) P-C4' energy: -186.264 flat angles C4'-P-C4' energy: -172.066 flat angles P-C4'-P energy: -126.508 tors. eta vs tors. theta energy: -198.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -2378.684191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2378.684191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2378.684191 (E_RNA) where: Base-Base interactions energy: -1575.832 where: short stacking energy: -702.979 Base-Backbone interact. energy: -2.010 local terms energy: -800.842885 where: bonds (distance) C4'-P energy: -147.960 bonds (distance) P-C4' energy: -171.096 flat angles C4'-P-C4' energy: -180.293 flat angles P-C4'-P energy: -123.162 tors. eta vs tors. theta energy: -178.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -2200.837925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2200.837925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2200.837925 (E_RNA) where: Base-Base interactions energy: -1440.306 where: short stacking energy: -647.755 Base-Backbone interact. energy: -2.555 local terms energy: -757.976761 where: bonds (distance) C4'-P energy: -152.494 bonds (distance) P-C4' energy: -146.559 flat angles C4'-P-C4' energy: -179.720 flat angles P-C4'-P energy: -101.441 tors. eta vs tors. theta energy: -177.763 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1936.219886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1936.219886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1936.219886 (E_RNA) where: Base-Base interactions energy: -1249.378 where: short stacking energy: -537.345 Base-Backbone interact. energy: 1.359 local terms energy: -688.200403 where: bonds (distance) C4'-P energy: -142.017 bonds (distance) P-C4' energy: -161.445 flat angles C4'-P-C4' energy: -168.253 flat angles P-C4'-P energy: -110.428 tors. eta vs tors. theta energy: -106.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1759.739708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1759.739708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1759.739708 (E_RNA) where: Base-Base interactions energy: -1086.571 where: short stacking energy: -485.523 Base-Backbone interact. energy: -1.039 local terms energy: -672.130287 where: bonds (distance) C4'-P energy: -163.698 bonds (distance) P-C4' energy: -158.033 flat angles C4'-P-C4' energy: -159.151 flat angles P-C4'-P energy: -90.702 tors. eta vs tors. theta energy: -100.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -1186.327106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.327106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.327106 (E_RNA) where: Base-Base interactions energy: -634.122 where: short stacking energy: -349.504 Base-Backbone interact. energy: -2.472 local terms energy: -549.733318 where: bonds (distance) C4'-P energy: -139.145 bonds (distance) P-C4' energy: -136.421 flat angles C4'-P-C4' energy: -138.444 flat angles P-C4'-P energy: -106.121 tors. eta vs tors. theta energy: -29.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -1089.560961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.560961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.560961 (E_RNA) where: Base-Base interactions energy: -598.980 where: short stacking energy: -301.433 Base-Backbone interact. energy: 0.268 local terms energy: -490.849569 where: bonds (distance) C4'-P energy: -152.108 bonds (distance) P-C4' energy: -155.284 flat angles C4'-P-C4' energy: -86.529 flat angles P-C4'-P energy: -79.883 tors. eta vs tors. theta energy: -17.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -774.090123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.090123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.090123 (E_RNA) where: Base-Base interactions energy: -335.265 where: short stacking energy: -213.188 Base-Backbone interact. energy: -2.274 local terms energy: -436.551235 where: bonds (distance) C4'-P energy: -143.570 bonds (distance) P-C4' energy: -133.728 flat angles C4'-P-C4' energy: -101.271 flat angles P-C4'-P energy: -83.018 tors. eta vs tors. theta energy: 25.036 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -2927.279637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2927.279637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2927.279637 (E_RNA) where: Base-Base interactions energy: -1950.704 where: short stacking energy: -848.204 Base-Backbone interact. energy: -1.160 local terms energy: -975.415512 where: bonds (distance) C4'-P energy: -184.387 bonds (distance) P-C4' energy: -192.002 flat angles C4'-P-C4' energy: -216.663 flat angles P-C4'-P energy: -130.583 tors. eta vs tors. theta energy: -251.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -2657.470307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2657.470307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2657.470307 (E_RNA) where: Base-Base interactions energy: -1791.020 where: short stacking energy: -769.784 Base-Backbone interact. energy: 0.260 local terms energy: -866.710867 where: bonds (distance) C4'-P energy: -171.596 bonds (distance) P-C4' energy: -177.540 flat angles C4'-P-C4' energy: -191.255 flat angles P-C4'-P energy: -107.350 tors. eta vs tors. theta energy: -218.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -2588.935636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2588.935636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2588.935636 (E_RNA) where: Base-Base interactions energy: -1720.783 where: short stacking energy: -758.720 Base-Backbone interact. energy: 2.423 local terms energy: -870.576157 where: bonds (distance) C4'-P energy: -178.323 bonds (distance) P-C4' energy: -195.551 flat angles C4'-P-C4' energy: -187.573 flat angles P-C4'-P energy: -113.673 tors. eta vs tors. theta energy: -195.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -2426.597897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2426.597897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2426.597897 (E_RNA) where: Base-Base interactions energy: -1592.968 where: short stacking energy: -715.661 Base-Backbone interact. energy: -1.830 local terms energy: -831.799183 where: bonds (distance) C4'-P energy: -169.208 bonds (distance) P-C4' energy: -165.866 flat angles C4'-P-C4' energy: -197.061 flat angles P-C4'-P energy: -123.173 tors. eta vs tors. theta energy: -176.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -2194.141620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2194.141620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2194.141620 (E_RNA) where: Base-Base interactions energy: -1455.590 where: short stacking energy: -636.871 Base-Backbone interact. energy: 4.264 local terms energy: -742.815245 where: bonds (distance) C4'-P energy: -157.416 bonds (distance) P-C4' energy: -154.250 flat angles C4'-P-C4' energy: -154.783 flat angles P-C4'-P energy: -116.913 tors. eta vs tors. theta energy: -159.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1964.810946 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1964.810946 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1964.810946 (E_RNA) where: Base-Base interactions energy: -1271.035 where: short stacking energy: -562.267 Base-Backbone interact. energy: -5.653 local terms energy: -688.123599 where: bonds (distance) C4'-P energy: -150.510 bonds (distance) P-C4' energy: -158.804 flat angles C4'-P-C4' energy: -167.958 flat angles P-C4'-P energy: -92.009 tors. eta vs tors. theta energy: -118.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1698.218156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1698.218156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1698.218156 (E_RNA) where: Base-Base interactions energy: -1014.035 where: short stacking energy: -452.326 Base-Backbone interact. energy: 2.470 local terms energy: -686.653258 where: bonds (distance) C4'-P energy: -153.595 bonds (distance) P-C4' energy: -179.443 flat angles C4'-P-C4' energy: -172.744 flat angles P-C4'-P energy: -104.641 tors. eta vs tors. theta energy: -76.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -1168.349858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.349858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.349858 (E_RNA) where: Base-Base interactions energy: -591.473 where: short stacking energy: -312.787 Base-Backbone interact. energy: 1.884 local terms energy: -578.760844 where: bonds (distance) C4'-P energy: -142.285 bonds (distance) P-C4' energy: -148.623 flat angles C4'-P-C4' energy: -168.033 flat angles P-C4'-P energy: -80.442 tors. eta vs tors. theta energy: -39.377 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -1061.073722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1061.073722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.073722 (E_RNA) where: Base-Base interactions energy: -535.450 where: short stacking energy: -296.085 Base-Backbone interact. energy: 1.884 local terms energy: -527.507962 where: bonds (distance) C4'-P energy: -144.878 bonds (distance) P-C4' energy: -164.955 flat angles C4'-P-C4' energy: -132.800 flat angles P-C4'-P energy: -64.010 tors. eta vs tors. theta energy: -20.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -826.287835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.287835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.287835 (E_RNA) where: Base-Base interactions energy: -373.643 where: short stacking energy: -239.128 Base-Backbone interact. energy: 11.590 local terms energy: -464.234983 where: bonds (distance) C4'-P energy: -149.177 bonds (distance) P-C4' energy: -136.217 flat angles C4'-P-C4' energy: -133.911 flat angles P-C4'-P energy: -78.649 tors. eta vs tors. theta energy: 33.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -2937.956217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2937.956217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2937.956217 (E_RNA) where: Base-Base interactions energy: -2003.361 where: short stacking energy: -859.262 Base-Backbone interact. energy: -0.839 local terms energy: -933.756208 where: bonds (distance) C4'-P energy: -158.121 bonds (distance) P-C4' energy: -185.012 flat angles C4'-P-C4' energy: -196.495 flat angles P-C4'-P energy: -138.503 tors. eta vs tors. theta energy: -255.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -2666.954846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2666.954846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2666.954846 (E_RNA) where: Base-Base interactions energy: -1785.140 where: short stacking energy: -782.806 Base-Backbone interact. energy: -3.967 local terms energy: -877.847672 where: bonds (distance) C4'-P energy: -181.671 bonds (distance) P-C4' energy: -181.933 flat angles C4'-P-C4' energy: -193.855 flat angles P-C4'-P energy: -114.608 tors. eta vs tors. theta energy: -205.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -2565.170200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2565.170200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2565.170200 (E_RNA) where: Base-Base interactions energy: -1712.788 where: short stacking energy: -756.432 Base-Backbone interact. energy: -5.564 local terms energy: -846.817968 where: bonds (distance) C4'-P energy: -178.842 bonds (distance) P-C4' energy: -170.493 flat angles C4'-P-C4' energy: -195.305 flat angles P-C4'-P energy: -99.604 tors. eta vs tors. theta energy: -202.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -2409.033359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2409.033359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2409.033359 (E_RNA) where: Base-Base interactions energy: -1613.884 where: short stacking energy: -728.989 Base-Backbone interact. energy: 0.441 local terms energy: -795.590679 where: bonds (distance) C4'-P energy: -153.640 bonds (distance) P-C4' energy: -169.816 flat angles C4'-P-C4' energy: -170.672 flat angles P-C4'-P energy: -115.041 tors. eta vs tors. theta energy: -186.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -2275.769759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.769759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.769759 (E_RNA) where: Base-Base interactions energy: -1506.142 where: short stacking energy: -684.177 Base-Backbone interact. energy: -4.380 local terms energy: -765.247585 where: bonds (distance) C4'-P energy: -131.908 bonds (distance) P-C4' energy: -161.834 flat angles C4'-P-C4' energy: -184.600 flat angles P-C4'-P energy: -110.843 tors. eta vs tors. theta energy: -176.063 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1971.353129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1971.353129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1971.353129 (E_RNA) where: Base-Base interactions energy: -1253.154 where: short stacking energy: -570.161 Base-Backbone interact. energy: 2.574 local terms energy: -720.772927 where: bonds (distance) C4'-P energy: -157.431 bonds (distance) P-C4' energy: -176.495 flat angles C4'-P-C4' energy: -157.125 flat angles P-C4'-P energy: -98.827 tors. eta vs tors. theta energy: -130.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1634.168074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1634.168074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1634.168074 (E_RNA) where: Base-Base interactions energy: -962.776 where: short stacking energy: -455.884 Base-Backbone interact. energy: -3.390 local terms energy: -668.002892 where: bonds (distance) C4'-P energy: -160.397 bonds (distance) P-C4' energy: -170.484 flat angles C4'-P-C4' energy: -164.723 flat angles P-C4'-P energy: -103.645 tors. eta vs tors. theta energy: -68.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -1193.028043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.028043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.028043 (E_RNA) where: Base-Base interactions energy: -634.226 where: short stacking energy: -329.312 Base-Backbone interact. energy: 2.417 local terms energy: -561.219272 where: bonds (distance) C4'-P energy: -152.533 bonds (distance) P-C4' energy: -167.373 flat angles C4'-P-C4' energy: -143.525 flat angles P-C4'-P energy: -82.189 tors. eta vs tors. theta energy: -15.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -1035.581225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.581225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.581225 (E_RNA) where: Base-Base interactions energy: -523.838 where: short stacking energy: -302.468 Base-Backbone interact. energy: 0.383 local terms energy: -512.126301 where: bonds (distance) C4'-P energy: -124.449 bonds (distance) P-C4' energy: -134.460 flat angles C4'-P-C4' energy: -141.486 flat angles P-C4'-P energy: -81.218 tors. eta vs tors. theta energy: -30.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -831.982329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.982329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.982329 (E_RNA) where: Base-Base interactions energy: -349.455 where: short stacking energy: -203.600 Base-Backbone interact. energy: 8.907 local terms energy: -491.434159 where: bonds (distance) C4'-P energy: -168.090 bonds (distance) P-C4' energy: -157.145 flat angles C4'-P-C4' energy: -146.797 flat angles P-C4'-P energy: -48.851 tors. eta vs tors. theta energy: 29.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -2964.039231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2964.039231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2964.039231 (E_RNA) where: Base-Base interactions energy: -1994.655 where: short stacking energy: -876.987 Base-Backbone interact. energy: -1.755 local terms energy: -967.628786 where: bonds (distance) C4'-P energy: -188.554 bonds (distance) P-C4' energy: -188.116 flat angles C4'-P-C4' energy: -202.400 flat angles P-C4'-P energy: -128.936 tors. eta vs tors. theta energy: -259.623 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -2698.047297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2698.047297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2698.047297 (E_RNA) where: Base-Base interactions energy: -1803.437 where: short stacking energy: -797.238 Base-Backbone interact. energy: -1.488 local terms energy: -893.121956 where: bonds (distance) C4'-P energy: -176.003 bonds (distance) P-C4' energy: -154.372 flat angles C4'-P-C4' energy: -208.414 flat angles P-C4'-P energy: -128.011 tors. eta vs tors. theta energy: -226.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -2557.331650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2557.331650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2557.331650 (E_RNA) where: Base-Base interactions energy: -1691.522 where: short stacking energy: -750.876 Base-Backbone interact. energy: -6.777 local terms energy: -859.032911 where: bonds (distance) C4'-P energy: -156.839 bonds (distance) P-C4' energy: -178.599 flat angles C4'-P-C4' energy: -205.625 flat angles P-C4'-P energy: -124.061 tors. eta vs tors. theta energy: -193.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -2366.790813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2366.790813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2366.790813 (E_RNA) where: Base-Base interactions energy: -1572.429 where: short stacking energy: -713.261 Base-Backbone interact. energy: 7.989 local terms energy: -802.351546 where: bonds (distance) C4'-P energy: -160.312 bonds (distance) P-C4' energy: -172.596 flat angles C4'-P-C4' energy: -171.959 flat angles P-C4'-P energy: -118.372 tors. eta vs tors. theta energy: -179.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -2232.158188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2232.158188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2232.158188 (E_RNA) where: Base-Base interactions energy: -1474.198 where: short stacking energy: -647.925 Base-Backbone interact. energy: 3.608 local terms energy: -761.567704 where: bonds (distance) C4'-P energy: -139.790 bonds (distance) P-C4' energy: -152.448 flat angles C4'-P-C4' energy: -172.521 flat angles P-C4'-P energy: -113.792 tors. eta vs tors. theta energy: -183.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1871.574456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1871.574456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1871.574456 (E_RNA) where: Base-Base interactions energy: -1189.694 where: short stacking energy: -531.605 Base-Backbone interact. energy: -0.925 local terms energy: -680.955640 where: bonds (distance) C4'-P energy: -155.857 bonds (distance) P-C4' energy: -155.552 flat angles C4'-P-C4' energy: -147.084 flat angles P-C4'-P energy: -111.204 tors. eta vs tors. theta energy: -111.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1583.786865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1583.786865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.786865 (E_RNA) where: Base-Base interactions energy: -945.877 where: short stacking energy: -452.063 Base-Backbone interact. energy: -0.559 local terms energy: -637.350990 where: bonds (distance) C4'-P energy: -148.167 bonds (distance) P-C4' energy: -171.565 flat angles C4'-P-C4' energy: -142.004 flat angles P-C4'-P energy: -78.874 tors. eta vs tors. theta energy: -96.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -1217.400439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.400439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.400439 (E_RNA) where: Base-Base interactions energy: -632.517 where: short stacking energy: -371.461 Base-Backbone interact. energy: -1.641 local terms energy: -583.242729 where: bonds (distance) C4'-P energy: -142.669 bonds (distance) P-C4' energy: -160.921 flat angles C4'-P-C4' energy: -152.191 flat angles P-C4'-P energy: -87.521 tors. eta vs tors. theta energy: -39.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -1052.755156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.755156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.755156 (E_RNA) where: Base-Base interactions energy: -515.292 where: short stacking energy: -278.961 Base-Backbone interact. energy: 1.616 local terms energy: -539.079148 where: bonds (distance) C4'-P energy: -127.427 bonds (distance) P-C4' energy: -180.379 flat angles C4'-P-C4' energy: -142.957 flat angles P-C4'-P energy: -71.005 tors. eta vs tors. theta energy: -17.311 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -799.412370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.412370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.412370 (E_RNA) where: Base-Base interactions energy: -336.143 where: short stacking energy: -206.852 Base-Backbone interact. energy: 0.347 local terms energy: -463.616547 where: bonds (distance) C4'-P energy: -139.367 bonds (distance) P-C4' energy: -161.133 flat angles C4'-P-C4' energy: -110.435 flat angles P-C4'-P energy: -79.671 tors. eta vs tors. theta energy: 26.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -2942.554909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2942.554909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2942.554909 (E_RNA) where: Base-Base interactions energy: -1962.284 where: short stacking energy: -878.354 Base-Backbone interact. energy: -3.541 local terms energy: -976.729846 where: bonds (distance) C4'-P energy: -175.845 bonds (distance) P-C4' energy: -193.912 flat angles C4'-P-C4' energy: -214.925 flat angles P-C4'-P energy: -135.990 tors. eta vs tors. theta energy: -256.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -2757.574099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2757.574099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2757.574099 (E_RNA) where: Base-Base interactions energy: -1869.161 where: short stacking energy: -790.313 Base-Backbone interact. energy: -7.066 local terms energy: -881.347223 where: bonds (distance) C4'-P energy: -171.811 bonds (distance) P-C4' energy: -173.824 flat angles C4'-P-C4' energy: -205.074 flat angles P-C4'-P energy: -113.725 tors. eta vs tors. theta energy: -216.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -2569.686453 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2569.686453 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2569.686453 (E_RNA) where: Base-Base interactions energy: -1726.649 where: short stacking energy: -742.429 Base-Backbone interact. energy: -2.600 local terms energy: -840.437454 where: bonds (distance) C4'-P energy: -168.027 bonds (distance) P-C4' energy: -173.215 flat angles C4'-P-C4' energy: -183.104 flat angles P-C4'-P energy: -121.374 tors. eta vs tors. theta energy: -194.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -2509.271305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2509.271305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2509.271305 (E_RNA) where: Base-Base interactions energy: -1651.915 where: short stacking energy: -719.112 Base-Backbone interact. energy: -2.720 local terms energy: -854.636700 where: bonds (distance) C4'-P energy: -181.152 bonds (distance) P-C4' energy: -189.928 flat angles C4'-P-C4' energy: -166.442 flat angles P-C4'-P energy: -107.252 tors. eta vs tors. theta energy: -209.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -2255.250263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2255.250263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2255.250263 (E_RNA) where: Base-Base interactions energy: -1475.833 where: short stacking energy: -655.871 Base-Backbone interact. energy: -0.671 local terms energy: -778.746141 where: bonds (distance) C4'-P energy: -160.625 bonds (distance) P-C4' energy: -164.042 flat angles C4'-P-C4' energy: -185.165 flat angles P-C4'-P energy: -109.257 tors. eta vs tors. theta energy: -159.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1961.316479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1961.316479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1961.316479 (E_RNA) where: Base-Base interactions energy: -1235.326 where: short stacking energy: -583.178 Base-Backbone interact. energy: -0.388 local terms energy: -725.602847 where: bonds (distance) C4'-P energy: -159.380 bonds (distance) P-C4' energy: -152.447 flat angles C4'-P-C4' energy: -175.741 flat angles P-C4'-P energy: -99.484 tors. eta vs tors. theta energy: -138.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1608.794544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1608.794544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1608.794544 (E_RNA) where: Base-Base interactions energy: -963.467 where: short stacking energy: -477.874 Base-Backbone interact. energy: 2.787 local terms energy: -648.113854 where: bonds (distance) C4'-P energy: -157.159 bonds (distance) P-C4' energy: -150.843 flat angles C4'-P-C4' energy: -151.886 flat angles P-C4'-P energy: -102.499 tors. eta vs tors. theta energy: -85.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -1228.991430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.991430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.991430 (E_RNA) where: Base-Base interactions energy: -692.923 where: short stacking energy: -354.677 Base-Backbone interact. energy: 1.804 local terms energy: -537.873159 where: bonds (distance) C4'-P energy: -125.913 bonds (distance) P-C4' energy: -150.988 flat angles C4'-P-C4' energy: -149.613 flat angles P-C4'-P energy: -80.405 tors. eta vs tors. theta energy: -30.954 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -1038.612514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.612514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.612514 (E_RNA) where: Base-Base interactions energy: -543.354 where: short stacking energy: -307.985 Base-Backbone interact. energy: 0.606 local terms energy: -495.864395 where: bonds (distance) C4'-P energy: -133.934 bonds (distance) P-C4' energy: -148.888 flat angles C4'-P-C4' energy: -132.719 flat angles P-C4'-P energy: -81.511 tors. eta vs tors. theta energy: 1.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -849.744617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.744617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.744617 (E_RNA) where: Base-Base interactions energy: -408.064 where: short stacking energy: -243.925 Base-Backbone interact. energy: 1.609 local terms energy: -443.289086 where: bonds (distance) C4'-P energy: -125.943 bonds (distance) P-C4' energy: -157.940 flat angles C4'-P-C4' energy: -107.186 flat angles P-C4'-P energy: -61.869 tors. eta vs tors. theta energy: 9.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -2956.930086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2956.930086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2956.930086 (E_RNA) where: Base-Base interactions energy: -1991.061 where: short stacking energy: -896.822 Base-Backbone interact. energy: -4.497 local terms energy: -961.372560 where: bonds (distance) C4'-P energy: -172.134 bonds (distance) P-C4' energy: -197.124 flat angles C4'-P-C4' energy: -212.569 flat angles P-C4'-P energy: -119.279 tors. eta vs tors. theta energy: -260.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -2704.420411 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2704.420411 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2704.420411 (E_RNA) where: Base-Base interactions energy: -1798.003 where: short stacking energy: -762.323 Base-Backbone interact. energy: -5.023 local terms energy: -901.395019 where: bonds (distance) C4'-P energy: -192.674 bonds (distance) P-C4' energy: -182.986 flat angles C4'-P-C4' energy: -182.059 flat angles P-C4'-P energy: -129.166 tors. eta vs tors. theta energy: -214.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -2518.078694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2518.078694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2518.078694 (E_RNA) where: Base-Base interactions energy: -1691.503 where: short stacking energy: -720.470 Base-Backbone interact. energy: -0.063 local terms energy: -826.512980 where: bonds (distance) C4'-P energy: -170.166 bonds (distance) P-C4' energy: -178.868 flat angles C4'-P-C4' energy: -177.918 flat angles P-C4'-P energy: -116.139 tors. eta vs tors. theta energy: -183.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -2528.773174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2528.773174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2528.773174 (E_RNA) where: Base-Base interactions energy: -1681.370 where: short stacking energy: -723.574 Base-Backbone interact. energy: -4.817 local terms energy: -842.585644 where: bonds (distance) C4'-P energy: -171.357 bonds (distance) P-C4' energy: -167.935 flat angles C4'-P-C4' energy: -183.445 flat angles P-C4'-P energy: -114.544 tors. eta vs tors. theta energy: -205.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -2282.420879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2282.420879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2282.420879 (E_RNA) where: Base-Base interactions energy: -1502.877 where: short stacking energy: -659.140 Base-Backbone interact. energy: -0.019 local terms energy: -779.524902 where: bonds (distance) C4'-P energy: -165.000 bonds (distance) P-C4' energy: -164.945 flat angles C4'-P-C4' energy: -170.776 flat angles P-C4'-P energy: -102.972 tors. eta vs tors. theta energy: -175.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -2015.953159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2015.953159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2015.953159 (E_RNA) where: Base-Base interactions energy: -1279.224 where: short stacking energy: -567.838 Base-Backbone interact. energy: -1.088 local terms energy: -735.640635 where: bonds (distance) C4'-P energy: -154.723 bonds (distance) P-C4' energy: -153.361 flat angles C4'-P-C4' energy: -174.172 flat angles P-C4'-P energy: -120.716 tors. eta vs tors. theta energy: -132.668 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1599.909582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1599.909582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1599.909582 (E_RNA) where: Base-Base interactions energy: -987.256 where: short stacking energy: -458.461 Base-Backbone interact. energy: 0.812 local terms energy: -613.465644 where: bonds (distance) C4'-P energy: -147.047 bonds (distance) P-C4' energy: -168.686 flat angles C4'-P-C4' energy: -149.430 flat angles P-C4'-P energy: -72.888 tors. eta vs tors. theta energy: -75.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -1228.902895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1228.902895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.902895 (E_RNA) where: Base-Base interactions energy: -685.661 where: short stacking energy: -371.093 Base-Backbone interact. energy: -0.271 local terms energy: -542.970817 where: bonds (distance) C4'-P energy: -124.229 bonds (distance) P-C4' energy: -154.524 flat angles C4'-P-C4' energy: -133.439 flat angles P-C4'-P energy: -92.572 tors. eta vs tors. theta energy: -38.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -1110.483252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1110.483252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1110.483252 (E_RNA) where: Base-Base interactions energy: -577.624 where: short stacking energy: -285.000 Base-Backbone interact. energy: -3.540 local terms energy: -529.319583 where: bonds (distance) C4'-P energy: -152.565 bonds (distance) P-C4' energy: -153.296 flat angles C4'-P-C4' energy: -148.069 flat angles P-C4'-P energy: -83.343 tors. eta vs tors. theta energy: 7.953 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -838.543638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -838.543638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -838.543638 (E_RNA) where: Base-Base interactions energy: -375.699 where: short stacking energy: -207.654 Base-Backbone interact. energy: 5.458 local terms energy: -468.303062 where: bonds (distance) C4'-P energy: -140.516 bonds (distance) P-C4' energy: -154.148 flat angles C4'-P-C4' energy: -118.033 flat angles P-C4'-P energy: -82.160 tors. eta vs tors. theta energy: 26.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -2914.970416 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2914.970416 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2914.970416 (E_RNA) where: Base-Base interactions energy: -1958.793 where: short stacking energy: -854.140 Base-Backbone interact. energy: 1.372 local terms energy: -957.549198 where: bonds (distance) C4'-P energy: -165.921 bonds (distance) P-C4' energy: -188.697 flat angles C4'-P-C4' energy: -194.846 flat angles P-C4'-P energy: -145.184 tors. eta vs tors. theta energy: -262.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -2742.599600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2742.599600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2742.599600 (E_RNA) where: Base-Base interactions energy: -1839.581 where: short stacking energy: -779.838 Base-Backbone interact. energy: -4.835 local terms energy: -898.184155 where: bonds (distance) C4'-P energy: -164.435 bonds (distance) P-C4' energy: -178.990 flat angles C4'-P-C4' energy: -208.286 flat angles P-C4'-P energy: -131.430 tors. eta vs tors. theta energy: -215.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -2718.794721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2718.794721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2718.794721 (E_RNA) where: Base-Base interactions energy: -1828.377 where: short stacking energy: -753.852 Base-Backbone interact. energy: 0.191 local terms energy: -890.609280 where: bonds (distance) C4'-P energy: -170.658 bonds (distance) P-C4' energy: -180.717 flat angles C4'-P-C4' energy: -198.365 flat angles P-C4'-P energy: -125.438 tors. eta vs tors. theta energy: -215.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -2491.889291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2491.889291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2491.889291 (E_RNA) where: Base-Base interactions energy: -1653.989 where: short stacking energy: -706.878 Base-Backbone interact. energy: -2.347 local terms energy: -835.553960 where: bonds (distance) C4'-P energy: -167.246 bonds (distance) P-C4' energy: -175.109 flat angles C4'-P-C4' energy: -180.261 flat angles P-C4'-P energy: -117.333 tors. eta vs tors. theta energy: -195.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -2275.112054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2275.112054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2275.112054 (E_RNA) where: Base-Base interactions energy: -1482.875 where: short stacking energy: -646.958 Base-Backbone interact. energy: -4.998 local terms energy: -787.238915 where: bonds (distance) C4'-P energy: -163.984 bonds (distance) P-C4' energy: -152.743 flat angles C4'-P-C4' energy: -177.311 flat angles P-C4'-P energy: -119.015 tors. eta vs tors. theta energy: -174.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -2041.796458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2041.796458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2041.796458 (E_RNA) where: Base-Base interactions energy: -1354.723 where: short stacking energy: -594.468 Base-Backbone interact. energy: -2.398 local terms energy: -684.675138 where: bonds (distance) C4'-P energy: -142.245 bonds (distance) P-C4' energy: -154.567 flat angles C4'-P-C4' energy: -156.230 flat angles P-C4'-P energy: -96.297 tors. eta vs tors. theta energy: -135.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1662.839633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1662.839633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1662.839633 (E_RNA) where: Base-Base interactions energy: -1035.687 where: short stacking energy: -466.323 Base-Backbone interact. energy: -2.987 local terms energy: -624.165507 where: bonds (distance) C4'-P energy: -151.874 bonds (distance) P-C4' energy: -134.314 flat angles C4'-P-C4' energy: -154.833 flat angles P-C4'-P energy: -104.640 tors. eta vs tors. theta energy: -78.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -1236.500477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.500477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1236.500477 (E_RNA) where: Base-Base interactions energy: -703.586 where: short stacking energy: -377.706 Base-Backbone interact. energy: 0.756 local terms energy: -533.670492 where: bonds (distance) C4'-P energy: -143.379 bonds (distance) P-C4' energy: -124.143 flat angles C4'-P-C4' energy: -138.268 flat angles P-C4'-P energy: -91.648 tors. eta vs tors. theta energy: -36.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -1155.487794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.487794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.487794 (E_RNA) where: Base-Base interactions energy: -628.269 where: short stacking energy: -316.885 Base-Backbone interact. energy: -1.420 local terms energy: -525.798760 where: bonds (distance) C4'-P energy: -145.095 bonds (distance) P-C4' energy: -131.787 flat angles C4'-P-C4' energy: -144.548 flat angles P-C4'-P energy: -71.309 tors. eta vs tors. theta energy: -33.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -714.499228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.499228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.499228 (E_RNA) where: Base-Base interactions energy: -260.567 where: short stacking energy: -188.153 Base-Backbone interact. energy: 5.622 local terms energy: -459.553886 where: bonds (distance) C4'-P energy: -150.221 bonds (distance) P-C4' energy: -167.890 flat angles C4'-P-C4' energy: -112.617 flat angles P-C4'-P energy: -63.327 tors. eta vs tors. theta energy: 34.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -2952.347860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2952.347860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2952.347860 (E_RNA) where: Base-Base interactions energy: -1988.989 where: short stacking energy: -845.902 Base-Backbone interact. energy: 3.680 local terms energy: -967.039050 where: bonds (distance) C4'-P energy: -195.575 bonds (distance) P-C4' energy: -190.406 flat angles C4'-P-C4' energy: -207.730 flat angles P-C4'-P energy: -137.400 tors. eta vs tors. theta energy: -235.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -2771.968295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2771.968295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2771.968295 (E_RNA) where: Base-Base interactions energy: -1862.546 where: short stacking energy: -838.551 Base-Backbone interact. energy: -4.829 local terms energy: -904.593421 where: bonds (distance) C4'-P energy: -170.564 bonds (distance) P-C4' energy: -177.682 flat angles C4'-P-C4' energy: -189.690 flat angles P-C4'-P energy: -133.239 tors. eta vs tors. theta energy: -233.419 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -2680.102790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2680.102790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2680.102790 (E_RNA) where: Base-Base interactions energy: -1793.358 where: short stacking energy: -744.952 Base-Backbone interact. energy: -4.324 local terms energy: -882.420100 where: bonds (distance) C4'-P energy: -178.922 bonds (distance) P-C4' energy: -193.310 flat angles C4'-P-C4' energy: -184.008 flat angles P-C4'-P energy: -126.454 tors. eta vs tors. theta energy: -199.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -2462.119956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2462.119956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2462.119956 (E_RNA) where: Base-Base interactions energy: -1644.859 where: short stacking energy: -681.351 Base-Backbone interact. energy: -2.488 local terms energy: -814.772430 where: bonds (distance) C4'-P energy: -165.842 bonds (distance) P-C4' energy: -175.944 flat angles C4'-P-C4' energy: -196.199 flat angles P-C4'-P energy: -101.306 tors. eta vs tors. theta energy: -175.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -2253.329106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2253.329106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2253.329106 (E_RNA) where: Base-Base interactions energy: -1471.360 where: short stacking energy: -645.454 Base-Backbone interact. energy: -3.494 local terms energy: -778.474953 where: bonds (distance) C4'-P energy: -166.443 bonds (distance) P-C4' energy: -167.107 flat angles C4'-P-C4' energy: -179.743 flat angles P-C4'-P energy: -124.321 tors. eta vs tors. theta energy: -140.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1988.566214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1988.566214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1988.566214 (E_RNA) where: Base-Base interactions energy: -1305.859 where: short stacking energy: -565.453 Base-Backbone interact. energy: 8.452 local terms energy: -691.158977 where: bonds (distance) C4'-P energy: -153.452 bonds (distance) P-C4' energy: -168.363 flat angles C4'-P-C4' energy: -144.282 flat angles P-C4'-P energy: -97.662 tors. eta vs tors. theta energy: -127.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1638.322062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1638.322062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1638.322062 (E_RNA) where: Base-Base interactions energy: -989.918 where: short stacking energy: -469.992 Base-Backbone interact. energy: -3.048 local terms energy: -645.356235 where: bonds (distance) C4'-P energy: -157.585 bonds (distance) P-C4' energy: -173.189 flat angles C4'-P-C4' energy: -130.228 flat angles P-C4'-P energy: -85.966 tors. eta vs tors. theta energy: -98.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -1256.279785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.279785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.279785 (E_RNA) where: Base-Base interactions energy: -702.999 where: short stacking energy: -339.823 Base-Backbone interact. energy: 2.141 local terms energy: -555.421523 where: bonds (distance) C4'-P energy: -115.437 bonds (distance) P-C4' energy: -154.728 flat angles C4'-P-C4' energy: -160.896 flat angles P-C4'-P energy: -93.151 tors. eta vs tors. theta energy: -31.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -1102.052425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.052425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.052425 (E_RNA) where: Base-Base interactions energy: -579.345 where: short stacking energy: -290.672 Base-Backbone interact. energy: 5.733 local terms energy: -528.439989 where: bonds (distance) C4'-P energy: -147.918 bonds (distance) P-C4' energy: -144.859 flat angles C4'-P-C4' energy: -165.265 flat angles P-C4'-P energy: -80.794 tors. eta vs tors. theta energy: 10.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -775.034014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.034014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.034014 (E_RNA) where: Base-Base interactions energy: -303.655 where: short stacking energy: -209.233 Base-Backbone interact. energy: -2.880 local terms energy: -468.498728 where: bonds (distance) C4'-P energy: -153.216 bonds (distance) P-C4' energy: -160.604 flat angles C4'-P-C4' energy: -109.182 flat angles P-C4'-P energy: -69.842 tors. eta vs tors. theta energy: 24.346 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -2912.564281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2912.564281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2912.564281 (E_RNA) where: Base-Base interactions energy: -1992.949 where: short stacking energy: -868.212 Base-Backbone interact. energy: -3.309 local terms energy: -916.306178 where: bonds (distance) C4'-P energy: -161.166 bonds (distance) P-C4' energy: -178.462 flat angles C4'-P-C4' energy: -186.124 flat angles P-C4'-P energy: -141.528 tors. eta vs tors. theta energy: -249.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -2833.429551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2833.429551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2833.429551 (E_RNA) where: Base-Base interactions energy: -1888.863 where: short stacking energy: -842.517 Base-Backbone interact. energy: -2.324 local terms energy: -942.243307 where: bonds (distance) C4'-P energy: -162.887 bonds (distance) P-C4' energy: -209.466 flat angles C4'-P-C4' energy: -198.443 flat angles P-C4'-P energy: -133.986 tors. eta vs tors. theta energy: -237.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -2566.330232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2566.330232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2566.330232 (E_RNA) where: Base-Base interactions energy: -1689.431 where: short stacking energy: -736.104 Base-Backbone interact. energy: -6.539 local terms energy: -870.361219 where: bonds (distance) C4'-P energy: -164.545 bonds (distance) P-C4' energy: -166.364 flat angles C4'-P-C4' energy: -173.826 flat angles P-C4'-P energy: -140.257 tors. eta vs tors. theta energy: -225.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -2400.036502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2400.036502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2400.036502 (E_RNA) where: Base-Base interactions energy: -1583.807 where: short stacking energy: -671.452 Base-Backbone interact. energy: -4.119 local terms energy: -812.110150 where: bonds (distance) C4'-P energy: -174.443 bonds (distance) P-C4' energy: -171.774 flat angles C4'-P-C4' energy: -166.716 flat angles P-C4'-P energy: -123.016 tors. eta vs tors. theta energy: -176.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -2237.991655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2237.991655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2237.991655 (E_RNA) where: Base-Base interactions energy: -1462.417 where: short stacking energy: -630.883 Base-Backbone interact. energy: -0.656 local terms energy: -774.918414 where: bonds (distance) C4'-P energy: -160.933 bonds (distance) P-C4' energy: -172.742 flat angles C4'-P-C4' energy: -177.573 flat angles P-C4'-P energy: -99.675 tors. eta vs tors. theta energy: -163.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1955.683552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1955.683552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1955.683552 (E_RNA) where: Base-Base interactions energy: -1278.260 where: short stacking energy: -556.938 Base-Backbone interact. energy: -1.324 local terms energy: -676.099491 where: bonds (distance) C4'-P energy: -156.234 bonds (distance) P-C4' energy: -152.425 flat angles C4'-P-C4' energy: -159.066 flat angles P-C4'-P energy: -91.798 tors. eta vs tors. theta energy: -116.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -1696.837590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1696.837590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1696.837590 (E_RNA) where: Base-Base interactions energy: -1025.864 where: short stacking energy: -487.886 Base-Backbone interact. energy: -1.975 local terms energy: -668.998889 where: bonds (distance) C4'-P energy: -120.110 bonds (distance) P-C4' energy: -180.626 flat angles C4'-P-C4' energy: -165.283 flat angles P-C4'-P energy: -108.452 tors. eta vs tors. theta energy: -94.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -1274.141722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.141722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.141722 (E_RNA) where: Base-Base interactions energy: -711.562 where: short stacking energy: -374.273 Base-Backbone interact. energy: 4.573 local terms energy: -567.152448 where: bonds (distance) C4'-P energy: -146.710 bonds (distance) P-C4' energy: -161.073 flat angles C4'-P-C4' energy: -143.148 flat angles P-C4'-P energy: -90.424 tors. eta vs tors. theta energy: -25.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -1120.384710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.384710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1120.384710 (E_RNA) where: Base-Base interactions energy: -629.617 where: short stacking energy: -345.140 Base-Backbone interact. energy: -0.173 local terms energy: -490.594441 where: bonds (distance) C4'-P energy: -140.853 bonds (distance) P-C4' energy: -150.223 flat angles C4'-P-C4' energy: -136.285 flat angles P-C4'-P energy: -49.451 tors. eta vs tors. theta energy: -13.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -826.299004 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.299004 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.299004 (E_RNA) where: Base-Base interactions energy: -369.720 where: short stacking energy: -245.764 Base-Backbone interact. energy: -1.334 local terms energy: -455.244762 where: bonds (distance) C4'-P energy: -117.408 bonds (distance) P-C4' energy: -156.173 flat angles C4'-P-C4' energy: -136.089 flat angles P-C4'-P energy: -65.591 tors. eta vs tors. theta energy: 20.016 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -2952.274207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2952.274207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2952.274207 (E_RNA) where: Base-Base interactions energy: -2001.433 where: short stacking energy: -881.191 Base-Backbone interact. energy: 3.810 local terms energy: -954.651212 where: bonds (distance) C4'-P energy: -176.261 bonds (distance) P-C4' energy: -181.547 flat angles C4'-P-C4' energy: -191.014 flat angles P-C4'-P energy: -136.575 tors. eta vs tors. theta energy: -269.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -2774.123893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2774.123893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2774.123893 (E_RNA) where: Base-Base interactions energy: -1855.693 where: short stacking energy: -804.280 Base-Backbone interact. energy: -3.059 local terms energy: -915.371592 where: bonds (distance) C4'-P energy: -171.705 bonds (distance) P-C4' energy: -189.188 flat angles C4'-P-C4' energy: -190.493 flat angles P-C4'-P energy: -115.854 tors. eta vs tors. theta energy: -248.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -2574.075055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2574.075055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2574.075055 (E_RNA) where: Base-Base interactions energy: -1714.833 where: short stacking energy: -726.696 Base-Backbone interact. energy: -5.795 local terms energy: -853.447815 where: bonds (distance) C4'-P energy: -173.518 bonds (distance) P-C4' energy: -163.474 flat angles C4'-P-C4' energy: -174.418 flat angles P-C4'-P energy: -131.097 tors. eta vs tors. theta energy: -210.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -2421.793532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2421.793532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2421.793532 (E_RNA) where: Base-Base interactions energy: -1576.143 where: short stacking energy: -715.946 Base-Backbone interact. energy: -3.809 local terms energy: -841.841315 where: bonds (distance) C4'-P energy: -170.852 bonds (distance) P-C4' energy: -167.961 flat angles C4'-P-C4' energy: -197.237 flat angles P-C4'-P energy: -117.800 tors. eta vs tors. theta energy: -187.992 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -2206.770768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2206.770768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2206.770768 (E_RNA) where: Base-Base interactions energy: -1408.853 where: short stacking energy: -642.649 Base-Backbone interact. energy: 1.971 local terms energy: -799.888315 where: bonds (distance) C4'-P energy: -153.748 bonds (distance) P-C4' energy: -178.199 flat angles C4'-P-C4' energy: -172.488 flat angles P-C4'-P energy: -110.994 tors. eta vs tors. theta energy: -184.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1982.455241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1982.455241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1982.455241 (E_RNA) where: Base-Base interactions energy: -1292.599 where: short stacking energy: -576.990 Base-Backbone interact. energy: 3.198 local terms energy: -693.053809 where: bonds (distance) C4'-P energy: -153.869 bonds (distance) P-C4' energy: -147.704 flat angles C4'-P-C4' energy: -166.680 flat angles P-C4'-P energy: -105.839 tors. eta vs tors. theta energy: -118.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -1754.575535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1754.575535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.575535 (E_RNA) where: Base-Base interactions energy: -1085.922 where: short stacking energy: -491.430 Base-Backbone interact. energy: -3.398 local terms energy: -665.254755 where: bonds (distance) C4'-P energy: -157.123 bonds (distance) P-C4' energy: -137.154 flat angles C4'-P-C4' energy: -171.904 flat angles P-C4'-P energy: -103.255 tors. eta vs tors. theta energy: -95.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -1186.264193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.264193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.264193 (E_RNA) where: Base-Base interactions energy: -640.616 where: short stacking energy: -352.694 Base-Backbone interact. energy: -2.622 local terms energy: -543.025700 where: bonds (distance) C4'-P energy: -140.848 bonds (distance) P-C4' energy: -167.064 flat angles C4'-P-C4' energy: -129.200 flat angles P-C4'-P energy: -77.073 tors. eta vs tors. theta energy: -28.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -1068.234908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.234908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.234908 (E_RNA) where: Base-Base interactions energy: -564.828 where: short stacking energy: -326.565 Base-Backbone interact. energy: 2.483 local terms energy: -505.890535 where: bonds (distance) C4'-P energy: -130.724 bonds (distance) P-C4' energy: -145.847 flat angles C4'-P-C4' energy: -144.293 flat angles P-C4'-P energy: -64.442 tors. eta vs tors. theta energy: -20.585 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -847.981786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.981786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.981786 (E_RNA) where: Base-Base interactions energy: -363.585 where: short stacking energy: -209.600 Base-Backbone interact. energy: 3.184 local terms energy: -487.580675 where: bonds (distance) C4'-P energy: -146.061 bonds (distance) P-C4' energy: -137.384 flat angles C4'-P-C4' energy: -143.359 flat angles P-C4'-P energy: -81.692 tors. eta vs tors. theta energy: 20.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -2957.137159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2957.137159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2957.137159 (E_RNA) where: Base-Base interactions energy: -2000.985 where: short stacking energy: -862.555 Base-Backbone interact. energy: -6.920 local terms energy: -949.232049 where: bonds (distance) C4'-P energy: -190.050 bonds (distance) P-C4' energy: -192.685 flat angles C4'-P-C4' energy: -189.418 flat angles P-C4'-P energy: -133.620 tors. eta vs tors. theta energy: -243.460 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -2761.975045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2761.975045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2761.975045 (E_RNA) where: Base-Base interactions energy: -1863.208 where: short stacking energy: -817.506 Base-Backbone interact. energy: -1.669 local terms energy: -897.097995 where: bonds (distance) C4'-P energy: -164.698 bonds (distance) P-C4' energy: -168.084 flat angles C4'-P-C4' energy: -216.493 flat angles P-C4'-P energy: -118.014 tors. eta vs tors. theta energy: -229.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -2622.555746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2622.555746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2622.555746 (E_RNA) where: Base-Base interactions energy: -1741.321 where: short stacking energy: -767.528 Base-Backbone interact. energy: -3.035 local terms energy: -878.199066 where: bonds (distance) C4'-P energy: -187.739 bonds (distance) P-C4' energy: -175.893 flat angles C4'-P-C4' energy: -180.470 flat angles P-C4'-P energy: -121.601 tors. eta vs tors. theta energy: -212.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -2466.194834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2466.194834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2466.194834 (E_RNA) where: Base-Base interactions energy: -1642.760 where: short stacking energy: -735.956 Base-Backbone interact. energy: 1.500 local terms energy: -824.935006 where: bonds (distance) C4'-P energy: -139.418 bonds (distance) P-C4' energy: -180.757 flat angles C4'-P-C4' energy: -185.983 flat angles P-C4'-P energy: -123.450 tors. eta vs tors. theta energy: -195.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -2230.803107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2230.803107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2230.803107 (E_RNA) where: Base-Base interactions energy: -1441.296 where: short stacking energy: -665.978 Base-Backbone interact. energy: -0.970 local terms energy: -788.537101 where: bonds (distance) C4'-P energy: -163.184 bonds (distance) P-C4' energy: -160.890 flat angles C4'-P-C4' energy: -188.310 flat angles P-C4'-P energy: -109.421 tors. eta vs tors. theta energy: -166.732 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1974.423401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1974.423401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1974.423401 (E_RNA) where: Base-Base interactions energy: -1289.425 where: short stacking energy: -556.040 Base-Backbone interact. energy: -4.932 local terms energy: -680.066093 where: bonds (distance) C4'-P energy: -136.079 bonds (distance) P-C4' energy: -163.950 flat angles C4'-P-C4' energy: -148.095 flat angles P-C4'-P energy: -109.620 tors. eta vs tors. theta energy: -122.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -1842.341464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1842.341464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1842.341464 (E_RNA) where: Base-Base interactions energy: -1184.696 where: short stacking energy: -538.348 Base-Backbone interact. energy: -0.846 local terms energy: -656.799147 where: bonds (distance) C4'-P energy: -124.074 bonds (distance) P-C4' energy: -159.478 flat angles C4'-P-C4' energy: -157.335 flat angles P-C4'-P energy: -97.343 tors. eta vs tors. theta energy: -118.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -1174.338362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.338362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.338362 (E_RNA) where: Base-Base interactions energy: -611.176 where: short stacking energy: -337.921 Base-Backbone interact. energy: -3.125 local terms energy: -560.037026 where: bonds (distance) C4'-P energy: -160.330 bonds (distance) P-C4' energy: -161.924 flat angles C4'-P-C4' energy: -127.771 flat angles P-C4'-P energy: -95.223 tors. eta vs tors. theta energy: -14.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -1104.271329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.271329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.271329 (E_RNA) where: Base-Base interactions energy: -556.362 where: short stacking energy: -310.368 Base-Backbone interact. energy: -2.643 local terms energy: -545.266076 where: bonds (distance) C4'-P energy: -157.483 bonds (distance) P-C4' energy: -147.840 flat angles C4'-P-C4' energy: -119.739 flat angles P-C4'-P energy: -87.733 tors. eta vs tors. theta energy: -32.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -833.508878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -833.508878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -833.508878 (E_RNA) where: Base-Base interactions energy: -357.700 where: short stacking energy: -192.441 Base-Backbone interact. energy: -0.308 local terms energy: -475.500509 where: bonds (distance) C4'-P energy: -123.821 bonds (distance) P-C4' energy: -162.919 flat angles C4'-P-C4' energy: -129.541 flat angles P-C4'-P energy: -98.957 tors. eta vs tors. theta energy: 39.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -2945.438149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2945.438149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2945.438149 (E_RNA) where: Base-Base interactions energy: -1979.926 where: short stacking energy: -847.799 Base-Backbone interact. energy: -1.819 local terms energy: -963.692364 where: bonds (distance) C4'-P energy: -180.587 bonds (distance) P-C4' energy: -199.666 flat angles C4'-P-C4' energy: -207.745 flat angles P-C4'-P energy: -128.284 tors. eta vs tors. theta energy: -247.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -2784.026497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2784.026497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2784.026497 (E_RNA) where: Base-Base interactions energy: -1878.154 where: short stacking energy: -820.069 Base-Backbone interact. energy: -2.961 local terms energy: -902.911735 where: bonds (distance) C4'-P energy: -164.791 bonds (distance) P-C4' energy: -181.744 flat angles C4'-P-C4' energy: -191.873 flat angles P-C4'-P energy: -142.291 tors. eta vs tors. theta energy: -222.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -2584.604296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2584.604296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2584.604296 (E_RNA) where: Base-Base interactions energy: -1744.175 where: short stacking energy: -767.816 Base-Backbone interact. energy: -6.676 local terms energy: -833.753505 where: bonds (distance) C4'-P energy: -167.132 bonds (distance) P-C4' energy: -167.170 flat angles C4'-P-C4' energy: -196.064 flat angles P-C4'-P energy: -96.513 tors. eta vs tors. theta energy: -206.874 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -2406.788607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2406.788607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2406.788607 (E_RNA) where: Base-Base interactions energy: -1601.715 where: short stacking energy: -725.657 Base-Backbone interact. energy: 4.293 local terms energy: -809.366615 where: bonds (distance) C4'-P energy: -167.222 bonds (distance) P-C4' energy: -159.287 flat angles C4'-P-C4' energy: -189.479 flat angles P-C4'-P energy: -103.603 tors. eta vs tors. theta energy: -189.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -2210.452795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2210.452795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2210.452795 (E_RNA) where: Base-Base interactions energy: -1464.872 where: short stacking energy: -648.030 Base-Backbone interact. energy: -3.921 local terms energy: -741.659607 where: bonds (distance) C4'-P energy: -138.870 bonds (distance) P-C4' energy: -169.165 flat angles C4'-P-C4' energy: -157.324 flat angles P-C4'-P energy: -116.119 tors. eta vs tors. theta energy: -160.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1889.161484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1889.161484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1889.161484 (E_RNA) where: Base-Base interactions energy: -1176.380 where: short stacking energy: -527.192 Base-Backbone interact. energy: 1.845 local terms energy: -714.626494 where: bonds (distance) C4'-P energy: -150.982 bonds (distance) P-C4' energy: -165.331 flat angles C4'-P-C4' energy: -164.430 flat angles P-C4'-P energy: -111.462 tors. eta vs tors. theta energy: -122.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1866.854627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1866.854627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1866.854627 (E_RNA) where: Base-Base interactions energy: -1166.741 where: short stacking energy: -530.747 Base-Backbone interact. energy: -4.462 local terms energy: -695.651500 where: bonds (distance) C4'-P energy: -167.850 bonds (distance) P-C4' energy: -161.358 flat angles C4'-P-C4' energy: -172.067 flat angles P-C4'-P energy: -87.802 tors. eta vs tors. theta energy: -106.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -1176.500061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.500061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.500061 (E_RNA) where: Base-Base interactions energy: -618.605 where: short stacking energy: -353.480 Base-Backbone interact. energy: 1.909 local terms energy: -559.804504 where: bonds (distance) C4'-P energy: -146.216 bonds (distance) P-C4' energy: -130.374 flat angles C4'-P-C4' energy: -144.492 flat angles P-C4'-P energy: -106.441 tors. eta vs tors. theta energy: -32.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -1051.180740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.180740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.180740 (E_RNA) where: Base-Base interactions energy: -527.162 where: short stacking energy: -298.090 Base-Backbone interact. energy: -1.757 local terms energy: -522.261635 where: bonds (distance) C4'-P energy: -154.161 bonds (distance) P-C4' energy: -151.728 flat angles C4'-P-C4' energy: -122.548 flat angles P-C4'-P energy: -76.965 tors. eta vs tors. theta energy: -16.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -918.249174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -918.249174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -918.249174 (E_RNA) where: Base-Base interactions energy: -419.295 where: short stacking energy: -240.721 Base-Backbone interact. energy: 1.000 local terms energy: -499.954292 where: bonds (distance) C4'-P energy: -141.193 bonds (distance) P-C4' energy: -139.020 flat angles C4'-P-C4' energy: -144.139 flat angles P-C4'-P energy: -77.965 tors. eta vs tors. theta energy: 2.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -2976.036653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2976.036653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2976.036653 (E_RNA) where: Base-Base interactions energy: -2021.851 where: short stacking energy: -872.458 Base-Backbone interact. energy: 1.106 local terms energy: -955.292429 where: bonds (distance) C4'-P energy: -180.902 bonds (distance) P-C4' energy: -187.678 flat angles C4'-P-C4' energy: -190.622 flat angles P-C4'-P energy: -140.794 tors. eta vs tors. theta energy: -255.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -2771.844118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2771.844118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2771.844118 (E_RNA) where: Base-Base interactions energy: -1877.823 where: short stacking energy: -809.914 Base-Backbone interact. energy: 2.428 local terms energy: -896.449634 where: bonds (distance) C4'-P energy: -176.027 bonds (distance) P-C4' energy: -176.144 flat angles C4'-P-C4' energy: -199.251 flat angles P-C4'-P energy: -125.931 tors. eta vs tors. theta energy: -219.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -2576.929460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2576.929460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2576.929460 (E_RNA) where: Base-Base interactions energy: -1740.242 where: short stacking energy: -787.637 Base-Backbone interact. energy: -3.059 local terms energy: -833.627951 where: bonds (distance) C4'-P energy: -151.616 bonds (distance) P-C4' energy: -177.196 flat angles C4'-P-C4' energy: -178.257 flat angles P-C4'-P energy: -127.326 tors. eta vs tors. theta energy: -199.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -2407.263586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2407.263586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2407.263586 (E_RNA) where: Base-Base interactions energy: -1615.388 where: short stacking energy: -698.108 Base-Backbone interact. energy: 3.634 local terms energy: -795.508949 where: bonds (distance) C4'-P energy: -162.412 bonds (distance) P-C4' energy: -164.474 flat angles C4'-P-C4' energy: -178.381 flat angles P-C4'-P energy: -103.419 tors. eta vs tors. theta energy: -186.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -2277.430886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2277.430886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2277.430886 (E_RNA) where: Base-Base interactions energy: -1477.114 where: short stacking energy: -673.143 Base-Backbone interact. energy: 5.954 local terms energy: -806.270720 where: bonds (distance) C4'-P energy: -150.685 bonds (distance) P-C4' energy: -177.587 flat angles C4'-P-C4' energy: -171.392 flat angles P-C4'-P energy: -115.725 tors. eta vs tors. theta energy: -190.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -1929.457455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1929.457455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1929.457455 (E_RNA) where: Base-Base interactions energy: -1230.801 where: short stacking energy: -577.488 Base-Backbone interact. energy: -3.828 local terms energy: -694.828348 where: bonds (distance) C4'-P energy: -147.792 bonds (distance) P-C4' energy: -165.232 flat angles C4'-P-C4' energy: -168.612 flat angles P-C4'-P energy: -88.157 tors. eta vs tors. theta energy: -125.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1845.718226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1845.718226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1845.718226 (E_RNA) where: Base-Base interactions energy: -1194.485 where: short stacking energy: -522.827 Base-Backbone interact. energy: 2.009 local terms energy: -653.242280 where: bonds (distance) C4'-P energy: -151.461 bonds (distance) P-C4' energy: -138.919 flat angles C4'-P-C4' energy: -153.523 flat angles P-C4'-P energy: -87.751 tors. eta vs tors. theta energy: -121.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -1186.793897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.793897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.793897 (E_RNA) where: Base-Base interactions energy: -637.848 where: short stacking energy: -337.431 Base-Backbone interact. energy: -0.450 local terms energy: -548.496306 where: bonds (distance) C4'-P energy: -149.922 bonds (distance) P-C4' energy: -147.846 flat angles C4'-P-C4' energy: -145.529 flat angles P-C4'-P energy: -82.615 tors. eta vs tors. theta energy: -22.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -897.456409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.456409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.456409 (E_RNA) where: Base-Base interactions energy: -411.593 where: short stacking energy: -274.601 Base-Backbone interact. energy: 5.452 local terms energy: -491.315533 where: bonds (distance) C4'-P energy: -137.956 bonds (distance) P-C4' energy: -126.488 flat angles C4'-P-C4' energy: -144.525 flat angles P-C4'-P energy: -59.862 tors. eta vs tors. theta energy: -22.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -927.147953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -927.147953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -927.147953 (E_RNA) where: Base-Base interactions energy: -481.527 where: short stacking energy: -280.699 Base-Backbone interact. energy: 0.913 local terms energy: -446.534136 where: bonds (distance) C4'-P energy: -126.632 bonds (distance) P-C4' energy: -155.392 flat angles C4'-P-C4' energy: -89.481 flat angles P-C4'-P energy: -80.227 tors. eta vs tors. theta energy: 5.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -2956.235179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2956.235179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2956.235179 (E_RNA) where: Base-Base interactions energy: -2018.764 where: short stacking energy: -862.631 Base-Backbone interact. energy: -2.082 local terms energy: -935.389302 where: bonds (distance) C4'-P energy: -164.277 bonds (distance) P-C4' energy: -181.811 flat angles C4'-P-C4' energy: -205.572 flat angles P-C4'-P energy: -137.914 tors. eta vs tors. theta energy: -245.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -2797.302923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2797.302923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2797.302923 (E_RNA) where: Base-Base interactions energy: -1882.797 where: short stacking energy: -820.764 Base-Backbone interact. energy: -3.610 local terms energy: -910.895804 where: bonds (distance) C4'-P energy: -176.219 bonds (distance) P-C4' energy: -175.424 flat angles C4'-P-C4' energy: -184.935 flat angles P-C4'-P energy: -135.449 tors. eta vs tors. theta energy: -238.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -2589.779362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2589.779362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2589.779362 (E_RNA) where: Base-Base interactions energy: -1713.005 where: short stacking energy: -730.725 Base-Backbone interact. energy: 0.682 local terms energy: -877.455581 where: bonds (distance) C4'-P energy: -173.715 bonds (distance) P-C4' energy: -183.853 flat angles C4'-P-C4' energy: -195.127 flat angles P-C4'-P energy: -125.880 tors. eta vs tors. theta energy: -198.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -2439.779328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2439.779328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2439.779328 (E_RNA) where: Base-Base interactions energy: -1625.768 where: short stacking energy: -734.928 Base-Backbone interact. energy: -2.561 local terms energy: -811.450017 where: bonds (distance) C4'-P energy: -160.657 bonds (distance) P-C4' energy: -150.884 flat angles C4'-P-C4' energy: -188.703 flat angles P-C4'-P energy: -121.392 tors. eta vs tors. theta energy: -189.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -2260.398647 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2260.398647 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2260.398647 (E_RNA) where: Base-Base interactions energy: -1450.464 where: short stacking energy: -627.390 Base-Backbone interact. energy: -0.316 local terms energy: -809.618254 where: bonds (distance) C4'-P energy: -172.901 bonds (distance) P-C4' energy: -178.126 flat angles C4'-P-C4' energy: -181.211 flat angles P-C4'-P energy: -106.479 tors. eta vs tors. theta energy: -170.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -1951.398075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1951.398075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1951.398075 (E_RNA) where: Base-Base interactions energy: -1263.544 where: short stacking energy: -596.463 Base-Backbone interact. energy: 2.413 local terms energy: -690.267299 where: bonds (distance) C4'-P energy: -139.555 bonds (distance) P-C4' energy: -139.202 flat angles C4'-P-C4' energy: -158.707 flat angles P-C4'-P energy: -118.947 tors. eta vs tors. theta energy: -133.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -1749.585969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1749.585969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1749.585969 (E_RNA) where: Base-Base interactions energy: -1065.572 where: short stacking energy: -498.509 Base-Backbone interact. energy: 1.611 local terms energy: -685.625616 where: bonds (distance) C4'-P energy: -150.818 bonds (distance) P-C4' energy: -155.308 flat angles C4'-P-C4' energy: -169.471 flat angles P-C4'-P energy: -102.606 tors. eta vs tors. theta energy: -107.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -1204.000791 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1204.000791 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1204.000791 (E_RNA) where: Base-Base interactions energy: -664.921 where: short stacking energy: -363.951 Base-Backbone interact. energy: 1.292 local terms energy: -540.371420 where: bonds (distance) C4'-P energy: -150.538 bonds (distance) P-C4' energy: -152.119 flat angles C4'-P-C4' energy: -130.755 flat angles P-C4'-P energy: -74.234 tors. eta vs tors. theta energy: -32.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -882.505374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -882.505374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -882.505374 (E_RNA) where: Base-Base interactions energy: -409.272 where: short stacking energy: -265.015 Base-Backbone interact. energy: 3.412 local terms energy: -476.645673 where: bonds (distance) C4'-P energy: -145.756 bonds (distance) P-C4' energy: -148.510 flat angles C4'-P-C4' energy: -112.594 flat angles P-C4'-P energy: -77.939 tors. eta vs tors. theta energy: 8.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -895.530318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -895.530318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -895.530318 (E_RNA) where: Base-Base interactions energy: -442.110 where: short stacking energy: -247.278 Base-Backbone interact. energy: -1.946 local terms energy: -451.474501 where: bonds (distance) C4'-P energy: -142.015 bonds (distance) P-C4' energy: -122.932 flat angles C4'-P-C4' energy: -92.415 flat angles P-C4'-P energy: -92.175 tors. eta vs tors. theta energy: -1.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -2979.612954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2979.612954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2979.612954 (E_RNA) where: Base-Base interactions energy: -2007.790 where: short stacking energy: -853.147 Base-Backbone interact. energy: -5.335 local terms energy: -966.487554 where: bonds (distance) C4'-P energy: -192.787 bonds (distance) P-C4' energy: -181.743 flat angles C4'-P-C4' energy: -208.325 flat angles P-C4'-P energy: -133.382 tors. eta vs tors. theta energy: -250.251 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -2813.900470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2813.900470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2813.900470 (E_RNA) where: Base-Base interactions energy: -1899.888 where: short stacking energy: -832.247 Base-Backbone interact. energy: -0.979 local terms energy: -913.033426 where: bonds (distance) C4'-P energy: -163.041 bonds (distance) P-C4' energy: -177.008 flat angles C4'-P-C4' energy: -201.248 flat angles P-C4'-P energy: -131.740 tors. eta vs tors. theta energy: -239.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -2597.308664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2597.308664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2597.308664 (E_RNA) where: Base-Base interactions energy: -1751.750 where: short stacking energy: -752.513 Base-Backbone interact. energy: -6.533 local terms energy: -839.025413 where: bonds (distance) C4'-P energy: -159.391 bonds (distance) P-C4' energy: -162.149 flat angles C4'-P-C4' energy: -200.118 flat angles P-C4'-P energy: -127.654 tors. eta vs tors. theta energy: -189.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -2426.931249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2426.931249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2426.931249 (E_RNA) where: Base-Base interactions energy: -1632.211 where: short stacking energy: -697.328 Base-Backbone interact. energy: -3.079 local terms energy: -791.640778 where: bonds (distance) C4'-P energy: -157.791 bonds (distance) P-C4' energy: -168.803 flat angles C4'-P-C4' energy: -193.970 flat angles P-C4'-P energy: -106.580 tors. eta vs tors. theta energy: -164.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -2237.386476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2237.386476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2237.386476 (E_RNA) where: Base-Base interactions energy: -1490.015 where: short stacking energy: -646.904 Base-Backbone interact. energy: 0.630 local terms energy: -748.001724 where: bonds (distance) C4'-P energy: -155.255 bonds (distance) P-C4' energy: -166.061 flat angles C4'-P-C4' energy: -170.721 flat angles P-C4'-P energy: -94.981 tors. eta vs tors. theta energy: -160.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -1962.540804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1962.540804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1962.540804 (E_RNA) where: Base-Base interactions energy: -1260.190 where: short stacking energy: -536.404 Base-Backbone interact. energy: -0.111 local terms energy: -702.239636 where: bonds (distance) C4'-P energy: -150.853 bonds (distance) P-C4' energy: -165.946 flat angles C4'-P-C4' energy: -154.905 flat angles P-C4'-P energy: -105.988 tors. eta vs tors. theta energy: -124.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1683.001402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1683.001402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1683.001402 (E_RNA) where: Base-Base interactions energy: -1076.253 where: short stacking energy: -492.178 Base-Backbone interact. energy: -0.536 local terms energy: -606.213021 where: bonds (distance) C4'-P energy: -136.075 bonds (distance) P-C4' energy: -150.503 flat angles C4'-P-C4' energy: -154.156 flat angles P-C4'-P energy: -87.086 tors. eta vs tors. theta energy: -78.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -1197.285152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.285152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.285152 (E_RNA) where: Base-Base interactions energy: -636.558 where: short stacking energy: -336.168 Base-Backbone interact. energy: -3.489 local terms energy: -557.237707 where: bonds (distance) C4'-P energy: -156.001 bonds (distance) P-C4' energy: -159.888 flat angles C4'-P-C4' energy: -118.190 flat angles P-C4'-P energy: -90.658 tors. eta vs tors. theta energy: -32.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -953.520982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -953.520982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -953.520982 (E_RNA) where: Base-Base interactions energy: -432.676 where: short stacking energy: -248.681 Base-Backbone interact. energy: -0.570 local terms energy: -520.275001 where: bonds (distance) C4'-P energy: -152.689 bonds (distance) P-C4' energy: -147.811 flat angles C4'-P-C4' energy: -140.663 flat angles P-C4'-P energy: -69.590 tors. eta vs tors. theta energy: -9.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -824.607841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -824.607841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -824.607841 (E_RNA) where: Base-Base interactions energy: -385.502 where: short stacking energy: -263.185 Base-Backbone interact. energy: 0.964 local terms energy: -440.069314 where: bonds (distance) C4'-P energy: -120.498 bonds (distance) P-C4' energy: -137.129 flat angles C4'-P-C4' energy: -113.124 flat angles P-C4'-P energy: -69.733 tors. eta vs tors. theta energy: 0.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -2937.722854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2937.722854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2937.722854 (E_RNA) where: Base-Base interactions energy: -1996.151 where: short stacking energy: -867.671 Base-Backbone interact. energy: -4.390 local terms energy: -937.181575 where: bonds (distance) C4'-P energy: -180.846 bonds (distance) P-C4' energy: -177.273 flat angles C4'-P-C4' energy: -203.156 flat angles P-C4'-P energy: -123.397 tors. eta vs tors. theta energy: -252.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -2864.884278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2864.884278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2864.884278 (E_RNA) where: Base-Base interactions energy: -1958.433 where: short stacking energy: -840.893 Base-Backbone interact. energy: 0.767 local terms energy: -907.218073 where: bonds (distance) C4'-P energy: -171.445 bonds (distance) P-C4' energy: -175.728 flat angles C4'-P-C4' energy: -199.138 flat angles P-C4'-P energy: -126.892 tors. eta vs tors. theta energy: -234.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -2612.538740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2612.538740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2612.538740 (E_RNA) where: Base-Base interactions energy: -1737.202 where: short stacking energy: -770.578 Base-Backbone interact. energy: -3.643 local terms energy: -871.693466 where: bonds (distance) C4'-P energy: -159.353 bonds (distance) P-C4' energy: -171.290 flat angles C4'-P-C4' energy: -185.505 flat angles P-C4'-P energy: -130.724 tors. eta vs tors. theta energy: -224.822 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -2472.878858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2472.878858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2472.878858 (E_RNA) where: Base-Base interactions energy: -1680.253 where: short stacking energy: -735.022 Base-Backbone interact. energy: -3.037 local terms energy: -789.588772 where: bonds (distance) C4'-P energy: -152.023 bonds (distance) P-C4' energy: -171.991 flat angles C4'-P-C4' energy: -179.675 flat angles P-C4'-P energy: -97.691 tors. eta vs tors. theta energy: -188.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -2293.297975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2293.297975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2293.297975 (E_RNA) where: Base-Base interactions energy: -1498.322 where: short stacking energy: -681.343 Base-Backbone interact. energy: 0.749 local terms energy: -795.724815 where: bonds (distance) C4'-P energy: -155.268 bonds (distance) P-C4' energy: -159.993 flat angles C4'-P-C4' energy: -188.883 flat angles P-C4'-P energy: -106.454 tors. eta vs tors. theta energy: -185.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -2007.686995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2007.686995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2007.686995 (E_RNA) where: Base-Base interactions energy: -1273.208 where: short stacking energy: -585.415 Base-Backbone interact. energy: -2.708 local terms energy: -731.771164 where: bonds (distance) C4'-P energy: -153.646 bonds (distance) P-C4' energy: -166.015 flat angles C4'-P-C4' energy: -160.566 flat angles P-C4'-P energy: -106.180 tors. eta vs tors. theta energy: -145.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -1724.421586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1724.421586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1724.421586 (E_RNA) where: Base-Base interactions energy: -1120.210 where: short stacking energy: -489.475 Base-Backbone interact. energy: 3.099 local terms energy: -607.310866 where: bonds (distance) C4'-P energy: -138.908 bonds (distance) P-C4' energy: -149.754 flat angles C4'-P-C4' energy: -140.475 flat angles P-C4'-P energy: -98.786 tors. eta vs tors. theta energy: -79.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -1230.254021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.254021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.254021 (E_RNA) where: Base-Base interactions energy: -645.151 where: short stacking energy: -361.046 Base-Backbone interact. energy: 2.075 local terms energy: -587.178183 where: bonds (distance) C4'-P energy: -159.759 bonds (distance) P-C4' energy: -154.523 flat angles C4'-P-C4' energy: -135.994 flat angles P-C4'-P energy: -78.438 tors. eta vs tors. theta energy: -58.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -960.031897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.031897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.031897 (E_RNA) where: Base-Base interactions energy: -441.521 where: short stacking energy: -279.149 Base-Backbone interact. energy: 0.466 local terms energy: -518.976519 where: bonds (distance) C4'-P energy: -153.303 bonds (distance) P-C4' energy: -148.037 flat angles C4'-P-C4' energy: -126.981 flat angles P-C4'-P energy: -72.028 tors. eta vs tors. theta energy: -18.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -810.412090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.412090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.412090 (E_RNA) where: Base-Base interactions energy: -354.673 where: short stacking energy: -216.724 Base-Backbone interact. energy: 2.934 local terms energy: -458.672928 where: bonds (distance) C4'-P energy: -122.516 bonds (distance) P-C4' energy: -150.717 flat angles C4'-P-C4' energy: -117.003 flat angles P-C4'-P energy: -80.372 tors. eta vs tors. theta energy: 11.934 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -2984.779223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2984.779223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2984.779223 (E_RNA) where: Base-Base interactions energy: -2020.033 where: short stacking energy: -864.399 Base-Backbone interact. energy: -3.237 local terms energy: -961.509019 where: bonds (distance) C4'-P energy: -180.391 bonds (distance) P-C4' energy: -169.478 flat angles C4'-P-C4' energy: -212.150 flat angles P-C4'-P energy: -140.307 tors. eta vs tors. theta energy: -259.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -2930.155559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2930.155559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2930.155559 (E_RNA) where: Base-Base interactions energy: -1977.365 where: short stacking energy: -847.096 Base-Backbone interact. energy: 0.569 local terms energy: -953.359359 where: bonds (distance) C4'-P energy: -173.355 bonds (distance) P-C4' energy: -184.839 flat angles C4'-P-C4' energy: -194.195 flat angles P-C4'-P energy: -147.411 tors. eta vs tors. theta energy: -253.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -2577.859487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2577.859487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2577.859487 (E_RNA) where: Base-Base interactions energy: -1696.711 where: short stacking energy: -765.556 Base-Backbone interact. energy: -5.018 local terms energy: -876.130761 where: bonds (distance) C4'-P energy: -171.713 bonds (distance) P-C4' energy: -168.702 flat angles C4'-P-C4' energy: -186.646 flat angles P-C4'-P energy: -129.806 tors. eta vs tors. theta energy: -219.265 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -2446.523604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2446.523604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2446.523604 (E_RNA) where: Base-Base interactions energy: -1628.312 where: short stacking energy: -698.861 Base-Backbone interact. energy: -1.607 local terms energy: -816.604453 where: bonds (distance) C4'-P energy: -152.046 bonds (distance) P-C4' energy: -179.220 flat angles C4'-P-C4' energy: -176.824 flat angles P-C4'-P energy: -115.298 tors. eta vs tors. theta energy: -193.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -2283.777277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2283.777277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2283.777277 (E_RNA) where: Base-Base interactions energy: -1501.054 where: short stacking energy: -672.561 Base-Backbone interact. energy: -4.782 local terms energy: -777.940728 where: bonds (distance) C4'-P energy: -155.752 bonds (distance) P-C4' energy: -166.654 flat angles C4'-P-C4' energy: -168.936 flat angles P-C4'-P energy: -111.731 tors. eta vs tors. theta energy: -174.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -1982.930749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1982.930749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1982.930749 (E_RNA) where: Base-Base interactions energy: -1249.548 where: short stacking energy: -545.909 Base-Backbone interact. energy: -1.172 local terms energy: -732.210787 where: bonds (distance) C4'-P energy: -146.240 bonds (distance) P-C4' energy: -170.415 flat angles C4'-P-C4' energy: -164.785 flat angles P-C4'-P energy: -112.499 tors. eta vs tors. theta energy: -138.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -1663.617382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1663.617382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1663.617382 (E_RNA) where: Base-Base interactions energy: -1042.659 where: short stacking energy: -466.941 Base-Backbone interact. energy: -1.112 local terms energy: -619.846681 where: bonds (distance) C4'-P energy: -146.671 bonds (distance) P-C4' energy: -140.492 flat angles C4'-P-C4' energy: -151.784 flat angles P-C4'-P energy: -93.960 tors. eta vs tors. theta energy: -86.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -1175.176839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.176839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.176839 (E_RNA) where: Base-Base interactions energy: -622.759 where: short stacking energy: -323.524 Base-Backbone interact. energy: -2.775 local terms energy: -549.642865 where: bonds (distance) C4'-P energy: -152.667 bonds (distance) P-C4' energy: -142.866 flat angles C4'-P-C4' energy: -136.260 flat angles P-C4'-P energy: -81.783 tors. eta vs tors. theta energy: -36.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -1009.577418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.577418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.577418 (E_RNA) where: Base-Base interactions energy: -509.760 where: short stacking energy: -286.819 Base-Backbone interact. energy: -3.116 local terms energy: -496.701427 where: bonds (distance) C4'-P energy: -147.656 bonds (distance) P-C4' energy: -146.281 flat angles C4'-P-C4' energy: -135.790 flat angles P-C4'-P energy: -69.166 tors. eta vs tors. theta energy: 2.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -666.421301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -666.421301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -666.421301 (E_RNA) where: Base-Base interactions energy: -239.218 where: short stacking energy: -205.218 Base-Backbone interact. energy: 8.363 local terms energy: -435.566114 where: bonds (distance) C4'-P energy: -142.320 bonds (distance) P-C4' energy: -134.678 flat angles C4'-P-C4' energy: -129.842 flat angles P-C4'-P energy: -56.634 tors. eta vs tors. theta energy: 27.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -3012.793689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -3012.793689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -3012.793689 (E_RNA) where: Base-Base interactions energy: -2079.321 where: short stacking energy: -854.543 Base-Backbone interact. energy: 0.072 local terms energy: -933.544493 where: bonds (distance) C4'-P energy: -180.820 bonds (distance) P-C4' energy: -173.822 flat angles C4'-P-C4' energy: -201.022 flat angles P-C4'-P energy: -133.125 tors. eta vs tors. theta energy: -244.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -2914.706206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2914.706206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2914.706206 (E_RNA) where: Base-Base interactions energy: -1969.829 where: short stacking energy: -817.986 Base-Backbone interact. energy: -2.692 local terms energy: -942.185654 where: bonds (distance) C4'-P energy: -186.179 bonds (distance) P-C4' energy: -178.777 flat angles C4'-P-C4' energy: -210.405 flat angles P-C4'-P energy: -128.047 tors. eta vs tors. theta energy: -238.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -2599.442953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2599.442953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2599.442953 (E_RNA) where: Base-Base interactions energy: -1730.717 where: short stacking energy: -766.148 Base-Backbone interact. energy: -1.169 local terms energy: -867.557555 where: bonds (distance) C4'-P energy: -158.430 bonds (distance) P-C4' energy: -175.665 flat angles C4'-P-C4' energy: -190.019 flat angles P-C4'-P energy: -127.817 tors. eta vs tors. theta energy: -215.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -2513.590504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2513.590504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2513.590504 (E_RNA) where: Base-Base interactions energy: -1718.099 where: short stacking energy: -724.182 Base-Backbone interact. energy: -4.618 local terms energy: -790.873315 where: bonds (distance) C4'-P energy: -155.248 bonds (distance) P-C4' energy: -157.912 flat angles C4'-P-C4' energy: -180.640 flat angles P-C4'-P energy: -106.880 tors. eta vs tors. theta energy: -190.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -2261.649357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2261.649357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2261.649357 (E_RNA) where: Base-Base interactions energy: -1474.753 where: short stacking energy: -645.728 Base-Backbone interact. energy: -1.650 local terms energy: -785.245890 where: bonds (distance) C4'-P energy: -153.737 bonds (distance) P-C4' energy: -165.947 flat angles C4'-P-C4' energy: -184.239 flat angles P-C4'-P energy: -87.113 tors. eta vs tors. theta energy: -194.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -2044.724007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -2044.724007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -2044.724007 (E_RNA) where: Base-Base interactions energy: -1277.815 where: short stacking energy: -582.231 Base-Backbone interact. energy: 2.196 local terms energy: -769.105181 where: bonds (distance) C4'-P energy: -176.387 bonds (distance) P-C4' energy: -165.300 flat angles C4'-P-C4' energy: -160.379 flat angles P-C4'-P energy: -113.897 tors. eta vs tors. theta energy: -153.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -1748.984891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1748.984891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1748.984891 (E_RNA) where: Base-Base interactions energy: -1066.330 where: short stacking energy: -482.417 Base-Backbone interact. energy: -0.495 local terms energy: -682.159534 where: bonds (distance) C4'-P energy: -159.229 bonds (distance) P-C4' energy: -160.890 flat angles C4'-P-C4' energy: -166.392 flat angles P-C4'-P energy: -89.121 tors. eta vs tors. theta energy: -106.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -1212.422276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.422276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.422276 (E_RNA) where: Base-Base interactions energy: -647.551 where: short stacking energy: -338.741 Base-Backbone interact. energy: -2.551 local terms energy: -562.320190 where: bonds (distance) C4'-P energy: -104.733 bonds (distance) P-C4' energy: -160.979 flat angles C4'-P-C4' energy: -159.283 flat angles P-C4'-P energy: -88.460 tors. eta vs tors. theta energy: -48.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -986.476047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -986.476047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.476047 (E_RNA) where: Base-Base interactions energy: -483.363 where: short stacking energy: -290.913 Base-Backbone interact. energy: 5.311 local terms energy: -508.423906 where: bonds (distance) C4'-P energy: -155.109 bonds (distance) P-C4' energy: -150.415 flat angles C4'-P-C4' energy: -120.610 flat angles P-C4'-P energy: -70.682 tors. eta vs tors. theta energy: -11.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -691.054774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.054774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.054774 (E_RNA) where: Base-Base interactions energy: -271.702 where: short stacking energy: -202.291 Base-Backbone interact. energy: -1.783 local terms energy: -417.569418 where: bonds (distance) C4'-P energy: -113.447 bonds (distance) P-C4' energy: -143.970 flat angles C4'-P-C4' energy: -126.146 flat angles P-C4'-P energy: -58.751 tors. eta vs tors. theta energy: 24.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 3 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 53388404 moves confirmed later: 63182434 all moves confirmed: 116570838 percent of confirmed moves: 72.856774 current total energy: -2878.751052 recalc. total energy: -2878.751052 replica 9 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 47322162 moves confirmed later: 55182115 all moves confirmed: 102504277 percent of confirmed moves: 64.065173 current total energy: -2880.200723 recalc. total energy: -2880.200723 replica 4 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 40345775 moves confirmed later: 45966679 all moves confirmed: 86312454 percent of confirmed moves: 53.945284 current total energy: -2490.503003 recalc. total energy: -2490.503003 replica 10 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 38087557 moves confirmed later: 42912834 all moves confirmed: 81000391 percent of confirmed moves: 50.625244 current total energy: -2282.121207 recalc. total energy: -2282.121207 replica 7 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 44858565 moves confirmed later: 52108676 all moves confirmed: 96967241 percent of confirmed moves: 60.604526 current total energy: -2120.987963 recalc. total energy: -2120.987963 replica 2 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 53879674 moves confirmed later: 63452619 all moves confirmed: 117332293 percent of confirmed moves: 73.332683 current total energy: -1685.344436 recalc. total energy: -1685.344436 replica 6 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 45360294 moves confirmed later: 52540067 all moves confirmed: 97900361 percent of confirmed moves: 61.187726 current total energy: -1590.924758 recalc. total energy: -1590.924758 replica 8 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 68409928 moves confirmed later: 83074071 all moves confirmed: 151483999 percent of confirmed moves: 94.677499 current total energy: -990.466501 recalc. total energy: -990.466501 replica 5 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 53979564 moves confirmed later: 63939552 all moves confirmed: 117919116 percent of confirmed moves: 73.699448 current total energy: -768.654025 recalc. total energy: -768.654025 replica 1 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 66746231 moves confirmed later: 80342809 all moves confirmed: 147089040 percent of confirmed moves: 91.930650 current total energy: -534.012266 recalc. total energy: -534.012266 out arg RESULTS//1/MCL-1-602-898-c43e838d_01 Time of doing 1600000 iterations: 11303.978 seconds