SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa first_line: R R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID_620-838260ac/inputs/seq.fa: 2 curr_seq: _CUUCUUCUGCAGCUUCCUCAC_ curr_seq: _GUGAGGAAGCUGCAGAAGAAG_ chainIds_rna: _AB_, chainIds_protein: __ chainId: A, chainSeq: CUUCUUCUGCAGCUUCCUCAC chainId: B, chainSeq: GUGAGGAAGCUGCAGAAGAAG RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 21 nucleotides chain B contains 21 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 220 n_atoms_counter: 220 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _(((((((((((((((((((((_ chain: 2: _)))))))))))))))))))))_ nucl1: 20, chain1: 0, <---> nucl2: 0, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 1, nuclIndex_2: 22 nucl1: 19, chain1: 0, <---> nucl2: 1, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 1, nuclIndex_2: 23 nucl1: 18, chain1: 0, <---> nucl2: 2, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 18, chainIndex_2: 1, nuclIndex_2: 24 nucl1: 17, chain1: 0, <---> nucl2: 3, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 17, chainIndex_2: 1, nuclIndex_2: 25 nucl1: 16, chain1: 0, <---> nucl2: 4, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 1, nuclIndex_2: 26 nucl1: 15, chain1: 0, <---> nucl2: 5, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 1, nuclIndex_2: 27 nucl1: 14, chain1: 0, <---> nucl2: 6, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 14, chainIndex_2: 1, nuclIndex_2: 28 nucl1: 13, chain1: 0, <---> nucl2: 7, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 13, chainIndex_2: 1, nuclIndex_2: 29 nucl1: 12, chain1: 0, <---> nucl2: 8, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 12, chainIndex_2: 1, nuclIndex_2: 30 nucl1: 11, chain1: 0, <---> nucl2: 9, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 11, chainIndex_2: 1, nuclIndex_2: 31 nucl1: 10, chain1: 0, <---> nucl2: 10, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 1, nuclIndex_2: 32 nucl1: 9, chain1: 0, <---> nucl2: 11, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 1, nuclIndex_2: 33 nucl1: 8, chain1: 0, <---> nucl2: 12, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 1, nuclIndex_2: 34 nucl1: 7, chain1: 0, <---> nucl2: 13, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 1, nuclIndex_2: 35 nucl1: 6, chain1: 0, <---> nucl2: 14, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 1, nuclIndex_2: 36 nucl1: 5, chain1: 0, <---> nucl2: 15, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 1, nuclIndex_2: 37 nucl1: 4, chain1: 0, <---> nucl2: 16, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 1, nuclIndex_2: 38 nucl1: 3, chain1: 0, <---> nucl2: 17, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 1, nuclIndex_2: 39 nucl1: 2, chain1: 0, <---> nucl2: 18, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 2, chainIndex_2: 1, nuclIndex_2: 40 nucl1: 1, chain1: 0, <---> nucl2: 19, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 1, nuclIndex_2: 41 nucl1: 0, chain1: 0, <---> nucl2: 20, chain2: 1 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 1, nuclIndex_2: 42 RNAStructure::tertiaryStrcWeight = 1.000000 void RNAStructure::setLimitingSphereRadius(double limitingSphereRadius): limiting sphere radius value: 42.000000 was provided by the user EntireStructure::rnaStruct limitingSphereRadius : 42.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 8000000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: 656.397790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 656.397790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -98.782309 (E_RNA) where: Base-Base interactions energy: -2.113 where: short stacking energy: -2.113 Base-Backbone interact. energy: -0.000 local terms energy: -164.270538 where: bonds (distance) C4'-P energy: -40.806 bonds (distance) P-C4' energy: -39.365 flat angles C4'-P-C4' energy: -30.837 flat angles P-C4'-P energy: -35.275 tors. eta vs tors. theta energy: -17.987 Dist. restrs. and SS energy: 755.180 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 67.601 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -346.471088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.471088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.127760 (E_RNA) where: Base-Base interactions energy: -242.246 where: short stacking energy: -84.510 Base-Backbone interact. energy: -0.131 local terms energy: -116.976966 where: bonds (distance) C4'-P energy: -26.532 bonds (distance) P-C4' energy: -31.834 flat angles C4'-P-C4' energy: -22.132 flat angles P-C4'-P energy: -13.323 tors. eta vs tors. theta energy: -23.156 Dist. restrs. and SS energy: 12.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.226 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -384.029876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.029876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.724970 (E_RNA) where: Base-Base interactions energy: -275.058 where: short stacking energy: -90.201 Base-Backbone interact. energy: -1.987 local terms energy: -117.590054 where: bonds (distance) C4'-P energy: -28.269 bonds (distance) P-C4' energy: -29.871 flat angles C4'-P-C4' energy: -24.068 flat angles P-C4'-P energy: -13.744 tors. eta vs tors. theta energy: -21.638 Dist. restrs. and SS energy: 7.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.910 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -328.908976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.908976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.882182 (E_RNA) where: Base-Base interactions energy: -226.216 where: short stacking energy: -87.522 Base-Backbone interact. energy: -0.391 local terms energy: -118.601340 where: bonds (distance) C4'-P energy: -29.556 bonds (distance) P-C4' energy: -29.709 flat angles C4'-P-C4' energy: -19.736 flat angles P-C4'-P energy: -16.170 tors. eta vs tors. theta energy: -23.431 Dist. restrs. and SS energy: 13.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.326 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -275.400887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.400887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.482687 (E_RNA) where: Base-Base interactions energy: -185.664 where: short stacking energy: -75.403 Base-Backbone interact. energy: 0.980 local terms energy: -111.798886 where: bonds (distance) C4'-P energy: -27.099 bonds (distance) P-C4' energy: -27.525 flat angles C4'-P-C4' energy: -23.101 flat angles P-C4'-P energy: -16.016 tors. eta vs tors. theta energy: -18.059 Dist. restrs. and SS energy: 21.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -351.143200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.143200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.041928 (E_RNA) where: Base-Base interactions energy: -248.354 where: short stacking energy: -89.542 Base-Backbone interact. energy: -0.101 local terms energy: -112.129929 where: bonds (distance) C4'-P energy: -30.136 bonds (distance) P-C4' energy: -26.946 flat angles C4'-P-C4' energy: -21.320 flat angles P-C4'-P energy: -12.783 tors. eta vs tors. theta energy: -20.945 Dist. restrs. and SS energy: 6.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.543 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -325.347885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.347885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.740302 (E_RNA) where: Base-Base interactions energy: -230.158 where: short stacking energy: -68.344 Base-Backbone interact. energy: -0.315 local terms energy: -104.267699 where: bonds (distance) C4'-P energy: -24.435 bonds (distance) P-C4' energy: -25.502 flat angles C4'-P-C4' energy: -22.218 flat angles P-C4'-P energy: -16.682 tors. eta vs tors. theta energy: -15.431 Dist. restrs. and SS energy: 9.392 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -221.498952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.498952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.691041 (E_RNA) where: Base-Base interactions energy: -160.714 where: short stacking energy: -61.817 Base-Backbone interact. energy: -0.982 local terms energy: -90.994810 where: bonds (distance) C4'-P energy: -25.898 bonds (distance) P-C4' energy: -19.461 flat angles C4'-P-C4' energy: -18.790 flat angles P-C4'-P energy: -14.180 tors. eta vs tors. theta energy: -12.666 Dist. restrs. and SS energy: 31.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -300.591132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.591132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -317.664450 (E_RNA) where: Base-Base interactions energy: -214.890 where: short stacking energy: -75.469 Base-Backbone interact. energy: -0.372 local terms energy: -102.402595 where: bonds (distance) C4'-P energy: -20.099 bonds (distance) P-C4' energy: -26.673 flat angles C4'-P-C4' energy: -23.396 flat angles P-C4'-P energy: -13.389 tors. eta vs tors. theta energy: -18.846 Dist. restrs. and SS energy: 17.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -346.313273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.313273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.936473 (E_RNA) where: Base-Base interactions energy: -245.174 where: short stacking energy: -90.383 Base-Backbone interact. energy: 0.295 local terms energy: -110.058069 where: bonds (distance) C4'-P energy: -24.368 bonds (distance) P-C4' energy: -18.414 flat angles C4'-P-C4' energy: -24.939 flat angles P-C4'-P energy: -13.646 tors. eta vs tors. theta energy: -28.691 Dist. restrs. and SS energy: 8.623 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -244.423969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.423969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.003805 (E_RNA) where: Base-Base interactions energy: -180.981 where: short stacking energy: -61.777 Base-Backbone interact. energy: 0.091 local terms energy: -86.218218 where: bonds (distance) C4'-P energy: -13.462 bonds (distance) P-C4' energy: -20.067 flat angles C4'-P-C4' energy: -20.820 flat angles P-C4'-P energy: -13.068 tors. eta vs tors. theta energy: -18.802 Dist. restrs. and SS energy: 21.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.105 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -416.224044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.224044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.607188 (E_RNA) where: Base-Base interactions energy: -290.717 where: short stacking energy: -101.325 Base-Backbone interact. energy: -0.338 local terms energy: -131.861826 where: bonds (distance) C4'-P energy: -28.959 bonds (distance) P-C4' energy: -25.312 flat angles C4'-P-C4' energy: -28.019 flat angles P-C4'-P energy: -24.515 tors. eta vs tors. theta energy: -25.057 Dist. restrs. and SS energy: 5.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.309 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -384.403920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.403920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.616171 (E_RNA) where: Base-Base interactions energy: -273.843 where: short stacking energy: -83.376 Base-Backbone interact. energy: -1.071 local terms energy: -119.050078 where: bonds (distance) C4'-P energy: -29.526 bonds (distance) P-C4' energy: -25.693 flat angles C4'-P-C4' energy: -22.008 flat angles P-C4'-P energy: -19.260 tors. eta vs tors. theta energy: -22.563 Dist. restrs. and SS energy: 9.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.348 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -427.747040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.747040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.363948 (E_RNA) where: Base-Base interactions energy: -305.440 where: short stacking energy: -104.867 Base-Backbone interact. energy: -0.840 local terms energy: -128.083886 where: bonds (distance) C4'-P energy: -25.378 bonds (distance) P-C4' energy: -27.695 flat angles C4'-P-C4' energy: -31.970 flat angles P-C4'-P energy: -15.387 tors. eta vs tors. theta energy: -27.655 Dist. restrs. and SS energy: 6.617 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -399.920601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.920601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.477700 (E_RNA) where: Base-Base interactions energy: -290.416 where: short stacking energy: -108.743 Base-Backbone interact. energy: -0.379 local terms energy: -119.682959 where: bonds (distance) C4'-P energy: -20.056 bonds (distance) P-C4' energy: -33.027 flat angles C4'-P-C4' energy: -26.962 flat angles P-C4'-P energy: -13.615 tors. eta vs tors. theta energy: -26.023 Dist. restrs. and SS energy: 10.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -371.835505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.835505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.693353 (E_RNA) where: Base-Base interactions energy: -278.082 where: short stacking energy: -102.304 Base-Backbone interact. energy: 0.129 local terms energy: -108.682167 where: bonds (distance) C4'-P energy: -24.818 bonds (distance) P-C4' energy: -16.609 flat angles C4'-P-C4' energy: -24.853 flat angles P-C4'-P energy: -19.323 tors. eta vs tors. theta energy: -23.079 Dist. restrs. and SS energy: 11.858 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.941 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -346.157602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.157602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.699001 (E_RNA) where: Base-Base interactions energy: -258.282 where: short stacking energy: -89.771 Base-Backbone interact. energy: 1.081 local terms energy: -106.844581 where: bonds (distance) C4'-P energy: -18.770 bonds (distance) P-C4' energy: -28.128 flat angles C4'-P-C4' energy: -20.980 flat angles P-C4'-P energy: -12.941 tors. eta vs tors. theta energy: -26.026 Dist. restrs. and SS energy: 16.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.347 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -284.627876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.627876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.754962 (E_RNA) where: Base-Base interactions energy: -199.471 where: short stacking energy: -79.119 Base-Backbone interact. energy: -0.412 local terms energy: -108.369621 where: bonds (distance) C4'-P energy: -22.195 bonds (distance) P-C4' energy: -24.278 flat angles C4'-P-C4' energy: -24.510 flat angles P-C4'-P energy: -17.774 tors. eta vs tors. theta energy: -19.612 Dist. restrs. and SS energy: 20.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 3.497 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -359.456002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.456002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.250037 (E_RNA) where: Base-Base interactions energy: -264.066 where: short stacking energy: -104.542 Base-Backbone interact. energy: -0.730 local terms energy: -105.453703 where: bonds (distance) C4'-P energy: -19.822 bonds (distance) P-C4' energy: -23.569 flat angles C4'-P-C4' energy: -20.626 flat angles P-C4'-P energy: -11.111 tors. eta vs tors. theta energy: -30.327 Dist. restrs. and SS energy: 10.794 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -349.047574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.047574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.643820 (E_RNA) where: Base-Base interactions energy: -266.253 where: short stacking energy: -92.555 Base-Backbone interact. energy: -0.318 local terms energy: -100.072446 where: bonds (distance) C4'-P energy: -23.495 bonds (distance) P-C4' energy: -27.535 flat angles C4'-P-C4' energy: -18.517 flat angles P-C4'-P energy: -7.653 tors. eta vs tors. theta energy: -22.872 Dist. restrs. and SS energy: 17.596 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -258.905351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.905351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.196406 (E_RNA) where: Base-Base interactions energy: -191.008 where: short stacking energy: -71.789 Base-Backbone interact. energy: 1.091 local terms energy: -94.435035 where: bonds (distance) C4'-P energy: -12.565 bonds (distance) P-C4' energy: -29.798 flat angles C4'-P-C4' energy: -25.678 flat angles P-C4'-P energy: -13.669 tors. eta vs tors. theta energy: -12.725 Dist. restrs. and SS energy: 25.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.156 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -444.757086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.757086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.049032 (E_RNA) where: Base-Base interactions energy: -337.315 where: short stacking energy: -111.815 Base-Backbone interact. energy: -0.214 local terms energy: -118.520254 where: bonds (distance) C4'-P energy: -20.869 bonds (distance) P-C4' energy: -29.823 flat angles C4'-P-C4' energy: -22.870 flat angles P-C4'-P energy: -14.625 tors. eta vs tors. theta energy: -30.333 Dist. restrs. and SS energy: 11.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -426.660184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.660184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.647179 (E_RNA) where: Base-Base interactions energy: -315.960 where: short stacking energy: -110.946 Base-Backbone interact. energy: -0.484 local terms energy: -119.203598 where: bonds (distance) C4'-P energy: -29.925 bonds (distance) P-C4' energy: -25.134 flat angles C4'-P-C4' energy: -20.986 flat angles P-C4'-P energy: -17.571 tors. eta vs tors. theta energy: -25.589 Dist. restrs. and SS energy: 8.987 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -415.073144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.073144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.565949 (E_RNA) where: Base-Base interactions energy: -302.900 where: short stacking energy: -100.353 Base-Backbone interact. energy: -0.813 local terms energy: -118.852625 where: bonds (distance) C4'-P energy: -24.006 bonds (distance) P-C4' energy: -29.966 flat angles C4'-P-C4' energy: -26.688 flat angles P-C4'-P energy: -10.861 tors. eta vs tors. theta energy: -27.332 Dist. restrs. and SS energy: 7.493 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -420.215430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.215430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.008632 (E_RNA) where: Base-Base interactions energy: -311.152 where: short stacking energy: -110.472 Base-Backbone interact. energy: -0.743 local terms energy: -116.113657 where: bonds (distance) C4'-P energy: -21.864 bonds (distance) P-C4' energy: -30.039 flat angles C4'-P-C4' energy: -22.894 flat angles P-C4'-P energy: -16.096 tors. eta vs tors. theta energy: -25.221 Dist. restrs. and SS energy: 7.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -408.499214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.499214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.060048 (E_RNA) where: Base-Base interactions energy: -297.875 where: short stacking energy: -101.581 Base-Backbone interact. energy: -0.133 local terms energy: -116.051922 where: bonds (distance) C4'-P energy: -19.822 bonds (distance) P-C4' energy: -28.445 flat angles C4'-P-C4' energy: -24.556 flat angles P-C4'-P energy: -14.665 tors. eta vs tors. theta energy: -28.564 Dist. restrs. and SS energy: 5.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -386.934333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.934333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.300174 (E_RNA) where: Base-Base interactions energy: -291.953 where: short stacking energy: -103.673 Base-Backbone interact. energy: -0.297 local terms energy: -103.577959 where: bonds (distance) C4'-P energy: -24.189 bonds (distance) P-C4' energy: -22.014 flat angles C4'-P-C4' energy: -20.796 flat angles P-C4'-P energy: -12.848 tors. eta vs tors. theta energy: -23.731 Dist. restrs. and SS energy: 8.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.528 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -392.655773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.655773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.699946 (E_RNA) where: Base-Base interactions energy: -292.177 where: short stacking energy: -93.847 Base-Backbone interact. energy: -0.793 local terms energy: -110.729905 where: bonds (distance) C4'-P energy: -21.519 bonds (distance) P-C4' energy: -24.278 flat angles C4'-P-C4' energy: -24.850 flat angles P-C4'-P energy: -13.465 tors. eta vs tors. theta energy: -26.618 Dist. restrs. and SS energy: 11.044 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -303.334963 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.334963 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.817215 (E_RNA) where: Base-Base interactions energy: -213.621 where: short stacking energy: -85.415 Base-Backbone interact. energy: -0.008 local terms energy: -102.187685 where: bonds (distance) C4'-P energy: -22.755 bonds (distance) P-C4' energy: -12.802 flat angles C4'-P-C4' energy: -27.743 flat angles P-C4'-P energy: -12.277 tors. eta vs tors. theta energy: -26.610 Dist. restrs. and SS energy: 12.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -367.165552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.165552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.674819 (E_RNA) where: Base-Base interactions energy: -262.689 where: short stacking energy: -92.988 Base-Backbone interact. energy: -0.724 local terms energy: -113.261299 where: bonds (distance) C4'-P energy: -14.226 bonds (distance) P-C4' energy: -28.590 flat angles C4'-P-C4' energy: -29.602 flat angles P-C4'-P energy: -13.232 tors. eta vs tors. theta energy: -27.611 Dist. restrs. and SS energy: 9.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -388.108345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.108345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.673069 (E_RNA) where: Base-Base interactions energy: -284.803 where: short stacking energy: -96.937 Base-Backbone interact. energy: -0.501 local terms energy: -106.882912 where: bonds (distance) C4'-P energy: -18.331 bonds (distance) P-C4' energy: -22.675 flat angles C4'-P-C4' energy: -27.652 flat angles P-C4'-P energy: -13.048 tors. eta vs tors. theta energy: -25.177 Dist. restrs. and SS energy: 3.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.513 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -447.933550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.933550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.819632 (E_RNA) where: Base-Base interactions energy: -329.873 where: short stacking energy: -106.287 Base-Backbone interact. energy: -0.130 local terms energy: -124.815888 where: bonds (distance) C4'-P energy: -23.898 bonds (distance) P-C4' energy: -30.931 flat angles C4'-P-C4' energy: -27.351 flat angles P-C4'-P energy: -15.569 tors. eta vs tors. theta energy: -27.067 Dist. restrs. and SS energy: 6.886 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -452.230768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.230768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.098577 (E_RNA) where: Base-Base interactions energy: -328.860 where: short stacking energy: -125.147 Base-Backbone interact. energy: -0.748 local terms energy: -133.490246 where: bonds (distance) C4'-P energy: -29.477 bonds (distance) P-C4' energy: -28.930 flat angles C4'-P-C4' energy: -25.934 flat angles P-C4'-P energy: -19.435 tors. eta vs tors. theta energy: -29.714 Dist. restrs. and SS energy: 10.868 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -432.679980 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.679980 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.796161 (E_RNA) where: Base-Base interactions energy: -320.132 where: short stacking energy: -112.755 Base-Backbone interact. energy: 0.297 local terms energy: -122.983934 where: bonds (distance) C4'-P energy: -21.796 bonds (distance) P-C4' energy: -26.789 flat angles C4'-P-C4' energy: -23.698 flat angles P-C4'-P energy: -19.194 tors. eta vs tors. theta energy: -31.507 Dist. restrs. and SS energy: 8.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.023 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -448.863189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.863189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.318850 (E_RNA) where: Base-Base interactions energy: -330.241 where: short stacking energy: -126.262 Base-Backbone interact. energy: 2.190 local terms energy: -129.267403 where: bonds (distance) C4'-P energy: -28.459 bonds (distance) P-C4' energy: -26.031 flat angles C4'-P-C4' energy: -22.106 flat angles P-C4'-P energy: -16.560 tors. eta vs tors. theta energy: -36.111 Dist. restrs. and SS energy: 8.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -409.738988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.738988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.633724 (E_RNA) where: Base-Base interactions energy: -294.480 where: short stacking energy: -119.524 Base-Backbone interact. energy: -0.100 local terms energy: -126.053718 where: bonds (distance) C4'-P energy: -23.357 bonds (distance) P-C4' energy: -31.585 flat angles C4'-P-C4' energy: -26.285 flat angles P-C4'-P energy: -13.138 tors. eta vs tors. theta energy: -31.688 Dist. restrs. and SS energy: 10.895 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -421.644671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.644671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.506778 (E_RNA) where: Base-Base interactions energy: -300.167 where: short stacking energy: -121.729 Base-Backbone interact. energy: 0.567 local terms energy: -136.906365 where: bonds (distance) C4'-P energy: -28.346 bonds (distance) P-C4' energy: -24.997 flat angles C4'-P-C4' energy: -25.956 flat angles P-C4'-P energy: -21.020 tors. eta vs tors. theta energy: -36.588 Dist. restrs. and SS energy: 14.862 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -391.055539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.055539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.669030 (E_RNA) where: Base-Base interactions energy: -287.756 where: short stacking energy: -106.338 Base-Backbone interact. energy: 0.782 local terms energy: -112.040897 where: bonds (distance) C4'-P energy: -22.790 bonds (distance) P-C4' energy: -22.622 flat angles C4'-P-C4' energy: -25.677 flat angles P-C4'-P energy: -16.888 tors. eta vs tors. theta energy: -24.063 Dist. restrs. and SS energy: 7.613 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.346 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -429.246622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.246622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.205221 (E_RNA) where: Base-Base interactions energy: -334.418 where: short stacking energy: -120.687 Base-Backbone interact. energy: -0.397 local terms energy: -102.489827 where: bonds (distance) C4'-P energy: -17.001 bonds (distance) P-C4' energy: -25.144 flat angles C4'-P-C4' energy: -12.981 flat angles P-C4'-P energy: -16.516 tors. eta vs tors. theta energy: -30.848 Dist. restrs. and SS energy: 4.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 3.100 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -309.614280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -309.614280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.391522 (E_RNA) where: Base-Base interactions energy: -209.763 where: short stacking energy: -89.379 Base-Backbone interact. energy: 0.462 local terms energy: -119.717297 where: bonds (distance) C4'-P energy: -26.034 bonds (distance) P-C4' energy: -28.670 flat angles C4'-P-C4' energy: -26.673 flat angles P-C4'-P energy: -13.463 tors. eta vs tors. theta energy: -24.877 Dist. restrs. and SS energy: 17.777 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.627 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -435.262401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.262401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.440049 (E_RNA) where: Base-Base interactions energy: -334.634 where: short stacking energy: -125.610 Base-Backbone interact. energy: -0.343 local terms energy: -107.463680 where: bonds (distance) C4'-P energy: -18.486 bonds (distance) P-C4' energy: -15.044 flat angles C4'-P-C4' energy: -25.462 flat angles P-C4'-P energy: -11.333 tors. eta vs tors. theta energy: -37.139 Dist. restrs. and SS energy: 7.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -494.566452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.566452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.757632 (E_RNA) where: Base-Base interactions energy: -362.829 where: short stacking energy: -137.694 Base-Backbone interact. energy: -0.286 local terms energy: -136.642653 where: bonds (distance) C4'-P energy: -27.843 bonds (distance) P-C4' energy: -29.628 flat angles C4'-P-C4' energy: -30.548 flat angles P-C4'-P energy: -14.092 tors. eta vs tors. theta energy: -34.531 Dist. restrs. and SS energy: 5.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -451.343479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.343479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.209394 (E_RNA) where: Base-Base interactions energy: -348.280 where: short stacking energy: -126.362 Base-Backbone interact. energy: -0.598 local terms energy: -111.233453 where: bonds (distance) C4'-P energy: -24.645 bonds (distance) P-C4' energy: -28.251 flat angles C4'-P-C4' energy: -22.484 flat angles P-C4'-P energy: -6.413 tors. eta vs tors. theta energy: -29.440 Dist. restrs. and SS energy: 7.866 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.902 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -465.054799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.054799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.448023 (E_RNA) where: Base-Base interactions energy: -346.587 where: short stacking energy: -133.050 Base-Backbone interact. energy: -0.761 local terms energy: -128.247926 where: bonds (distance) C4'-P energy: -27.518 bonds (distance) P-C4' energy: -23.851 flat angles C4'-P-C4' energy: -26.053 flat angles P-C4'-P energy: -17.910 tors. eta vs tors. theta energy: -32.915 Dist. restrs. and SS energy: 10.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.147 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -451.775668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.775668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.490661 (E_RNA) where: Base-Base interactions energy: -337.989 where: short stacking energy: -120.000 Base-Backbone interact. energy: -0.250 local terms energy: -116.775319 where: bonds (distance) C4'-P energy: -31.005 bonds (distance) P-C4' energy: -27.958 flat angles C4'-P-C4' energy: -24.030 flat angles P-C4'-P energy: -6.524 tors. eta vs tors. theta energy: -27.258 Dist. restrs. and SS energy: 2.715 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.523 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -424.191636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.191636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.813360 (E_RNA) where: Base-Base interactions energy: -307.125 where: short stacking energy: -125.180 Base-Backbone interact. energy: -0.419 local terms energy: -131.268843 where: bonds (distance) C4'-P energy: -22.703 bonds (distance) P-C4' energy: -30.007 flat angles C4'-P-C4' energy: -27.544 flat angles P-C4'-P energy: -15.263 tors. eta vs tors. theta energy: -35.752 Dist. restrs. and SS energy: 14.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -420.949612 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.949612 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.753011 (E_RNA) where: Base-Base interactions energy: -313.284 where: short stacking energy: -97.374 Base-Backbone interact. energy: 0.558 local terms energy: -112.026864 where: bonds (distance) C4'-P energy: -18.248 bonds (distance) P-C4' energy: -27.240 flat angles C4'-P-C4' energy: -26.338 flat angles P-C4'-P energy: -12.551 tors. eta vs tors. theta energy: -27.651 Dist. restrs. and SS energy: 3.803 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -462.981854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.981854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.882392 (E_RNA) where: Base-Base interactions energy: -332.158 where: short stacking energy: -120.323 Base-Backbone interact. energy: -0.530 local terms energy: -136.351755 where: bonds (distance) C4'-P energy: -22.682 bonds (distance) P-C4' energy: -33.877 flat angles C4'-P-C4' energy: -26.447 flat angles P-C4'-P energy: -17.201 tors. eta vs tors. theta energy: -36.146 Dist. restrs. and SS energy: 5.901 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.157 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -415.551720 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.551720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.396831 (E_RNA) where: Base-Base interactions energy: -313.592 where: short stacking energy: -122.829 Base-Backbone interact. energy: -0.137 local terms energy: -109.838252 where: bonds (distance) C4'-P energy: -17.223 bonds (distance) P-C4' energy: -23.384 flat angles C4'-P-C4' energy: -28.609 flat angles P-C4'-P energy: -7.850 tors. eta vs tors. theta energy: -32.773 Dist. restrs. and SS energy: 7.845 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.170 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -451.203033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.203033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.650019 (E_RNA) where: Base-Base interactions energy: -334.446 where: short stacking energy: -126.602 Base-Backbone interact. energy: -0.040 local terms energy: -122.163941 where: bonds (distance) C4'-P energy: -22.282 bonds (distance) P-C4' energy: -26.637 flat angles C4'-P-C4' energy: -24.802 flat angles P-C4'-P energy: -9.883 tors. eta vs tors. theta energy: -38.560 Dist. restrs. and SS energy: 5.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -334.742571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.742571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.095778 (E_RNA) where: Base-Base interactions energy: -252.685 where: short stacking energy: -102.016 Base-Backbone interact. energy: -0.801 local terms energy: -98.645893 where: bonds (distance) C4'-P energy: -24.964 bonds (distance) P-C4' energy: -15.095 flat angles C4'-P-C4' energy: -22.310 flat angles P-C4'-P energy: -14.784 tors. eta vs tors. theta energy: -21.492 Dist. restrs. and SS energy: 16.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.037 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -507.245890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.245890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.331699 (E_RNA) where: Base-Base interactions energy: -370.356 where: short stacking energy: -132.028 Base-Backbone interact. energy: -0.454 local terms energy: -138.522216 where: bonds (distance) C4'-P energy: -28.839 bonds (distance) P-C4' energy: -31.206 flat angles C4'-P-C4' energy: -27.190 flat angles P-C4'-P energy: -17.274 tors. eta vs tors. theta energy: -34.013 Dist. restrs. and SS energy: 2.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -473.398021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.398021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.392967 (E_RNA) where: Base-Base interactions energy: -342.835 where: short stacking energy: -118.863 Base-Backbone interact. energy: -0.534 local terms energy: -139.433677 where: bonds (distance) C4'-P energy: -28.993 bonds (distance) P-C4' energy: -29.920 flat angles C4'-P-C4' energy: -32.334 flat angles P-C4'-P energy: -15.701 tors. eta vs tors. theta energy: -32.487 Dist. restrs. and SS energy: 8.995 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.409 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -449.227625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.227625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.592083 (E_RNA) where: Base-Base interactions energy: -344.771 where: short stacking energy: -128.232 Base-Backbone interact. energy: -0.492 local terms energy: -115.121222 where: bonds (distance) C4'-P energy: -20.166 bonds (distance) P-C4' energy: -25.606 flat angles C4'-P-C4' energy: -24.715 flat angles P-C4'-P energy: -13.582 tors. eta vs tors. theta energy: -31.052 Dist. restrs. and SS energy: 9.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.793 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -472.474847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.474847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.247212 (E_RNA) where: Base-Base interactions energy: -341.491 where: short stacking energy: -120.875 Base-Backbone interact. energy: -0.374 local terms energy: -136.796271 where: bonds (distance) C4'-P energy: -28.756 bonds (distance) P-C4' energy: -31.291 flat angles C4'-P-C4' energy: -26.292 flat angles P-C4'-P energy: -16.425 tors. eta vs tors. theta energy: -34.032 Dist. restrs. and SS energy: 4.772 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.414 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -430.769337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.769337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.308214 (E_RNA) where: Base-Base interactions energy: -312.363 where: short stacking energy: -125.594 Base-Backbone interact. energy: 1.787 local terms energy: -132.731757 where: bonds (distance) C4'-P energy: -23.196 bonds (distance) P-C4' energy: -32.497 flat angles C4'-P-C4' energy: -25.891 flat angles P-C4'-P energy: -17.192 tors. eta vs tors. theta energy: -33.955 Dist. restrs. and SS energy: 12.539 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -475.153141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.153141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.301991 (E_RNA) where: Base-Base interactions energy: -349.397 where: short stacking energy: -122.791 Base-Backbone interact. energy: 1.066 local terms energy: -130.632817 where: bonds (distance) C4'-P energy: -22.207 bonds (distance) P-C4' energy: -29.458 flat angles C4'-P-C4' energy: -23.306 flat angles P-C4'-P energy: -21.032 tors. eta vs tors. theta energy: -34.629 Dist. restrs. and SS energy: 2.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.661 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -444.856839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.856839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.726257 (E_RNA) where: Base-Base interactions energy: -322.332 where: short stacking energy: -113.426 Base-Backbone interact. energy: -0.155 local terms energy: -131.239216 where: bonds (distance) C4'-P energy: -22.479 bonds (distance) P-C4' energy: -26.362 flat angles C4'-P-C4' energy: -29.504 flat angles P-C4'-P energy: -21.313 tors. eta vs tors. theta energy: -31.582 Dist. restrs. and SS energy: 8.869 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -462.237962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.237962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.746325 (E_RNA) where: Base-Base interactions energy: -340.253 where: short stacking energy: -121.598 Base-Backbone interact. energy: -0.296 local terms energy: -134.197470 where: bonds (distance) C4'-P energy: -29.171 bonds (distance) P-C4' energy: -21.223 flat angles C4'-P-C4' energy: -28.879 flat angles P-C4'-P energy: -14.443 tors. eta vs tors. theta energy: -40.481 Dist. restrs. and SS energy: 12.508 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -409.211011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.211011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.826354 (E_RNA) where: Base-Base interactions energy: -303.055 where: short stacking energy: -106.010 Base-Backbone interact. energy: -0.582 local terms energy: -113.147135 where: bonds (distance) C4'-P energy: -22.132 bonds (distance) P-C4' energy: -25.149 flat angles C4'-P-C4' energy: -24.641 flat angles P-C4'-P energy: -13.894 tors. eta vs tors. theta energy: -27.331 Dist. restrs. and SS energy: 6.615 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.958 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -347.174739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.174739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.724593 (E_RNA) where: Base-Base interactions energy: -264.691 where: short stacking energy: -97.809 Base-Backbone interact. energy: 0.025 local terms energy: -95.396050 where: bonds (distance) C4'-P energy: -28.592 bonds (distance) P-C4' energy: -20.326 flat angles C4'-P-C4' energy: -15.404 flat angles P-C4'-P energy: -6.769 tors. eta vs tors. theta energy: -24.305 Dist. restrs. and SS energy: 8.550 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 4.338 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -492.535487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.535487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.669531 (E_RNA) where: Base-Base interactions energy: -360.377 where: short stacking energy: -129.708 Base-Backbone interact. energy: -0.739 local terms energy: -135.554474 where: bonds (distance) C4'-P energy: -28.902 bonds (distance) P-C4' energy: -30.947 flat angles C4'-P-C4' energy: -26.886 flat angles P-C4'-P energy: -17.545 tors. eta vs tors. theta energy: -31.275 Dist. restrs. and SS energy: 4.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -522.168464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.168464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.729194 (E_RNA) where: Base-Base interactions energy: -381.791 where: short stacking energy: -141.156 Base-Backbone interact. energy: -0.456 local terms energy: -144.837553 where: bonds (distance) C4'-P energy: -27.192 bonds (distance) P-C4' energy: -30.756 flat angles C4'-P-C4' energy: -32.118 flat angles P-C4'-P energy: -19.893 tors. eta vs tors. theta energy: -34.879 Dist. restrs. and SS energy: 4.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.356 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -483.569564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.569564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.340275 (E_RNA) where: Base-Base interactions energy: -357.542 where: short stacking energy: -144.953 Base-Backbone interact. energy: -0.150 local terms energy: -136.648195 where: bonds (distance) C4'-P energy: -23.738 bonds (distance) P-C4' energy: -29.927 flat angles C4'-P-C4' energy: -28.085 flat angles P-C4'-P energy: -15.191 tors. eta vs tors. theta energy: -39.708 Dist. restrs. and SS energy: 10.771 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -442.697866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.697866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.035902 (E_RNA) where: Base-Base interactions energy: -330.059 where: short stacking energy: -120.167 Base-Backbone interact. energy: -0.219 local terms energy: -121.295792 where: bonds (distance) C4'-P energy: -21.197 bonds (distance) P-C4' energy: -26.169 flat angles C4'-P-C4' energy: -22.542 flat angles P-C4'-P energy: -18.243 tors. eta vs tors. theta energy: -33.144 Dist. restrs. and SS energy: 8.338 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.537 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -488.447022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.447022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.035967 (E_RNA) where: Base-Base interactions energy: -355.425 where: short stacking energy: -127.917 Base-Backbone interact. energy: -0.283 local terms energy: -138.146016 where: bonds (distance) C4'-P energy: -25.347 bonds (distance) P-C4' energy: -25.071 flat angles C4'-P-C4' energy: -29.226 flat angles P-C4'-P energy: -23.117 tors. eta vs tors. theta energy: -35.385 Dist. restrs. and SS energy: 4.589 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.818 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -506.752027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.752027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.874721 (E_RNA) where: Base-Base interactions energy: -380.172 where: short stacking energy: -137.502 Base-Backbone interact. energy: -0.010 local terms energy: -127.693189 where: bonds (distance) C4'-P energy: -19.492 bonds (distance) P-C4' energy: -22.924 flat angles C4'-P-C4' energy: -27.415 flat angles P-C4'-P energy: -14.354 tors. eta vs tors. theta energy: -43.508 Dist. restrs. and SS energy: 1.123 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -492.923792 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.923792 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.336334 (E_RNA) where: Base-Base interactions energy: -372.883 where: short stacking energy: -141.612 Base-Backbone interact. energy: -0.278 local terms energy: -128.175047 where: bonds (distance) C4'-P energy: -19.964 bonds (distance) P-C4' energy: -28.145 flat angles C4'-P-C4' energy: -22.357 flat angles P-C4'-P energy: -19.617 tors. eta vs tors. theta energy: -38.092 Dist. restrs. and SS energy: 8.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -457.189343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.189343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.684886 (E_RNA) where: Base-Base interactions energy: -338.468 where: short stacking energy: -118.278 Base-Backbone interact. energy: -0.709 local terms energy: -124.507085 where: bonds (distance) C4'-P energy: -20.033 bonds (distance) P-C4' energy: -27.163 flat angles C4'-P-C4' energy: -23.617 flat angles P-C4'-P energy: -18.111 tors. eta vs tors. theta energy: -35.583 Dist. restrs. and SS energy: 6.496 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -396.956238 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.956238 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.717865 (E_RNA) where: Base-Base interactions energy: -286.729 where: short stacking energy: -101.765 Base-Backbone interact. energy: -0.161 local terms energy: -118.942541 where: bonds (distance) C4'-P energy: -28.818 bonds (distance) P-C4' energy: -27.609 flat angles C4'-P-C4' energy: -20.478 flat angles P-C4'-P energy: -16.313 tors. eta vs tors. theta energy: -25.724 Dist. restrs. and SS energy: 8.762 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.116 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -359.885270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.885270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.516686 (E_RNA) where: Base-Base interactions energy: -249.868 where: short stacking energy: -97.718 Base-Backbone interact. energy: -0.415 local terms energy: -127.234266 where: bonds (distance) C4'-P energy: -20.078 bonds (distance) P-C4' energy: -29.514 flat angles C4'-P-C4' energy: -33.054 flat angles P-C4'-P energy: -17.310 tors. eta vs tors. theta energy: -27.277 Dist. restrs. and SS energy: 17.631 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -516.291842 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.291842 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.874987 (E_RNA) where: Base-Base interactions energy: -370.322 where: short stacking energy: -130.483 Base-Backbone interact. energy: -0.013 local terms energy: -149.539552 where: bonds (distance) C4'-P energy: -25.985 bonds (distance) P-C4' energy: -31.697 flat angles C4'-P-C4' energy: -35.356 flat angles P-C4'-P energy: -23.625 tors. eta vs tors. theta energy: -32.876 Dist. restrs. and SS energy: 3.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -507.088112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.088112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.124897 (E_RNA) where: Base-Base interactions energy: -377.696 where: short stacking energy: -142.154 Base-Backbone interact. energy: -0.245 local terms energy: -136.184094 where: bonds (distance) C4'-P energy: -28.686 bonds (distance) P-C4' energy: -29.062 flat angles C4'-P-C4' energy: -24.489 flat angles P-C4'-P energy: -15.191 tors. eta vs tors. theta energy: -38.756 Dist. restrs. and SS energy: 7.037 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -504.695530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.695530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.863427 (E_RNA) where: Base-Base interactions energy: -377.938 where: short stacking energy: -135.930 Base-Backbone interact. energy: -0.484 local terms energy: -132.365594 where: bonds (distance) C4'-P energy: -29.779 bonds (distance) P-C4' energy: -29.078 flat angles C4'-P-C4' energy: -30.459 flat angles P-C4'-P energy: -12.862 tors. eta vs tors. theta energy: -30.188 Dist. restrs. and SS energy: 5.168 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.924 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -493.539876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.539876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.317716 (E_RNA) where: Base-Base interactions energy: -367.873 where: short stacking energy: -133.324 Base-Backbone interact. energy: -0.103 local terms energy: -129.468247 where: bonds (distance) C4'-P energy: -25.609 bonds (distance) P-C4' energy: -30.803 flat angles C4'-P-C4' energy: -23.426 flat angles P-C4'-P energy: -14.641 tors. eta vs tors. theta energy: -34.989 Dist. restrs. and SS energy: 1.778 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.127 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -436.100098 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.100098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.251315 (E_RNA) where: Base-Base interactions energy: -328.242 where: short stacking energy: -114.981 Base-Backbone interact. energy: -0.125 local terms energy: -114.434660 where: bonds (distance) C4'-P energy: -21.802 bonds (distance) P-C4' energy: -23.488 flat angles C4'-P-C4' energy: -22.672 flat angles P-C4'-P energy: -14.927 tors. eta vs tors. theta energy: -31.546 Dist. restrs. and SS energy: 6.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.551 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -505.768753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.768753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.961952 (E_RNA) where: Base-Base interactions energy: -375.504 where: short stacking energy: -137.297 Base-Backbone interact. energy: 0.857 local terms energy: -133.314733 where: bonds (distance) C4'-P energy: -21.488 bonds (distance) P-C4' energy: -24.088 flat angles C4'-P-C4' energy: -27.758 flat angles P-C4'-P energy: -18.724 tors. eta vs tors. theta energy: -41.256 Dist. restrs. and SS energy: 2.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -507.277825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.277825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.127275 (E_RNA) where: Base-Base interactions energy: -379.931 where: short stacking energy: -143.241 Base-Backbone interact. energy: -0.003 local terms energy: -128.193007 where: bonds (distance) C4'-P energy: -20.110 bonds (distance) P-C4' energy: -27.059 flat angles C4'-P-C4' energy: -19.308 flat angles P-C4'-P energy: -17.339 tors. eta vs tors. theta energy: -44.377 Dist. restrs. and SS energy: 0.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -420.425476 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.425476 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.309828 (E_RNA) where: Base-Base interactions energy: -307.776 where: short stacking energy: -117.626 Base-Backbone interact. energy: -0.028 local terms energy: -125.505191 where: bonds (distance) C4'-P energy: -19.272 bonds (distance) P-C4' energy: -22.566 flat angles C4'-P-C4' energy: -25.775 flat angles P-C4'-P energy: -21.762 tors. eta vs tors. theta energy: -36.131 Dist. restrs. and SS energy: 12.884 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -481.773895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.773895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.066008 (E_RNA) where: Base-Base interactions energy: -369.324 where: short stacking energy: -138.317 Base-Backbone interact. energy: -0.583 local terms energy: -117.158611 where: bonds (distance) C4'-P energy: -18.871 bonds (distance) P-C4' energy: -24.441 flat angles C4'-P-C4' energy: -22.980 flat angles P-C4'-P energy: -16.059 tors. eta vs tors. theta energy: -34.808 Dist. restrs. and SS energy: 5.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -384.071219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.071219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.517941 (E_RNA) where: Base-Base interactions energy: -285.440 where: short stacking energy: -112.776 Base-Backbone interact. energy: -0.805 local terms energy: -116.272599 where: bonds (distance) C4'-P energy: -23.186 bonds (distance) P-C4' energy: -26.356 flat angles C4'-P-C4' energy: -23.172 flat angles P-C4'-P energy: -17.204 tors. eta vs tors. theta energy: -26.354 Dist. restrs. and SS energy: 18.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -514.409931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.409931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.399296 (E_RNA) where: Base-Base interactions energy: -376.050 where: short stacking energy: -141.556 Base-Backbone interact. energy: -0.058 local terms energy: -143.290793 where: bonds (distance) C4'-P energy: -26.147 bonds (distance) P-C4' energy: -29.015 flat angles C4'-P-C4' energy: -28.161 flat angles P-C4'-P energy: -21.139 tors. eta vs tors. theta energy: -38.829 Dist. restrs. and SS energy: 4.989 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -508.080795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.080795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.174251 (E_RNA) where: Base-Base interactions energy: -385.367 where: short stacking energy: -141.177 Base-Backbone interact. energy: 1.286 local terms energy: -129.092527 where: bonds (distance) C4'-P energy: -23.522 bonds (distance) P-C4' energy: -28.401 flat angles C4'-P-C4' energy: -28.989 flat angles P-C4'-P energy: -18.263 tors. eta vs tors. theta energy: -29.918 Dist. restrs. and SS energy: 5.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -522.441690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.441690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.685867 (E_RNA) where: Base-Base interactions energy: -384.575 where: short stacking energy: -140.758 Base-Backbone interact. energy: -0.038 local terms energy: -139.072673 where: bonds (distance) C4'-P energy: -28.863 bonds (distance) P-C4' energy: -27.109 flat angles C4'-P-C4' energy: -27.112 flat angles P-C4'-P energy: -16.318 tors. eta vs tors. theta energy: -39.672 Dist. restrs. and SS energy: 1.244 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -501.193729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.193729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.218623 (E_RNA) where: Base-Base interactions energy: -372.384 where: short stacking energy: -138.651 Base-Backbone interact. energy: -0.494 local terms energy: -132.341264 where: bonds (distance) C4'-P energy: -22.248 bonds (distance) P-C4' energy: -28.814 flat angles C4'-P-C4' energy: -28.564 flat angles P-C4'-P energy: -19.594 tors. eta vs tors. theta energy: -33.121 Dist. restrs. and SS energy: 4.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -510.286611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.286611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.632056 (E_RNA) where: Base-Base interactions energy: -376.730 where: short stacking energy: -140.771 Base-Backbone interact. energy: -0.261 local terms energy: -134.641370 where: bonds (distance) C4'-P energy: -26.518 bonds (distance) P-C4' energy: -26.313 flat angles C4'-P-C4' energy: -26.117 flat angles P-C4'-P energy: -16.407 tors. eta vs tors. theta energy: -39.286 Dist. restrs. and SS energy: 1.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -429.498538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.498538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.640658 (E_RNA) where: Base-Base interactions energy: -324.091 where: short stacking energy: -114.213 Base-Backbone interact. energy: -0.067 local terms energy: -114.892136 where: bonds (distance) C4'-P energy: -18.676 bonds (distance) P-C4' energy: -24.140 flat angles C4'-P-C4' energy: -20.762 flat angles P-C4'-P energy: -22.297 tors. eta vs tors. theta energy: -29.018 Dist. restrs. and SS energy: 9.142 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.409 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -539.262895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.262895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.358298 (E_RNA) where: Base-Base interactions energy: -402.370 where: short stacking energy: -142.465 Base-Backbone interact. energy: -0.009 local terms energy: -136.979215 where: bonds (distance) C4'-P energy: -20.712 bonds (distance) P-C4' energy: -22.419 flat angles C4'-P-C4' energy: -28.501 flat angles P-C4'-P energy: -19.296 tors. eta vs tors. theta energy: -46.051 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -432.613668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.613668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.933103 (E_RNA) where: Base-Base interactions energy: -318.647 where: short stacking energy: -113.727 Base-Backbone interact. energy: 0.154 local terms energy: -123.440332 where: bonds (distance) C4'-P energy: -20.514 bonds (distance) P-C4' energy: -22.957 flat angles C4'-P-C4' energy: -29.500 flat angles P-C4'-P energy: -18.431 tors. eta vs tors. theta energy: -32.039 Dist. restrs. and SS energy: 9.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -474.340874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.340874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.657487 (E_RNA) where: Base-Base interactions energy: -353.486 where: short stacking energy: -129.434 Base-Backbone interact. energy: -0.018 local terms energy: -127.016226 where: bonds (distance) C4'-P energy: -23.348 bonds (distance) P-C4' energy: -15.797 flat angles C4'-P-C4' energy: -27.494 flat angles P-C4'-P energy: -18.269 tors. eta vs tors. theta energy: -42.108 Dist. restrs. and SS energy: 5.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.863 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -380.008456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.008456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.040030 (E_RNA) where: Base-Base interactions energy: -280.595 where: short stacking energy: -98.554 Base-Backbone interact. energy: 1.460 local terms energy: -118.905127 where: bonds (distance) C4'-P energy: -23.631 bonds (distance) P-C4' energy: -28.537 flat angles C4'-P-C4' energy: -18.998 flat angles P-C4'-P energy: -19.927 tors. eta vs tors. theta energy: -27.812 Dist. restrs. and SS energy: 18.032 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -512.570020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.570020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.153125 (E_RNA) where: Base-Base interactions energy: -374.306 where: short stacking energy: -134.690 Base-Backbone interact. energy: -0.085 local terms energy: -142.762198 where: bonds (distance) C4'-P energy: -27.650 bonds (distance) P-C4' energy: -30.108 flat angles C4'-P-C4' energy: -25.208 flat angles P-C4'-P energy: -21.085 tors. eta vs tors. theta energy: -38.711 Dist. restrs. and SS energy: 4.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -538.014252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.014252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.142000 (E_RNA) where: Base-Base interactions energy: -394.477 where: short stacking energy: -153.339 Base-Backbone interact. energy: -0.072 local terms energy: -147.592966 where: bonds (distance) C4'-P energy: -30.301 bonds (distance) P-C4' energy: -32.352 flat angles C4'-P-C4' energy: -26.936 flat angles P-C4'-P energy: -17.457 tors. eta vs tors. theta energy: -40.548 Dist. restrs. and SS energy: 4.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -497.432601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.432601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.025312 (E_RNA) where: Base-Base interactions energy: -376.723 where: short stacking energy: -133.178 Base-Backbone interact. energy: -1.239 local terms energy: -125.063021 where: bonds (distance) C4'-P energy: -25.812 bonds (distance) P-C4' energy: -19.771 flat angles C4'-P-C4' energy: -34.168 flat angles P-C4'-P energy: -15.416 tors. eta vs tors. theta energy: -29.895 Dist. restrs. and SS energy: 5.593 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -515.220789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.220789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.842337 (E_RNA) where: Base-Base interactions energy: -374.954 where: short stacking energy: -140.266 Base-Backbone interact. energy: -0.208 local terms energy: -143.680188 where: bonds (distance) C4'-P energy: -31.275 bonds (distance) P-C4' energy: -29.078 flat angles C4'-P-C4' energy: -24.026 flat angles P-C4'-P energy: -19.937 tors. eta vs tors. theta energy: -39.364 Dist. restrs. and SS energy: 3.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -497.618440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.618440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.339820 (E_RNA) where: Base-Base interactions energy: -369.301 where: short stacking energy: -130.341 Base-Backbone interact. energy: -0.416 local terms energy: -131.621974 where: bonds (distance) C4'-P energy: -24.685 bonds (distance) P-C4' energy: -27.634 flat angles C4'-P-C4' energy: -30.348 flat angles P-C4'-P energy: -17.536 tors. eta vs tors. theta energy: -31.418 Dist. restrs. and SS energy: 3.721 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -556.839852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.839852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.100020 (E_RNA) where: Base-Base interactions energy: -415.704 where: short stacking energy: -157.671 Base-Backbone interact. energy: -0.008 local terms energy: -141.388277 where: bonds (distance) C4'-P energy: -21.723 bonds (distance) P-C4' energy: -24.986 flat angles C4'-P-C4' energy: -26.701 flat angles P-C4'-P energy: -19.539 tors. eta vs tors. theta energy: -48.439 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -419.084979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.084979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.781830 (E_RNA) where: Base-Base interactions energy: -320.828 where: short stacking energy: -114.326 Base-Backbone interact. energy: -0.152 local terms energy: -109.593149 where: bonds (distance) C4'-P energy: -14.029 bonds (distance) P-C4' energy: -26.261 flat angles C4'-P-C4' energy: -19.665 flat angles P-C4'-P energy: -19.112 tors. eta vs tors. theta energy: -30.526 Dist. restrs. and SS energy: 9.697 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.791 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -501.104729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.104729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.223701 (E_RNA) where: Base-Base interactions energy: -382.464 where: short stacking energy: -142.390 Base-Backbone interact. energy: -0.149 local terms energy: -124.610660 where: bonds (distance) C4'-P energy: -27.075 bonds (distance) P-C4' energy: -12.868 flat angles C4'-P-C4' energy: -25.344 flat angles P-C4'-P energy: -17.346 tors. eta vs tors. theta energy: -41.978 Dist. restrs. and SS energy: 6.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -429.259669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.259669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.893958 (E_RNA) where: Base-Base interactions energy: -316.841 where: short stacking energy: -122.173 Base-Backbone interact. energy: -0.813 local terms energy: -120.240618 where: bonds (distance) C4'-P energy: -21.847 bonds (distance) P-C4' energy: -26.462 flat angles C4'-P-C4' energy: -21.301 flat angles P-C4'-P energy: -15.629 tors. eta vs tors. theta energy: -35.001 Dist. restrs. and SS energy: 8.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -362.749183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.749183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.737775 (E_RNA) where: Base-Base interactions energy: -274.671 where: short stacking energy: -98.901 Base-Backbone interact. energy: -0.033 local terms energy: -99.034355 where: bonds (distance) C4'-P energy: -24.660 bonds (distance) P-C4' energy: -23.951 flat angles C4'-P-C4' energy: -10.067 flat angles P-C4'-P energy: -20.557 tors. eta vs tors. theta energy: -19.800 Dist. restrs. and SS energy: 10.989 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -534.857406 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -534.857406 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.957550 (E_RNA) where: Base-Base interactions energy: -393.379 where: short stacking energy: -150.186 Base-Backbone interact. energy: -0.002 local terms energy: -143.575788 where: bonds (distance) C4'-P energy: -25.315 bonds (distance) P-C4' energy: -24.663 flat angles C4'-P-C4' energy: -30.200 flat angles P-C4'-P energy: -20.074 tors. eta vs tors. theta energy: -43.324 Dist. restrs. and SS energy: 2.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -514.908661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.908661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.629342 (E_RNA) where: Base-Base interactions energy: -373.516 where: short stacking energy: -140.245 Base-Backbone interact. energy: -0.160 local terms energy: -144.953337 where: bonds (distance) C4'-P energy: -25.087 bonds (distance) P-C4' energy: -30.626 flat angles C4'-P-C4' energy: -31.074 flat angles P-C4'-P energy: -20.646 tors. eta vs tors. theta energy: -37.520 Dist. restrs. and SS energy: 3.721 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -520.946563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.946563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.078763 (E_RNA) where: Base-Base interactions energy: -379.777 where: short stacking energy: -142.444 Base-Backbone interact. energy: -0.278 local terms energy: -146.024262 where: bonds (distance) C4'-P energy: -30.519 bonds (distance) P-C4' energy: -28.215 flat angles C4'-P-C4' energy: -24.010 flat angles P-C4'-P energy: -19.844 tors. eta vs tors. theta energy: -43.436 Dist. restrs. and SS energy: 5.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -506.047419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.047419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.996612 (E_RNA) where: Base-Base interactions energy: -384.254 where: short stacking energy: -131.059 Base-Backbone interact. energy: 0.367 local terms energy: -125.109783 where: bonds (distance) C4'-P energy: -25.562 bonds (distance) P-C4' energy: -26.845 flat angles C4'-P-C4' energy: -24.077 flat angles P-C4'-P energy: -17.116 tors. eta vs tors. theta energy: -31.510 Dist. restrs. and SS energy: 2.949 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -562.294745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.294745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.473748 (E_RNA) where: Base-Base interactions energy: -407.884 where: short stacking energy: -157.929 Base-Backbone interact. energy: -0.053 local terms energy: -154.536735 where: bonds (distance) C4'-P energy: -28.822 bonds (distance) P-C4' energy: -28.970 flat angles C4'-P-C4' energy: -24.103 flat angles P-C4'-P energy: -24.693 tors. eta vs tors. theta energy: -47.949 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -462.998166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.998166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.705240 (E_RNA) where: Base-Base interactions energy: -348.122 where: short stacking energy: -127.363 Base-Backbone interact. energy: 1.896 local terms energy: -121.713068 where: bonds (distance) C4'-P energy: -17.660 bonds (distance) P-C4' energy: -27.242 flat angles C4'-P-C4' energy: -28.140 flat angles P-C4'-P energy: -15.024 tors. eta vs tors. theta energy: -33.647 Dist. restrs. and SS energy: 4.707 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.234 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -565.622891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.622891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.971460 (E_RNA) where: Base-Base interactions energy: -415.450 where: short stacking energy: -153.715 Base-Backbone interact. energy: -0.001 local terms energy: -150.520715 where: bonds (distance) C4'-P energy: -27.688 bonds (distance) P-C4' energy: -28.209 flat angles C4'-P-C4' energy: -28.366 flat angles P-C4'-P energy: -17.668 tors. eta vs tors. theta energy: -48.591 Dist. restrs. and SS energy: 0.349 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -423.123234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.123234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.610665 (E_RNA) where: Base-Base interactions energy: -302.261 where: short stacking energy: -125.367 Base-Backbone interact. energy: -1.251 local terms energy: -131.098636 where: bonds (distance) C4'-P energy: -24.061 bonds (distance) P-C4' energy: -24.937 flat angles C4'-P-C4' energy: -25.976 flat angles P-C4'-P energy: -20.844 tors. eta vs tors. theta energy: -35.281 Dist. restrs. and SS energy: 11.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -376.110035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.110035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.058077 (E_RNA) where: Base-Base interactions energy: -276.070 where: short stacking energy: -100.980 Base-Backbone interact. energy: -0.553 local terms energy: -114.435264 where: bonds (distance) C4'-P energy: -23.113 bonds (distance) P-C4' energy: -14.894 flat angles C4'-P-C4' energy: -29.641 flat angles P-C4'-P energy: -19.829 tors. eta vs tors. theta energy: -26.958 Dist. restrs. and SS energy: 14.948 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -407.950421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.950421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.363801 (E_RNA) where: Base-Base interactions energy: -296.316 where: short stacking energy: -117.248 Base-Backbone interact. energy: -2.751 local terms energy: -129.297369 where: bonds (distance) C4'-P energy: -27.874 bonds (distance) P-C4' energy: -24.112 flat angles C4'-P-C4' energy: -22.880 flat angles P-C4'-P energy: -17.787 tors. eta vs tors. theta energy: -36.645 Dist. restrs. and SS energy: 20.413 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -536.892086 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.892086 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.525085 (E_RNA) where: Base-Base interactions energy: -391.314 where: short stacking energy: -150.920 Base-Backbone interact. energy: -0.031 local terms energy: -146.180144 where: bonds (distance) C4'-P energy: -30.669 bonds (distance) P-C4' energy: -29.046 flat angles C4'-P-C4' energy: -25.932 flat angles P-C4'-P energy: -18.290 tors. eta vs tors. theta energy: -42.243 Dist. restrs. and SS energy: 0.633 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -532.924704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.924704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.618217 (E_RNA) where: Base-Base interactions energy: -394.305 where: short stacking energy: -150.212 Base-Backbone interact. energy: -0.480 local terms energy: -141.833498 where: bonds (distance) C4'-P energy: -22.475 bonds (distance) P-C4' energy: -26.593 flat angles C4'-P-C4' energy: -28.015 flat angles P-C4'-P energy: -22.633 tors. eta vs tors. theta energy: -42.119 Dist. restrs. and SS energy: 3.694 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -505.219784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.219784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.398126 (E_RNA) where: Base-Base interactions energy: -369.588 where: short stacking energy: -137.870 Base-Backbone interact. energy: 0.741 local terms energy: -140.551328 where: bonds (distance) C4'-P energy: -27.102 bonds (distance) P-C4' energy: -28.368 flat angles C4'-P-C4' energy: -28.180 flat angles P-C4'-P energy: -20.753 tors. eta vs tors. theta energy: -36.148 Dist. restrs. and SS energy: 4.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -565.880266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.880266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.096011 (E_RNA) where: Base-Base interactions energy: -415.957 where: short stacking energy: -158.954 Base-Backbone interact. energy: -0.165 local terms energy: -149.974128 where: bonds (distance) C4'-P energy: -24.989 bonds (distance) P-C4' energy: -29.170 flat angles C4'-P-C4' energy: -29.531 flat angles P-C4'-P energy: -18.181 tors. eta vs tors. theta energy: -48.103 Dist. restrs. and SS energy: 0.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -492.748025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.748025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.100074 (E_RNA) where: Base-Base interactions energy: -362.955 where: short stacking energy: -127.062 Base-Backbone interact. energy: -0.264 local terms energy: -136.880936 where: bonds (distance) C4'-P energy: -31.186 bonds (distance) P-C4' energy: -28.381 flat angles C4'-P-C4' energy: -27.032 flat angles P-C4'-P energy: -15.496 tors. eta vs tors. theta energy: -34.786 Dist. restrs. and SS energy: 7.352 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -566.117284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.117284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.783808 (E_RNA) where: Base-Base interactions energy: -416.110 where: short stacking energy: -157.690 Base-Backbone interact. energy: 0.104 local terms energy: -150.777630 where: bonds (distance) C4'-P energy: -22.251 bonds (distance) P-C4' energy: -23.881 flat angles C4'-P-C4' energy: -32.420 flat angles P-C4'-P energy: -21.581 tors. eta vs tors. theta energy: -50.644 Dist. restrs. and SS energy: 0.667 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -460.895475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.895475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.534084 (E_RNA) where: Base-Base interactions energy: -345.528 where: short stacking energy: -123.602 Base-Backbone interact. energy: -0.322 local terms energy: -121.684387 where: bonds (distance) C4'-P energy: -25.854 bonds (distance) P-C4' energy: -22.335 flat angles C4'-P-C4' energy: -21.018 flat angles P-C4'-P energy: -20.005 tors. eta vs tors. theta energy: -32.472 Dist. restrs. and SS energy: 6.639 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -438.410333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.410333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.621601 (E_RNA) where: Base-Base interactions energy: -330.862 where: short stacking energy: -122.631 Base-Backbone interact. energy: -0.496 local terms energy: -117.262884 where: bonds (distance) C4'-P energy: -23.889 bonds (distance) P-C4' energy: -11.712 flat angles C4'-P-C4' energy: -26.119 flat angles P-C4'-P energy: -20.309 tors. eta vs tors. theta energy: -35.234 Dist. restrs. and SS energy: 10.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -380.067417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.067417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.371623 (E_RNA) where: Base-Base interactions energy: -289.440 where: short stacking energy: -91.502 Base-Backbone interact. energy: -0.590 local terms energy: -98.341098 where: bonds (distance) C4'-P energy: -21.796 bonds (distance) P-C4' energy: -28.250 flat angles C4'-P-C4' energy: -15.610 flat angles P-C4'-P energy: -8.743 tors. eta vs tors. theta energy: -23.943 Dist. restrs. and SS energy: 8.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -436.743443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.743443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.532978 (E_RNA) where: Base-Base interactions energy: -327.639 where: short stacking energy: -118.649 Base-Backbone interact. energy: 0.185 local terms energy: -116.078634 where: bonds (distance) C4'-P energy: -20.977 bonds (distance) P-C4' energy: -23.674 flat angles C4'-P-C4' energy: -26.047 flat angles P-C4'-P energy: -14.040 tors. eta vs tors. theta energy: -31.340 Dist. restrs. and SS energy: 6.790 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -543.711867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.711867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.828322 (E_RNA) where: Base-Base interactions energy: -385.997 where: short stacking energy: -148.223 Base-Backbone interact. energy: -0.204 local terms energy: -158.627461 where: bonds (distance) C4'-P energy: -34.108 bonds (distance) P-C4' energy: -32.994 flat angles C4'-P-C4' energy: -26.153 flat angles P-C4'-P energy: -21.763 tors. eta vs tors. theta energy: -43.609 Dist. restrs. and SS energy: 1.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -533.551148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.551148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -535.661107 (E_RNA) where: Base-Base interactions energy: -386.399 where: short stacking energy: -146.392 Base-Backbone interact. energy: -0.218 local terms energy: -149.043215 where: bonds (distance) C4'-P energy: -31.982 bonds (distance) P-C4' energy: -18.136 flat angles C4'-P-C4' energy: -33.851 flat angles P-C4'-P energy: -22.438 tors. eta vs tors. theta energy: -42.635 Dist. restrs. and SS energy: 2.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -571.797384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.797384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.208918 (E_RNA) where: Base-Base interactions energy: -413.542 where: short stacking energy: -157.836 Base-Backbone interact. energy: -0.001 local terms energy: -158.666119 where: bonds (distance) C4'-P energy: -26.197 bonds (distance) P-C4' energy: -27.102 flat angles C4'-P-C4' energy: -31.577 flat angles P-C4'-P energy: -25.041 tors. eta vs tors. theta energy: -48.749 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -499.181346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.181346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.777085 (E_RNA) where: Base-Base interactions energy: -361.221 where: short stacking energy: -132.029 Base-Backbone interact. energy: -0.644 local terms energy: -143.912080 where: bonds (distance) C4'-P energy: -23.575 bonds (distance) P-C4' energy: -31.219 flat angles C4'-P-C4' energy: -28.054 flat angles P-C4'-P energy: -21.957 tors. eta vs tors. theta energy: -39.107 Dist. restrs. and SS energy: 6.596 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -573.509648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.509648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.009793 (E_RNA) where: Base-Base interactions energy: -429.691 where: short stacking energy: -165.584 Base-Backbone interact. energy: -0.001 local terms energy: -144.317360 where: bonds (distance) C4'-P energy: -17.777 bonds (distance) P-C4' energy: -23.871 flat angles C4'-P-C4' energy: -28.038 flat angles P-C4'-P energy: -25.775 tors. eta vs tors. theta energy: -48.857 Dist. restrs. and SS energy: 0.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -500.039409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.039409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.557947 (E_RNA) where: Base-Base interactions energy: -381.724 where: short stacking energy: -143.562 Base-Backbone interact. energy: -0.286 local terms energy: -123.548284 where: bonds (distance) C4'-P energy: -15.638 bonds (distance) P-C4' energy: -22.591 flat angles C4'-P-C4' energy: -27.754 flat angles P-C4'-P energy: -18.274 tors. eta vs tors. theta energy: -39.291 Dist. restrs. and SS energy: 5.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -466.514864 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.514864 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.531870 (E_RNA) where: Base-Base interactions energy: -337.508 where: short stacking energy: -128.534 Base-Backbone interact. energy: -0.431 local terms energy: -135.592417 where: bonds (distance) C4'-P energy: -23.270 bonds (distance) P-C4' energy: -25.693 flat angles C4'-P-C4' energy: -25.930 flat angles P-C4'-P energy: -18.980 tors. eta vs tors. theta energy: -41.719 Dist. restrs. and SS energy: 7.017 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -466.991126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.991126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.517917 (E_RNA) where: Base-Base interactions energy: -339.844 where: short stacking energy: -129.040 Base-Backbone interact. energy: 1.299 local terms energy: -136.387953 where: bonds (distance) C4'-P energy: -22.481 bonds (distance) P-C4' energy: -26.660 flat angles C4'-P-C4' energy: -30.315 flat angles P-C4'-P energy: -21.495 tors. eta vs tors. theta energy: -35.437 Dist. restrs. and SS energy: 7.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.414 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -477.627742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.627742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.885266 (E_RNA) where: Base-Base interactions energy: -353.467 where: short stacking energy: -120.112 Base-Backbone interact. energy: -0.172 local terms energy: -127.246487 where: bonds (distance) C4'-P energy: -23.137 bonds (distance) P-C4' energy: -25.374 flat angles C4'-P-C4' energy: -23.125 flat angles P-C4'-P energy: -18.292 tors. eta vs tors. theta energy: -37.319 Dist. restrs. and SS energy: 3.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -364.208870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.208870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.945079 (E_RNA) where: Base-Base interactions energy: -263.620 where: short stacking energy: -101.350 Base-Backbone interact. energy: 0.463 local terms energy: -111.787630 where: bonds (distance) C4'-P energy: -23.120 bonds (distance) P-C4' energy: -25.103 flat angles C4'-P-C4' energy: -19.684 flat angles P-C4'-P energy: -18.195 tors. eta vs tors. theta energy: -25.686 Dist. restrs. and SS energy: 10.736 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -528.868654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.868654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.771823 (E_RNA) where: Base-Base interactions energy: -393.358 where: short stacking energy: -146.148 Base-Backbone interact. energy: -0.037 local terms energy: -137.376925 where: bonds (distance) C4'-P energy: -23.754 bonds (distance) P-C4' energy: -29.262 flat angles C4'-P-C4' energy: -28.412 flat angles P-C4'-P energy: -17.407 tors. eta vs tors. theta energy: -38.542 Dist. restrs. and SS energy: 1.903 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -582.363868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.363868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.912839 (E_RNA) where: Base-Base interactions energy: -423.490 where: short stacking energy: -162.976 Base-Backbone interact. energy: -0.002 local terms energy: -159.421011 where: bonds (distance) C4'-P energy: -30.347 bonds (distance) P-C4' energy: -29.043 flat angles C4'-P-C4' energy: -29.911 flat angles P-C4'-P energy: -21.104 tors. eta vs tors. theta energy: -49.015 Dist. restrs. and SS energy: 0.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -535.388577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.388577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.456184 (E_RNA) where: Base-Base interactions energy: -397.955 where: short stacking energy: -147.966 Base-Backbone interact. energy: -0.315 local terms energy: -142.185669 where: bonds (distance) C4'-P energy: -27.118 bonds (distance) P-C4' energy: -22.802 flat angles C4'-P-C4' energy: -31.256 flat angles P-C4'-P energy: -23.048 tors. eta vs tors. theta energy: -37.962 Dist. restrs. and SS energy: 5.068 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -583.310911 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.310911 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.753948 (E_RNA) where: Base-Base interactions energy: -431.971 where: short stacking energy: -162.809 Base-Backbone interact. energy: -0.001 local terms energy: -152.248121 where: bonds (distance) C4'-P energy: -26.554 bonds (distance) P-C4' energy: -25.556 flat angles C4'-P-C4' energy: -30.530 flat angles P-C4'-P energy: -19.802 tors. eta vs tors. theta energy: -49.807 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.466 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -498.410953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.410953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.721741 (E_RNA) where: Base-Base interactions energy: -364.184 where: short stacking energy: -132.352 Base-Backbone interact. energy: 0.187 local terms energy: -138.724415 where: bonds (distance) C4'-P energy: -27.765 bonds (distance) P-C4' energy: -30.720 flat angles C4'-P-C4' energy: -25.689 flat angles P-C4'-P energy: -18.752 tors. eta vs tors. theta energy: -35.799 Dist. restrs. and SS energy: 4.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -507.010282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.010282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.274327 (E_RNA) where: Base-Base interactions energy: -363.341 where: short stacking energy: -136.213 Base-Backbone interact. energy: -0.385 local terms energy: -147.548225 where: bonds (distance) C4'-P energy: -28.666 bonds (distance) P-C4' energy: -28.601 flat angles C4'-P-C4' energy: -24.313 flat angles P-C4'-P energy: -23.427 tors. eta vs tors. theta energy: -42.541 Dist. restrs. and SS energy: 4.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -495.066993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.066993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.229204 (E_RNA) where: Base-Base interactions energy: -378.548 where: short stacking energy: -134.825 Base-Backbone interact. energy: 0.081 local terms energy: -120.762548 where: bonds (distance) C4'-P energy: -22.934 bonds (distance) P-C4' energy: -24.564 flat angles C4'-P-C4' energy: -20.828 flat angles P-C4'-P energy: -13.516 tors. eta vs tors. theta energy: -38.920 Dist. restrs. and SS energy: 4.162 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -506.112748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.112748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.005605 (E_RNA) where: Base-Base interactions energy: -370.770 where: short stacking energy: -125.733 Base-Backbone interact. energy: -0.042 local terms energy: -136.193637 where: bonds (distance) C4'-P energy: -24.456 bonds (distance) P-C4' energy: -28.158 flat angles C4'-P-C4' energy: -26.182 flat angles P-C4'-P energy: -23.628 tors. eta vs tors. theta energy: -33.770 Dist. restrs. and SS energy: 0.893 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -447.604205 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.604205 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.265986 (E_RNA) where: Base-Base interactions energy: -323.722 where: short stacking energy: -130.676 Base-Backbone interact. energy: -0.576 local terms energy: -133.968096 where: bonds (distance) C4'-P energy: -32.005 bonds (distance) P-C4' energy: -26.472 flat angles C4'-P-C4' energy: -21.472 flat angles P-C4'-P energy: -12.370 tors. eta vs tors. theta energy: -41.649 Dist. restrs. and SS energy: 10.662 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -347.010150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.010150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.461288 (E_RNA) where: Base-Base interactions energy: -255.413 where: short stacking energy: -90.467 Base-Backbone interact. energy: 2.880 local terms energy: -100.929000 where: bonds (distance) C4'-P energy: -18.766 bonds (distance) P-C4' energy: -29.791 flat angles C4'-P-C4' energy: -15.846 flat angles P-C4'-P energy: -11.682 tors. eta vs tors. theta energy: -24.844 Dist. restrs. and SS energy: 6.451 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -603.214816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.214816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.482138 (E_RNA) where: Base-Base interactions energy: -436.361 where: short stacking energy: -169.599 Base-Backbone interact. energy: -0.000 local terms energy: -167.120562 where: bonds (distance) C4'-P energy: -28.665 bonds (distance) P-C4' energy: -30.862 flat angles C4'-P-C4' energy: -32.422 flat angles P-C4'-P energy: -24.772 tors. eta vs tors. theta energy: -50.400 Dist. restrs. and SS energy: 0.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -524.387045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.387045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.768255 (E_RNA) where: Base-Base interactions energy: -371.358 where: short stacking energy: -128.663 Base-Backbone interact. energy: -0.338 local terms energy: -154.072206 where: bonds (distance) C4'-P energy: -31.078 bonds (distance) P-C4' energy: -30.322 flat angles C4'-P-C4' energy: -29.396 flat angles P-C4'-P energy: -23.076 tors. eta vs tors. theta energy: -40.200 Dist. restrs. and SS energy: 1.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -588.486857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.486857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.797997 (E_RNA) where: Base-Base interactions energy: -428.313 where: short stacking energy: -168.191 Base-Backbone interact. energy: -0.001 local terms energy: -160.483931 where: bonds (distance) C4'-P energy: -24.564 bonds (distance) P-C4' energy: -30.650 flat angles C4'-P-C4' energy: -30.826 flat angles P-C4'-P energy: -24.844 tors. eta vs tors. theta energy: -49.601 Dist. restrs. and SS energy: 0.311 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -531.045335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.045335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.625127 (E_RNA) where: Base-Base interactions energy: -392.809 where: short stacking energy: -146.421 Base-Backbone interact. energy: -0.864 local terms energy: -142.952154 where: bonds (distance) C4'-P energy: -21.332 bonds (distance) P-C4' energy: -28.243 flat angles C4'-P-C4' energy: -30.420 flat angles P-C4'-P energy: -24.204 tors. eta vs tors. theta energy: -38.752 Dist. restrs. and SS energy: 5.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -492.445466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.445466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.977802 (E_RNA) where: Base-Base interactions energy: -366.614 where: short stacking energy: -135.364 Base-Backbone interact. energy: -1.106 local terms energy: -127.258031 where: bonds (distance) C4'-P energy: -24.846 bonds (distance) P-C4' energy: -15.044 flat angles C4'-P-C4' energy: -26.951 flat angles P-C4'-P energy: -18.922 tors. eta vs tors. theta energy: -41.495 Dist. restrs. and SS energy: 2.532 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -482.552675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.552675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.261517 (E_RNA) where: Base-Base interactions energy: -367.070 where: short stacking energy: -131.749 Base-Backbone interact. energy: -0.480 local terms energy: -121.943382 where: bonds (distance) C4'-P energy: -20.355 bonds (distance) P-C4' energy: -13.191 flat angles C4'-P-C4' energy: -30.128 flat angles P-C4'-P energy: -22.623 tors. eta vs tors. theta energy: -35.647 Dist. restrs. and SS energy: 6.709 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.231 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -487.171736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.171736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.862795 (E_RNA) where: Base-Base interactions energy: -360.154 where: short stacking energy: -125.507 Base-Backbone interact. energy: -0.048 local terms energy: -128.661673 where: bonds (distance) C4'-P energy: -16.116 bonds (distance) P-C4' energy: -29.358 flat angles C4'-P-C4' energy: -25.173 flat angles P-C4'-P energy: -19.538 tors. eta vs tors. theta energy: -38.477 Dist. restrs. and SS energy: 1.691 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -487.585419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.585419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.758423 (E_RNA) where: Base-Base interactions energy: -362.905 where: short stacking energy: -131.375 Base-Backbone interact. energy: 2.025 local terms energy: -130.878328 where: bonds (distance) C4'-P energy: -23.693 bonds (distance) P-C4' energy: -22.891 flat angles C4'-P-C4' energy: -30.467 flat angles P-C4'-P energy: -16.797 tors. eta vs tors. theta energy: -37.031 Dist. restrs. and SS energy: 4.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -362.519034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.519034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.196776 (E_RNA) where: Base-Base interactions energy: -250.234 where: short stacking energy: -93.477 Base-Backbone interact. energy: 1.126 local terms energy: -125.089418 where: bonds (distance) C4'-P energy: -24.155 bonds (distance) P-C4' energy: -21.803 flat angles C4'-P-C4' energy: -28.277 flat angles P-C4'-P energy: -19.697 tors. eta vs tors. theta energy: -31.158 Dist. restrs. and SS energy: 11.678 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -449.267342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.267342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.345156 (E_RNA) where: Base-Base interactions energy: -330.734 where: short stacking energy: -128.862 Base-Backbone interact. energy: -0.265 local terms energy: -123.346336 where: bonds (distance) C4'-P energy: -23.274 bonds (distance) P-C4' energy: -26.449 flat angles C4'-P-C4' energy: -25.205 flat angles P-C4'-P energy: -15.022 tors. eta vs tors. theta energy: -33.396 Dist. restrs. and SS energy: 5.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -604.140479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.140479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.186675 (E_RNA) where: Base-Base interactions energy: -438.718 where: short stacking energy: -165.656 Base-Backbone interact. energy: -0.000 local terms energy: -165.468634 where: bonds (distance) C4'-P energy: -24.953 bonds (distance) P-C4' energy: -32.061 flat angles C4'-P-C4' energy: -30.444 flat angles P-C4'-P energy: -28.159 tors. eta vs tors. theta energy: -49.852 Dist. restrs. and SS energy: 0.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -586.269397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.269397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.395298 (E_RNA) where: Base-Base interactions energy: -431.625 where: short stacking energy: -167.446 Base-Backbone interact. energy: -0.001 local terms energy: -154.769309 where: bonds (distance) C4'-P energy: -27.207 bonds (distance) P-C4' energy: -27.104 flat angles C4'-P-C4' energy: -32.248 flat angles P-C4'-P energy: -20.091 tors. eta vs tors. theta energy: -48.120 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -518.307808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.307808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.483239 (E_RNA) where: Base-Base interactions energy: -375.975 where: short stacking energy: -137.157 Base-Backbone interact. energy: -0.291 local terms energy: -143.216833 where: bonds (distance) C4'-P energy: -26.996 bonds (distance) P-C4' energy: -25.721 flat angles C4'-P-C4' energy: -27.174 flat angles P-C4'-P energy: -22.610 tors. eta vs tors. theta energy: -40.716 Dist. restrs. and SS energy: 1.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -527.510555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.510555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.860118 (E_RNA) where: Base-Base interactions energy: -392.323 where: short stacking energy: -141.281 Base-Backbone interact. energy: -0.412 local terms energy: -137.125453 where: bonds (distance) C4'-P energy: -24.623 bonds (distance) P-C4' energy: -24.214 flat angles C4'-P-C4' energy: -25.769 flat angles P-C4'-P energy: -22.719 tors. eta vs tors. theta energy: -39.800 Dist. restrs. and SS energy: 2.350 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -510.519350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.519350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.792457 (E_RNA) where: Base-Base interactions energy: -372.678 where: short stacking energy: -140.805 Base-Backbone interact. energy: -0.678 local terms energy: -141.436863 where: bonds (distance) C4'-P energy: -25.186 bonds (distance) P-C4' energy: -29.325 flat angles C4'-P-C4' energy: -26.205 flat angles P-C4'-P energy: -20.724 tors. eta vs tors. theta energy: -39.997 Dist. restrs. and SS energy: 4.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -499.761194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.761194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.591404 (E_RNA) where: Base-Base interactions energy: -375.894 where: short stacking energy: -135.519 Base-Backbone interact. energy: -0.118 local terms energy: -128.579523 where: bonds (distance) C4'-P energy: -27.049 bonds (distance) P-C4' energy: -23.970 flat angles C4'-P-C4' energy: -28.118 flat angles P-C4'-P energy: -16.072 tors. eta vs tors. theta energy: -33.371 Dist. restrs. and SS energy: 4.830 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -485.522830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.522830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.672778 (E_RNA) where: Base-Base interactions energy: -365.177 where: short stacking energy: -128.160 Base-Backbone interact. energy: -0.436 local terms energy: -126.060417 where: bonds (distance) C4'-P energy: -26.053 bonds (distance) P-C4' energy: -24.655 flat angles C4'-P-C4' energy: -25.169 flat angles P-C4'-P energy: -16.019 tors. eta vs tors. theta energy: -34.164 Dist. restrs. and SS energy: 6.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -488.348803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.348803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.707314 (E_RNA) where: Base-Base interactions energy: -362.335 where: short stacking energy: -137.068 Base-Backbone interact. energy: -0.035 local terms energy: -130.337287 where: bonds (distance) C4'-P energy: -15.773 bonds (distance) P-C4' energy: -27.657 flat angles C4'-P-C4' energy: -28.729 flat angles P-C4'-P energy: -17.030 tors. eta vs tors. theta energy: -41.148 Dist. restrs. and SS energy: 4.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -398.494603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.494603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.818297 (E_RNA) where: Base-Base interactions energy: -296.850 where: short stacking energy: -103.260 Base-Backbone interact. energy: -1.024 local terms energy: -110.943985 where: bonds (distance) C4'-P energy: -21.113 bonds (distance) P-C4' energy: -18.590 flat angles C4'-P-C4' energy: -30.644 flat angles P-C4'-P energy: -8.640 tors. eta vs tors. theta energy: -31.957 Dist. restrs. and SS energy: 10.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -432.518877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.518877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.478094 (E_RNA) where: Base-Base interactions energy: -332.336 where: short stacking energy: -125.244 Base-Backbone interact. energy: -0.630 local terms energy: -106.511437 where: bonds (distance) C4'-P energy: -22.031 bonds (distance) P-C4' energy: -15.192 flat angles C4'-P-C4' energy: -24.387 flat angles P-C4'-P energy: -11.909 tors. eta vs tors. theta energy: -32.993 Dist. restrs. and SS energy: 6.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -600.468496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.468496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.914639 (E_RNA) where: Base-Base interactions energy: -439.344 where: short stacking energy: -167.525 Base-Backbone interact. energy: -0.770 local terms energy: -161.148301 where: bonds (distance) C4'-P energy: -24.642 bonds (distance) P-C4' energy: -28.842 flat angles C4'-P-C4' energy: -35.372 flat angles P-C4'-P energy: -22.371 tors. eta vs tors. theta energy: -49.922 Dist. restrs. and SS energy: 0.446 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.347 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -598.949765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.949765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.101535 (E_RNA) where: Base-Base interactions energy: -441.471 where: short stacking energy: -171.159 Base-Backbone interact. energy: -0.001 local terms energy: -157.628776 where: bonds (distance) C4'-P energy: -24.875 bonds (distance) P-C4' energy: -28.677 flat angles C4'-P-C4' energy: -31.129 flat angles P-C4'-P energy: -23.158 tors. eta vs tors. theta energy: -49.790 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -529.761338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.761338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -534.117160 (E_RNA) where: Base-Base interactions energy: -394.611 where: short stacking energy: -147.155 Base-Backbone interact. energy: -0.188 local terms energy: -139.318179 where: bonds (distance) C4'-P energy: -23.680 bonds (distance) P-C4' energy: -24.280 flat angles C4'-P-C4' energy: -25.830 flat angles P-C4'-P energy: -21.235 tors. eta vs tors. theta energy: -44.293 Dist. restrs. and SS energy: 4.356 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -509.986221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.986221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.944206 (E_RNA) where: Base-Base interactions energy: -360.079 where: short stacking energy: -134.821 Base-Backbone interact. energy: -0.012 local terms energy: -150.853543 where: bonds (distance) C4'-P energy: -27.309 bonds (distance) P-C4' energy: -33.394 flat angles C4'-P-C4' energy: -29.527 flat angles P-C4'-P energy: -22.117 tors. eta vs tors. theta energy: -38.507 Dist. restrs. and SS energy: 0.958 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -506.749385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.749385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.104066 (E_RNA) where: Base-Base interactions energy: -387.399 where: short stacking energy: -147.070 Base-Backbone interact. energy: -0.384 local terms energy: -124.320758 where: bonds (distance) C4'-P energy: -26.665 bonds (distance) P-C4' energy: -22.819 flat angles C4'-P-C4' energy: -23.430 flat angles P-C4'-P energy: -13.907 tors. eta vs tors. theta energy: -37.500 Dist. restrs. and SS energy: 5.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -492.001256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.001256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.523436 (E_RNA) where: Base-Base interactions energy: -349.060 where: short stacking energy: -132.130 Base-Backbone interact. energy: 0.722 local terms energy: -147.374414 where: bonds (distance) C4'-P energy: -28.121 bonds (distance) P-C4' energy: -29.166 flat angles C4'-P-C4' energy: -28.926 flat angles P-C4'-P energy: -20.912 tors. eta vs tors. theta energy: -40.250 Dist. restrs. and SS energy: 3.522 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.189 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -474.471228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.471228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.062464 (E_RNA) where: Base-Base interactions energy: -358.144 where: short stacking energy: -136.283 Base-Backbone interact. energy: -0.642 local terms energy: -122.276727 where: bonds (distance) C4'-P energy: -23.126 bonds (distance) P-C4' energy: -24.489 flat angles C4'-P-C4' energy: -25.307 flat angles P-C4'-P energy: -8.294 tors. eta vs tors. theta energy: -41.061 Dist. restrs. and SS energy: 6.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -481.097250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.097250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.974007 (E_RNA) where: Base-Base interactions energy: -360.513 where: short stacking energy: -142.344 Base-Backbone interact. energy: -0.265 local terms energy: -124.196046 where: bonds (distance) C4'-P energy: -10.802 bonds (distance) P-C4' energy: -26.503 flat angles C4'-P-C4' energy: -31.352 flat angles P-C4'-P energy: -16.371 tors. eta vs tors. theta energy: -39.169 Dist. restrs. and SS energy: 3.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -446.528904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.528904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.724187 (E_RNA) where: Base-Base interactions energy: -333.996 where: short stacking energy: -122.256 Base-Backbone interact. energy: 0.023 local terms energy: -123.750631 where: bonds (distance) C4'-P energy: -20.522 bonds (distance) P-C4' energy: -20.368 flat angles C4'-P-C4' energy: -26.939 flat angles P-C4'-P energy: -18.834 tors. eta vs tors. theta energy: -37.087 Dist. restrs. and SS energy: 11.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -398.125916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.125916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.732087 (E_RNA) where: Base-Base interactions energy: -289.189 where: short stacking energy: -122.793 Base-Backbone interact. energy: -0.225 local terms energy: -115.318025 where: bonds (distance) C4'-P energy: -16.771 bonds (distance) P-C4' energy: -21.794 flat angles C4'-P-C4' energy: -29.447 flat angles P-C4'-P energy: -13.304 tors. eta vs tors. theta energy: -34.002 Dist. restrs. and SS energy: 6.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -595.656517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.656517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.765271 (E_RNA) where: Base-Base interactions energy: -440.002 where: short stacking energy: -164.250 Base-Backbone interact. energy: -0.002 local terms energy: -155.761439 where: bonds (distance) C4'-P energy: -23.080 bonds (distance) P-C4' energy: -31.153 flat angles C4'-P-C4' energy: -29.828 flat angles P-C4'-P energy: -23.006 tors. eta vs tors. theta energy: -48.694 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -544.865667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.865667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.406555 (E_RNA) where: Base-Base interactions energy: -396.925 where: short stacking energy: -156.868 Base-Backbone interact. energy: -0.207 local terms energy: -153.274260 where: bonds (distance) C4'-P energy: -31.227 bonds (distance) P-C4' energy: -29.023 flat angles C4'-P-C4' energy: -25.847 flat angles P-C4'-P energy: -25.448 tors. eta vs tors. theta energy: -41.729 Dist. restrs. and SS energy: 5.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -586.792591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.792591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.324762 (E_RNA) where: Base-Base interactions energy: -423.119 where: short stacking energy: -162.242 Base-Backbone interact. energy: -0.002 local terms energy: -164.203582 where: bonds (distance) C4'-P energy: -33.046 bonds (distance) P-C4' energy: -24.407 flat angles C4'-P-C4' energy: -31.388 flat angles P-C4'-P energy: -24.666 tors. eta vs tors. theta energy: -50.696 Dist. restrs. and SS energy: 0.532 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -512.942999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.942999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.290703 (E_RNA) where: Base-Base interactions energy: -372.420 where: short stacking energy: -139.306 Base-Backbone interact. energy: -0.058 local terms energy: -140.812643 where: bonds (distance) C4'-P energy: -23.610 bonds (distance) P-C4' energy: -28.569 flat angles C4'-P-C4' energy: -28.719 flat angles P-C4'-P energy: -20.035 tors. eta vs tors. theta energy: -39.879 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -491.659639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.659639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.182181 (E_RNA) where: Base-Base interactions energy: -358.834 where: short stacking energy: -130.575 Base-Backbone interact. energy: -0.151 local terms energy: -135.197626 where: bonds (distance) C4'-P energy: -24.192 bonds (distance) P-C4' energy: -25.695 flat angles C4'-P-C4' energy: -29.794 flat angles P-C4'-P energy: -17.537 tors. eta vs tors. theta energy: -37.981 Dist. restrs. and SS energy: 2.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -505.332057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.332057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.738796 (E_RNA) where: Base-Base interactions energy: -373.005 where: short stacking energy: -140.770 Base-Backbone interact. energy: -0.058 local terms energy: -138.675483 where: bonds (distance) C4'-P energy: -26.044 bonds (distance) P-C4' energy: -31.121 flat angles C4'-P-C4' energy: -26.993 flat angles P-C4'-P energy: -20.239 tors. eta vs tors. theta energy: -34.279 Dist. restrs. and SS energy: 6.407 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -485.849781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.849781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.588230 (E_RNA) where: Base-Base interactions energy: -351.529 where: short stacking energy: -134.715 Base-Backbone interact. energy: -0.077 local terms energy: -140.982079 where: bonds (distance) C4'-P energy: -27.903 bonds (distance) P-C4' energy: -19.998 flat angles C4'-P-C4' energy: -31.570 flat angles P-C4'-P energy: -21.166 tors. eta vs tors. theta energy: -40.344 Dist. restrs. and SS energy: 6.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -467.538846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.538846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.009156 (E_RNA) where: Base-Base interactions energy: -353.924 where: short stacking energy: -136.208 Base-Backbone interact. energy: -0.287 local terms energy: -118.112014 where: bonds (distance) C4'-P energy: -21.701 bonds (distance) P-C4' energy: -28.734 flat angles C4'-P-C4' energy: -19.375 flat angles P-C4'-P energy: -13.834 tors. eta vs tors. theta energy: -34.469 Dist. restrs. and SS energy: 4.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.315 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -482.722197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.722197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.802609 (E_RNA) where: Base-Base interactions energy: -354.390 where: short stacking energy: -137.678 Base-Backbone interact. energy: -0.077 local terms energy: -133.335906 where: bonds (distance) C4'-P energy: -19.768 bonds (distance) P-C4' energy: -29.743 flat angles C4'-P-C4' energy: -24.453 flat angles P-C4'-P energy: -20.053 tors. eta vs tors. theta energy: -39.319 Dist. restrs. and SS energy: 5.080 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -387.752291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.752291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.238456 (E_RNA) where: Base-Base interactions energy: -298.029 where: short stacking energy: -104.814 Base-Backbone interact. energy: 4.142 local terms energy: -101.351294 where: bonds (distance) C4'-P energy: -16.968 bonds (distance) P-C4' energy: -16.328 flat angles C4'-P-C4' energy: -22.748 flat angles P-C4'-P energy: -20.366 tors. eta vs tors. theta energy: -24.940 Dist. restrs. and SS energy: 7.486 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -563.274019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.274019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.796757 (E_RNA) where: Base-Base interactions energy: -410.526 where: short stacking energy: -154.535 Base-Backbone interact. energy: -0.163 local terms energy: -153.108345 where: bonds (distance) C4'-P energy: -28.425 bonds (distance) P-C4' energy: -28.234 flat angles C4'-P-C4' energy: -30.418 flat angles P-C4'-P energy: -23.811 tors. eta vs tors. theta energy: -42.221 Dist. restrs. and SS energy: 0.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -593.758173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.758173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.890517 (E_RNA) where: Base-Base interactions energy: -436.599 where: short stacking energy: -164.950 Base-Backbone interact. energy: -0.000 local terms energy: -157.291373 where: bonds (distance) C4'-P energy: -26.968 bonds (distance) P-C4' energy: -29.234 flat angles C4'-P-C4' energy: -30.851 flat angles P-C4'-P energy: -22.477 tors. eta vs tors. theta energy: -47.761 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -517.088329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.088329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.013891 (E_RNA) where: Base-Base interactions energy: -377.303 where: short stacking energy: -133.758 Base-Backbone interact. energy: -0.238 local terms energy: -141.472528 where: bonds (distance) C4'-P energy: -31.800 bonds (distance) P-C4' energy: -27.416 flat angles C4'-P-C4' energy: -25.344 flat angles P-C4'-P energy: -19.715 tors. eta vs tors. theta energy: -37.198 Dist. restrs. and SS energy: 1.926 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -578.626659 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.626659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.864861 (E_RNA) where: Base-Base interactions energy: -429.558 where: short stacking energy: -161.583 Base-Backbone interact. energy: -0.001 local terms energy: -149.305537 where: bonds (distance) C4'-P energy: -17.132 bonds (distance) P-C4' energy: -28.973 flat angles C4'-P-C4' energy: -29.997 flat angles P-C4'-P energy: -26.898 tors. eta vs tors. theta energy: -46.305 Dist. restrs. and SS energy: 0.238 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -509.719441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.719441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.050648 (E_RNA) where: Base-Base interactions energy: -376.568 where: short stacking energy: -135.400 Base-Backbone interact. energy: -0.048 local terms energy: -133.435122 where: bonds (distance) C4'-P energy: -24.593 bonds (distance) P-C4' energy: -25.168 flat angles C4'-P-C4' energy: -27.140 flat angles P-C4'-P energy: -20.143 tors. eta vs tors. theta energy: -36.391 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -482.993487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.993487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.727140 (E_RNA) where: Base-Base interactions energy: -344.254 where: short stacking energy: -133.719 Base-Backbone interact. energy: -1.223 local terms energy: -144.250922 where: bonds (distance) C4'-P energy: -21.064 bonds (distance) P-C4' energy: -29.322 flat angles C4'-P-C4' energy: -31.910 flat angles P-C4'-P energy: -21.162 tors. eta vs tors. theta energy: -40.792 Dist. restrs. and SS energy: 6.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -468.702785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.702785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.958388 (E_RNA) where: Base-Base interactions energy: -347.432 where: short stacking energy: -132.049 Base-Backbone interact. energy: -0.418 local terms energy: -127.108940 where: bonds (distance) C4'-P energy: -26.555 bonds (distance) P-C4' energy: -21.142 flat angles C4'-P-C4' energy: -26.818 flat angles P-C4'-P energy: -19.572 tors. eta vs tors. theta energy: -33.022 Dist. restrs. and SS energy: 6.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -479.172857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.172857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.797559 (E_RNA) where: Base-Base interactions energy: -360.234 where: short stacking energy: -142.366 Base-Backbone interact. energy: -0.340 local terms energy: -126.224423 where: bonds (distance) C4'-P energy: -17.294 bonds (distance) P-C4' energy: -24.090 flat angles C4'-P-C4' energy: -26.423 flat angles P-C4'-P energy: -15.692 tors. eta vs tors. theta energy: -42.724 Dist. restrs. and SS energy: 7.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -492.002281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.002281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.190177 (E_RNA) where: Base-Base interactions energy: -365.619 where: short stacking energy: -135.798 Base-Backbone interact. energy: -0.253 local terms energy: -134.296651 where: bonds (distance) C4'-P energy: -26.887 bonds (distance) P-C4' energy: -17.693 flat angles C4'-P-C4' energy: -27.040 flat angles P-C4'-P energy: -18.177 tors. eta vs tors. theta energy: -44.499 Dist. restrs. and SS energy: 7.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.979 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -392.165736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.165736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.437874 (E_RNA) where: Base-Base interactions energy: -288.021 where: short stacking energy: -107.043 Base-Backbone interact. energy: 0.964 local terms energy: -116.381515 where: bonds (distance) C4'-P energy: -20.340 bonds (distance) P-C4' energy: -21.698 flat angles C4'-P-C4' energy: -28.937 flat angles P-C4'-P energy: -17.112 tors. eta vs tors. theta energy: -28.294 Dist. restrs. and SS energy: 11.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -573.826030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.826030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.011378 (E_RNA) where: Base-Base interactions energy: -419.664 where: short stacking energy: -156.333 Base-Backbone interact. energy: -0.203 local terms energy: -154.144821 where: bonds (distance) C4'-P energy: -32.474 bonds (distance) P-C4' energy: -27.654 flat angles C4'-P-C4' energy: -25.354 flat angles P-C4'-P energy: -25.233 tors. eta vs tors. theta energy: -43.430 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -599.403068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.403068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.523927 (E_RNA) where: Base-Base interactions energy: -436.950 where: short stacking energy: -167.889 Base-Backbone interact. energy: -0.001 local terms energy: -162.573280 where: bonds (distance) C4'-P energy: -28.160 bonds (distance) P-C4' energy: -22.415 flat angles C4'-P-C4' energy: -32.776 flat angles P-C4'-P energy: -28.192 tors. eta vs tors. theta energy: -51.030 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -526.672843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.672843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.707535 (E_RNA) where: Base-Base interactions energy: -387.604 where: short stacking energy: -149.621 Base-Backbone interact. energy: 0.171 local terms energy: -140.274342 where: bonds (distance) C4'-P energy: -24.290 bonds (distance) P-C4' energy: -26.972 flat angles C4'-P-C4' energy: -27.531 flat angles P-C4'-P energy: -19.407 tors. eta vs tors. theta energy: -42.074 Dist. restrs. and SS energy: 1.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -585.518197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.518197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.826926 (E_RNA) where: Base-Base interactions energy: -432.791 where: short stacking energy: -170.010 Base-Backbone interact. energy: -0.007 local terms energy: -153.029620 where: bonds (distance) C4'-P energy: -28.760 bonds (distance) P-C4' energy: -22.600 flat angles C4'-P-C4' energy: -33.491 flat angles P-C4'-P energy: -23.137 tors. eta vs tors. theta energy: -45.042 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -515.168950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.168950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.416600 (E_RNA) where: Base-Base interactions energy: -383.927 where: short stacking energy: -139.958 Base-Backbone interact. energy: -0.005 local terms energy: -132.484358 where: bonds (distance) C4'-P energy: -23.555 bonds (distance) P-C4' energy: -17.943 flat angles C4'-P-C4' energy: -29.536 flat angles P-C4'-P energy: -23.227 tors. eta vs tors. theta energy: -38.225 Dist. restrs. and SS energy: 1.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -476.293360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.293360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.745439 (E_RNA) where: Base-Base interactions energy: -353.077 where: short stacking energy: -136.932 Base-Backbone interact. energy: -0.196 local terms energy: -130.472440 where: bonds (distance) C4'-P energy: -20.076 bonds (distance) P-C4' energy: -22.162 flat angles C4'-P-C4' energy: -31.725 flat angles P-C4'-P energy: -21.486 tors. eta vs tors. theta energy: -35.024 Dist. restrs. and SS energy: 7.452 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -483.053625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.053625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.013183 (E_RNA) where: Base-Base interactions energy: -362.469 where: short stacking energy: -143.345 Base-Backbone interact. energy: 7.783 local terms energy: -132.327349 where: bonds (distance) C4'-P energy: -20.446 bonds (distance) P-C4' energy: -22.957 flat angles C4'-P-C4' energy: -29.890 flat angles P-C4'-P energy: -20.813 tors. eta vs tors. theta energy: -38.222 Dist. restrs. and SS energy: 3.960 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -513.868846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.868846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.245617 (E_RNA) where: Base-Base interactions energy: -379.758 where: short stacking energy: -141.307 Base-Backbone interact. energy: 1.334 local terms energy: -140.822000 where: bonds (distance) C4'-P energy: -22.595 bonds (distance) P-C4' energy: -23.664 flat angles C4'-P-C4' energy: -34.675 flat angles P-C4'-P energy: -18.409 tors. eta vs tors. theta energy: -41.479 Dist. restrs. and SS energy: 5.377 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -477.350225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.350225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.850608 (E_RNA) where: Base-Base interactions energy: -350.768 where: short stacking energy: -135.003 Base-Backbone interact. energy: -0.428 local terms energy: -130.655249 where: bonds (distance) C4'-P energy: -21.875 bonds (distance) P-C4' energy: -26.806 flat angles C4'-P-C4' energy: -25.171 flat angles P-C4'-P energy: -19.761 tors. eta vs tors. theta energy: -37.042 Dist. restrs. and SS energy: 4.500 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -424.948216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.948216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.115173 (E_RNA) where: Base-Base interactions energy: -311.501 where: short stacking energy: -114.842 Base-Backbone interact. energy: -0.219 local terms energy: -117.473945 where: bonds (distance) C4'-P energy: -15.102 bonds (distance) P-C4' energy: -23.025 flat angles C4'-P-C4' energy: -32.736 flat angles P-C4'-P energy: -15.185 tors. eta vs tors. theta energy: -31.427 Dist. restrs. and SS energy: 4.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.079 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -598.246463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.246463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.491444 (E_RNA) where: Base-Base interactions energy: -437.503 where: short stacking energy: -170.935 Base-Backbone interact. energy: -0.001 local terms energy: -160.986877 where: bonds (distance) C4'-P energy: -27.081 bonds (distance) P-C4' energy: -30.323 flat angles C4'-P-C4' energy: -31.431 flat angles P-C4'-P energy: -24.078 tors. eta vs tors. theta energy: -48.074 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -572.064005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.064005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.241811 (E_RNA) where: Base-Base interactions energy: -417.196 where: short stacking energy: -157.432 Base-Backbone interact. energy: -0.001 local terms energy: -155.045012 where: bonds (distance) C4'-P energy: -24.233 bonds (distance) P-C4' energy: -25.845 flat angles C4'-P-C4' energy: -35.168 flat angles P-C4'-P energy: -23.368 tors. eta vs tors. theta energy: -46.430 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -588.399262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.399262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.493748 (E_RNA) where: Base-Base interactions energy: -431.465 where: short stacking energy: -165.622 Base-Backbone interact. energy: -0.001 local terms energy: -157.027757 where: bonds (distance) C4'-P energy: -28.553 bonds (distance) P-C4' energy: -27.140 flat angles C4'-P-C4' energy: -28.092 flat angles P-C4'-P energy: -24.559 tors. eta vs tors. theta energy: -48.684 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -508.529723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.529723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.822439 (E_RNA) where: Base-Base interactions energy: -372.528 where: short stacking energy: -138.385 Base-Backbone interact. energy: -0.035 local terms energy: -138.260042 where: bonds (distance) C4'-P energy: -23.907 bonds (distance) P-C4' energy: -24.363 flat angles C4'-P-C4' energy: -30.287 flat angles P-C4'-P energy: -18.588 tors. eta vs tors. theta energy: -41.115 Dist. restrs. and SS energy: 2.293 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -522.799853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.799853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.006963 (E_RNA) where: Base-Base interactions energy: -383.699 where: short stacking energy: -131.878 Base-Backbone interact. energy: 0.900 local terms energy: -141.207614 where: bonds (distance) C4'-P energy: -25.246 bonds (distance) P-C4' energy: -22.698 flat angles C4'-P-C4' energy: -32.680 flat angles P-C4'-P energy: -23.221 tors. eta vs tors. theta energy: -37.363 Dist. restrs. and SS energy: 1.207 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -523.444821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.444821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.623693 (E_RNA) where: Base-Base interactions energy: -380.851 where: short stacking energy: -140.195 Base-Backbone interact. energy: -0.665 local terms energy: -147.107413 where: bonds (distance) C4'-P energy: -27.088 bonds (distance) P-C4' energy: -27.892 flat angles C4'-P-C4' energy: -30.641 flat angles P-C4'-P energy: -21.620 tors. eta vs tors. theta energy: -39.866 Dist. restrs. and SS energy: 5.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -556.886914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.886914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.257805 (E_RNA) where: Base-Base interactions energy: -411.824 where: short stacking energy: -157.575 Base-Backbone interact. energy: -0.005 local terms energy: -145.428346 where: bonds (distance) C4'-P energy: -26.939 bonds (distance) P-C4' energy: -17.749 flat angles C4'-P-C4' energy: -29.609 flat angles P-C4'-P energy: -23.717 tors. eta vs tors. theta energy: -47.414 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -472.838879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.838879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.437354 (E_RNA) where: Base-Base interactions energy: -353.533 where: short stacking energy: -134.761 Base-Backbone interact. energy: -0.316 local terms energy: -124.587936 where: bonds (distance) C4'-P energy: -22.879 bonds (distance) P-C4' energy: -30.617 flat angles C4'-P-C4' energy: -22.977 flat angles P-C4'-P energy: -10.923 tors. eta vs tors. theta energy: -37.193 Dist. restrs. and SS energy: 5.598 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -469.374795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.374795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.630848 (E_RNA) where: Base-Base interactions energy: -349.788 where: short stacking energy: -132.101 Base-Backbone interact. energy: -0.500 local terms energy: -126.342896 where: bonds (distance) C4'-P energy: -19.358 bonds (distance) P-C4' energy: -19.688 flat angles C4'-P-C4' energy: -24.101 flat angles P-C4'-P energy: -24.095 tors. eta vs tors. theta energy: -39.101 Dist. restrs. and SS energy: 7.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -424.895323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.895323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.378841 (E_RNA) where: Base-Base interactions energy: -317.441 where: short stacking energy: -115.303 Base-Backbone interact. energy: -0.268 local terms energy: -111.670411 where: bonds (distance) C4'-P energy: -20.157 bonds (distance) P-C4' energy: -26.067 flat angles C4'-P-C4' energy: -21.808 flat angles P-C4'-P energy: -13.097 tors. eta vs tors. theta energy: -30.541 Dist. restrs. and SS energy: 4.484 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -601.556658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.556658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.930318 (E_RNA) where: Base-Base interactions energy: -443.394 where: short stacking energy: -169.117 Base-Backbone interact. energy: -0.002 local terms energy: -158.533773 where: bonds (distance) C4'-P energy: -27.493 bonds (distance) P-C4' energy: -26.613 flat angles C4'-P-C4' energy: -33.374 flat angles P-C4'-P energy: -20.552 tors. eta vs tors. theta energy: -50.502 Dist. restrs. and SS energy: 0.374 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -593.296331 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.296331 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.847370 (E_RNA) where: Base-Base interactions energy: -429.205 where: short stacking energy: -164.509 Base-Backbone interact. energy: -0.001 local terms energy: -164.641687 where: bonds (distance) C4'-P energy: -32.442 bonds (distance) P-C4' energy: -29.095 flat angles C4'-P-C4' energy: -31.905 flat angles P-C4'-P energy: -19.235 tors. eta vs tors. theta energy: -51.965 Dist. restrs. and SS energy: 0.551 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -567.546917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.546917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.716796 (E_RNA) where: Base-Base interactions energy: -421.749 where: short stacking energy: -161.943 Base-Backbone interact. energy: -0.001 local terms energy: -146.172502 where: bonds (distance) C4'-P energy: -20.116 bonds (distance) P-C4' energy: -30.507 flat angles C4'-P-C4' energy: -32.135 flat angles P-C4'-P energy: -18.897 tors. eta vs tors. theta energy: -44.517 Dist. restrs. and SS energy: 0.170 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.206 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -524.944729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.944729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -525.368064 (E_RNA) where: Base-Base interactions energy: -389.403 where: short stacking energy: -136.290 Base-Backbone interact. energy: 3.205 local terms energy: -139.169267 where: bonds (distance) C4'-P energy: -26.472 bonds (distance) P-C4' energy: -25.359 flat angles C4'-P-C4' energy: -30.016 flat angles P-C4'-P energy: -18.742 tors. eta vs tors. theta energy: -38.580 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -495.405270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.405270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.244029 (E_RNA) where: Base-Base interactions energy: -370.654 where: short stacking energy: -134.121 Base-Backbone interact. energy: -0.078 local terms energy: -125.512692 where: bonds (distance) C4'-P energy: -18.649 bonds (distance) P-C4' energy: -28.897 flat angles C4'-P-C4' energy: -31.515 flat angles P-C4'-P energy: -11.326 tors. eta vs tors. theta energy: -35.125 Dist. restrs. and SS energy: 0.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -576.913135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.913135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.667880 (E_RNA) where: Base-Base interactions energy: -415.994 where: short stacking energy: -162.965 Base-Backbone interact. energy: -0.295 local terms energy: -162.919401 where: bonds (distance) C4'-P energy: -26.225 bonds (distance) P-C4' energy: -31.281 flat angles C4'-P-C4' energy: -30.030 flat angles P-C4'-P energy: -25.529 tors. eta vs tors. theta energy: -49.855 Dist. restrs. and SS energy: 0.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.540 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -542.470193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.470193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.044100 (E_RNA) where: Base-Base interactions energy: -394.259 where: short stacking energy: -153.793 Base-Backbone interact. energy: -0.017 local terms energy: -149.767414 where: bonds (distance) C4'-P energy: -29.720 bonds (distance) P-C4' energy: -28.314 flat angles C4'-P-C4' energy: -23.594 flat angles P-C4'-P energy: -24.132 tors. eta vs tors. theta energy: -44.008 Dist. restrs. and SS energy: 1.574 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -477.341742 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.341742 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.277643 (E_RNA) where: Base-Base interactions energy: -355.859 where: short stacking energy: -125.156 Base-Backbone interact. energy: -0.476 local terms energy: -127.942855 where: bonds (distance) C4'-P energy: -27.101 bonds (distance) P-C4' energy: -17.830 flat angles C4'-P-C4' energy: -29.742 flat angles P-C4'-P energy: -12.809 tors. eta vs tors. theta energy: -40.461 Dist. restrs. and SS energy: 6.936 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -439.437229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.437229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.595554 (E_RNA) where: Base-Base interactions energy: -335.480 where: short stacking energy: -122.365 Base-Backbone interact. energy: -0.062 local terms energy: -109.324695 where: bonds (distance) C4'-P energy: -21.486 bonds (distance) P-C4' energy: -21.879 flat angles C4'-P-C4' energy: -21.697 flat angles P-C4'-P energy: -15.059 tors. eta vs tors. theta energy: -29.204 Dist. restrs. and SS energy: 3.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.271 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -416.045169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.045169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.642563 (E_RNA) where: Base-Base interactions energy: -304.124 where: short stacking energy: -102.530 Base-Backbone interact. energy: 0.808 local terms energy: -117.325932 where: bonds (distance) C4'-P energy: -27.154 bonds (distance) P-C4' energy: -24.010 flat angles C4'-P-C4' energy: -22.899 flat angles P-C4'-P energy: -18.215 tors. eta vs tors. theta energy: -25.047 Dist. restrs. and SS energy: 4.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -605.706053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.706053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.962422 (E_RNA) where: Base-Base interactions energy: -438.927 where: short stacking energy: -169.247 Base-Backbone interact. energy: 0.281 local terms energy: -167.316442 where: bonds (distance) C4'-P energy: -28.380 bonds (distance) P-C4' energy: -28.430 flat angles C4'-P-C4' energy: -34.127 flat angles P-C4'-P energy: -23.294 tors. eta vs tors. theta energy: -53.084 Dist. restrs. and SS energy: 0.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -600.217015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.217015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.888814 (E_RNA) where: Base-Base interactions energy: -427.226 where: short stacking energy: -165.154 Base-Backbone interact. energy: -0.042 local terms energy: -173.621208 where: bonds (distance) C4'-P energy: -31.882 bonds (distance) P-C4' energy: -31.618 flat angles C4'-P-C4' energy: -32.596 flat angles P-C4'-P energy: -26.820 tors. eta vs tors. theta energy: -50.706 Dist. restrs. and SS energy: 0.672 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -531.506029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -531.506029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -532.245127 (E_RNA) where: Base-Base interactions energy: -404.329 where: short stacking energy: -142.854 Base-Backbone interact. energy: -0.324 local terms energy: -127.592013 where: bonds (distance) C4'-P energy: -21.010 bonds (distance) P-C4' energy: -20.894 flat angles C4'-P-C4' energy: -23.908 flat angles P-C4'-P energy: -23.151 tors. eta vs tors. theta energy: -38.629 Dist. restrs. and SS energy: 0.739 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -550.713271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.713271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.174396 (E_RNA) where: Base-Base interactions energy: -403.607 where: short stacking energy: -151.919 Base-Backbone interact. energy: -0.612 local terms energy: -146.955639 where: bonds (distance) C4'-P energy: -23.109 bonds (distance) P-C4' energy: -29.926 flat angles C4'-P-C4' energy: -29.575 flat angles P-C4'-P energy: -20.554 tors. eta vs tors. theta energy: -43.791 Dist. restrs. and SS energy: 0.461 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -583.110625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.110625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.429647 (E_RNA) where: Base-Base interactions energy: -431.475 where: short stacking energy: -168.566 Base-Backbone interact. energy: -0.569 local terms energy: -152.013938 where: bonds (distance) C4'-P energy: -20.042 bonds (distance) P-C4' energy: -29.106 flat angles C4'-P-C4' energy: -30.572 flat angles P-C4'-P energy: -22.293 tors. eta vs tors. theta energy: -50.000 Dist. restrs. and SS energy: 0.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.628 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -481.378795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.378795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.944010 (E_RNA) where: Base-Base interactions energy: -352.300 where: short stacking energy: -138.654 Base-Backbone interact. energy: -0.073 local terms energy: -133.571005 where: bonds (distance) C4'-P energy: -24.573 bonds (distance) P-C4' energy: -24.424 flat angles C4'-P-C4' energy: -26.600 flat angles P-C4'-P energy: -19.697 tors. eta vs tors. theta energy: -38.277 Dist. restrs. and SS energy: 4.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -485.510508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.510508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.485112 (E_RNA) where: Base-Base interactions energy: -354.444 where: short stacking energy: -134.754 Base-Backbone interact. energy: -0.248 local terms energy: -137.792921 where: bonds (distance) C4'-P energy: -20.497 bonds (distance) P-C4' energy: -27.063 flat angles C4'-P-C4' energy: -26.123 flat angles P-C4'-P energy: -21.523 tors. eta vs tors. theta energy: -42.587 Dist. restrs. and SS energy: 6.975 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -555.619038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.619038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -556.398209 (E_RNA) where: Base-Base interactions energy: -410.434 where: short stacking energy: -158.741 Base-Backbone interact. energy: -0.290 local terms energy: -145.674564 where: bonds (distance) C4'-P energy: -26.463 bonds (distance) P-C4' energy: -18.780 flat angles C4'-P-C4' energy: -33.411 flat angles P-C4'-P energy: -19.006 tors. eta vs tors. theta energy: -48.015 Dist. restrs. and SS energy: 0.779 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -410.254233 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.254233 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.887768 (E_RNA) where: Base-Base interactions energy: -308.336 where: short stacking energy: -113.273 Base-Backbone interact. energy: -0.582 local terms energy: -108.969858 where: bonds (distance) C4'-P energy: -18.124 bonds (distance) P-C4' energy: -22.998 flat angles C4'-P-C4' energy: -27.520 flat angles P-C4'-P energy: -16.063 tors. eta vs tors. theta energy: -24.265 Dist. restrs. and SS energy: 7.634 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -427.827990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.827990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.851991 (E_RNA) where: Base-Base interactions energy: -314.546 where: short stacking energy: -114.929 Base-Backbone interact. energy: -0.512 local terms energy: -118.556739 where: bonds (distance) C4'-P energy: -17.708 bonds (distance) P-C4' energy: -23.739 flat angles C4'-P-C4' energy: -28.053 flat angles P-C4'-P energy: -16.793 tors. eta vs tors. theta energy: -32.264 Dist. restrs. and SS energy: 5.024 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.763 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -593.272246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.272246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.482468 (E_RNA) where: Base-Base interactions energy: -435.939 where: short stacking energy: -171.913 Base-Backbone interact. energy: 0.048 local terms energy: -157.591166 where: bonds (distance) C4'-P energy: -26.765 bonds (distance) P-C4' energy: -27.120 flat angles C4'-P-C4' energy: -32.803 flat angles P-C4'-P energy: -21.745 tors. eta vs tors. theta energy: -49.158 Dist. restrs. and SS energy: 0.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -594.363211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.363211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.134922 (E_RNA) where: Base-Base interactions energy: -429.450 where: short stacking energy: -168.620 Base-Backbone interact. energy: -0.122 local terms energy: -165.655209 where: bonds (distance) C4'-P energy: -26.978 bonds (distance) P-C4' energy: -30.487 flat angles C4'-P-C4' energy: -34.231 flat angles P-C4'-P energy: -24.173 tors. eta vs tors. theta energy: -49.786 Dist. restrs. and SS energy: 0.772 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.092 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -535.707952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.707952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.021909 (E_RNA) where: Base-Base interactions energy: -394.194 where: short stacking energy: -144.600 Base-Backbone interact. energy: 1.406 local terms energy: -144.234453 where: bonds (distance) C4'-P energy: -21.416 bonds (distance) P-C4' energy: -32.721 flat angles C4'-P-C4' energy: -31.816 flat angles P-C4'-P energy: -20.085 tors. eta vs tors. theta energy: -38.196 Dist. restrs. and SS energy: 1.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -584.440896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.440896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.618676 (E_RNA) where: Base-Base interactions energy: -432.092 where: short stacking energy: -163.744 Base-Backbone interact. energy: -0.755 local terms energy: -152.266632 where: bonds (distance) C4'-P energy: -20.758 bonds (distance) P-C4' energy: -28.243 flat angles C4'-P-C4' energy: -31.146 flat angles P-C4'-P energy: -21.796 tors. eta vs tors. theta energy: -50.324 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.494 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -552.772618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.772618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -552.907114 (E_RNA) where: Base-Base interactions energy: -404.062 where: short stacking energy: -148.968 Base-Backbone interact. energy: -0.003 local terms energy: -148.841842 where: bonds (distance) C4'-P energy: -31.931 bonds (distance) P-C4' energy: -25.615 flat angles C4'-P-C4' energy: -27.246 flat angles P-C4'-P energy: -20.265 tors. eta vs tors. theta energy: -43.785 Dist. restrs. and SS energy: 0.134 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -485.345974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.345974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.218352 (E_RNA) where: Base-Base interactions energy: -352.973 where: short stacking energy: -137.239 Base-Backbone interact. energy: -0.304 local terms energy: -139.941107 where: bonds (distance) C4'-P energy: -25.655 bonds (distance) P-C4' energy: -25.945 flat angles C4'-P-C4' energy: -28.807 flat angles P-C4'-P energy: -19.168 tors. eta vs tors. theta energy: -40.366 Dist. restrs. and SS energy: 7.872 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -477.340828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.340828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.923751 (E_RNA) where: Base-Base interactions energy: -345.692 where: short stacking energy: -147.335 Base-Backbone interact. energy: -0.385 local terms energy: -138.846468 where: bonds (distance) C4'-P energy: -27.618 bonds (distance) P-C4' energy: -28.785 flat angles C4'-P-C4' energy: -30.034 flat angles P-C4'-P energy: -13.404 tors. eta vs tors. theta energy: -39.006 Dist. restrs. and SS energy: 7.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -561.043274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.043274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.579466 (E_RNA) where: Base-Base interactions energy: -418.206 where: short stacking energy: -161.325 Base-Backbone interact. energy: -0.004 local terms energy: -143.369334 where: bonds (distance) C4'-P energy: -25.793 bonds (distance) P-C4' energy: -21.290 flat angles C4'-P-C4' energy: -29.452 flat angles P-C4'-P energy: -18.334 tors. eta vs tors. theta energy: -48.500 Dist. restrs. and SS energy: 0.536 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -419.832381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.832381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.268212 (E_RNA) where: Base-Base interactions energy: -308.667 where: short stacking energy: -110.725 Base-Backbone interact. energy: -0.118 local terms energy: -116.482634 where: bonds (distance) C4'-P energy: -20.522 bonds (distance) P-C4' energy: -22.898 flat angles C4'-P-C4' energy: -30.437 flat angles P-C4'-P energy: -12.652 tors. eta vs tors. theta energy: -29.973 Dist. restrs. and SS energy: 5.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -424.968896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.968896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.353617 (E_RNA) where: Base-Base interactions energy: -310.393 where: short stacking energy: -120.392 Base-Backbone interact. energy: -0.069 local terms energy: -120.927278 where: bonds (distance) C4'-P energy: -22.911 bonds (distance) P-C4' energy: -16.231 flat angles C4'-P-C4' energy: -27.045 flat angles P-C4'-P energy: -20.080 tors. eta vs tors. theta energy: -34.661 Dist. restrs. and SS energy: 5.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.036 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -601.925521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.925521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.623833 (E_RNA) where: Base-Base interactions energy: -435.525 where: short stacking energy: -173.122 Base-Backbone interact. energy: -0.002 local terms energy: -167.096809 where: bonds (distance) C4'-P energy: -32.372 bonds (distance) P-C4' energy: -29.756 flat angles C4'-P-C4' energy: -34.549 flat angles P-C4'-P energy: -19.064 tors. eta vs tors. theta energy: -51.355 Dist. restrs. and SS energy: 0.698 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -597.841652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.841652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.111573 (E_RNA) where: Base-Base interactions energy: -435.128 where: short stacking energy: -166.518 Base-Backbone interact. energy: -0.001 local terms energy: -162.981850 where: bonds (distance) C4'-P energy: -28.484 bonds (distance) P-C4' energy: -30.795 flat angles C4'-P-C4' energy: -29.215 flat angles P-C4'-P energy: -25.024 tors. eta vs tors. theta energy: -49.464 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -589.593231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.593231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.160088 (E_RNA) where: Base-Base interactions energy: -424.265 where: short stacking energy: -162.636 Base-Backbone interact. energy: 0.366 local terms energy: -166.261333 where: bonds (distance) C4'-P energy: -26.156 bonds (distance) P-C4' energy: -26.955 flat angles C4'-P-C4' energy: -35.783 flat angles P-C4'-P energy: -25.526 tors. eta vs tors. theta energy: -51.841 Dist. restrs. and SS energy: 0.567 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -533.735246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.735246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -537.563512 (E_RNA) where: Base-Base interactions energy: -390.416 where: short stacking energy: -138.723 Base-Backbone interact. energy: -0.729 local terms energy: -146.418129 where: bonds (distance) C4'-P energy: -18.552 bonds (distance) P-C4' energy: -29.936 flat angles C4'-P-C4' energy: -32.978 flat angles P-C4'-P energy: -24.056 tors. eta vs tors. theta energy: -40.898 Dist. restrs. and SS energy: 3.828 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -562.573951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.573951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -562.707153 (E_RNA) where: Base-Base interactions energy: -425.399 where: short stacking energy: -164.710 Base-Backbone interact. energy: 0.175 local terms energy: -137.483582 where: bonds (distance) C4'-P energy: -27.514 bonds (distance) P-C4' energy: -20.110 flat angles C4'-P-C4' energy: -23.891 flat angles P-C4'-P energy: -20.579 tors. eta vs tors. theta energy: -45.389 Dist. restrs. and SS energy: 0.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -479.645613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.645613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.483811 (E_RNA) where: Base-Base interactions energy: -346.976 where: short stacking energy: -132.806 Base-Backbone interact. energy: -0.315 local terms energy: -143.193025 where: bonds (distance) C4'-P energy: -23.499 bonds (distance) P-C4' energy: -26.104 flat angles C4'-P-C4' energy: -30.891 flat angles P-C4'-P energy: -22.356 tors. eta vs tors. theta energy: -40.343 Dist. restrs. and SS energy: 10.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -567.151758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.151758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.801468 (E_RNA) where: Base-Base interactions energy: -407.294 where: short stacking energy: -152.283 Base-Backbone interact. energy: -0.002 local terms energy: -160.505387 where: bonds (distance) C4'-P energy: -22.583 bonds (distance) P-C4' energy: -31.926 flat angles C4'-P-C4' energy: -35.457 flat angles P-C4'-P energy: -21.763 tors. eta vs tors. theta energy: -48.776 Dist. restrs. and SS energy: 0.650 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -458.362352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.362352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.887296 (E_RNA) where: Base-Base interactions energy: -330.425 where: short stacking energy: -129.151 Base-Backbone interact. energy: -0.986 local terms energy: -135.475881 where: bonds (distance) C4'-P energy: -19.276 bonds (distance) P-C4' energy: -31.299 flat angles C4'-P-C4' energy: -25.874 flat angles P-C4'-P energy: -19.618 tors. eta vs tors. theta energy: -39.408 Dist. restrs. and SS energy: 8.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -444.275303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.275303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.152154 (E_RNA) where: Base-Base interactions energy: -328.304 where: short stacking energy: -118.963 Base-Backbone interact. energy: -0.664 local terms energy: -120.879629 where: bonds (distance) C4'-P energy: -21.680 bonds (distance) P-C4' energy: -25.051 flat angles C4'-P-C4' energy: -27.464 flat angles P-C4'-P energy: -12.520 tors. eta vs tors. theta energy: -34.164 Dist. restrs. and SS energy: 4.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.696 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -410.866121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.866121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.746752 (E_RNA) where: Base-Base interactions energy: -314.951 where: short stacking energy: -111.539 Base-Backbone interact. energy: -0.207 local terms energy: -100.588252 where: bonds (distance) C4'-P energy: -21.306 bonds (distance) P-C4' energy: -12.339 flat angles C4'-P-C4' energy: -19.506 flat angles P-C4'-P energy: -18.065 tors. eta vs tors. theta energy: -29.372 Dist. restrs. and SS energy: 4.881 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -608.970494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.970494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.306938 (E_RNA) where: Base-Base interactions energy: -443.745 where: short stacking energy: -171.329 Base-Backbone interact. energy: -0.215 local terms energy: -165.347143 where: bonds (distance) C4'-P energy: -29.679 bonds (distance) P-C4' energy: -27.091 flat angles C4'-P-C4' energy: -32.336 flat angles P-C4'-P energy: -26.127 tors. eta vs tors. theta energy: -50.113 Dist. restrs. and SS energy: 0.336 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -595.392808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.392808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.658252 (E_RNA) where: Base-Base interactions energy: -438.169 where: short stacking energy: -171.267 Base-Backbone interact. energy: 1.044 local terms energy: -158.533142 where: bonds (distance) C4'-P energy: -27.008 bonds (distance) P-C4' energy: -27.130 flat angles C4'-P-C4' energy: -30.874 flat angles P-C4'-P energy: -25.354 tors. eta vs tors. theta energy: -48.167 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -583.471222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.471222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.497067 (E_RNA) where: Base-Base interactions energy: -431.207 where: short stacking energy: -164.150 Base-Backbone interact. energy: -0.014 local terms energy: -152.277015 where: bonds (distance) C4'-P energy: -25.296 bonds (distance) P-C4' energy: -23.734 flat angles C4'-P-C4' energy: -33.119 flat angles P-C4'-P energy: -19.230 tors. eta vs tors. theta energy: -50.899 Dist. restrs. and SS energy: 0.026 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -566.985141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.985141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.319543 (E_RNA) where: Base-Base interactions energy: -421.055 where: short stacking energy: -157.613 Base-Backbone interact. energy: 0.274 local terms energy: -146.537988 where: bonds (distance) C4'-P energy: -20.603 bonds (distance) P-C4' energy: -27.538 flat angles C4'-P-C4' energy: -30.333 flat angles P-C4'-P energy: -21.431 tors. eta vs tors. theta energy: -46.633 Dist. restrs. and SS energy: 0.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -527.871339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -527.871339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.768072 (E_RNA) where: Base-Base interactions energy: -384.594 where: short stacking energy: -145.516 Base-Backbone interact. energy: -0.465 local terms energy: -145.709551 where: bonds (distance) C4'-P energy: -29.986 bonds (distance) P-C4' energy: -26.077 flat angles C4'-P-C4' energy: -29.064 flat angles P-C4'-P energy: -22.096 tors. eta vs tors. theta energy: -38.487 Dist. restrs. and SS energy: 2.897 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -580.942383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.942383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.249721 (E_RNA) where: Base-Base interactions energy: -433.561 where: short stacking energy: -170.264 Base-Backbone interact. energy: -0.281 local terms energy: -147.408305 where: bonds (distance) C4'-P energy: -21.321 bonds (distance) P-C4' energy: -25.888 flat angles C4'-P-C4' energy: -29.901 flat angles P-C4'-P energy: -19.234 tors. eta vs tors. theta energy: -51.064 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -474.053615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.053615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.305842 (E_RNA) where: Base-Base interactions energy: -361.225 where: short stacking energy: -141.405 Base-Backbone interact. energy: -0.324 local terms energy: -121.010737 where: bonds (distance) C4'-P energy: -19.589 bonds (distance) P-C4' energy: -23.004 flat angles C4'-P-C4' energy: -24.259 flat angles P-C4'-P energy: -15.201 tors. eta vs tors. theta energy: -38.958 Dist. restrs. and SS energy: 8.252 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.254 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -456.006473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.006473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.799093 (E_RNA) where: Base-Base interactions energy: -345.711 where: short stacking energy: -128.727 Base-Backbone interact. energy: -0.271 local terms energy: -113.817811 where: bonds (distance) C4'-P energy: -19.971 bonds (distance) P-C4' energy: -22.518 flat angles C4'-P-C4' energy: -24.384 flat angles P-C4'-P energy: -13.065 tors. eta vs tors. theta energy: -33.880 Dist. restrs. and SS energy: 3.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -442.532290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.532290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.618173 (E_RNA) where: Base-Base interactions energy: -333.975 where: short stacking energy: -129.368 Base-Backbone interact. energy: -0.302 local terms energy: -114.340778 where: bonds (distance) C4'-P energy: -19.419 bonds (distance) P-C4' energy: -24.549 flat angles C4'-P-C4' energy: -22.534 flat angles P-C4'-P energy: -12.299 tors. eta vs tors. theta energy: -35.539 Dist. restrs. and SS energy: 6.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -413.323189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.323189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.013141 (E_RNA) where: Base-Base interactions energy: -315.246 where: short stacking energy: -112.852 Base-Backbone interact. energy: 0.776 local terms energy: -108.544002 where: bonds (distance) C4'-P energy: -21.455 bonds (distance) P-C4' energy: -18.332 flat angles C4'-P-C4' energy: -22.010 flat angles P-C4'-P energy: -18.719 tors. eta vs tors. theta energy: -28.029 Dist. restrs. and SS energy: 9.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -605.300389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.300389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.458387 (E_RNA) where: Base-Base interactions energy: -437.479 where: short stacking energy: -162.678 Base-Backbone interact. energy: -0.000 local terms energy: -167.978817 where: bonds (distance) C4'-P energy: -31.638 bonds (distance) P-C4' energy: -31.878 flat angles C4'-P-C4' energy: -31.665 flat angles P-C4'-P energy: -22.535 tors. eta vs tors. theta energy: -50.263 Dist. restrs. and SS energy: 0.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -599.488187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.488187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.604537 (E_RNA) where: Base-Base interactions energy: -438.804 where: short stacking energy: -169.325 Base-Backbone interact. energy: -0.280 local terms energy: -160.520715 where: bonds (distance) C4'-P energy: -29.250 bonds (distance) P-C4' energy: -24.801 flat angles C4'-P-C4' energy: -30.018 flat angles P-C4'-P energy: -26.722 tors. eta vs tors. theta energy: -49.729 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -585.503741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.503741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.754221 (E_RNA) where: Base-Base interactions energy: -424.280 where: short stacking energy: -162.381 Base-Backbone interact. energy: -0.005 local terms energy: -161.468585 where: bonds (distance) C4'-P energy: -25.162 bonds (distance) P-C4' energy: -32.182 flat angles C4'-P-C4' energy: -30.478 flat angles P-C4'-P energy: -23.621 tors. eta vs tors. theta energy: -50.026 Dist. restrs. and SS energy: 0.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -561.565002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.565002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.765169 (E_RNA) where: Base-Base interactions energy: -408.058 where: short stacking energy: -153.511 Base-Backbone interact. energy: -0.292 local terms energy: -153.414924 where: bonds (distance) C4'-P energy: -26.234 bonds (distance) P-C4' energy: -28.972 flat angles C4'-P-C4' energy: -29.496 flat angles P-C4'-P energy: -21.842 tors. eta vs tors. theta energy: -46.871 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -574.968881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.968881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.107176 (E_RNA) where: Base-Base interactions energy: -414.863 where: short stacking energy: -159.159 Base-Backbone interact. energy: -0.063 local terms energy: -160.180808 where: bonds (distance) C4'-P energy: -26.337 bonds (distance) P-C4' energy: -29.402 flat angles C4'-P-C4' energy: -30.684 flat angles P-C4'-P energy: -24.404 tors. eta vs tors. theta energy: -49.354 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -521.126378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.126378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.347596 (E_RNA) where: Base-Base interactions energy: -376.888 where: short stacking energy: -141.287 Base-Backbone interact. energy: -0.497 local terms energy: -144.962937 where: bonds (distance) C4'-P energy: -24.421 bonds (distance) P-C4' energy: -32.556 flat angles C4'-P-C4' energy: -31.376 flat angles P-C4'-P energy: -21.609 tors. eta vs tors. theta energy: -35.000 Dist. restrs. and SS energy: 1.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -471.903741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.903741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.267211 (E_RNA) where: Base-Base interactions energy: -363.870 where: short stacking energy: -135.787 Base-Backbone interact. energy: 2.468 local terms energy: -115.865698 where: bonds (distance) C4'-P energy: -16.647 bonds (distance) P-C4' energy: -21.425 flat angles C4'-P-C4' energy: -26.227 flat angles P-C4'-P energy: -18.935 tors. eta vs tors. theta energy: -32.633 Dist. restrs. and SS energy: 5.363 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -467.933753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.933753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.102650 (E_RNA) where: Base-Base interactions energy: -341.423 where: short stacking energy: -134.577 Base-Backbone interact. energy: -0.072 local terms energy: -131.608182 where: bonds (distance) C4'-P energy: -25.744 bonds (distance) P-C4' energy: -22.766 flat angles C4'-P-C4' energy: -26.400 flat angles P-C4'-P energy: -18.293 tors. eta vs tors. theta energy: -38.404 Dist. restrs. and SS energy: 5.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -427.324051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.324051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.463772 (E_RNA) where: Base-Base interactions energy: -320.540 where: short stacking energy: -106.618 Base-Backbone interact. energy: 2.241 local terms energy: -111.164389 where: bonds (distance) C4'-P energy: -24.565 bonds (distance) P-C4' energy: -19.281 flat angles C4'-P-C4' energy: -23.773 flat angles P-C4'-P energy: -16.523 tors. eta vs tors. theta energy: -27.022 Dist. restrs. and SS energy: 2.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -425.331618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.331618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.593077 (E_RNA) where: Base-Base interactions energy: -314.554 where: short stacking energy: -117.832 Base-Backbone interact. energy: -0.277 local terms energy: -119.762270 where: bonds (distance) C4'-P energy: -17.806 bonds (distance) P-C4' energy: -22.829 flat angles C4'-P-C4' energy: -25.767 flat angles P-C4'-P energy: -16.808 tors. eta vs tors. theta energy: -36.553 Dist. restrs. and SS energy: 9.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -599.594526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.594526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.823393 (E_RNA) where: Base-Base interactions energy: -428.206 where: short stacking energy: -163.930 Base-Backbone interact. energy: -0.000 local terms energy: -171.617472 where: bonds (distance) C4'-P energy: -27.455 bonds (distance) P-C4' energy: -32.822 flat angles C4'-P-C4' energy: -35.727 flat angles P-C4'-P energy: -26.288 tors. eta vs tors. theta energy: -49.325 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -596.819598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.819598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.202904 (E_RNA) where: Base-Base interactions energy: -434.134 where: short stacking energy: -169.841 Base-Backbone interact. energy: -0.000 local terms energy: -163.068946 where: bonds (distance) C4'-P energy: -29.302 bonds (distance) P-C4' energy: -24.742 flat angles C4'-P-C4' energy: -33.202 flat angles P-C4'-P energy: -25.090 tors. eta vs tors. theta energy: -50.733 Dist. restrs. and SS energy: 0.383 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -590.736717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.736717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.020586 (E_RNA) where: Base-Base interactions energy: -436.679 where: short stacking energy: -168.115 Base-Backbone interact. energy: -0.001 local terms energy: -154.340873 where: bonds (distance) C4'-P energy: -26.561 bonds (distance) P-C4' energy: -25.700 flat angles C4'-P-C4' energy: -29.514 flat angles P-C4'-P energy: -22.509 tors. eta vs tors. theta energy: -50.058 Dist. restrs. and SS energy: 0.284 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -584.428162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.428162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.827972 (E_RNA) where: Base-Base interactions energy: -430.638 where: short stacking energy: -164.804 Base-Backbone interact. energy: -0.002 local terms energy: -154.187074 where: bonds (distance) C4'-P energy: -20.759 bonds (distance) P-C4' energy: -29.506 flat angles C4'-P-C4' energy: -32.312 flat angles P-C4'-P energy: -23.172 tors. eta vs tors. theta energy: -48.438 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -557.384131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.384131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.102888 (E_RNA) where: Base-Base interactions energy: -410.972 where: short stacking energy: -154.841 Base-Backbone interact. energy: -0.002 local terms energy: -147.129003 where: bonds (distance) C4'-P energy: -24.066 bonds (distance) P-C4' energy: -21.892 flat angles C4'-P-C4' energy: -33.367 flat angles P-C4'-P energy: -23.897 tors. eta vs tors. theta energy: -43.906 Dist. restrs. and SS energy: 0.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -471.395068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.395068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.977649 (E_RNA) where: Base-Base interactions energy: -339.596 where: short stacking energy: -128.110 Base-Backbone interact. energy: -0.014 local terms energy: -134.367400 where: bonds (distance) C4'-P energy: -24.727 bonds (distance) P-C4' energy: -25.759 flat angles C4'-P-C4' energy: -31.039 flat angles P-C4'-P energy: -17.982 tors. eta vs tors. theta energy: -34.860 Dist. restrs. and SS energy: 2.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -521.339087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -521.339087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.450442 (E_RNA) where: Base-Base interactions energy: -390.135 where: short stacking energy: -140.780 Base-Backbone interact. energy: -0.388 local terms energy: -131.926771 where: bonds (distance) C4'-P energy: -20.340 bonds (distance) P-C4' energy: -19.917 flat angles C4'-P-C4' energy: -32.161 flat angles P-C4'-P energy: -20.876 tors. eta vs tors. theta energy: -38.632 Dist. restrs. and SS energy: 1.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -465.611565 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.611565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.710258 (E_RNA) where: Base-Base interactions energy: -349.372 where: short stacking energy: -133.997 Base-Backbone interact. energy: -0.308 local terms energy: -120.030663 where: bonds (distance) C4'-P energy: -21.673 bonds (distance) P-C4' energy: -23.801 flat angles C4'-P-C4' energy: -21.308 flat angles P-C4'-P energy: -16.304 tors. eta vs tors. theta energy: -36.944 Dist. restrs. and SS energy: 4.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -418.396367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.396367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.184870 (E_RNA) where: Base-Base interactions energy: -315.739 where: short stacking energy: -114.323 Base-Backbone interact. energy: 1.628 local terms energy: -109.074734 where: bonds (distance) C4'-P energy: -10.408 bonds (distance) P-C4' energy: -19.308 flat angles C4'-P-C4' energy: -30.910 flat angles P-C4'-P energy: -20.591 tors. eta vs tors. theta energy: -27.859 Dist. restrs. and SS energy: 4.789 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -432.941629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.941629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.594234 (E_RNA) where: Base-Base interactions energy: -325.630 where: short stacking energy: -126.738 Base-Backbone interact. energy: -1.501 local terms energy: -112.463841 where: bonds (distance) C4'-P energy: -20.343 bonds (distance) P-C4' energy: -18.449 flat angles C4'-P-C4' energy: -21.113 flat angles P-C4'-P energy: -17.980 tors. eta vs tors. theta energy: -34.579 Dist. restrs. and SS energy: 6.653 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -601.884239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.884239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.991548 (E_RNA) where: Base-Base interactions energy: -437.231 where: short stacking energy: -167.202 Base-Backbone interact. energy: -0.000 local terms energy: -164.759863 where: bonds (distance) C4'-P energy: -30.010 bonds (distance) P-C4' energy: -25.734 flat angles C4'-P-C4' energy: -31.406 flat angles P-C4'-P energy: -28.208 tors. eta vs tors. theta energy: -49.402 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -595.042935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.042935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.193898 (E_RNA) where: Base-Base interactions energy: -432.698 where: short stacking energy: -161.761 Base-Backbone interact. energy: -0.001 local terms energy: -162.495069 where: bonds (distance) C4'-P energy: -28.545 bonds (distance) P-C4' energy: -30.794 flat angles C4'-P-C4' energy: -32.464 flat angles P-C4'-P energy: -19.761 tors. eta vs tors. theta energy: -50.931 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -590.059010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.059010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.452043 (E_RNA) where: Base-Base interactions energy: -429.383 where: short stacking energy: -169.124 Base-Backbone interact. energy: -0.156 local terms energy: -160.912378 where: bonds (distance) C4'-P energy: -26.262 bonds (distance) P-C4' energy: -27.933 flat angles C4'-P-C4' energy: -33.861 flat angles P-C4'-P energy: -22.749 tors. eta vs tors. theta energy: -50.107 Dist. restrs. and SS energy: 0.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -588.057748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.057748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.410963 (E_RNA) where: Base-Base interactions energy: -426.095 where: short stacking energy: -161.472 Base-Backbone interact. energy: -0.000 local terms energy: -162.315569 where: bonds (distance) C4'-P energy: -28.095 bonds (distance) P-C4' energy: -28.183 flat angles C4'-P-C4' energy: -31.814 flat angles P-C4'-P energy: -25.000 tors. eta vs tors. theta energy: -49.224 Dist. restrs. and SS energy: 0.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -550.055033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.055033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.300179 (E_RNA) where: Base-Base interactions energy: -399.004 where: short stacking energy: -154.516 Base-Backbone interact. energy: -0.029 local terms energy: -151.267110 where: bonds (distance) C4'-P energy: -27.176 bonds (distance) P-C4' energy: -26.465 flat angles C4'-P-C4' energy: -32.387 flat angles P-C4'-P energy: -21.335 tors. eta vs tors. theta energy: -43.904 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -488.691718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.691718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.219150 (E_RNA) where: Base-Base interactions energy: -356.070 where: short stacking energy: -132.747 Base-Backbone interact. energy: 0.222 local terms energy: -137.371344 where: bonds (distance) C4'-P energy: -26.354 bonds (distance) P-C4' energy: -22.801 flat angles C4'-P-C4' energy: -31.927 flat angles P-C4'-P energy: -19.243 tors. eta vs tors. theta energy: -37.046 Dist. restrs. and SS energy: 4.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -516.998897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.998897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.849198 (E_RNA) where: Base-Base interactions energy: -386.423 where: short stacking energy: -143.827 Base-Backbone interact. energy: -0.081 local terms energy: -131.345547 where: bonds (distance) C4'-P energy: -21.548 bonds (distance) P-C4' energy: -20.162 flat angles C4'-P-C4' energy: -29.494 flat angles P-C4'-P energy: -20.784 tors. eta vs tors. theta energy: -39.357 Dist. restrs. and SS energy: 0.850 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -475.486080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.486080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.580744 (E_RNA) where: Base-Base interactions energy: -356.568 where: short stacking energy: -141.706 Base-Backbone interact. energy: 0.265 local terms energy: -127.278300 where: bonds (distance) C4'-P energy: -18.452 bonds (distance) P-C4' energy: -23.450 flat angles C4'-P-C4' energy: -29.107 flat angles P-C4'-P energy: -16.658 tors. eta vs tors. theta energy: -39.611 Dist. restrs. and SS energy: 8.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -432.321585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.321585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.101178 (E_RNA) where: Base-Base interactions energy: -332.635 where: short stacking energy: -121.678 Base-Backbone interact. energy: 1.743 local terms energy: -110.209340 where: bonds (distance) C4'-P energy: -25.565 bonds (distance) P-C4' energy: -23.784 flat angles C4'-P-C4' energy: -15.178 flat angles P-C4'-P energy: -18.089 tors. eta vs tors. theta energy: -27.593 Dist. restrs. and SS energy: 8.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -431.523148 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.523148 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.076836 (E_RNA) where: Base-Base interactions energy: -333.115 where: short stacking energy: -120.311 Base-Backbone interact. energy: 12.348 local terms energy: -116.310260 where: bonds (distance) C4'-P energy: -22.068 bonds (distance) P-C4' energy: -25.285 flat angles C4'-P-C4' energy: -29.126 flat angles P-C4'-P energy: -11.698 tors. eta vs tors. theta energy: -28.133 Dist. restrs. and SS energy: 5.554 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -598.612008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.612008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.685037 (E_RNA) where: Base-Base interactions energy: -437.198 where: short stacking energy: -166.816 Base-Backbone interact. energy: -0.291 local terms energy: -161.196012 where: bonds (distance) C4'-P energy: -27.360 bonds (distance) P-C4' energy: -28.071 flat angles C4'-P-C4' energy: -30.759 flat angles P-C4'-P energy: -24.956 tors. eta vs tors. theta energy: -50.050 Dist. restrs. and SS energy: 0.073 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -604.396212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.396212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.531220 (E_RNA) where: Base-Base interactions energy: -444.464 where: short stacking energy: -170.818 Base-Backbone interact. energy: -0.167 local terms energy: -159.900392 where: bonds (distance) C4'-P energy: -26.711 bonds (distance) P-C4' energy: -29.109 flat angles C4'-P-C4' energy: -32.789 flat angles P-C4'-P energy: -21.754 tors. eta vs tors. theta energy: -49.538 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -585.243986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.243986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.375170 (E_RNA) where: Base-Base interactions energy: -429.722 where: short stacking energy: -168.268 Base-Backbone interact. energy: -0.001 local terms energy: -155.652175 where: bonds (distance) C4'-P energy: -21.468 bonds (distance) P-C4' energy: -28.913 flat angles C4'-P-C4' energy: -31.563 flat angles P-C4'-P energy: -22.664 tors. eta vs tors. theta energy: -51.044 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -557.272080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -557.272080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.420584 (E_RNA) where: Base-Base interactions energy: -417.624 where: short stacking energy: -156.540 Base-Backbone interact. energy: -0.434 local terms energy: -139.362906 where: bonds (distance) C4'-P energy: -26.024 bonds (distance) P-C4' energy: -24.395 flat angles C4'-P-C4' energy: -26.707 flat angles P-C4'-P energy: -17.424 tors. eta vs tors. theta energy: -44.813 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -579.746443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.746443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.333517 (E_RNA) where: Base-Base interactions energy: -417.438 where: short stacking energy: -163.106 Base-Backbone interact. energy: -0.527 local terms energy: -162.368694 where: bonds (distance) C4'-P energy: -26.339 bonds (distance) P-C4' energy: -31.416 flat angles C4'-P-C4' energy: -34.506 flat angles P-C4'-P energy: -22.107 tors. eta vs tors. theta energy: -48.001 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -525.945890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -525.945890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.797230 (E_RNA) where: Base-Base interactions energy: -386.698 where: short stacking energy: -143.323 Base-Backbone interact. energy: -0.285 local terms energy: -144.814300 where: bonds (distance) C4'-P energy: -25.266 bonds (distance) P-C4' energy: -21.142 flat angles C4'-P-C4' energy: -32.470 flat angles P-C4'-P energy: -24.901 tors. eta vs tors. theta energy: -41.034 Dist. restrs. and SS energy: 5.851 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -466.738472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.738472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.881594 (E_RNA) where: Base-Base interactions energy: -326.219 where: short stacking energy: -128.194 Base-Backbone interact. energy: 0.115 local terms energy: -145.777614 where: bonds (distance) C4'-P energy: -25.374 bonds (distance) P-C4' energy: -29.603 flat angles C4'-P-C4' energy: -31.466 flat angles P-C4'-P energy: -22.092 tors. eta vs tors. theta energy: -37.242 Dist. restrs. and SS energy: 5.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -446.035696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.035696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.773513 (E_RNA) where: Base-Base interactions energy: -337.841 where: short stacking energy: -125.954 Base-Backbone interact. energy: 1.528 local terms energy: -116.460368 where: bonds (distance) C4'-P energy: -27.655 bonds (distance) P-C4' energy: -17.299 flat angles C4'-P-C4' energy: -19.611 flat angles P-C4'-P energy: -16.392 tors. eta vs tors. theta energy: -35.503 Dist. restrs. and SS energy: 6.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -461.861436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.861436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.193766 (E_RNA) where: Base-Base interactions energy: -347.857 where: short stacking energy: -133.267 Base-Backbone interact. energy: -0.262 local terms energy: -122.075185 where: bonds (distance) C4'-P energy: -22.564 bonds (distance) P-C4' energy: -17.930 flat angles C4'-P-C4' energy: -26.985 flat angles P-C4'-P energy: -17.160 tors. eta vs tors. theta energy: -37.437 Dist. restrs. and SS energy: 8.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -410.062440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.062440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.994283 (E_RNA) where: Base-Base interactions energy: -304.865 where: short stacking energy: -109.947 Base-Backbone interact. energy: 2.240 local terms energy: -112.369031 where: bonds (distance) C4'-P energy: -22.656 bonds (distance) P-C4' energy: -26.742 flat angles C4'-P-C4' energy: -25.955 flat angles P-C4'-P energy: -7.694 tors. eta vs tors. theta energy: -29.321 Dist. restrs. and SS energy: 4.932 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -613.258441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.258441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.435383 (E_RNA) where: Base-Base interactions energy: -444.760 where: short stacking energy: -170.554 Base-Backbone interact. energy: -0.002 local terms energy: -169.064750 where: bonds (distance) C4'-P energy: -28.920 bonds (distance) P-C4' energy: -27.174 flat angles C4'-P-C4' energy: -33.425 flat angles P-C4'-P energy: -27.163 tors. eta vs tors. theta energy: -52.383 Dist. restrs. and SS energy: 0.177 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.391 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -595.867785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.867785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.203213 (E_RNA) where: Base-Base interactions energy: -439.063 where: short stacking energy: -174.613 Base-Backbone interact. energy: -0.002 local terms energy: -157.137818 where: bonds (distance) C4'-P energy: -23.862 bonds (distance) P-C4' energy: -29.749 flat angles C4'-P-C4' energy: -27.362 flat angles P-C4'-P energy: -24.139 tors. eta vs tors. theta energy: -52.025 Dist. restrs. and SS energy: 0.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -592.422898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.422898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.567664 (E_RNA) where: Base-Base interactions energy: -431.726 where: short stacking energy: -167.870 Base-Backbone interact. energy: -0.157 local terms energy: -160.684792 where: bonds (distance) C4'-P energy: -25.638 bonds (distance) P-C4' energy: -29.334 flat angles C4'-P-C4' energy: -31.048 flat angles P-C4'-P energy: -24.483 tors. eta vs tors. theta energy: -50.182 Dist. restrs. and SS energy: 0.145 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -575.624295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.624295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.115451 (E_RNA) where: Base-Base interactions energy: -433.560 where: short stacking energy: -168.620 Base-Backbone interact. energy: -0.024 local terms energy: -142.531681 where: bonds (distance) C4'-P energy: -18.242 bonds (distance) P-C4' energy: -25.897 flat angles C4'-P-C4' energy: -31.985 flat angles P-C4'-P energy: -19.125 tors. eta vs tors. theta energy: -47.283 Dist. restrs. and SS energy: 0.491 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -571.659537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.659537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.828780 (E_RNA) where: Base-Base interactions energy: -423.689 where: short stacking energy: -161.810 Base-Backbone interact. energy: -0.001 local terms energy: -148.139402 where: bonds (distance) C4'-P energy: -22.005 bonds (distance) P-C4' energy: -25.924 flat angles C4'-P-C4' energy: -32.785 flat angles P-C4'-P energy: -17.558 tors. eta vs tors. theta energy: -49.867 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -526.269338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.269338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -527.022673 (E_RNA) where: Base-Base interactions energy: -384.177 where: short stacking energy: -143.528 Base-Backbone interact. energy: -0.012 local terms energy: -142.834145 where: bonds (distance) C4'-P energy: -27.275 bonds (distance) P-C4' energy: -29.449 flat angles C4'-P-C4' energy: -25.006 flat angles P-C4'-P energy: -20.531 tors. eta vs tors. theta energy: -40.574 Dist. restrs. and SS energy: 0.753 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -479.871704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.871704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.384557 (E_RNA) where: Base-Base interactions energy: -348.877 where: short stacking energy: -136.390 Base-Backbone interact. energy: 0.337 local terms energy: -135.843882 where: bonds (distance) C4'-P energy: -25.072 bonds (distance) P-C4' energy: -21.928 flat angles C4'-P-C4' energy: -33.411 flat angles P-C4'-P energy: -19.279 tors. eta vs tors. theta energy: -36.153 Dist. restrs. and SS energy: 4.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -464.585073 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.585073 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.780388 (E_RNA) where: Base-Base interactions energy: -347.240 where: short stacking energy: -132.983 Base-Backbone interact. energy: -0.220 local terms energy: -122.320843 where: bonds (distance) C4'-P energy: -17.682 bonds (distance) P-C4' energy: -25.415 flat angles C4'-P-C4' energy: -26.114 flat angles P-C4'-P energy: -14.987 tors. eta vs tors. theta energy: -38.122 Dist. restrs. and SS energy: 5.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -442.057271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.057271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.530048 (E_RNA) where: Base-Base interactions energy: -331.766 where: short stacking energy: -132.413 Base-Backbone interact. energy: 0.617 local terms energy: -118.381557 where: bonds (distance) C4'-P energy: -13.974 bonds (distance) P-C4' energy: -26.429 flat angles C4'-P-C4' energy: -22.356 flat angles P-C4'-P energy: -16.881 tors. eta vs tors. theta energy: -38.742 Dist. restrs. and SS energy: 7.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -398.200297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.200297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.386582 (E_RNA) where: Base-Base interactions energy: -291.907 where: short stacking energy: -109.272 Base-Backbone interact. energy: -0.208 local terms energy: -115.131107 where: bonds (distance) C4'-P energy: -29.125 bonds (distance) P-C4' energy: -19.388 flat angles C4'-P-C4' energy: -21.879 flat angles P-C4'-P energy: -18.681 tors. eta vs tors. theta energy: -26.058 Dist. restrs. and SS energy: 8.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.859 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -602.040592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.040592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.366851 (E_RNA) where: Base-Base interactions energy: -437.208 where: short stacking energy: -166.473 Base-Backbone interact. energy: -0.217 local terms energy: -164.941659 where: bonds (distance) C4'-P energy: -29.583 bonds (distance) P-C4' energy: -29.264 flat angles C4'-P-C4' energy: -29.812 flat angles P-C4'-P energy: -27.630 tors. eta vs tors. theta energy: -48.653 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -590.928546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.928546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.196778 (E_RNA) where: Base-Base interactions energy: -441.825 where: short stacking energy: -169.998 Base-Backbone interact. energy: -0.001 local terms energy: -149.370198 where: bonds (distance) C4'-P energy: -18.674 bonds (distance) P-C4' energy: -24.544 flat angles C4'-P-C4' energy: -31.789 flat angles P-C4'-P energy: -26.088 tors. eta vs tors. theta energy: -48.275 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -598.556669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.556669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.943820 (E_RNA) where: Base-Base interactions energy: -434.609 where: short stacking energy: -169.467 Base-Backbone interact. energy: -0.001 local terms energy: -164.334271 where: bonds (distance) C4'-P energy: -29.278 bonds (distance) P-C4' energy: -30.000 flat angles C4'-P-C4' energy: -30.061 flat angles P-C4'-P energy: -24.338 tors. eta vs tors. theta energy: -50.656 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -586.032078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.032078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.203296 (E_RNA) where: Base-Base interactions energy: -430.497 where: short stacking energy: -169.394 Base-Backbone interact. energy: -0.006 local terms energy: -155.700351 where: bonds (distance) C4'-P energy: -27.043 bonds (distance) P-C4' energy: -23.021 flat angles C4'-P-C4' energy: -30.086 flat angles P-C4'-P energy: -23.223 tors. eta vs tors. theta energy: -52.328 Dist. restrs. and SS energy: 0.171 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -585.600109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.600109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.716128 (E_RNA) where: Base-Base interactions energy: -433.859 where: short stacking energy: -171.556 Base-Backbone interact. energy: -0.000 local terms energy: -151.856798 where: bonds (distance) C4'-P energy: -21.284 bonds (distance) P-C4' energy: -24.989 flat angles C4'-P-C4' energy: -32.564 flat angles P-C4'-P energy: -23.787 tors. eta vs tors. theta energy: -49.232 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -549.813309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.813309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -550.764596 (E_RNA) where: Base-Base interactions energy: -400.562 where: short stacking energy: -152.768 Base-Backbone interact. energy: -0.003 local terms energy: -150.199741 where: bonds (distance) C4'-P energy: -24.247 bonds (distance) P-C4' energy: -30.271 flat angles C4'-P-C4' energy: -25.922 flat angles P-C4'-P energy: -24.049 tors. eta vs tors. theta energy: -45.711 Dist. restrs. and SS energy: 0.951 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -475.603281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.603281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.336919 (E_RNA) where: Base-Base interactions energy: -355.487 where: short stacking energy: -126.007 Base-Backbone interact. energy: -0.294 local terms energy: -122.555865 where: bonds (distance) C4'-P energy: -20.493 bonds (distance) P-C4' energy: -26.650 flat angles C4'-P-C4' energy: -27.042 flat angles P-C4'-P energy: -14.454 tors. eta vs tors. theta energy: -33.918 Dist. restrs. and SS energy: 2.734 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -459.159586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.159586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.591775 (E_RNA) where: Base-Base interactions energy: -330.705 where: short stacking energy: -135.314 Base-Backbone interact. energy: -0.118 local terms energy: -137.768385 where: bonds (distance) C4'-P energy: -24.869 bonds (distance) P-C4' energy: -26.655 flat angles C4'-P-C4' energy: -25.785 flat angles P-C4'-P energy: -19.532 tors. eta vs tors. theta energy: -40.928 Dist. restrs. and SS energy: 9.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -453.756045 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.756045 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.724165 (E_RNA) where: Base-Base interactions energy: -332.945 where: short stacking energy: -137.489 Base-Backbone interact. energy: 0.947 local terms energy: -131.726388 where: bonds (distance) C4'-P energy: -29.016 bonds (distance) P-C4' energy: -30.894 flat angles C4'-P-C4' energy: -24.852 flat angles P-C4'-P energy: -9.115 tors. eta vs tors. theta energy: -37.849 Dist. restrs. and SS energy: 9.968 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -401.046201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.046201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.238545 (E_RNA) where: Base-Base interactions energy: -303.743 where: short stacking energy: -109.308 Base-Backbone interact. energy: 0.961 local terms energy: -104.456995 where: bonds (distance) C4'-P energy: -17.115 bonds (distance) P-C4' energy: -27.162 flat angles C4'-P-C4' energy: -18.825 flat angles P-C4'-P energy: -15.333 tors. eta vs tors. theta energy: -26.022 Dist. restrs. and SS energy: 6.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -594.532587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.532587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.771337 (E_RNA) where: Base-Base interactions energy: -436.032 where: short stacking energy: -166.687 Base-Backbone interact. energy: -0.239 local terms energy: -158.500128 where: bonds (distance) C4'-P energy: -23.868 bonds (distance) P-C4' energy: -30.095 flat angles C4'-P-C4' energy: -32.564 flat angles P-C4'-P energy: -23.769 tors. eta vs tors. theta energy: -48.204 Dist. restrs. and SS energy: 0.239 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -592.151765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.151765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.439583 (E_RNA) where: Base-Base interactions energy: -437.760 where: short stacking energy: -171.421 Base-Backbone interact. energy: -0.000 local terms energy: -154.679246 where: bonds (distance) C4'-P energy: -23.863 bonds (distance) P-C4' energy: -23.994 flat angles C4'-P-C4' energy: -32.269 flat angles P-C4'-P energy: -25.147 tors. eta vs tors. theta energy: -49.407 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -591.441623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.441623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.598148 (E_RNA) where: Base-Base interactions energy: -429.839 where: short stacking energy: -161.974 Base-Backbone interact. energy: -0.042 local terms energy: -161.717360 where: bonds (distance) C4'-P energy: -24.773 bonds (distance) P-C4' energy: -31.216 flat angles C4'-P-C4' energy: -31.256 flat angles P-C4'-P energy: -23.861 tors. eta vs tors. theta energy: -50.611 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -590.612589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.612589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.054176 (E_RNA) where: Base-Base interactions energy: -428.959 where: short stacking energy: -166.826 Base-Backbone interact. energy: -0.242 local terms energy: -161.853434 where: bonds (distance) C4'-P energy: -27.162 bonds (distance) P-C4' energy: -28.616 flat angles C4'-P-C4' energy: -32.567 flat angles P-C4'-P energy: -22.948 tors. eta vs tors. theta energy: -50.560 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -577.008814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.008814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.198471 (E_RNA) where: Base-Base interactions energy: -421.404 where: short stacking energy: -161.628 Base-Backbone interact. energy: -0.002 local terms energy: -155.792585 where: bonds (distance) C4'-P energy: -25.710 bonds (distance) P-C4' energy: -25.705 flat angles C4'-P-C4' energy: -33.317 flat angles P-C4'-P energy: -21.299 tors. eta vs tors. theta energy: -49.762 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -581.281009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.281009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.813650 (E_RNA) where: Base-Base interactions energy: -420.774 where: short stacking energy: -167.045 Base-Backbone interact. energy: -0.007 local terms energy: -161.032542 where: bonds (distance) C4'-P energy: -26.623 bonds (distance) P-C4' energy: -29.118 flat angles C4'-P-C4' energy: -31.201 flat angles P-C4'-P energy: -23.907 tors. eta vs tors. theta energy: -50.185 Dist. restrs. and SS energy: 0.533 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -470.556893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.556893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.343450 (E_RNA) where: Base-Base interactions energy: -340.009 where: short stacking energy: -124.330 Base-Backbone interact. energy: -1.082 local terms energy: -131.252376 where: bonds (distance) C4'-P energy: -29.391 bonds (distance) P-C4' energy: -28.387 flat angles C4'-P-C4' energy: -25.500 flat angles P-C4'-P energy: -12.735 tors. eta vs tors. theta energy: -35.239 Dist. restrs. and SS energy: 1.787 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -457.629439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.629439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.255251 (E_RNA) where: Base-Base interactions energy: -350.648 where: short stacking energy: -119.671 Base-Backbone interact. energy: -0.086 local terms energy: -109.521120 where: bonds (distance) C4'-P energy: -24.397 bonds (distance) P-C4' energy: -10.502 flat angles C4'-P-C4' energy: -29.217 flat angles P-C4'-P energy: -13.549 tors. eta vs tors. theta energy: -31.857 Dist. restrs. and SS energy: 2.626 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -470.902632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.902632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.020426 (E_RNA) where: Base-Base interactions energy: -342.234 where: short stacking energy: -120.712 Base-Backbone interact. energy: -0.075 local terms energy: -130.711809 where: bonds (distance) C4'-P energy: -23.134 bonds (distance) P-C4' energy: -24.741 flat angles C4'-P-C4' energy: -28.658 flat angles P-C4'-P energy: -18.243 tors. eta vs tors. theta energy: -35.936 Dist. restrs. and SS energy: 2.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -398.872668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.872668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.331601 (E_RNA) where: Base-Base interactions energy: -300.170 where: short stacking energy: -108.587 Base-Backbone interact. energy: 4.326 local terms energy: -110.487759 where: bonds (distance) C4'-P energy: -26.446 bonds (distance) P-C4' energy: -19.821 flat angles C4'-P-C4' energy: -27.703 flat angles P-C4'-P energy: -13.697 tors. eta vs tors. theta energy: -22.821 Dist. restrs. and SS energy: 7.459 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -597.300914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.300914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.656306 (E_RNA) where: Base-Base interactions energy: -441.922 where: short stacking energy: -168.560 Base-Backbone interact. energy: -0.001 local terms energy: -155.733138 where: bonds (distance) C4'-P energy: -28.002 bonds (distance) P-C4' energy: -23.723 flat angles C4'-P-C4' energy: -29.962 flat angles P-C4'-P energy: -23.946 tors. eta vs tors. theta energy: -50.101 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -595.292799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.292799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.373869 (E_RNA) where: Base-Base interactions energy: -436.445 where: short stacking energy: -163.658 Base-Backbone interact. energy: -0.002 local terms energy: -158.926900 where: bonds (distance) C4'-P energy: -24.373 bonds (distance) P-C4' energy: -25.592 flat angles C4'-P-C4' energy: -32.877 flat angles P-C4'-P energy: -24.671 tors. eta vs tors. theta energy: -51.414 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -586.683219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.683219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.153054 (E_RNA) where: Base-Base interactions energy: -428.550 where: short stacking energy: -166.108 Base-Backbone interact. energy: -0.000 local terms energy: -158.602294 where: bonds (distance) C4'-P energy: -28.781 bonds (distance) P-C4' energy: -25.977 flat angles C4'-P-C4' energy: -32.774 flat angles P-C4'-P energy: -20.184 tors. eta vs tors. theta energy: -50.886 Dist. restrs. and SS energy: 0.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -595.684663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.684663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.803789 (E_RNA) where: Base-Base interactions energy: -437.240 where: short stacking energy: -166.286 Base-Backbone interact. energy: -0.003 local terms energy: -158.560282 where: bonds (distance) C4'-P energy: -27.458 bonds (distance) P-C4' energy: -28.514 flat angles C4'-P-C4' energy: -28.957 flat angles P-C4'-P energy: -23.315 tors. eta vs tors. theta energy: -50.316 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -578.217434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.217434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.399981 (E_RNA) where: Base-Base interactions energy: -424.632 where: short stacking energy: -165.384 Base-Backbone interact. energy: -0.171 local terms energy: -153.596668 where: bonds (distance) C4'-P energy: -21.727 bonds (distance) P-C4' energy: -29.769 flat angles C4'-P-C4' energy: -26.292 flat angles P-C4'-P energy: -25.401 tors. eta vs tors. theta energy: -50.408 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -565.918414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.918414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.166834 (E_RNA) where: Base-Base interactions energy: -415.116 where: short stacking energy: -158.807 Base-Backbone interact. energy: -0.001 local terms energy: -151.050307 where: bonds (distance) C4'-P energy: -26.334 bonds (distance) P-C4' energy: -23.992 flat angles C4'-P-C4' energy: -31.798 flat angles P-C4'-P energy: -20.280 tors. eta vs tors. theta energy: -48.645 Dist. restrs. and SS energy: 0.248 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -479.242810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.242810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.339305 (E_RNA) where: Base-Base interactions energy: -336.465 where: short stacking energy: -125.796 Base-Backbone interact. energy: 0.271 local terms energy: -147.145542 where: bonds (distance) C4'-P energy: -23.175 bonds (distance) P-C4' energy: -32.087 flat angles C4'-P-C4' energy: -30.120 flat angles P-C4'-P energy: -23.253 tors. eta vs tors. theta energy: -38.511 Dist. restrs. and SS energy: 4.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -481.907267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.907267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.653718 (E_RNA) where: Base-Base interactions energy: -353.146 where: short stacking energy: -136.623 Base-Backbone interact. energy: 1.093 local terms energy: -133.600594 where: bonds (distance) C4'-P energy: -21.406 bonds (distance) P-C4' energy: -25.347 flat angles C4'-P-C4' energy: -29.872 flat angles P-C4'-P energy: -22.144 tors. eta vs tors. theta energy: -34.831 Dist. restrs. and SS energy: 3.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -453.999545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.999545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.163879 (E_RNA) where: Base-Base interactions energy: -339.923 where: short stacking energy: -117.121 Base-Backbone interact. energy: -0.219 local terms energy: -118.022252 where: bonds (distance) C4'-P energy: -29.163 bonds (distance) P-C4' energy: -28.445 flat angles C4'-P-C4' energy: -15.874 flat angles P-C4'-P energy: -13.889 tors. eta vs tors. theta energy: -30.651 Dist. restrs. and SS energy: 4.164 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -406.830402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.830402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.687714 (E_RNA) where: Base-Base interactions energy: -296.265 where: short stacking energy: -112.773 Base-Backbone interact. energy: -0.435 local terms energy: -118.988331 where: bonds (distance) C4'-P energy: -19.403 bonds (distance) P-C4' energy: -30.235 flat angles C4'-P-C4' energy: -28.062 flat angles P-C4'-P energy: -17.186 tors. eta vs tors. theta energy: -24.103 Dist. restrs. and SS energy: 8.857 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -599.836308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.836308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.964906 (E_RNA) where: Base-Base interactions energy: -439.018 where: short stacking energy: -167.258 Base-Backbone interact. energy: -0.014 local terms energy: -160.933462 where: bonds (distance) C4'-P energy: -27.129 bonds (distance) P-C4' energy: -27.193 flat angles C4'-P-C4' energy: -32.446 flat angles P-C4'-P energy: -25.979 tors. eta vs tors. theta energy: -48.185 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -599.691768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.691768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.114464 (E_RNA) where: Base-Base interactions energy: -438.175 where: short stacking energy: -168.430 Base-Backbone interact. energy: -0.122 local terms energy: -161.817201 where: bonds (distance) C4'-P energy: -25.839 bonds (distance) P-C4' energy: -31.318 flat angles C4'-P-C4' energy: -30.114 flat angles P-C4'-P energy: -23.424 tors. eta vs tors. theta energy: -51.122 Dist. restrs. and SS energy: 0.423 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -588.329345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.329345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.817143 (E_RNA) where: Base-Base interactions energy: -430.345 where: short stacking energy: -163.409 Base-Backbone interact. energy: -0.002 local terms energy: -158.470218 where: bonds (distance) C4'-P energy: -26.394 bonds (distance) P-C4' energy: -23.418 flat angles C4'-P-C4' energy: -32.638 flat angles P-C4'-P energy: -25.112 tors. eta vs tors. theta energy: -50.909 Dist. restrs. and SS energy: 0.488 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -587.786447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.786447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.938473 (E_RNA) where: Base-Base interactions energy: -442.058 where: short stacking energy: -171.119 Base-Backbone interact. energy: -0.000 local terms energy: -145.880013 where: bonds (distance) C4'-P energy: -17.401 bonds (distance) P-C4' energy: -24.053 flat angles C4'-P-C4' energy: -33.727 flat angles P-C4'-P energy: -22.030 tors. eta vs tors. theta energy: -48.669 Dist. restrs. and SS energy: 0.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -566.352024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.352024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.573936 (E_RNA) where: Base-Base interactions energy: -411.834 where: short stacking energy: -155.049 Base-Backbone interact. energy: -0.240 local terms energy: -154.499619 where: bonds (distance) C4'-P energy: -23.992 bonds (distance) P-C4' energy: -28.635 flat angles C4'-P-C4' energy: -28.634 flat angles P-C4'-P energy: -26.319 tors. eta vs tors. theta energy: -46.919 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -571.761874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.761874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.225096 (E_RNA) where: Base-Base interactions energy: -415.021 where: short stacking energy: -156.029 Base-Backbone interact. energy: -0.575 local terms energy: -156.628902 where: bonds (distance) C4'-P energy: -23.866 bonds (distance) P-C4' energy: -25.583 flat angles C4'-P-C4' energy: -31.745 flat angles P-C4'-P energy: -24.820 tors. eta vs tors. theta energy: -50.616 Dist. restrs. and SS energy: 0.463 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -499.067843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.067843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.880459 (E_RNA) where: Base-Base interactions energy: -366.973 where: short stacking energy: -138.859 Base-Backbone interact. energy: 3.323 local terms energy: -137.230351 where: bonds (distance) C4'-P energy: -21.665 bonds (distance) P-C4' energy: -22.964 flat angles C4'-P-C4' energy: -30.258 flat angles P-C4'-P energy: -23.028 tors. eta vs tors. theta energy: -39.315 Dist. restrs. and SS energy: 1.813 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -470.886948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.886948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.493981 (E_RNA) where: Base-Base interactions energy: -351.969 where: short stacking energy: -130.083 Base-Backbone interact. energy: -0.032 local terms energy: -120.493230 where: bonds (distance) C4'-P energy: -21.566 bonds (distance) P-C4' energy: -24.844 flat angles C4'-P-C4' energy: -21.429 flat angles P-C4'-P energy: -18.636 tors. eta vs tors. theta energy: -34.018 Dist. restrs. and SS energy: 1.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -445.408777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.408777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.886288 (E_RNA) where: Base-Base interactions energy: -323.275 where: short stacking energy: -123.956 Base-Backbone interact. energy: -0.314 local terms energy: -126.296850 where: bonds (distance) C4'-P energy: -21.521 bonds (distance) P-C4' energy: -24.903 flat angles C4'-P-C4' energy: -24.316 flat angles P-C4'-P energy: -23.882 tors. eta vs tors. theta energy: -31.674 Dist. restrs. and SS energy: 4.478 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -403.950880 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.950880 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.635466 (E_RNA) where: Base-Base interactions energy: -313.860 where: short stacking energy: -104.430 Base-Backbone interact. energy: 7.586 local terms energy: -104.362309 where: bonds (distance) C4'-P energy: -17.001 bonds (distance) P-C4' energy: -22.366 flat angles C4'-P-C4' energy: -28.111 flat angles P-C4'-P energy: -9.853 tors. eta vs tors. theta energy: -27.031 Dist. restrs. and SS energy: 6.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -602.296907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.296907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.541739 (E_RNA) where: Base-Base interactions energy: -439.299 where: short stacking energy: -169.177 Base-Backbone interact. energy: -0.002 local terms energy: -163.240839 where: bonds (distance) C4'-P energy: -25.814 bonds (distance) P-C4' energy: -28.493 flat angles C4'-P-C4' energy: -31.611 flat angles P-C4'-P energy: -26.300 tors. eta vs tors. theta energy: -51.024 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -599.480621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.480621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.409526 (E_RNA) where: Base-Base interactions energy: -431.389 where: short stacking energy: -173.891 Base-Backbone interact. energy: -0.005 local terms energy: -169.015522 where: bonds (distance) C4'-P energy: -25.037 bonds (distance) P-C4' energy: -32.869 flat angles C4'-P-C4' energy: -32.850 flat angles P-C4'-P energy: -27.160 tors. eta vs tors. theta energy: -51.099 Dist. restrs. and SS energy: 0.929 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -588.284812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.284812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.413507 (E_RNA) where: Base-Base interactions energy: -426.841 where: short stacking energy: -168.717 Base-Backbone interact. energy: -0.158 local terms energy: -161.415026 where: bonds (distance) C4'-P energy: -26.856 bonds (distance) P-C4' energy: -26.925 flat angles C4'-P-C4' energy: -33.600 flat angles P-C4'-P energy: -22.543 tors. eta vs tors. theta energy: -51.490 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -580.311817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.311817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.541418 (E_RNA) where: Base-Base interactions energy: -424.109 where: short stacking energy: -163.127 Base-Backbone interact. energy: -0.001 local terms energy: -156.554527 where: bonds (distance) C4'-P energy: -26.519 bonds (distance) P-C4' energy: -25.116 flat angles C4'-P-C4' energy: -31.040 flat angles P-C4'-P energy: -23.677 tors. eta vs tors. theta energy: -50.202 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.123 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -560.996535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.996535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.422389 (E_RNA) where: Base-Base interactions energy: -423.469 where: short stacking energy: -157.191 Base-Backbone interact. energy: -0.004 local terms energy: -137.949925 where: bonds (distance) C4'-P energy: -25.359 bonds (distance) P-C4' energy: -20.189 flat angles C4'-P-C4' energy: -24.996 flat angles P-C4'-P energy: -20.850 tors. eta vs tors. theta energy: -46.556 Dist. restrs. and SS energy: 0.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -571.134137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.134137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.425386 (E_RNA) where: Base-Base interactions energy: -415.702 where: short stacking energy: -162.079 Base-Backbone interact. energy: -0.590 local terms energy: -155.133819 where: bonds (distance) C4'-P energy: -22.522 bonds (distance) P-C4' energy: -28.761 flat angles C4'-P-C4' energy: -31.186 flat angles P-C4'-P energy: -23.681 tors. eta vs tors. theta energy: -48.984 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -490.746093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.746093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.556414 (E_RNA) where: Base-Base interactions energy: -361.033 where: short stacking energy: -131.693 Base-Backbone interact. energy: -0.984 local terms energy: -129.539579 where: bonds (distance) C4'-P energy: -24.889 bonds (distance) P-C4' energy: -24.380 flat angles C4'-P-C4' energy: -27.613 flat angles P-C4'-P energy: -16.665 tors. eta vs tors. theta energy: -35.992 Dist. restrs. and SS energy: 0.810 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -464.075085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.075085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.202706 (E_RNA) where: Base-Base interactions energy: -332.803 where: short stacking energy: -127.699 Base-Backbone interact. energy: -0.196 local terms energy: -136.203905 where: bonds (distance) C4'-P energy: -23.337 bonds (distance) P-C4' energy: -32.888 flat angles C4'-P-C4' energy: -28.364 flat angles P-C4'-P energy: -20.400 tors. eta vs tors. theta energy: -31.215 Dist. restrs. and SS energy: 5.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -472.755071 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.755071 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.155183 (E_RNA) where: Base-Base interactions energy: -346.677 where: short stacking energy: -124.656 Base-Backbone interact. energy: 1.997 local terms energy: -130.475333 where: bonds (distance) C4'-P energy: -23.160 bonds (distance) P-C4' energy: -19.038 flat angles C4'-P-C4' energy: -31.027 flat angles P-C4'-P energy: -21.928 tors. eta vs tors. theta energy: -35.322 Dist. restrs. and SS energy: 2.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -387.297425 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.297425 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.343617 (E_RNA) where: Base-Base interactions energy: -286.158 where: short stacking energy: -99.471 Base-Backbone interact. energy: -0.546 local terms energy: -106.639516 where: bonds (distance) C4'-P energy: -25.506 bonds (distance) P-C4' energy: -22.585 flat angles C4'-P-C4' energy: -26.892 flat angles P-C4'-P energy: -6.513 tors. eta vs tors. theta energy: -25.144 Dist. restrs. and SS energy: 6.046 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -606.463988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.463988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.775583 (E_RNA) where: Base-Base interactions energy: -444.252 where: short stacking energy: -173.904 Base-Backbone interact. energy: -0.003 local terms energy: -162.725976 where: bonds (distance) C4'-P energy: -28.440 bonds (distance) P-C4' energy: -26.134 flat angles C4'-P-C4' energy: -35.104 flat angles P-C4'-P energy: -22.311 tors. eta vs tors. theta energy: -50.737 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.206 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -599.701744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.701744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.200446 (E_RNA) where: Base-Base interactions energy: -435.311 where: short stacking energy: -167.258 Base-Backbone interact. energy: -0.211 local terms energy: -164.677734 where: bonds (distance) C4'-P energy: -26.004 bonds (distance) P-C4' energy: -29.881 flat angles C4'-P-C4' energy: -32.094 flat angles P-C4'-P energy: -26.379 tors. eta vs tors. theta energy: -50.320 Dist. restrs. and SS energy: 0.499 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -586.940389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.940389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.052014 (E_RNA) where: Base-Base interactions energy: -421.391 where: short stacking energy: -161.595 Base-Backbone interact. energy: -0.000 local terms energy: -167.192899 where: bonds (distance) C4'-P energy: -30.508 bonds (distance) P-C4' energy: -29.990 flat angles C4'-P-C4' energy: -33.449 flat angles P-C4'-P energy: -24.212 tors. eta vs tors. theta energy: -49.034 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.532 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -576.672250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.672250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.940909 (E_RNA) where: Base-Base interactions energy: -429.930 where: short stacking energy: -160.213 Base-Backbone interact. energy: -0.122 local terms energy: -146.889032 where: bonds (distance) C4'-P energy: -19.262 bonds (distance) P-C4' energy: -24.220 flat angles C4'-P-C4' energy: -34.728 flat angles P-C4'-P energy: -22.639 tors. eta vs tors. theta energy: -46.041 Dist. restrs. and SS energy: 0.269 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -587.466204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.466204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.779620 (E_RNA) where: Base-Base interactions energy: -427.122 where: short stacking energy: -164.430 Base-Backbone interact. energy: -0.008 local terms energy: -160.649351 where: bonds (distance) C4'-P energy: -27.079 bonds (distance) P-C4' energy: -26.475 flat angles C4'-P-C4' energy: -32.816 flat angles P-C4'-P energy: -23.464 tors. eta vs tors. theta energy: -50.815 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -560.791632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.791632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.265047 (E_RNA) where: Base-Base interactions energy: -410.214 where: short stacking energy: -153.529 Base-Backbone interact. energy: -0.217 local terms energy: -150.833987 where: bonds (distance) C4'-P energy: -21.473 bonds (distance) P-C4' energy: -24.963 flat angles C4'-P-C4' energy: -34.267 flat angles P-C4'-P energy: -21.664 tors. eta vs tors. theta energy: -48.467 Dist. restrs. and SS energy: 0.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -488.234690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.234690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.427229 (E_RNA) where: Base-Base interactions energy: -346.666 where: short stacking energy: -129.343 Base-Backbone interact. energy: -0.039 local terms energy: -142.722344 where: bonds (distance) C4'-P energy: -24.843 bonds (distance) P-C4' energy: -31.512 flat angles C4'-P-C4' energy: -26.686 flat angles P-C4'-P energy: -23.433 tors. eta vs tors. theta energy: -36.247 Dist. restrs. and SS energy: 1.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -458.122696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.122696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.537597 (E_RNA) where: Base-Base interactions energy: -337.427 where: short stacking energy: -119.907 Base-Backbone interact. energy: -0.999 local terms energy: -122.111122 where: bonds (distance) C4'-P energy: -26.350 bonds (distance) P-C4' energy: -19.145 flat angles C4'-P-C4' energy: -26.015 flat angles P-C4'-P energy: -19.348 tors. eta vs tors. theta energy: -31.254 Dist. restrs. and SS energy: 2.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -450.918417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.918417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.329474 (E_RNA) where: Base-Base interactions energy: -329.837 where: short stacking energy: -129.308 Base-Backbone interact. energy: -0.423 local terms energy: -126.069223 where: bonds (distance) C4'-P energy: -23.902 bonds (distance) P-C4' energy: -28.594 flat angles C4'-P-C4' energy: -23.871 flat angles P-C4'-P energy: -14.477 tors. eta vs tors. theta energy: -35.226 Dist. restrs. and SS energy: 5.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -417.439099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.439099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.453674 (E_RNA) where: Base-Base interactions energy: -305.030 where: short stacking energy: -112.929 Base-Backbone interact. energy: 2.053 local terms energy: -121.476579 where: bonds (distance) C4'-P energy: -20.740 bonds (distance) P-C4' energy: -28.231 flat angles C4'-P-C4' energy: -27.513 flat angles P-C4'-P energy: -20.163 tors. eta vs tors. theta energy: -24.830 Dist. restrs. and SS energy: 7.015 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -609.526461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -609.526461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -609.627418 (E_RNA) where: Base-Base interactions energy: -438.727 where: short stacking energy: -168.830 Base-Backbone interact. energy: -0.172 local terms energy: -170.728353 where: bonds (distance) C4'-P energy: -30.823 bonds (distance) P-C4' energy: -29.077 flat angles C4'-P-C4' energy: -34.965 flat angles P-C4'-P energy: -24.198 tors. eta vs tors. theta energy: -51.666 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -600.848439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.848439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.023269 (E_RNA) where: Base-Base interactions energy: -435.120 where: short stacking energy: -169.643 Base-Backbone interact. energy: -0.001 local terms energy: -165.901951 where: bonds (distance) C4'-P energy: -27.754 bonds (distance) P-C4' energy: -27.071 flat angles C4'-P-C4' energy: -34.766 flat angles P-C4'-P energy: -23.961 tors. eta vs tors. theta energy: -52.350 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -589.627055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.627055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.186877 (E_RNA) where: Base-Base interactions energy: -429.641 where: short stacking energy: -164.370 Base-Backbone interact. energy: -0.001 local terms energy: -160.545379 where: bonds (distance) C4'-P energy: -27.630 bonds (distance) P-C4' energy: -26.344 flat angles C4'-P-C4' energy: -30.007 flat angles P-C4'-P energy: -25.862 tors. eta vs tors. theta energy: -50.702 Dist. restrs. and SS energy: 0.560 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -586.232977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.232977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.645378 (E_RNA) where: Base-Base interactions energy: -427.724 where: short stacking energy: -167.696 Base-Backbone interact. energy: -0.002 local terms energy: -158.919205 where: bonds (distance) C4'-P energy: -27.756 bonds (distance) P-C4' energy: -26.155 flat angles C4'-P-C4' energy: -30.585 flat angles P-C4'-P energy: -22.801 tors. eta vs tors. theta energy: -51.623 Dist. restrs. and SS energy: 0.412 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -570.736301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.736301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.596375 (E_RNA) where: Base-Base interactions energy: -429.707 where: short stacking energy: -164.633 Base-Backbone interact. energy: -0.011 local terms energy: -141.877867 where: bonds (distance) C4'-P energy: -21.302 bonds (distance) P-C4' energy: -24.050 flat angles C4'-P-C4' energy: -30.098 flat angles P-C4'-P energy: -15.703 tors. eta vs tors. theta energy: -50.725 Dist. restrs. and SS energy: 0.860 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -570.454351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.454351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.914437 (E_RNA) where: Base-Base interactions energy: -426.582 where: short stacking energy: -165.477 Base-Backbone interact. energy: -0.001 local terms energy: -144.331452 where: bonds (distance) C4'-P energy: -21.461 bonds (distance) P-C4' energy: -23.798 flat angles C4'-P-C4' energy: -29.250 flat angles P-C4'-P energy: -21.011 tors. eta vs tors. theta energy: -48.811 Dist. restrs. and SS energy: 0.460 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -496.349250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.349250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.496724 (E_RNA) where: Base-Base interactions energy: -370.201 where: short stacking energy: -132.461 Base-Backbone interact. energy: 0.038 local terms energy: -127.334142 where: bonds (distance) C4'-P energy: -24.289 bonds (distance) P-C4' energy: -21.629 flat angles C4'-P-C4' energy: -30.858 flat angles P-C4'-P energy: -17.098 tors. eta vs tors. theta energy: -33.460 Dist. restrs. and SS energy: 1.147 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -465.310561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.310561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.557903 (E_RNA) where: Base-Base interactions energy: -336.927 where: short stacking energy: -127.118 Base-Backbone interact. energy: 4.524 local terms energy: -136.155422 where: bonds (distance) C4'-P energy: -25.054 bonds (distance) P-C4' energy: -23.157 flat angles C4'-P-C4' energy: -27.020 flat angles P-C4'-P energy: -23.777 tors. eta vs tors. theta energy: -37.148 Dist. restrs. and SS energy: 3.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -462.815932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.815932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.907113 (E_RNA) where: Base-Base interactions energy: -340.736 where: short stacking energy: -131.203 Base-Backbone interact. energy: 2.000 local terms energy: -127.170653 where: bonds (distance) C4'-P energy: -22.013 bonds (distance) P-C4' energy: -27.534 flat angles C4'-P-C4' energy: -23.632 flat angles P-C4'-P energy: -19.311 tors. eta vs tors. theta energy: -34.681 Dist. restrs. and SS energy: 3.091 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -402.945312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.945312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.202262 (E_RNA) where: Base-Base interactions energy: -298.023 where: short stacking energy: -103.989 Base-Backbone interact. energy: -0.634 local terms energy: -110.544664 where: bonds (distance) C4'-P energy: -27.105 bonds (distance) P-C4' energy: -25.006 flat angles C4'-P-C4' energy: -20.479 flat angles P-C4'-P energy: -14.139 tors. eta vs tors. theta energy: -23.816 Dist. restrs. and SS energy: 6.257 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -605.353972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.353972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.617533 (E_RNA) where: Base-Base interactions energy: -439.368 where: short stacking energy: -171.756 Base-Backbone interact. energy: -0.000 local terms energy: -166.249415 where: bonds (distance) C4'-P energy: -26.318 bonds (distance) P-C4' energy: -32.232 flat angles C4'-P-C4' energy: -33.106 flat angles P-C4'-P energy: -23.743 tors. eta vs tors. theta energy: -50.850 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -592.239653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.239653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.547243 (E_RNA) where: Base-Base interactions energy: -430.960 where: short stacking energy: -167.220 Base-Backbone interact. energy: -0.002 local terms energy: -161.585945 where: bonds (distance) C4'-P energy: -25.345 bonds (distance) P-C4' energy: -32.330 flat angles C4'-P-C4' energy: -29.683 flat angles P-C4'-P energy: -22.759 tors. eta vs tors. theta energy: -51.469 Dist. restrs. and SS energy: 0.308 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -588.714988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.714988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.117160 (E_RNA) where: Base-Base interactions energy: -431.147 where: short stacking energy: -167.185 Base-Backbone interact. energy: -0.122 local terms energy: -157.847354 where: bonds (distance) C4'-P energy: -25.267 bonds (distance) P-C4' energy: -31.283 flat angles C4'-P-C4' energy: -29.388 flat angles P-C4'-P energy: -21.894 tors. eta vs tors. theta energy: -50.017 Dist. restrs. and SS energy: 0.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -584.605131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.605131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.154990 (E_RNA) where: Base-Base interactions energy: -421.683 where: short stacking energy: -157.898 Base-Backbone interact. energy: -0.414 local terms energy: -163.058137 where: bonds (distance) C4'-P energy: -32.966 bonds (distance) P-C4' energy: -23.994 flat angles C4'-P-C4' energy: -32.627 flat angles P-C4'-P energy: -24.351 tors. eta vs tors. theta energy: -49.120 Dist. restrs. and SS energy: 0.550 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -591.706087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.706087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.060898 (E_RNA) where: Base-Base interactions energy: -423.008 where: short stacking energy: -163.574 Base-Backbone interact. energy: -0.002 local terms energy: -169.051088 where: bonds (distance) C4'-P energy: -28.421 bonds (distance) P-C4' energy: -28.647 flat angles C4'-P-C4' energy: -35.360 flat angles P-C4'-P energy: -24.168 tors. eta vs tors. theta energy: -52.456 Dist. restrs. and SS energy: 0.355 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -580.142194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.142194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.486251 (E_RNA) where: Base-Base interactions energy: -433.205 where: short stacking energy: -169.733 Base-Backbone interact. energy: -0.005 local terms energy: -147.276282 where: bonds (distance) C4'-P energy: -17.800 bonds (distance) P-C4' energy: -27.473 flat angles C4'-P-C4' energy: -30.795 flat angles P-C4'-P energy: -20.780 tors. eta vs tors. theta energy: -50.428 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -480.918040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.918040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.024766 (E_RNA) where: Base-Base interactions energy: -358.539 where: short stacking energy: -134.337 Base-Backbone interact. energy: -0.335 local terms energy: -124.150660 where: bonds (distance) C4'-P energy: -19.164 bonds (distance) P-C4' energy: -23.274 flat angles C4'-P-C4' energy: -23.756 flat angles P-C4'-P energy: -22.267 tors. eta vs tors. theta energy: -35.689 Dist. restrs. and SS energy: 2.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -509.280468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.280468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.730931 (E_RNA) where: Base-Base interactions energy: -370.800 where: short stacking energy: -137.918 Base-Backbone interact. energy: -0.301 local terms energy: -138.630208 where: bonds (distance) C4'-P energy: -30.671 bonds (distance) P-C4' energy: -22.534 flat angles C4'-P-C4' energy: -28.426 flat angles P-C4'-P energy: -18.458 tors. eta vs tors. theta energy: -38.542 Dist. restrs. and SS energy: 0.450 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -424.727377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.727377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.268781 (E_RNA) where: Base-Base interactions energy: -322.801 where: short stacking energy: -121.620 Base-Backbone interact. energy: -0.670 local terms energy: -109.797571 where: bonds (distance) C4'-P energy: -18.267 bonds (distance) P-C4' energy: -26.130 flat angles C4'-P-C4' energy: -22.184 flat angles P-C4'-P energy: -10.173 tors. eta vs tors. theta energy: -33.044 Dist. restrs. and SS energy: 8.541 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -378.552749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.552749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.409108 (E_RNA) where: Base-Base interactions energy: -290.668 where: short stacking energy: -102.275 Base-Backbone interact. energy: 4.025 local terms energy: -97.766413 where: bonds (distance) C4'-P energy: -18.767 bonds (distance) P-C4' energy: -19.726 flat angles C4'-P-C4' energy: -17.810 flat angles P-C4'-P energy: -18.475 tors. eta vs tors. theta energy: -22.988 Dist. restrs. and SS energy: 5.856 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -612.321093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.321093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.390789 (E_RNA) where: Base-Base interactions energy: -441.979 where: short stacking energy: -167.396 Base-Backbone interact. energy: -0.000 local terms energy: -170.411210 where: bonds (distance) C4'-P energy: -25.800 bonds (distance) P-C4' energy: -31.798 flat angles C4'-P-C4' energy: -34.722 flat angles P-C4'-P energy: -26.807 tors. eta vs tors. theta energy: -51.285 Dist. restrs. and SS energy: 0.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -591.632645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.632645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.710192 (E_RNA) where: Base-Base interactions energy: -437.517 where: short stacking energy: -169.345 Base-Backbone interact. energy: -0.240 local terms energy: -153.953215 where: bonds (distance) C4'-P energy: -25.360 bonds (distance) P-C4' energy: -22.149 flat angles C4'-P-C4' energy: -33.601 flat angles P-C4'-P energy: -22.613 tors. eta vs tors. theta energy: -50.230 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -597.250837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.250837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.581229 (E_RNA) where: Base-Base interactions energy: -434.795 where: short stacking energy: -170.163 Base-Backbone interact. energy: -0.280 local terms energy: -162.506601 where: bonds (distance) C4'-P energy: -28.011 bonds (distance) P-C4' energy: -26.404 flat angles C4'-P-C4' energy: -32.727 flat angles P-C4'-P energy: -23.923 tors. eta vs tors. theta energy: -51.442 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -590.255967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.255967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.464532 (E_RNA) where: Base-Base interactions energy: -429.627 where: short stacking energy: -168.542 Base-Backbone interact. energy: -0.578 local terms energy: -160.259886 where: bonds (distance) C4'-P energy: -28.529 bonds (distance) P-C4' energy: -25.961 flat angles C4'-P-C4' energy: -32.441 flat angles P-C4'-P energy: -22.917 tors. eta vs tors. theta energy: -50.411 Dist. restrs. and SS energy: 0.209 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -579.724847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.724847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.001175 (E_RNA) where: Base-Base interactions energy: -415.351 where: short stacking energy: -160.119 Base-Backbone interact. energy: -0.000 local terms energy: -164.649798 where: bonds (distance) C4'-P energy: -30.303 bonds (distance) P-C4' energy: -30.177 flat angles C4'-P-C4' energy: -28.565 flat angles P-C4'-P energy: -26.544 tors. eta vs tors. theta energy: -49.059 Dist. restrs. and SS energy: 0.276 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -568.232805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.232805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.542590 (E_RNA) where: Base-Base interactions energy: -422.557 where: short stacking energy: -162.566 Base-Backbone interact. energy: -0.001 local terms energy: -145.984275 where: bonds (distance) C4'-P energy: -19.497 bonds (distance) P-C4' energy: -24.775 flat angles C4'-P-C4' energy: -30.075 flat angles P-C4'-P energy: -22.540 tors. eta vs tors. theta energy: -49.098 Dist. restrs. and SS energy: 0.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -460.134175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.134175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.346238 (E_RNA) where: Base-Base interactions energy: -339.365 where: short stacking energy: -129.178 Base-Backbone interact. energy: -0.047 local terms energy: -124.934968 where: bonds (distance) C4'-P energy: -23.491 bonds (distance) P-C4' energy: -19.642 flat angles C4'-P-C4' energy: -28.808 flat angles P-C4'-P energy: -18.518 tors. eta vs tors. theta energy: -34.476 Dist. restrs. and SS energy: 4.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -444.908295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.908295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.383814 (E_RNA) where: Base-Base interactions energy: -335.252 where: short stacking energy: -118.614 Base-Backbone interact. energy: 2.178 local terms energy: -113.310655 where: bonds (distance) C4'-P energy: -21.954 bonds (distance) P-C4' energy: -24.870 flat angles C4'-P-C4' energy: -24.167 flat angles P-C4'-P energy: -12.577 tors. eta vs tors. theta energy: -29.743 Dist. restrs. and SS energy: 1.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -474.455142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.455142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.787492 (E_RNA) where: Base-Base interactions energy: -353.948 where: short stacking energy: -132.486 Base-Backbone interact. energy: -0.103 local terms energy: -125.736165 where: bonds (distance) C4'-P energy: -24.391 bonds (distance) P-C4' energy: -19.851 flat angles C4'-P-C4' energy: -25.338 flat angles P-C4'-P energy: -19.451 tors. eta vs tors. theta energy: -36.705 Dist. restrs. and SS energy: 5.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -396.273983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.273983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.830512 (E_RNA) where: Base-Base interactions energy: -304.983 where: short stacking energy: -111.199 Base-Backbone interact. energy: -0.580 local terms energy: -96.266977 where: bonds (distance) C4'-P energy: -16.974 bonds (distance) P-C4' energy: -20.035 flat angles C4'-P-C4' energy: -22.172 flat angles P-C4'-P energy: -13.005 tors. eta vs tors. theta energy: -24.080 Dist. restrs. and SS energy: 5.557 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -604.567773 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.567773 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.722936 (E_RNA) where: Base-Base interactions energy: -438.269 where: short stacking energy: -166.435 Base-Backbone interact. energy: -0.000 local terms energy: -166.453558 where: bonds (distance) C4'-P energy: -23.169 bonds (distance) P-C4' energy: -31.860 flat angles C4'-P-C4' energy: -35.321 flat angles P-C4'-P energy: -24.211 tors. eta vs tors. theta energy: -51.892 Dist. restrs. and SS energy: 0.155 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -594.240049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.240049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.326119 (E_RNA) where: Base-Base interactions energy: -435.895 where: short stacking energy: -168.453 Base-Backbone interact. energy: -0.001 local terms energy: -158.430222 where: bonds (distance) C4'-P energy: -24.172 bonds (distance) P-C4' energy: -25.021 flat angles C4'-P-C4' energy: -35.482 flat angles P-C4'-P energy: -24.817 tors. eta vs tors. theta energy: -48.938 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -588.149339 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.149339 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.378584 (E_RNA) where: Base-Base interactions energy: -428.818 where: short stacking energy: -166.988 Base-Backbone interact. energy: -0.001 local terms energy: -159.559646 where: bonds (distance) C4'-P energy: -23.867 bonds (distance) P-C4' energy: -31.293 flat angles C4'-P-C4' energy: -30.434 flat angles P-C4'-P energy: -21.209 tors. eta vs tors. theta energy: -52.757 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -584.520473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.520473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.110436 (E_RNA) where: Base-Base interactions energy: -418.607 where: short stacking energy: -164.423 Base-Backbone interact. energy: -0.582 local terms energy: -165.921469 where: bonds (distance) C4'-P energy: -28.768 bonds (distance) P-C4' energy: -30.302 flat angles C4'-P-C4' energy: -31.995 flat angles P-C4'-P energy: -24.869 tors. eta vs tors. theta energy: -49.988 Dist. restrs. and SS energy: 0.590 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -571.511123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.511123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.129952 (E_RNA) where: Base-Base interactions energy: -417.068 where: short stacking energy: -159.931 Base-Backbone interact. energy: -0.001 local terms energy: -155.061166 where: bonds (distance) C4'-P energy: -24.045 bonds (distance) P-C4' energy: -28.754 flat angles C4'-P-C4' energy: -28.595 flat angles P-C4'-P energy: -24.531 tors. eta vs tors. theta energy: -49.137 Dist. restrs. and SS energy: 0.619 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -585.272297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.272297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.494434 (E_RNA) where: Base-Base interactions energy: -425.852 where: short stacking energy: -166.147 Base-Backbone interact. energy: -0.724 local terms energy: -158.917808 where: bonds (distance) C4'-P energy: -26.708 bonds (distance) P-C4' energy: -28.940 flat angles C4'-P-C4' energy: -32.304 flat angles P-C4'-P energy: -21.998 tors. eta vs tors. theta energy: -48.968 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -471.753160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.753160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.358690 (E_RNA) where: Base-Base interactions energy: -350.386 where: short stacking energy: -131.045 Base-Backbone interact. energy: 1.384 local terms energy: -127.356456 where: bonds (distance) C4'-P energy: -23.296 bonds (distance) P-C4' energy: -31.237 flat angles C4'-P-C4' energy: -22.839 flat angles P-C4'-P energy: -16.692 tors. eta vs tors. theta energy: -33.293 Dist. restrs. and SS energy: 4.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -478.002904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.002904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.765780 (E_RNA) where: Base-Base interactions energy: -357.710 where: short stacking energy: -136.086 Base-Backbone interact. energy: 2.374 local terms energy: -126.429686 where: bonds (distance) C4'-P energy: -22.467 bonds (distance) P-C4' energy: -21.239 flat angles C4'-P-C4' energy: -25.243 flat angles P-C4'-P energy: -19.613 tors. eta vs tors. theta energy: -37.867 Dist. restrs. and SS energy: 3.763 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -490.524843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.524843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.923503 (E_RNA) where: Base-Base interactions energy: -370.765 where: short stacking energy: -140.437 Base-Backbone interact. energy: 1.536 local terms energy: -123.694952 where: bonds (distance) C4'-P energy: -12.405 bonds (distance) P-C4' energy: -26.381 flat angles C4'-P-C4' energy: -28.106 flat angles P-C4'-P energy: -21.780 tors. eta vs tors. theta energy: -35.022 Dist. restrs. and SS energy: 2.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -373.589629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.589629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.108749 (E_RNA) where: Base-Base interactions energy: -271.956 where: short stacking energy: -97.282 Base-Backbone interact. energy: 4.707 local terms energy: -114.231525 where: bonds (distance) C4'-P energy: -20.438 bonds (distance) P-C4' energy: -19.704 flat angles C4'-P-C4' energy: -29.620 flat angles P-C4'-P energy: -19.749 tors. eta vs tors. theta energy: -24.721 Dist. restrs. and SS energy: 6.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.372 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -603.672760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.672760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.767567 (E_RNA) where: Base-Base interactions energy: -436.724 where: short stacking energy: -165.734 Base-Backbone interact. energy: -0.000 local terms energy: -167.042831 where: bonds (distance) C4'-P energy: -30.462 bonds (distance) P-C4' energy: -28.782 flat angles C4'-P-C4' energy: -32.978 flat angles P-C4'-P energy: -25.061 tors. eta vs tors. theta energy: -49.760 Dist. restrs. and SS energy: 0.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -599.131174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.131174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.213107 (E_RNA) where: Base-Base interactions energy: -431.986 where: short stacking energy: -160.165 Base-Backbone interact. energy: -0.001 local terms energy: -167.226735 where: bonds (distance) C4'-P energy: -26.815 bonds (distance) P-C4' energy: -31.909 flat angles C4'-P-C4' energy: -30.341 flat angles P-C4'-P energy: -26.439 tors. eta vs tors. theta energy: -51.724 Dist. restrs. and SS energy: 0.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -587.214847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.214847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.549250 (E_RNA) where: Base-Base interactions energy: -429.485 where: short stacking energy: -165.026 Base-Backbone interact. energy: -0.242 local terms energy: -157.822071 where: bonds (distance) C4'-P energy: -28.284 bonds (distance) P-C4' energy: -25.842 flat angles C4'-P-C4' energy: -31.759 flat angles P-C4'-P energy: -22.513 tors. eta vs tors. theta energy: -49.424 Dist. restrs. and SS energy: 0.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -566.623997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.623997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.056446 (E_RNA) where: Base-Base interactions energy: -421.606 where: short stacking energy: -159.384 Base-Backbone interact. energy: -0.004 local terms energy: -145.446785 where: bonds (distance) C4'-P energy: -25.699 bonds (distance) P-C4' energy: -25.803 flat angles C4'-P-C4' energy: -24.455 flat angles P-C4'-P energy: -22.492 tors. eta vs tors. theta energy: -46.998 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -579.919915 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.919915 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.241396 (E_RNA) where: Base-Base interactions energy: -415.040 where: short stacking energy: -163.539 Base-Backbone interact. energy: -0.001 local terms energy: -165.200975 where: bonds (distance) C4'-P energy: -27.757 bonds (distance) P-C4' energy: -32.327 flat angles C4'-P-C4' energy: -33.192 flat angles P-C4'-P energy: -21.710 tors. eta vs tors. theta energy: -50.216 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -576.343276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.343276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.724510 (E_RNA) where: Base-Base interactions energy: -427.788 where: short stacking energy: -163.476 Base-Backbone interact. energy: -0.003 local terms energy: -148.933022 where: bonds (distance) C4'-P energy: -21.420 bonds (distance) P-C4' energy: -29.896 flat angles C4'-P-C4' energy: -32.395 flat angles P-C4'-P energy: -16.409 tors. eta vs tors. theta energy: -48.813 Dist. restrs. and SS energy: 0.381 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -478.270573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.270573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.134701 (E_RNA) where: Base-Base interactions energy: -359.864 where: short stacking energy: -120.020 Base-Backbone interact. energy: 2.541 local terms energy: -125.811818 where: bonds (distance) C4'-P energy: -25.680 bonds (distance) P-C4' energy: -25.591 flat angles C4'-P-C4' energy: -24.038 flat angles P-C4'-P energy: -17.721 tors. eta vs tors. theta energy: -32.782 Dist. restrs. and SS energy: 4.864 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -493.934729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.934729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.122677 (E_RNA) where: Base-Base interactions energy: -367.314 where: short stacking energy: -133.350 Base-Backbone interact. energy: 1.032 local terms energy: -131.840959 where: bonds (distance) C4'-P energy: -26.967 bonds (distance) P-C4' energy: -17.767 flat angles C4'-P-C4' energy: -25.632 flat angles P-C4'-P energy: -23.501 tors. eta vs tors. theta energy: -37.974 Dist. restrs. and SS energy: 4.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -471.378228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.378228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.336846 (E_RNA) where: Base-Base interactions energy: -336.776 where: short stacking energy: -131.128 Base-Backbone interact. energy: -0.390 local terms energy: -137.170659 where: bonds (distance) C4'-P energy: -19.600 bonds (distance) P-C4' energy: -26.124 flat angles C4'-P-C4' energy: -34.152 flat angles P-C4'-P energy: -19.745 tors. eta vs tors. theta energy: -37.550 Dist. restrs. and SS energy: 2.959 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -414.448580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.448580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.250596 (E_RNA) where: Base-Base interactions energy: -306.123 where: short stacking energy: -109.484 Base-Backbone interact. energy: -0.389 local terms energy: -112.990418 where: bonds (distance) C4'-P energy: -21.280 bonds (distance) P-C4' energy: -21.041 flat angles C4'-P-C4' energy: -29.551 flat angles P-C4'-P energy: -13.978 tors. eta vs tors. theta energy: -27.140 Dist. restrs. and SS energy: 4.802 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.252 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -604.835505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.835505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.862974 (E_RNA) where: Base-Base interactions energy: -443.730 where: short stacking energy: -171.803 Base-Backbone interact. energy: -0.280 local terms energy: -160.853078 where: bonds (distance) C4'-P energy: -27.066 bonds (distance) P-C4' energy: -23.031 flat angles C4'-P-C4' energy: -33.297 flat angles P-C4'-P energy: -26.784 tors. eta vs tors. theta energy: -50.674 Dist. restrs. and SS energy: 0.027 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -602.665739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.665739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.825807 (E_RNA) where: Base-Base interactions energy: -436.864 where: short stacking energy: -169.960 Base-Backbone interact. energy: -0.000 local terms energy: -165.961031 where: bonds (distance) C4'-P energy: -29.889 bonds (distance) P-C4' energy: -26.711 flat angles C4'-P-C4' energy: -32.180 flat angles P-C4'-P energy: -25.459 tors. eta vs tors. theta energy: -51.723 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -585.663252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.663252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.812601 (E_RNA) where: Base-Base interactions energy: -426.496 where: short stacking energy: -159.556 Base-Backbone interact. energy: -0.086 local terms energy: -159.230090 where: bonds (distance) C4'-P energy: -26.206 bonds (distance) P-C4' energy: -30.043 flat angles C4'-P-C4' energy: -29.666 flat angles P-C4'-P energy: -23.430 tors. eta vs tors. theta energy: -49.885 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -584.877449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.877449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.069739 (E_RNA) where: Base-Base interactions energy: -433.138 where: short stacking energy: -165.733 Base-Backbone interact. energy: -0.245 local terms energy: -151.686000 where: bonds (distance) C4'-P energy: -26.467 bonds (distance) P-C4' energy: -26.493 flat angles C4'-P-C4' energy: -28.766 flat angles P-C4'-P energy: -20.735 tors. eta vs tors. theta energy: -49.225 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -571.730977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.730977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.976174 (E_RNA) where: Base-Base interactions energy: -430.515 where: short stacking energy: -166.573 Base-Backbone interact. energy: -0.056 local terms energy: -141.404858 where: bonds (distance) C4'-P energy: -14.589 bonds (distance) P-C4' energy: -25.853 flat angles C4'-P-C4' energy: -30.921 flat angles P-C4'-P energy: -20.153 tors. eta vs tors. theta energy: -49.890 Dist. restrs. and SS energy: 0.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -576.066116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.066116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.634477 (E_RNA) where: Base-Base interactions energy: -428.640 where: short stacking energy: -169.011 Base-Backbone interact. energy: -0.002 local terms energy: -147.992245 where: bonds (distance) C4'-P energy: -25.678 bonds (distance) P-C4' energy: -21.769 flat angles C4'-P-C4' energy: -31.231 flat angles P-C4'-P energy: -22.504 tors. eta vs tors. theta energy: -46.810 Dist. restrs. and SS energy: 0.568 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -495.295607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.295607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.121142 (E_RNA) where: Base-Base interactions energy: -382.575 where: short stacking energy: -148.126 Base-Backbone interact. energy: -0.339 local terms energy: -113.207009 where: bonds (distance) C4'-P energy: -15.720 bonds (distance) P-C4' energy: -23.186 flat angles C4'-P-C4' energy: -23.440 flat angles P-C4'-P energy: -14.300 tors. eta vs tors. theta energy: -36.561 Dist. restrs. and SS energy: 0.826 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -457.262586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.262586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.509110 (E_RNA) where: Base-Base interactions energy: -340.125 where: short stacking energy: -123.068 Base-Backbone interact. energy: -0.115 local terms energy: -118.269591 where: bonds (distance) C4'-P energy: -15.209 bonds (distance) P-C4' energy: -24.507 flat angles C4'-P-C4' energy: -28.134 flat angles P-C4'-P energy: -18.869 tors. eta vs tors. theta energy: -31.551 Dist. restrs. and SS energy: 1.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -458.744710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.744710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.481409 (E_RNA) where: Base-Base interactions energy: -350.940 where: short stacking energy: -125.796 Base-Backbone interact. energy: 1.176 local terms energy: -112.717907 where: bonds (distance) C4'-P energy: -16.198 bonds (distance) P-C4' energy: -22.978 flat angles C4'-P-C4' energy: -21.558 flat angles P-C4'-P energy: -18.211 tors. eta vs tors. theta energy: -33.772 Dist. restrs. and SS energy: 3.737 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -407.760679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.760679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.255585 (E_RNA) where: Base-Base interactions energy: -316.058 where: short stacking energy: -108.964 Base-Backbone interact. energy: 1.323 local terms energy: -97.520187 where: bonds (distance) C4'-P energy: -22.029 bonds (distance) P-C4' energy: -17.428 flat angles C4'-P-C4' energy: -25.887 flat angles P-C4'-P energy: -9.225 tors. eta vs tors. theta energy: -22.951 Dist. restrs. and SS energy: 4.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -605.154786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.154786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.341158 (E_RNA) where: Base-Base interactions energy: -442.457 where: short stacking energy: -166.827 Base-Backbone interact. energy: -0.001 local terms energy: -162.882887 where: bonds (distance) C4'-P energy: -24.681 bonds (distance) P-C4' energy: -30.425 flat angles C4'-P-C4' energy: -31.422 flat angles P-C4'-P energy: -26.641 tors. eta vs tors. theta energy: -49.714 Dist. restrs. and SS energy: 0.186 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -590.477721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.477721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.709948 (E_RNA) where: Base-Base interactions energy: -440.016 where: short stacking energy: -167.735 Base-Backbone interact. energy: -0.001 local terms energy: -150.693506 where: bonds (distance) C4'-P energy: -19.782 bonds (distance) P-C4' energy: -26.902 flat angles C4'-P-C4' energy: -31.615 flat angles P-C4'-P energy: -23.275 tors. eta vs tors. theta energy: -49.119 Dist. restrs. and SS energy: 0.232 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -583.444836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.444836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.035476 (E_RNA) where: Base-Base interactions energy: -430.209 where: short stacking energy: -168.237 Base-Backbone interact. energy: -0.005 local terms energy: -153.822058 where: bonds (distance) C4'-P energy: -25.481 bonds (distance) P-C4' energy: -23.706 flat angles C4'-P-C4' energy: -32.210 flat angles P-C4'-P energy: -21.998 tors. eta vs tors. theta energy: -50.427 Dist. restrs. and SS energy: 0.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -579.320123 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.320123 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.520127 (E_RNA) where: Base-Base interactions energy: -435.821 where: short stacking energy: -163.284 Base-Backbone interact. energy: -0.003 local terms energy: -143.696550 where: bonds (distance) C4'-P energy: -27.944 bonds (distance) P-C4' energy: -19.066 flat angles C4'-P-C4' energy: -30.613 flat angles P-C4'-P energy: -19.659 tors. eta vs tors. theta energy: -46.413 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -574.590590 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.590590 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.866050 (E_RNA) where: Base-Base interactions energy: -421.505 where: short stacking energy: -156.219 Base-Backbone interact. energy: -0.001 local terms energy: -153.360168 where: bonds (distance) C4'-P energy: -28.334 bonds (distance) P-C4' energy: -28.566 flat angles C4'-P-C4' energy: -28.308 flat angles P-C4'-P energy: -19.616 tors. eta vs tors. theta energy: -48.537 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -585.047243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.047243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.242048 (E_RNA) where: Base-Base interactions energy: -431.840 where: short stacking energy: -168.862 Base-Backbone interact. energy: -0.608 local terms energy: -152.793937 where: bonds (distance) C4'-P energy: -27.114 bonds (distance) P-C4' energy: -18.907 flat angles C4'-P-C4' energy: -33.100 flat angles P-C4'-P energy: -26.291 tors. eta vs tors. theta energy: -47.382 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -526.515049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.515049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.706799 (E_RNA) where: Base-Base interactions energy: -391.146 where: short stacking energy: -144.207 Base-Backbone interact. energy: 1.077 local terms energy: -136.638548 where: bonds (distance) C4'-P energy: -28.862 bonds (distance) P-C4' energy: -21.583 flat angles C4'-P-C4' energy: -27.075 flat angles P-C4'-P energy: -19.785 tors. eta vs tors. theta energy: -39.333 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -496.988249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.988249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.157640 (E_RNA) where: Base-Base interactions energy: -354.148 where: short stacking energy: -124.064 Base-Backbone interact. energy: 0.247 local terms energy: -144.256878 where: bonds (distance) C4'-P energy: -26.541 bonds (distance) P-C4' energy: -31.541 flat angles C4'-P-C4' energy: -26.075 flat angles P-C4'-P energy: -21.555 tors. eta vs tors. theta energy: -38.545 Dist. restrs. and SS energy: 1.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -455.489240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.489240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.635722 (E_RNA) where: Base-Base interactions energy: -342.678 where: short stacking energy: -124.735 Base-Backbone interact. energy: -0.703 local terms energy: -115.254240 where: bonds (distance) C4'-P energy: -22.893 bonds (distance) P-C4' energy: -19.772 flat angles C4'-P-C4' energy: -21.700 flat angles P-C4'-P energy: -20.432 tors. eta vs tors. theta energy: -30.457 Dist. restrs. and SS energy: 3.146 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -401.124188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.124188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.222148 (E_RNA) where: Base-Base interactions energy: -291.334 where: short stacking energy: -98.543 Base-Backbone interact. energy: 0.943 local terms energy: -114.831138 where: bonds (distance) C4'-P energy: -27.258 bonds (distance) P-C4' energy: -24.589 flat angles C4'-P-C4' energy: -18.688 flat angles P-C4'-P energy: -18.739 tors. eta vs tors. theta energy: -25.557 Dist. restrs. and SS energy: 4.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -595.986112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.986112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.207767 (E_RNA) where: Base-Base interactions energy: -435.881 where: short stacking energy: -162.463 Base-Backbone interact. energy: -0.042 local terms energy: -160.285176 where: bonds (distance) C4'-P energy: -31.593 bonds (distance) P-C4' energy: -25.313 flat angles C4'-P-C4' energy: -28.156 flat angles P-C4'-P energy: -26.641 tors. eta vs tors. theta energy: -48.583 Dist. restrs. and SS energy: 0.222 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -597.963984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.963984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.124745 (E_RNA) where: Base-Base interactions energy: -436.194 where: short stacking energy: -171.348 Base-Backbone interact. energy: -0.001 local terms energy: -161.930154 where: bonds (distance) C4'-P energy: -28.818 bonds (distance) P-C4' energy: -24.243 flat angles C4'-P-C4' energy: -34.068 flat angles P-C4'-P energy: -24.824 tors. eta vs tors. theta energy: -49.976 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -591.219209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.219209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.483237 (E_RNA) where: Base-Base interactions energy: -423.363 where: short stacking energy: -167.386 Base-Backbone interact. energy: -0.001 local terms energy: -168.119933 where: bonds (distance) C4'-P energy: -30.549 bonds (distance) P-C4' energy: -23.604 flat angles C4'-P-C4' energy: -36.106 flat angles P-C4'-P energy: -24.564 tors. eta vs tors. theta energy: -53.297 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -580.638572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.638572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.196901 (E_RNA) where: Base-Base interactions energy: -426.863 where: short stacking energy: -164.896 Base-Backbone interact. energy: 0.289 local terms energy: -154.623359 where: bonds (distance) C4'-P energy: -25.551 bonds (distance) P-C4' energy: -27.184 flat angles C4'-P-C4' energy: -28.292 flat angles P-C4'-P energy: -24.127 tors. eta vs tors. theta energy: -49.470 Dist. restrs. and SS energy: 0.558 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -577.682194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.682194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.839439 (E_RNA) where: Base-Base interactions energy: -430.038 where: short stacking energy: -161.871 Base-Backbone interact. energy: -0.001 local terms energy: -147.800327 where: bonds (distance) C4'-P energy: -25.824 bonds (distance) P-C4' energy: -26.202 flat angles C4'-P-C4' energy: -23.719 flat angles P-C4'-P energy: -24.872 tors. eta vs tors. theta energy: -47.183 Dist. restrs. and SS energy: 0.157 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -579.887751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.887751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.215800 (E_RNA) where: Base-Base interactions energy: -422.135 where: short stacking energy: -161.217 Base-Backbone interact. energy: -0.004 local terms energy: -158.076378 where: bonds (distance) C4'-P energy: -24.653 bonds (distance) P-C4' energy: -27.650 flat angles C4'-P-C4' energy: -33.264 flat angles P-C4'-P energy: -22.713 tors. eta vs tors. theta energy: -49.797 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -507.859991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.859991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.821791 (E_RNA) where: Base-Base interactions energy: -380.069 where: short stacking energy: -146.364 Base-Backbone interact. energy: 1.071 local terms energy: -130.823897 where: bonds (distance) C4'-P energy: -19.590 bonds (distance) P-C4' energy: -23.932 flat angles C4'-P-C4' energy: -30.042 flat angles P-C4'-P energy: -18.127 tors. eta vs tors. theta energy: -39.134 Dist. restrs. and SS energy: 1.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -487.935504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.935504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.995253 (E_RNA) where: Base-Base interactions energy: -358.182 where: short stacking energy: -135.340 Base-Backbone interact. energy: -0.156 local terms energy: -131.657449 where: bonds (distance) C4'-P energy: -24.417 bonds (distance) P-C4' energy: -28.146 flat angles C4'-P-C4' energy: -23.916 flat angles P-C4'-P energy: -18.201 tors. eta vs tors. theta energy: -36.979 Dist. restrs. and SS energy: 2.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -424.608802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.608802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.647241 (E_RNA) where: Base-Base interactions energy: -321.724 where: short stacking energy: -106.539 Base-Backbone interact. energy: 1.176 local terms energy: -111.110972 where: bonds (distance) C4'-P energy: -23.187 bonds (distance) P-C4' energy: -23.753 flat angles C4'-P-C4' energy: -23.261 flat angles P-C4'-P energy: -17.764 tors. eta vs tors. theta energy: -23.147 Dist. restrs. and SS energy: 7.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.012 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -440.881977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.881977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.970185 (E_RNA) where: Base-Base interactions energy: -323.612 where: short stacking energy: -118.458 Base-Backbone interact. energy: 1.084 local terms energy: -122.441896 where: bonds (distance) C4'-P energy: -26.253 bonds (distance) P-C4' energy: -17.688 flat angles C4'-P-C4' energy: -25.301 flat angles P-C4'-P energy: -17.120 tors. eta vs tors. theta energy: -36.079 Dist. restrs. and SS energy: 4.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -600.502949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.502949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.716636 (E_RNA) where: Base-Base interactions energy: -437.947 where: short stacking energy: -167.777 Base-Backbone interact. energy: -0.001 local terms energy: -162.768797 where: bonds (distance) C4'-P energy: -27.667 bonds (distance) P-C4' energy: -28.816 flat angles C4'-P-C4' energy: -34.466 flat angles P-C4'-P energy: -21.593 tors. eta vs tors. theta energy: -50.227 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -588.226759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.226759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.620551 (E_RNA) where: Base-Base interactions energy: -423.095 where: short stacking energy: -161.341 Base-Backbone interact. energy: -0.001 local terms energy: -165.525039 where: bonds (distance) C4'-P energy: -25.098 bonds (distance) P-C4' energy: -30.053 flat angles C4'-P-C4' energy: -31.581 flat angles P-C4'-P energy: -29.352 tors. eta vs tors. theta energy: -49.442 Dist. restrs. and SS energy: 0.394 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -586.158594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.158594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.671379 (E_RNA) where: Base-Base interactions energy: -435.881 where: short stacking energy: -168.241 Base-Backbone interact. energy: -0.050 local terms energy: -150.739984 where: bonds (distance) C4'-P energy: -27.382 bonds (distance) P-C4' energy: -22.853 flat angles C4'-P-C4' energy: -26.064 flat angles P-C4'-P energy: -24.230 tors. eta vs tors. theta energy: -50.210 Dist. restrs. and SS energy: 0.513 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -582.599283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.599283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.841849 (E_RNA) where: Base-Base interactions energy: -419.132 where: short stacking energy: -160.334 Base-Backbone interact. energy: -0.001 local terms energy: -163.709512 where: bonds (distance) C4'-P energy: -28.871 bonds (distance) P-C4' energy: -30.118 flat angles C4'-P-C4' energy: -32.018 flat angles P-C4'-P energy: -23.435 tors. eta vs tors. theta energy: -49.267 Dist. restrs. and SS energy: 0.243 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -564.190754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.190754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.425061 (E_RNA) where: Base-Base interactions energy: -422.952 where: short stacking energy: -166.054 Base-Backbone interact. energy: -0.001 local terms energy: -141.471459 where: bonds (distance) C4'-P energy: -16.786 bonds (distance) P-C4' energy: -25.527 flat angles C4'-P-C4' energy: -30.397 flat angles P-C4'-P energy: -24.039 tors. eta vs tors. theta energy: -44.722 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -572.405010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.405010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.837276 (E_RNA) where: Base-Base interactions energy: -418.074 where: short stacking energy: -161.843 Base-Backbone interact. energy: -0.000 local terms energy: -154.762765 where: bonds (distance) C4'-P energy: -27.739 bonds (distance) P-C4' energy: -28.763 flat angles C4'-P-C4' energy: -32.181 flat angles P-C4'-P energy: -17.394 tors. eta vs tors. theta energy: -48.687 Dist. restrs. and SS energy: 0.432 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -490.337878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.337878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.240608 (E_RNA) where: Base-Base interactions energy: -361.644 where: short stacking energy: -131.480 Base-Backbone interact. energy: 0.287 local terms energy: -130.883453 where: bonds (distance) C4'-P energy: -20.853 bonds (distance) P-C4' energy: -28.935 flat angles C4'-P-C4' energy: -25.824 flat angles P-C4'-P energy: -20.529 tors. eta vs tors. theta energy: -34.742 Dist. restrs. and SS energy: 1.903 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -496.593502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.593502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.120860 (E_RNA) where: Base-Base interactions energy: -362.401 where: short stacking energy: -128.607 Base-Backbone interact. energy: -0.374 local terms energy: -135.345412 where: bonds (distance) C4'-P energy: -23.890 bonds (distance) P-C4' energy: -22.347 flat angles C4'-P-C4' energy: -32.437 flat angles P-C4'-P energy: -19.545 tors. eta vs tors. theta energy: -37.126 Dist. restrs. and SS energy: 1.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -444.096555 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.096555 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.117272 (E_RNA) where: Base-Base interactions energy: -334.337 where: short stacking energy: -123.729 Base-Backbone interact. energy: -0.558 local terms energy: -114.222227 where: bonds (distance) C4'-P energy: -22.103 bonds (distance) P-C4' energy: -17.962 flat angles C4'-P-C4' energy: -27.215 flat angles P-C4'-P energy: -13.467 tors. eta vs tors. theta energy: -33.475 Dist. restrs. and SS energy: 5.021 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -441.843818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.843818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.931386 (E_RNA) where: Base-Base interactions energy: -324.071 where: short stacking energy: -117.317 Base-Backbone interact. energy: 1.829 local terms energy: -124.688838 where: bonds (distance) C4'-P energy: -20.589 bonds (distance) P-C4' energy: -28.480 flat angles C4'-P-C4' energy: -23.606 flat angles P-C4'-P energy: -18.517 tors. eta vs tors. theta energy: -33.498 Dist. restrs. and SS energy: 5.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -602.472966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.472966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.790204 (E_RNA) where: Base-Base interactions energy: -430.924 where: short stacking energy: -167.378 Base-Backbone interact. energy: -0.156 local terms energy: -171.709916 where: bonds (distance) C4'-P energy: -26.838 bonds (distance) P-C4' energy: -31.700 flat angles C4'-P-C4' energy: -34.827 flat angles P-C4'-P energy: -28.224 tors. eta vs tors. theta energy: -50.121 Dist. restrs. and SS energy: 0.317 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -606.519881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.519881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.631742 (E_RNA) where: Base-Base interactions energy: -445.264 where: short stacking energy: -175.563 Base-Backbone interact. energy: -0.001 local terms energy: -161.366916 where: bonds (distance) C4'-P energy: -31.663 bonds (distance) P-C4' energy: -25.238 flat angles C4'-P-C4' energy: -35.777 flat angles P-C4'-P energy: -20.457 tors. eta vs tors. theta energy: -48.231 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -584.635454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.635454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.750079 (E_RNA) where: Base-Base interactions energy: -431.832 where: short stacking energy: -174.043 Base-Backbone interact. energy: -0.166 local terms energy: -152.752452 where: bonds (distance) C4'-P energy: -26.239 bonds (distance) P-C4' energy: -26.724 flat angles C4'-P-C4' energy: -32.186 flat angles P-C4'-P energy: -20.852 tors. eta vs tors. theta energy: -46.752 Dist. restrs. and SS energy: 0.115 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -593.219027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.219027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.356753 (E_RNA) where: Base-Base interactions energy: -435.850 where: short stacking energy: -169.459 Base-Backbone interact. energy: -0.004 local terms energy: -157.502335 where: bonds (distance) C4'-P energy: -23.673 bonds (distance) P-C4' energy: -28.826 flat angles C4'-P-C4' energy: -32.766 flat angles P-C4'-P energy: -22.263 tors. eta vs tors. theta energy: -49.973 Dist. restrs. and SS energy: 0.138 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -591.732820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.732820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.091381 (E_RNA) where: Base-Base interactions energy: -431.349 where: short stacking energy: -165.800 Base-Backbone interact. energy: -0.000 local terms energy: -160.741911 where: bonds (distance) C4'-P energy: -27.023 bonds (distance) P-C4' energy: -28.033 flat angles C4'-P-C4' energy: -32.080 flat angles P-C4'-P energy: -24.379 tors. eta vs tors. theta energy: -49.228 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -558.327622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.327622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.112813 (E_RNA) where: Base-Base interactions energy: -404.419 where: short stacking energy: -153.946 Base-Backbone interact. energy: -0.001 local terms energy: -155.014724 where: bonds (distance) C4'-P energy: -29.522 bonds (distance) P-C4' energy: -24.952 flat angles C4'-P-C4' energy: -30.397 flat angles P-C4'-P energy: -22.357 tors. eta vs tors. theta energy: -47.786 Dist. restrs. and SS energy: 0.785 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.322 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -516.479973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.479973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.145077 (E_RNA) where: Base-Base interactions energy: -388.698 where: short stacking energy: -142.338 Base-Backbone interact. energy: -0.131 local terms energy: -128.315721 where: bonds (distance) C4'-P energy: -19.171 bonds (distance) P-C4' energy: -29.555 flat angles C4'-P-C4' energy: -29.168 flat angles P-C4'-P energy: -13.395 tors. eta vs tors. theta energy: -37.027 Dist. restrs. and SS energy: 0.665 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -490.269793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.269793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.211083 (E_RNA) where: Base-Base interactions energy: -366.163 where: short stacking energy: -137.555 Base-Backbone interact. energy: 0.113 local terms energy: -126.161098 where: bonds (distance) C4'-P energy: -25.238 bonds (distance) P-C4' energy: -19.692 flat angles C4'-P-C4' energy: -25.961 flat angles P-C4'-P energy: -20.021 tors. eta vs tors. theta energy: -35.248 Dist. restrs. and SS energy: 1.941 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -495.658260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.658260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.321592 (E_RNA) where: Base-Base interactions energy: -371.492 where: short stacking energy: -137.383 Base-Backbone interact. energy: -0.939 local terms energy: -124.890165 where: bonds (distance) C4'-P energy: -19.369 bonds (distance) P-C4' energy: -18.436 flat angles C4'-P-C4' energy: -28.176 flat angles P-C4'-P energy: -20.873 tors. eta vs tors. theta energy: -38.036 Dist. restrs. and SS energy: 1.663 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -438.454541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.454541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.103565 (E_RNA) where: Base-Base interactions energy: -317.360 where: short stacking energy: -118.952 Base-Backbone interact. energy: -0.067 local terms energy: -126.676830 where: bonds (distance) C4'-P energy: -30.656 bonds (distance) P-C4' energy: -22.387 flat angles C4'-P-C4' energy: -23.537 flat angles P-C4'-P energy: -16.344 tors. eta vs tors. theta energy: -33.753 Dist. restrs. and SS energy: 5.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -602.861601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.861601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.182051 (E_RNA) where: Base-Base interactions energy: -436.364 where: short stacking energy: -164.689 Base-Backbone interact. energy: 0.359 local terms energy: -167.176406 where: bonds (distance) C4'-P energy: -26.086 bonds (distance) P-C4' energy: -30.343 flat angles C4'-P-C4' energy: -33.365 flat angles P-C4'-P energy: -27.858 tors. eta vs tors. theta energy: -49.525 Dist. restrs. and SS energy: 0.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -596.277161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.277161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.464801 (E_RNA) where: Base-Base interactions energy: -432.376 where: short stacking energy: -167.266 Base-Backbone interact. energy: -0.002 local terms energy: -164.086964 where: bonds (distance) C4'-P energy: -26.157 bonds (distance) P-C4' energy: -31.851 flat angles C4'-P-C4' energy: -30.795 flat angles P-C4'-P energy: -23.573 tors. eta vs tors. theta energy: -51.710 Dist. restrs. and SS energy: 0.188 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -587.385218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.385218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.181915 (E_RNA) where: Base-Base interactions energy: -433.143 where: short stacking energy: -168.716 Base-Backbone interact. energy: -0.000 local terms energy: -155.038801 where: bonds (distance) C4'-P energy: -27.377 bonds (distance) P-C4' energy: -25.601 flat angles C4'-P-C4' energy: -33.823 flat angles P-C4'-P energy: -20.743 tors. eta vs tors. theta energy: -47.495 Dist. restrs. and SS energy: 0.797 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -582.639493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.639493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.204107 (E_RNA) where: Base-Base interactions energy: -422.344 where: short stacking energy: -164.384 Base-Backbone interact. energy: -0.577 local terms energy: -160.282638 where: bonds (distance) C4'-P energy: -22.362 bonds (distance) P-C4' energy: -25.345 flat angles C4'-P-C4' energy: -35.221 flat angles P-C4'-P energy: -27.084 tors. eta vs tors. theta energy: -50.270 Dist. restrs. and SS energy: 0.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -571.712525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.712525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.007950 (E_RNA) where: Base-Base interactions energy: -432.252 where: short stacking energy: -165.535 Base-Backbone interact. energy: -0.000 local terms energy: -140.220554 where: bonds (distance) C4'-P energy: -19.443 bonds (distance) P-C4' energy: -19.256 flat angles C4'-P-C4' energy: -33.121 flat angles P-C4'-P energy: -21.250 tors. eta vs tors. theta energy: -47.150 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.465 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -572.647890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.647890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.690689 (E_RNA) where: Base-Base interactions energy: -421.503 where: short stacking energy: -162.693 Base-Backbone interact. energy: -0.001 local terms energy: -151.186554 where: bonds (distance) C4'-P energy: -24.891 bonds (distance) P-C4' energy: -29.467 flat angles C4'-P-C4' energy: -27.310 flat angles P-C4'-P energy: -21.981 tors. eta vs tors. theta energy: -47.538 Dist. restrs. and SS energy: 0.043 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -517.509629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.509629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.271436 (E_RNA) where: Base-Base interactions energy: -384.775 where: short stacking energy: -143.524 Base-Backbone interact. energy: 3.219 local terms energy: -136.715408 where: bonds (distance) C4'-P energy: -27.402 bonds (distance) P-C4' energy: -23.142 flat angles C4'-P-C4' energy: -30.657 flat angles P-C4'-P energy: -16.348 tors. eta vs tors. theta energy: -39.167 Dist. restrs. and SS energy: 0.762 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -508.225293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -508.225293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.715138 (E_RNA) where: Base-Base interactions energy: -383.540 where: short stacking energy: -141.439 Base-Backbone interact. energy: -0.548 local terms energy: -124.627172 where: bonds (distance) C4'-P energy: -15.569 bonds (distance) P-C4' energy: -21.233 flat angles C4'-P-C4' energy: -31.331 flat angles P-C4'-P energy: -16.920 tors. eta vs tors. theta energy: -39.574 Dist. restrs. and SS energy: 0.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -480.333250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.333250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.357970 (E_RNA) where: Base-Base interactions energy: -368.366 where: short stacking energy: -137.678 Base-Backbone interact. energy: -0.249 local terms energy: -118.743378 where: bonds (distance) C4'-P energy: -21.808 bonds (distance) P-C4' energy: -22.414 flat angles C4'-P-C4' energy: -23.770 flat angles P-C4'-P energy: -15.309 tors. eta vs tors. theta energy: -35.441 Dist. restrs. and SS energy: 7.025 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -450.822688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.822688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.631412 (E_RNA) where: Base-Base interactions energy: -326.886 where: short stacking energy: -122.922 Base-Backbone interact. energy: -0.019 local terms energy: -126.727002 where: bonds (distance) C4'-P energy: -20.543 bonds (distance) P-C4' energy: -28.362 flat angles C4'-P-C4' energy: -24.058 flat angles P-C4'-P energy: -21.148 tors. eta vs tors. theta energy: -32.617 Dist. restrs. and SS energy: 2.809 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -604.749850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.749850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.811837 (E_RNA) where: Base-Base interactions energy: -434.835 where: short stacking energy: -165.183 Base-Backbone interact. energy: -0.003 local terms energy: -169.973409 where: bonds (distance) C4'-P energy: -27.461 bonds (distance) P-C4' energy: -29.599 flat angles C4'-P-C4' energy: -35.378 flat angles P-C4'-P energy: -27.250 tors. eta vs tors. theta energy: -50.285 Dist. restrs. and SS energy: 0.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -606.967173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.967173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.516320 (E_RNA) where: Base-Base interactions energy: -448.984 where: short stacking energy: -175.848 Base-Backbone interact. energy: -0.000 local terms energy: -158.531603 where: bonds (distance) C4'-P energy: -22.459 bonds (distance) P-C4' energy: -27.639 flat angles C4'-P-C4' energy: -32.079 flat angles P-C4'-P energy: -26.052 tors. eta vs tors. theta energy: -50.302 Dist. restrs. and SS energy: 0.549 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -587.415354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.415354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.781044 (E_RNA) where: Base-Base interactions energy: -428.175 where: short stacking energy: -162.538 Base-Backbone interact. energy: -0.867 local terms energy: -158.739216 where: bonds (distance) C4'-P energy: -30.386 bonds (distance) P-C4' energy: -18.660 flat angles C4'-P-C4' energy: -34.586 flat angles P-C4'-P energy: -24.182 tors. eta vs tors. theta energy: -50.925 Dist. restrs. and SS energy: 0.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -584.067175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.067175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.367460 (E_RNA) where: Base-Base interactions energy: -431.356 where: short stacking energy: -160.151 Base-Backbone interact. energy: -0.002 local terms energy: -153.009238 where: bonds (distance) C4'-P energy: -24.112 bonds (distance) P-C4' energy: -29.174 flat angles C4'-P-C4' energy: -28.417 flat angles P-C4'-P energy: -22.193 tors. eta vs tors. theta energy: -49.114 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -571.485164 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.485164 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.721732 (E_RNA) where: Base-Base interactions energy: -421.847 where: short stacking energy: -160.500 Base-Backbone interact. energy: -0.000 local terms energy: -149.873992 where: bonds (distance) C4'-P energy: -27.481 bonds (distance) P-C4' energy: -22.042 flat angles C4'-P-C4' energy: -30.537 flat angles P-C4'-P energy: -22.724 tors. eta vs tors. theta energy: -47.091 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -574.519936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.519936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.029764 (E_RNA) where: Base-Base interactions energy: -425.238 where: short stacking energy: -165.092 Base-Backbone interact. energy: -0.000 local terms energy: -151.242490 where: bonds (distance) C4'-P energy: -23.338 bonds (distance) P-C4' energy: -26.261 flat angles C4'-P-C4' energy: -30.964 flat angles P-C4'-P energy: -22.871 tors. eta vs tors. theta energy: -47.809 Dist. restrs. and SS energy: 0.510 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.451 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -529.484103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.484103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.457103 (E_RNA) where: Base-Base interactions energy: -383.936 where: short stacking energy: -137.913 Base-Backbone interact. energy: -0.832 local terms energy: -145.690031 where: bonds (distance) C4'-P energy: -23.770 bonds (distance) P-C4' energy: -30.821 flat angles C4'-P-C4' energy: -31.165 flat angles P-C4'-P energy: -18.239 tors. eta vs tors. theta energy: -41.695 Dist. restrs. and SS energy: 0.973 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -498.988977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.988977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.060210 (E_RNA) where: Base-Base interactions energy: -364.110 where: short stacking energy: -132.488 Base-Backbone interact. energy: -0.284 local terms energy: -135.666539 where: bonds (distance) C4'-P energy: -23.996 bonds (distance) P-C4' energy: -26.724 flat angles C4'-P-C4' energy: -23.168 flat angles P-C4'-P energy: -22.577 tors. eta vs tors. theta energy: -39.202 Dist. restrs. and SS energy: 1.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -488.737857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.737857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.492026 (E_RNA) where: Base-Base interactions energy: -369.623 where: short stacking energy: -142.891 Base-Backbone interact. energy: -0.152 local terms energy: -119.717521 where: bonds (distance) C4'-P energy: -21.308 bonds (distance) P-C4' energy: -16.269 flat angles C4'-P-C4' energy: -29.097 flat angles P-C4'-P energy: -19.311 tors. eta vs tors. theta energy: -33.732 Dist. restrs. and SS energy: 0.754 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -404.714999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.714999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.671852 (E_RNA) where: Base-Base interactions energy: -301.531 where: short stacking energy: -113.242 Base-Backbone interact. energy: 2.318 local terms energy: -111.459182 where: bonds (distance) C4'-P energy: -17.349 bonds (distance) P-C4' energy: -19.295 flat angles C4'-P-C4' energy: -27.080 flat angles P-C4'-P energy: -16.786 tors. eta vs tors. theta energy: -30.950 Dist. restrs. and SS energy: 5.957 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -598.036681 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.036681 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.190052 (E_RNA) where: Base-Base interactions energy: -433.439 where: short stacking energy: -167.510 Base-Backbone interact. energy: -0.292 local terms energy: -164.459413 where: bonds (distance) C4'-P energy: -28.667 bonds (distance) P-C4' energy: -27.153 flat angles C4'-P-C4' energy: -34.244 flat angles P-C4'-P energy: -24.342 tors. eta vs tors. theta energy: -50.053 Dist. restrs. and SS energy: 0.153 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -602.806024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.806024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.154347 (E_RNA) where: Base-Base interactions energy: -434.683 where: short stacking energy: -159.511 Base-Backbone interact. energy: -0.000 local terms energy: -168.848169 where: bonds (distance) C4'-P energy: -30.714 bonds (distance) P-C4' energy: -27.568 flat angles C4'-P-C4' energy: -33.905 flat angles P-C4'-P energy: -25.063 tors. eta vs tors. theta energy: -51.598 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.377 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -593.653275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.653275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.886658 (E_RNA) where: Base-Base interactions energy: -436.806 where: short stacking energy: -166.520 Base-Backbone interact. energy: -0.003 local terms energy: -157.078275 where: bonds (distance) C4'-P energy: -29.290 bonds (distance) P-C4' energy: -24.528 flat angles C4'-P-C4' energy: -33.299 flat angles P-C4'-P energy: -22.080 tors. eta vs tors. theta energy: -47.881 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -575.970926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.970926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.079811 (E_RNA) where: Base-Base interactions energy: -429.336 where: short stacking energy: -162.983 Base-Backbone interact. energy: -0.156 local terms energy: -146.587874 where: bonds (distance) C4'-P energy: -18.344 bonds (distance) P-C4' energy: -26.165 flat angles C4'-P-C4' energy: -32.173 flat angles P-C4'-P energy: -20.514 tors. eta vs tors. theta energy: -49.393 Dist. restrs. and SS energy: 0.109 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -588.706418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.706418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.003895 (E_RNA) where: Base-Base interactions energy: -433.566 where: short stacking energy: -167.236 Base-Backbone interact. energy: -0.045 local terms energy: -155.393072 where: bonds (distance) C4'-P energy: -22.210 bonds (distance) P-C4' energy: -26.481 flat angles C4'-P-C4' energy: -31.931 flat angles P-C4'-P energy: -25.015 tors. eta vs tors. theta energy: -49.755 Dist. restrs. and SS energy: 0.297 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -567.356983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.356983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.631397 (E_RNA) where: Base-Base interactions energy: -421.300 where: short stacking energy: -157.816 Base-Backbone interact. energy: -0.012 local terms energy: -146.967952 where: bonds (distance) C4'-P energy: -17.164 bonds (distance) P-C4' energy: -32.549 flat angles C4'-P-C4' energy: -30.000 flat angles P-C4'-P energy: -19.832 tors. eta vs tors. theta energy: -47.422 Dist. restrs. and SS energy: 0.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.649 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -526.118465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.118465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -526.697696 (E_RNA) where: Base-Base interactions energy: -390.141 where: short stacking energy: -145.698 Base-Backbone interact. energy: -0.372 local terms energy: -136.184605 where: bonds (distance) C4'-P energy: -21.925 bonds (distance) P-C4' energy: -26.657 flat angles C4'-P-C4' energy: -28.126 flat angles P-C4'-P energy: -21.904 tors. eta vs tors. theta energy: -37.573 Dist. restrs. and SS energy: 0.579 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -515.481114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.481114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.262282 (E_RNA) where: Base-Base interactions energy: -387.471 where: short stacking energy: -145.800 Base-Backbone interact. energy: 2.096 local terms energy: -136.887266 where: bonds (distance) C4'-P energy: -13.823 bonds (distance) P-C4' energy: -32.744 flat angles C4'-P-C4' energy: -28.399 flat angles P-C4'-P energy: -24.072 tors. eta vs tors. theta energy: -37.850 Dist. restrs. and SS energy: 6.781 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -479.463042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.463042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.256432 (E_RNA) where: Base-Base interactions energy: -353.508 where: short stacking energy: -132.770 Base-Backbone interact. energy: 1.983 local terms energy: -130.731910 where: bonds (distance) C4'-P energy: -14.683 bonds (distance) P-C4' energy: -27.979 flat angles C4'-P-C4' energy: -28.064 flat angles P-C4'-P energy: -23.494 tors. eta vs tors. theta energy: -36.512 Dist. restrs. and SS energy: 2.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -401.273221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.273221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.767683 (E_RNA) where: Base-Base interactions energy: -289.096 where: short stacking energy: -118.306 Base-Backbone interact. energy: -0.419 local terms energy: -120.252583 where: bonds (distance) C4'-P energy: -18.702 bonds (distance) P-C4' energy: -26.864 flat angles C4'-P-C4' energy: -22.527 flat angles P-C4'-P energy: -18.077 tors. eta vs tors. theta energy: -34.083 Dist. restrs. and SS energy: 8.494 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -594.008938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.008938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.174260 (E_RNA) where: Base-Base interactions energy: -428.117 where: short stacking energy: -164.367 Base-Backbone interact. energy: -0.002 local terms energy: -166.055731 where: bonds (distance) C4'-P energy: -25.056 bonds (distance) P-C4' energy: -33.675 flat angles C4'-P-C4' energy: -32.368 flat angles P-C4'-P energy: -25.949 tors. eta vs tors. theta energy: -49.008 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -593.289244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.289244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.566047 (E_RNA) where: Base-Base interactions energy: -430.788 where: short stacking energy: -169.962 Base-Backbone interact. energy: -0.000 local terms energy: -162.777812 where: bonds (distance) C4'-P energy: -28.981 bonds (distance) P-C4' energy: -26.607 flat angles C4'-P-C4' energy: -33.908 flat angles P-C4'-P energy: -24.148 tors. eta vs tors. theta energy: -49.134 Dist. restrs. and SS energy: 0.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -583.835216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.835216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.206038 (E_RNA) where: Base-Base interactions energy: -431.591 where: short stacking energy: -162.878 Base-Backbone interact. energy: -0.041 local terms energy: -152.573932 where: bonds (distance) C4'-P energy: -23.856 bonds (distance) P-C4' energy: -30.966 flat angles C4'-P-C4' energy: -28.904 flat angles P-C4'-P energy: -23.131 tors. eta vs tors. theta energy: -45.718 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -578.846244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.846244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.427110 (E_RNA) where: Base-Base interactions energy: -413.987 where: short stacking energy: -160.243 Base-Backbone interact. energy: -0.413 local terms energy: -165.027525 where: bonds (distance) C4'-P energy: -24.453 bonds (distance) P-C4' energy: -28.028 flat angles C4'-P-C4' energy: -35.599 flat angles P-C4'-P energy: -25.586 tors. eta vs tors. theta energy: -51.361 Dist. restrs. and SS energy: 0.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -567.787137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.787137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.268758 (E_RNA) where: Base-Base interactions energy: -416.889 where: short stacking energy: -161.903 Base-Backbone interact. energy: -0.284 local terms energy: -151.829336 where: bonds (distance) C4'-P energy: -27.881 bonds (distance) P-C4' energy: -31.526 flat angles C4'-P-C4' energy: -26.889 flat angles P-C4'-P energy: -16.548 tors. eta vs tors. theta energy: -48.985 Dist. restrs. and SS energy: 0.482 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.734 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -571.383900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.383900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.550880 (E_RNA) where: Base-Base interactions energy: -419.063 where: short stacking energy: -165.067 Base-Backbone interact. energy: -0.001 local terms energy: -152.487167 where: bonds (distance) C4'-P energy: -22.234 bonds (distance) P-C4' energy: -26.239 flat angles C4'-P-C4' energy: -31.900 flat angles P-C4'-P energy: -21.095 tors. eta vs tors. theta energy: -51.019 Dist. restrs. and SS energy: 0.167 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -511.705079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.705079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.477428 (E_RNA) where: Base-Base interactions energy: -389.860 where: short stacking energy: -149.871 Base-Backbone interact. energy: 1.938 local terms energy: -124.555457 where: bonds (distance) C4'-P energy: -22.238 bonds (distance) P-C4' energy: -20.150 flat angles C4'-P-C4' energy: -27.684 flat angles P-C4'-P energy: -16.551 tors. eta vs tors. theta energy: -37.932 Dist. restrs. and SS energy: 0.772 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -518.527986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.527986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.751325 (E_RNA) where: Base-Base interactions energy: -379.236 where: short stacking energy: -136.025 Base-Backbone interact. energy: -0.441 local terms energy: -139.074544 where: bonds (distance) C4'-P energy: -28.429 bonds (distance) P-C4' energy: -25.571 flat angles C4'-P-C4' energy: -24.732 flat angles P-C4'-P energy: -17.949 tors. eta vs tors. theta energy: -42.394 Dist. restrs. and SS energy: 0.223 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -493.756153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.756153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.896711 (E_RNA) where: Base-Base interactions energy: -372.636 where: short stacking energy: -132.072 Base-Backbone interact. energy: -0.034 local terms energy: -121.226707 where: bonds (distance) C4'-P energy: -17.469 bonds (distance) P-C4' energy: -26.099 flat angles C4'-P-C4' energy: -21.020 flat angles P-C4'-P energy: -18.978 tors. eta vs tors. theta energy: -37.660 Dist. restrs. and SS energy: 0.141 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -411.258889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.258889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.442364 (E_RNA) where: Base-Base interactions energy: -322.493 where: short stacking energy: -119.241 Base-Backbone interact. energy: -0.202 local terms energy: -91.746720 where: bonds (distance) C4'-P energy: -11.309 bonds (distance) P-C4' energy: -18.765 flat angles C4'-P-C4' energy: -12.910 flat angles P-C4'-P energy: -17.663 tors. eta vs tors. theta energy: -31.100 Dist. restrs. and SS energy: 3.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -595.694954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.694954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.110782 (E_RNA) where: Base-Base interactions energy: -425.557 where: short stacking energy: -163.319 Base-Backbone interact. energy: -0.000 local terms energy: -170.553802 where: bonds (distance) C4'-P energy: -29.488 bonds (distance) P-C4' energy: -26.983 flat angles C4'-P-C4' energy: -34.414 flat angles P-C4'-P energy: -29.232 tors. eta vs tors. theta energy: -50.436 Dist. restrs. and SS energy: 0.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -589.470414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.470414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.569909 (E_RNA) where: Base-Base interactions energy: -436.375 where: short stacking energy: -165.483 Base-Backbone interact. energy: -0.000 local terms energy: -153.195007 where: bonds (distance) C4'-P energy: -26.535 bonds (distance) P-C4' energy: -23.486 flat angles C4'-P-C4' energy: -29.649 flat angles P-C4'-P energy: -27.014 tors. eta vs tors. theta energy: -46.512 Dist. restrs. and SS energy: 0.099 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -585.892356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.892356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.119047 (E_RNA) where: Base-Base interactions energy: -436.819 where: short stacking energy: -165.489 Base-Backbone interact. energy: -0.007 local terms energy: -149.292800 where: bonds (distance) C4'-P energy: -23.292 bonds (distance) P-C4' energy: -29.647 flat angles C4'-P-C4' energy: -30.035 flat angles P-C4'-P energy: -18.299 tors. eta vs tors. theta energy: -48.020 Dist. restrs. and SS energy: 0.227 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -583.680342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.680342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.752690 (E_RNA) where: Base-Base interactions energy: -431.856 where: short stacking energy: -164.994 Base-Backbone interact. energy: -0.001 local terms energy: -151.895590 where: bonds (distance) C4'-P energy: -20.448 bonds (distance) P-C4' energy: -28.831 flat angles C4'-P-C4' energy: -30.497 flat angles P-C4'-P energy: -23.750 tors. eta vs tors. theta energy: -48.369 Dist. restrs. and SS energy: 0.072 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -583.743914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.743914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.113368 (E_RNA) where: Base-Base interactions energy: -422.659 where: short stacking energy: -157.840 Base-Backbone interact. energy: -0.001 local terms energy: -161.479106 where: bonds (distance) C4'-P energy: -29.787 bonds (distance) P-C4' energy: -28.287 flat angles C4'-P-C4' energy: -31.023 flat angles P-C4'-P energy: -22.614 tors. eta vs tors. theta energy: -49.768 Dist. restrs. and SS energy: 0.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.025 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -572.666510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.666510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.965357 (E_RNA) where: Base-Base interactions energy: -427.025 where: short stacking energy: -160.700 Base-Backbone interact. energy: -0.003 local terms energy: -145.936631 where: bonds (distance) C4'-P energy: -18.854 bonds (distance) P-C4' energy: -23.725 flat angles C4'-P-C4' energy: -32.096 flat angles P-C4'-P energy: -23.207 tors. eta vs tors. theta energy: -48.055 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -503.329059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.329059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.431537 (E_RNA) where: Base-Base interactions energy: -374.331 where: short stacking energy: -142.405 Base-Backbone interact. energy: 1.158 local terms energy: -132.259397 where: bonds (distance) C4'-P energy: -22.031 bonds (distance) P-C4' energy: -23.372 flat angles C4'-P-C4' energy: -27.857 flat angles P-C4'-P energy: -22.455 tors. eta vs tors. theta energy: -36.545 Dist. restrs. and SS energy: 2.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -512.780824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.780824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.299669 (E_RNA) where: Base-Base interactions energy: -382.736 where: short stacking energy: -139.159 Base-Backbone interact. energy: 1.979 local terms energy: -132.542144 where: bonds (distance) C4'-P energy: -14.677 bonds (distance) P-C4' energy: -25.656 flat angles C4'-P-C4' energy: -28.935 flat angles P-C4'-P energy: -24.520 tors. eta vs tors. theta energy: -38.754 Dist. restrs. and SS energy: 0.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -499.250171 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.250171 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.109449 (E_RNA) where: Base-Base interactions energy: -369.802 where: short stacking energy: -134.674 Base-Backbone interact. energy: -1.585 local terms energy: -128.723011 where: bonds (distance) C4'-P energy: -30.088 bonds (distance) P-C4' energy: -25.450 flat angles C4'-P-C4' energy: -24.815 flat angles P-C4'-P energy: -12.607 tors. eta vs tors. theta energy: -35.763 Dist. restrs. and SS energy: 0.859 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -454.912109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.912109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.414157 (E_RNA) where: Base-Base interactions energy: -347.048 where: short stacking energy: -131.269 Base-Backbone interact. energy: 0.803 local terms energy: -113.169062 where: bonds (distance) C4'-P energy: -28.946 bonds (distance) P-C4' energy: -18.237 flat angles C4'-P-C4' energy: -19.202 flat angles P-C4'-P energy: -11.152 tors. eta vs tors. theta energy: -35.633 Dist. restrs. and SS energy: 4.502 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -600.490026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.490026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.545292 (E_RNA) where: Base-Base interactions energy: -437.477 where: short stacking energy: -165.173 Base-Backbone interact. energy: -0.000 local terms energy: -163.068306 where: bonds (distance) C4'-P energy: -23.627 bonds (distance) P-C4' energy: -29.158 flat angles C4'-P-C4' energy: -33.384 flat angles P-C4'-P energy: -28.100 tors. eta vs tors. theta energy: -48.800 Dist. restrs. and SS energy: 0.055 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -594.181718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.181718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.306767 (E_RNA) where: Base-Base interactions energy: -428.021 where: short stacking energy: -161.132 Base-Backbone interact. energy: -0.289 local terms energy: -165.996479 where: bonds (distance) C4'-P energy: -25.560 bonds (distance) P-C4' energy: -33.993 flat angles C4'-P-C4' energy: -30.589 flat angles P-C4'-P energy: -25.242 tors. eta vs tors. theta energy: -50.612 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -591.464056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.464056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.580384 (E_RNA) where: Base-Base interactions energy: -431.760 where: short stacking energy: -165.897 Base-Backbone interact. energy: -0.000 local terms energy: -159.990595 where: bonds (distance) C4'-P energy: -29.634 bonds (distance) P-C4' energy: -27.398 flat angles C4'-P-C4' energy: -26.939 flat angles P-C4'-P energy: -26.706 tors. eta vs tors. theta energy: -49.314 Dist. restrs. and SS energy: 0.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.171 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -587.195995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.195995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.478053 (E_RNA) where: Base-Base interactions energy: -428.179 where: short stacking energy: -167.939 Base-Backbone interact. energy: -0.616 local terms energy: -158.682980 where: bonds (distance) C4'-P energy: -26.054 bonds (distance) P-C4' energy: -26.854 flat angles C4'-P-C4' energy: -32.422 flat angles P-C4'-P energy: -24.821 tors. eta vs tors. theta energy: -48.532 Dist. restrs. and SS energy: 0.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -585.285939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.285939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.694211 (E_RNA) where: Base-Base interactions energy: -425.073 where: short stacking energy: -165.115 Base-Backbone interact. energy: -0.000 local terms energy: -161.180386 where: bonds (distance) C4'-P energy: -27.223 bonds (distance) P-C4' energy: -26.376 flat angles C4'-P-C4' energy: -31.472 flat angles P-C4'-P energy: -24.503 tors. eta vs tors. theta energy: -51.606 Dist. restrs. and SS energy: 0.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.560 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -573.707511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.707511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.154827 (E_RNA) where: Base-Base interactions energy: -417.395 where: short stacking energy: -160.099 Base-Backbone interact. energy: -0.042 local terms energy: -156.718128 where: bonds (distance) C4'-P energy: -29.770 bonds (distance) P-C4' energy: -25.721 flat angles C4'-P-C4' energy: -27.990 flat angles P-C4'-P energy: -23.508 tors. eta vs tors. theta energy: -49.728 Dist. restrs. and SS energy: 0.447 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -528.731076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -528.731076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -529.270777 (E_RNA) where: Base-Base interactions energy: -391.599 where: short stacking energy: -145.623 Base-Backbone interact. energy: -0.283 local terms energy: -137.389160 where: bonds (distance) C4'-P energy: -26.492 bonds (distance) P-C4' energy: -22.143 flat angles C4'-P-C4' energy: -26.454 flat angles P-C4'-P energy: -21.812 tors. eta vs tors. theta energy: -40.488 Dist. restrs. and SS energy: 0.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -499.633319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.633319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.030124 (E_RNA) where: Base-Base interactions energy: -389.080 where: short stacking energy: -140.683 Base-Backbone interact. energy: 1.496 local terms energy: -112.446138 where: bonds (distance) C4'-P energy: -12.678 bonds (distance) P-C4' energy: -26.183 flat angles C4'-P-C4' energy: -24.466 flat angles P-C4'-P energy: -11.620 tors. eta vs tors. theta energy: -37.500 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -462.989167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.989167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.593368 (E_RNA) where: Base-Base interactions energy: -339.466 where: short stacking energy: -122.886 Base-Backbone interact. energy: -1.112 local terms energy: -128.015292 where: bonds (distance) C4'-P energy: -22.588 bonds (distance) P-C4' energy: -27.705 flat angles C4'-P-C4' energy: -30.869 flat angles P-C4'-P energy: -11.670 tors. eta vs tors. theta energy: -35.184 Dist. restrs. and SS energy: 5.604 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -484.498211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.498211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.771987 (E_RNA) where: Base-Base interactions energy: -355.754 where: short stacking energy: -135.343 Base-Backbone interact. energy: -0.036 local terms energy: -131.982416 where: bonds (distance) C4'-P energy: -26.473 bonds (distance) P-C4' energy: -24.545 flat angles C4'-P-C4' energy: -23.675 flat angles P-C4'-P energy: -21.490 tors. eta vs tors. theta energy: -35.799 Dist. restrs. and SS energy: 3.274 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -603.258753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.258753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.643173 (E_RNA) where: Base-Base interactions energy: -446.305 where: short stacking energy: -172.741 Base-Backbone interact. energy: -0.043 local terms energy: -157.295015 where: bonds (distance) C4'-P energy: -23.751 bonds (distance) P-C4' energy: -27.312 flat angles C4'-P-C4' energy: -33.770 flat angles P-C4'-P energy: -21.960 tors. eta vs tors. theta energy: -50.502 Dist. restrs. and SS energy: 0.384 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -587.066902 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.066902 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.398073 (E_RNA) where: Base-Base interactions energy: -437.864 where: short stacking energy: -167.525 Base-Backbone interact. energy: -0.003 local terms energy: -149.531608 where: bonds (distance) C4'-P energy: -25.588 bonds (distance) P-C4' energy: -26.256 flat angles C4'-P-C4' energy: -27.861 flat angles P-C4'-P energy: -19.878 tors. eta vs tors. theta energy: -49.948 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -593.624702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.624702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.923494 (E_RNA) where: Base-Base interactions energy: -433.142 where: short stacking energy: -170.713 Base-Backbone interact. energy: -0.000 local terms energy: -160.781291 where: bonds (distance) C4'-P energy: -25.588 bonds (distance) P-C4' energy: -26.857 flat angles C4'-P-C4' energy: -35.187 flat angles P-C4'-P energy: -23.153 tors. eta vs tors. theta energy: -49.996 Dist. restrs. and SS energy: 0.299 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -586.144675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.144675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.451428 (E_RNA) where: Base-Base interactions energy: -431.378 where: short stacking energy: -161.578 Base-Backbone interact. energy: -0.012 local terms energy: -155.061894 where: bonds (distance) C4'-P energy: -18.826 bonds (distance) P-C4' energy: -29.792 flat angles C4'-P-C4' energy: -32.519 flat angles P-C4'-P energy: -24.532 tors. eta vs tors. theta energy: -49.393 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -582.565857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.565857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.870171 (E_RNA) where: Base-Base interactions energy: -426.379 where: short stacking energy: -168.691 Base-Backbone interact. energy: -0.320 local terms energy: -156.171196 where: bonds (distance) C4'-P energy: -26.236 bonds (distance) P-C4' energy: -23.236 flat angles C4'-P-C4' energy: -33.353 flat angles P-C4'-P energy: -23.718 tors. eta vs tors. theta energy: -49.629 Dist. restrs. and SS energy: 0.304 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -580.002274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.002274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.281911 (E_RNA) where: Base-Base interactions energy: -419.877 where: short stacking energy: -162.926 Base-Backbone interact. energy: -0.002 local terms energy: -160.403379 where: bonds (distance) C4'-P energy: -22.708 bonds (distance) P-C4' energy: -30.111 flat angles C4'-P-C4' energy: -34.598 flat angles P-C4'-P energy: -23.694 tors. eta vs tors. theta energy: -49.292 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -536.039414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.039414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.914968 (E_RNA) where: Base-Base interactions energy: -391.718 where: short stacking energy: -147.859 Base-Backbone interact. energy: 0.255 local terms energy: -145.452084 where: bonds (distance) C4'-P energy: -25.366 bonds (distance) P-C4' energy: -25.826 flat angles C4'-P-C4' energy: -31.102 flat angles P-C4'-P energy: -21.523 tors. eta vs tors. theta energy: -41.635 Dist. restrs. and SS energy: 0.876 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -520.379114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.379114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.990602 (E_RNA) where: Base-Base interactions energy: -383.221 where: short stacking energy: -136.236 Base-Backbone interact. energy: 2.732 local terms energy: -140.501692 where: bonds (distance) C4'-P energy: -28.197 bonds (distance) P-C4' energy: -29.007 flat angles C4'-P-C4' energy: -28.647 flat angles P-C4'-P energy: -18.463 tors. eta vs tors. theta energy: -36.187 Dist. restrs. and SS energy: 0.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -469.743646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.743646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.710051 (E_RNA) where: Base-Base interactions energy: -372.053 where: short stacking energy: -139.681 Base-Backbone interact. energy: 7.989 local terms energy: -108.646610 where: bonds (distance) C4'-P energy: -13.070 bonds (distance) P-C4' energy: -8.039 flat angles C4'-P-C4' energy: -32.427 flat angles P-C4'-P energy: -14.898 tors. eta vs tors. theta energy: -40.213 Dist. restrs. and SS energy: 2.966 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -482.031889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.031889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.873523 (E_RNA) where: Base-Base interactions energy: -354.017 where: short stacking energy: -130.603 Base-Backbone interact. energy: 0.448 local terms energy: -129.304552 where: bonds (distance) C4'-P energy: -27.058 bonds (distance) P-C4' energy: -19.765 flat angles C4'-P-C4' energy: -26.227 flat angles P-C4'-P energy: -18.369 tors. eta vs tors. theta energy: -37.885 Dist. restrs. and SS energy: 0.842 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -602.940533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.940533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.139604 (E_RNA) where: Base-Base interactions energy: -433.842 where: short stacking energy: -164.819 Base-Backbone interact. energy: -0.001 local terms energy: -169.815432 where: bonds (distance) C4'-P energy: -27.825 bonds (distance) P-C4' energy: -29.231 flat angles C4'-P-C4' energy: -33.611 flat angles P-C4'-P energy: -28.172 tors. eta vs tors. theta energy: -50.977 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.518 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -590.424283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.424283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.574348 (E_RNA) where: Base-Base interactions energy: -435.481 where: short stacking energy: -170.699 Base-Backbone interact. energy: -0.001 local terms energy: -155.092750 where: bonds (distance) C4'-P energy: -22.842 bonds (distance) P-C4' energy: -26.093 flat angles C4'-P-C4' energy: -32.191 flat angles P-C4'-P energy: -25.040 tors. eta vs tors. theta energy: -48.926 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -593.451716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.451716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.836651 (E_RNA) where: Base-Base interactions energy: -428.587 where: short stacking energy: -170.245 Base-Backbone interact. energy: -0.413 local terms energy: -164.836346 where: bonds (distance) C4'-P energy: -31.004 bonds (distance) P-C4' energy: -32.344 flat angles C4'-P-C4' energy: -29.162 flat angles P-C4'-P energy: -23.204 tors. eta vs tors. theta energy: -49.123 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -587.628444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.628444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.857457 (E_RNA) where: Base-Base interactions energy: -427.341 where: short stacking energy: -163.369 Base-Backbone interact. energy: -0.813 local terms energy: -159.748630 where: bonds (distance) C4'-P energy: -25.569 bonds (distance) P-C4' energy: -26.253 flat angles C4'-P-C4' energy: -34.092 flat angles P-C4'-P energy: -23.555 tors. eta vs tors. theta energy: -50.281 Dist. restrs. and SS energy: 0.229 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.045 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -582.369040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.369040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.615346 (E_RNA) where: Base-Base interactions energy: -422.546 where: short stacking energy: -162.714 Base-Backbone interact. energy: -0.787 local terms energy: -159.282483 where: bonds (distance) C4'-P energy: -25.151 bonds (distance) P-C4' energy: -28.600 flat angles C4'-P-C4' energy: -33.469 flat angles P-C4'-P energy: -20.726 tors. eta vs tors. theta energy: -51.336 Dist. restrs. and SS energy: 0.246 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -570.808121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.808121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.128466 (E_RNA) where: Base-Base interactions energy: -414.960 where: short stacking energy: -158.797 Base-Backbone interact. energy: -0.001 local terms energy: -156.167440 where: bonds (distance) C4'-P energy: -23.233 bonds (distance) P-C4' energy: -25.644 flat angles C4'-P-C4' energy: -32.734 flat angles P-C4'-P energy: -24.498 tors. eta vs tors. theta energy: -50.060 Dist. restrs. and SS energy: 0.320 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -523.055241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -523.055241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.641751 (E_RNA) where: Base-Base interactions energy: -394.506 where: short stacking energy: -144.720 Base-Backbone interact. energy: 5.463 local terms energy: -134.598609 where: bonds (distance) C4'-P energy: -22.107 bonds (distance) P-C4' energy: -27.451 flat angles C4'-P-C4' energy: -24.292 flat angles P-C4'-P energy: -20.460 tors. eta vs tors. theta energy: -40.289 Dist. restrs. and SS energy: 0.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -503.620437 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.620437 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.366400 (E_RNA) where: Base-Base interactions energy: -380.527 where: short stacking energy: -144.825 Base-Backbone interact. energy: -0.311 local terms energy: -123.528358 where: bonds (distance) C4'-P energy: -18.128 bonds (distance) P-C4' energy: -25.208 flat angles C4'-P-C4' energy: -26.576 flat angles P-C4'-P energy: -16.725 tors. eta vs tors. theta energy: -36.891 Dist. restrs. and SS energy: 0.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -488.801049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.801049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.490694 (E_RNA) where: Base-Base interactions energy: -369.525 where: short stacking energy: -137.714 Base-Backbone interact. energy: -0.063 local terms energy: -121.902480 where: bonds (distance) C4'-P energy: -21.796 bonds (distance) P-C4' energy: -19.830 flat angles C4'-P-C4' energy: -23.280 flat angles P-C4'-P energy: -21.323 tors. eta vs tors. theta energy: -35.674 Dist. restrs. and SS energy: 2.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -466.088934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.088934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.883026 (E_RNA) where: Base-Base interactions energy: -361.290 where: short stacking energy: -138.101 Base-Backbone interact. energy: -0.288 local terms energy: -108.305111 where: bonds (distance) C4'-P energy: -25.186 bonds (distance) P-C4' energy: -12.570 flat angles C4'-P-C4' energy: -22.149 flat angles P-C4'-P energy: -11.312 tors. eta vs tors. theta energy: -37.088 Dist. restrs. and SS energy: 3.794 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -610.641521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -610.641521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.237371 (E_RNA) where: Base-Base interactions energy: -437.924 where: short stacking energy: -174.228 Base-Backbone interact. energy: -0.001 local terms energy: -173.640716 where: bonds (distance) C4'-P energy: -27.365 bonds (distance) P-C4' energy: -32.626 flat angles C4'-P-C4' energy: -34.797 flat angles P-C4'-P energy: -25.456 tors. eta vs tors. theta energy: -53.396 Dist. restrs. and SS energy: 0.596 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.328 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -592.711619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.711619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.801482 (E_RNA) where: Base-Base interactions energy: -435.623 where: short stacking energy: -165.667 Base-Backbone interact. energy: -0.001 local terms energy: -157.177021 where: bonds (distance) C4'-P energy: -23.616 bonds (distance) P-C4' energy: -26.803 flat angles C4'-P-C4' energy: -29.343 flat angles P-C4'-P energy: -27.032 tors. eta vs tors. theta energy: -50.383 Dist. restrs. and SS energy: 0.090 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -586.219101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.219101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.498766 (E_RNA) where: Base-Base interactions energy: -433.905 where: short stacking energy: -165.157 Base-Backbone interact. energy: -0.229 local terms energy: -152.631972 where: bonds (distance) C4'-P energy: -23.730 bonds (distance) P-C4' energy: -24.329 flat angles C4'-P-C4' energy: -30.476 flat angles P-C4'-P energy: -23.439 tors. eta vs tors. theta energy: -50.658 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.267 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -593.938360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.938360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.138141 (E_RNA) where: Base-Base interactions energy: -432.751 where: short stacking energy: -165.170 Base-Backbone interact. energy: -0.000 local terms energy: -161.387190 where: bonds (distance) C4'-P energy: -28.917 bonds (distance) P-C4' energy: -25.030 flat angles C4'-P-C4' energy: -30.446 flat angles P-C4'-P energy: -27.271 tors. eta vs tors. theta energy: -49.724 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -580.750185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.750185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.193567 (E_RNA) where: Base-Base interactions energy: -429.244 where: short stacking energy: -165.809 Base-Backbone interact. energy: -0.000 local terms energy: -151.949218 where: bonds (distance) C4'-P energy: -21.051 bonds (distance) P-C4' energy: -28.585 flat angles C4'-P-C4' energy: -31.211 flat angles P-C4'-P energy: -21.610 tors. eta vs tors. theta energy: -49.491 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -568.061651 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.061651 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.296017 (E_RNA) where: Base-Base interactions energy: -421.114 where: short stacking energy: -161.048 Base-Backbone interact. energy: -0.132 local terms energy: -147.050023 where: bonds (distance) C4'-P energy: -21.226 bonds (distance) P-C4' energy: -27.105 flat angles C4'-P-C4' energy: -25.931 flat angles P-C4'-P energy: -24.002 tors. eta vs tors. theta energy: -48.785 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -529.607546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.607546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.468577 (E_RNA) where: Base-Base interactions energy: -389.861 where: short stacking energy: -144.585 Base-Backbone interact. energy: 1.203 local terms energy: -141.810610 where: bonds (distance) C4'-P energy: -28.855 bonds (distance) P-C4' energy: -26.880 flat angles C4'-P-C4' energy: -24.264 flat angles P-C4'-P energy: -22.662 tors. eta vs tors. theta energy: -39.150 Dist. restrs. and SS energy: 0.861 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -488.934811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.934811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.811638 (E_RNA) where: Base-Base interactions energy: -354.058 where: short stacking energy: -133.323 Base-Backbone interact. energy: 1.246 local terms energy: -137.999936 where: bonds (distance) C4'-P energy: -28.702 bonds (distance) P-C4' energy: -24.149 flat angles C4'-P-C4' energy: -30.409 flat angles P-C4'-P energy: -19.352 tors. eta vs tors. theta energy: -35.388 Dist. restrs. and SS energy: 1.877 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -510.505730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.505730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.765870 (E_RNA) where: Base-Base interactions energy: -383.599 where: short stacking energy: -138.934 Base-Backbone interact. energy: -0.428 local terms energy: -127.007176 where: bonds (distance) C4'-P energy: -23.113 bonds (distance) P-C4' energy: -24.088 flat angles C4'-P-C4' energy: -24.260 flat angles P-C4'-P energy: -17.659 tors. eta vs tors. theta energy: -37.887 Dist. restrs. and SS energy: 0.260 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.268 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -464.361384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.361384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.696364 (E_RNA) where: Base-Base interactions energy: -343.732 where: short stacking energy: -130.315 Base-Backbone interact. energy: -0.032 local terms energy: -125.933264 where: bonds (distance) C4'-P energy: -20.176 bonds (distance) P-C4' energy: -24.690 flat angles C4'-P-C4' energy: -20.858 flat angles P-C4'-P energy: -22.715 tors. eta vs tors. theta energy: -37.495 Dist. restrs. and SS energy: 5.335 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -604.869747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.869747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.056636 (E_RNA) where: Base-Base interactions energy: -432.998 where: short stacking energy: -166.278 Base-Backbone interact. energy: -0.000 local terms energy: -172.058371 where: bonds (distance) C4'-P energy: -29.435 bonds (distance) P-C4' energy: -30.210 flat angles C4'-P-C4' energy: -33.357 flat angles P-C4'-P energy: -26.764 tors. eta vs tors. theta energy: -52.293 Dist. restrs. and SS energy: 0.187 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -595.486709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.486709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.906507 (E_RNA) where: Base-Base interactions energy: -437.403 where: short stacking energy: -166.756 Base-Backbone interact. energy: -0.415 local terms energy: -158.088577 where: bonds (distance) C4'-P energy: -26.886 bonds (distance) P-C4' energy: -25.699 flat angles C4'-P-C4' energy: -30.810 flat angles P-C4'-P energy: -24.856 tors. eta vs tors. theta energy: -49.837 Dist. restrs. and SS energy: 0.420 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -582.808556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.808556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.072173 (E_RNA) where: Base-Base interactions energy: -418.881 where: short stacking energy: -153.093 Base-Backbone interact. energy: -0.023 local terms energy: -164.168578 where: bonds (distance) C4'-P energy: -32.871 bonds (distance) P-C4' energy: -24.796 flat angles C4'-P-C4' energy: -33.760 flat angles P-C4'-P energy: -22.602 tors. eta vs tors. theta energy: -50.140 Dist. restrs. and SS energy: 0.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -582.617404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.617404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.048511 (E_RNA) where: Base-Base interactions energy: -427.139 where: short stacking energy: -165.398 Base-Backbone interact. energy: -0.001 local terms energy: -155.908420 where: bonds (distance) C4'-P energy: -23.056 bonds (distance) P-C4' energy: -30.947 flat angles C4'-P-C4' energy: -29.578 flat angles P-C4'-P energy: -22.378 tors. eta vs tors. theta energy: -49.949 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -579.424117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.424117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.733088 (E_RNA) where: Base-Base interactions energy: -435.532 where: short stacking energy: -162.019 Base-Backbone interact. energy: -0.001 local terms energy: -144.200014 where: bonds (distance) C4'-P energy: -28.449 bonds (distance) P-C4' energy: -15.257 flat angles C4'-P-C4' energy: -32.397 flat angles P-C4'-P energy: -22.102 tors. eta vs tors. theta energy: -45.995 Dist. restrs. and SS energy: 0.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -565.269530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.269530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.409707 (E_RNA) where: Base-Base interactions energy: -419.851 where: short stacking energy: -160.655 Base-Backbone interact. energy: -0.000 local terms energy: -145.558830 where: bonds (distance) C4'-P energy: -19.108 bonds (distance) P-C4' energy: -24.853 flat angles C4'-P-C4' energy: -32.195 flat angles P-C4'-P energy: -22.046 tors. eta vs tors. theta energy: -47.357 Dist. restrs. and SS energy: 0.140 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -533.249412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.249412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.363263 (E_RNA) where: Base-Base interactions energy: -391.215 where: short stacking energy: -143.693 Base-Backbone interact. energy: 4.304 local terms energy: -146.452445 where: bonds (distance) C4'-P energy: -26.463 bonds (distance) P-C4' energy: -33.032 flat angles C4'-P-C4' energy: -24.783 flat angles P-C4'-P energy: -20.624 tors. eta vs tors. theta energy: -41.551 Dist. restrs. and SS energy: 0.114 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -494.792365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.792365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.944504 (E_RNA) where: Base-Base interactions energy: -371.691 where: short stacking energy: -134.370 Base-Backbone interact. energy: 3.702 local terms energy: -132.955197 where: bonds (distance) C4'-P energy: -23.079 bonds (distance) P-C4' energy: -21.826 flat angles C4'-P-C4' energy: -30.066 flat angles P-C4'-P energy: -21.466 tors. eta vs tors. theta energy: -36.518 Dist. restrs. and SS energy: 6.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -501.456807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.456807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.765673 (E_RNA) where: Base-Base interactions energy: -371.485 where: short stacking energy: -144.077 Base-Backbone interact. energy: 1.946 local terms energy: -133.236524 where: bonds (distance) C4'-P energy: -19.654 bonds (distance) P-C4' energy: -17.726 flat angles C4'-P-C4' energy: -34.074 flat angles P-C4'-P energy: -23.530 tors. eta vs tors. theta energy: -38.254 Dist. restrs. and SS energy: 1.309 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.010 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -449.835931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.835931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.244367 (E_RNA) where: Base-Base interactions energy: -337.352 where: short stacking energy: -126.417 Base-Backbone interact. energy: -0.128 local terms energy: -115.764350 where: bonds (distance) C4'-P energy: -18.658 bonds (distance) P-C4' energy: -19.840 flat angles C4'-P-C4' energy: -31.997 flat angles P-C4'-P energy: -9.640 tors. eta vs tors. theta energy: -35.629 Dist. restrs. and SS energy: 3.408 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -604.275132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.275132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.507775 (E_RNA) where: Base-Base interactions energy: -440.727 where: short stacking energy: -169.727 Base-Backbone interact. energy: -0.001 local terms energy: -163.779265 where: bonds (distance) C4'-P energy: -27.885 bonds (distance) P-C4' energy: -26.551 flat angles C4'-P-C4' energy: -30.955 flat angles P-C4'-P energy: -27.302 tors. eta vs tors. theta energy: -51.085 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -591.423882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.423882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.119345 (E_RNA) where: Base-Base interactions energy: -435.062 where: short stacking energy: -167.949 Base-Backbone interact. energy: -0.000 local terms energy: -157.057350 where: bonds (distance) C4'-P energy: -24.883 bonds (distance) P-C4' energy: -29.619 flat angles C4'-P-C4' energy: -34.085 flat angles P-C4'-P energy: -19.396 tors. eta vs tors. theta energy: -49.075 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -592.294812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.294812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.653361 (E_RNA) where: Base-Base interactions energy: -432.404 where: short stacking energy: -166.466 Base-Backbone interact. energy: -0.002 local terms energy: -160.247546 where: bonds (distance) C4'-P energy: -26.475 bonds (distance) P-C4' energy: -25.374 flat angles C4'-P-C4' energy: -32.021 flat angles P-C4'-P energy: -24.703 tors. eta vs tors. theta energy: -51.675 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -579.183847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.183847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.413712 (E_RNA) where: Base-Base interactions energy: -430.314 where: short stacking energy: -166.533 Base-Backbone interact. energy: -0.002 local terms energy: -149.097740 where: bonds (distance) C4'-P energy: -24.971 bonds (distance) P-C4' energy: -27.456 flat angles C4'-P-C4' energy: -25.022 flat angles P-C4'-P energy: -23.548 tors. eta vs tors. theta energy: -48.100 Dist. restrs. and SS energy: 0.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -572.769274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.769274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.069419 (E_RNA) where: Base-Base interactions energy: -414.242 where: short stacking energy: -158.894 Base-Backbone interact. energy: -0.001 local terms energy: -158.941176 where: bonds (distance) C4'-P energy: -32.171 bonds (distance) P-C4' energy: -26.679 flat angles C4'-P-C4' energy: -31.742 flat angles P-C4'-P energy: -22.538 tors. eta vs tors. theta energy: -45.811 Dist. restrs. and SS energy: 0.300 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.115 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -572.847944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.847944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.052164 (E_RNA) where: Base-Base interactions energy: -426.079 where: short stacking energy: -159.524 Base-Backbone interact. energy: -0.321 local terms energy: -146.652150 where: bonds (distance) C4'-P energy: -20.053 bonds (distance) P-C4' energy: -24.786 flat angles C4'-P-C4' energy: -26.716 flat angles P-C4'-P energy: -24.750 tors. eta vs tors. theta energy: -50.348 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -513.408724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.408724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.562822 (E_RNA) where: Base-Base interactions energy: -385.947 where: short stacking energy: -145.883 Base-Backbone interact. energy: 1.038 local terms energy: -130.653584 where: bonds (distance) C4'-P energy: -24.541 bonds (distance) P-C4' energy: -21.234 flat angles C4'-P-C4' energy: -28.001 flat angles P-C4'-P energy: -19.654 tors. eta vs tors. theta energy: -37.224 Dist. restrs. and SS energy: 2.154 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -520.115949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.115949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.231642 (E_RNA) where: Base-Base interactions energy: -381.135 where: short stacking energy: -140.115 Base-Backbone interact. energy: -0.375 local terms energy: -139.721771 where: bonds (distance) C4'-P energy: -21.365 bonds (distance) P-C4' energy: -28.301 flat angles C4'-P-C4' energy: -32.627 flat angles P-C4'-P energy: -19.043 tors. eta vs tors. theta energy: -38.385 Dist. restrs. and SS energy: 1.116 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -483.889376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.889376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.838216 (E_RNA) where: Base-Base interactions energy: -365.769 where: short stacking energy: -132.224 Base-Backbone interact. energy: -0.644 local terms energy: -118.425230 where: bonds (distance) C4'-P energy: -14.374 bonds (distance) P-C4' energy: -25.180 flat angles C4'-P-C4' energy: -24.878 flat angles P-C4'-P energy: -15.143 tors. eta vs tors. theta energy: -38.850 Dist. restrs. and SS energy: 0.949 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -462.051378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.051378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.048615 (E_RNA) where: Base-Base interactions energy: -347.899 where: short stacking energy: -129.214 Base-Backbone interact. energy: 1.865 local terms energy: -117.015164 where: bonds (distance) C4'-P energy: -23.000 bonds (distance) P-C4' energy: -16.691 flat angles C4'-P-C4' energy: -28.708 flat angles P-C4'-P energy: -13.922 tors. eta vs tors. theta energy: -34.694 Dist. restrs. and SS energy: 0.997 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -604.324200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.324200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.532638 (E_RNA) where: Base-Base interactions energy: -433.299 where: short stacking energy: -166.914 Base-Backbone interact. energy: -0.001 local terms energy: -171.233214 where: bonds (distance) C4'-P energy: -29.389 bonds (distance) P-C4' energy: -32.799 flat angles C4'-P-C4' energy: -32.557 flat angles P-C4'-P energy: -26.035 tors. eta vs tors. theta energy: -50.453 Dist. restrs. and SS energy: 0.208 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -593.994309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.994309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.129234 (E_RNA) where: Base-Base interactions energy: -433.675 where: short stacking energy: -165.370 Base-Backbone interact. energy: -0.007 local terms energy: -160.447156 where: bonds (distance) C4'-P energy: -27.809 bonds (distance) P-C4' energy: -26.408 flat angles C4'-P-C4' energy: -33.143 flat angles P-C4'-P energy: -22.447 tors. eta vs tors. theta energy: -50.641 Dist. restrs. and SS energy: 0.135 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -602.801395 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.801395 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.012888 (E_RNA) where: Base-Base interactions energy: -428.901 where: short stacking energy: -164.838 Base-Backbone interact. energy: -0.330 local terms energy: -173.781370 where: bonds (distance) C4'-P energy: -33.683 bonds (distance) P-C4' energy: -33.239 flat angles C4'-P-C4' energy: -33.033 flat angles P-C4'-P energy: -24.974 tors. eta vs tors. theta energy: -48.852 Dist. restrs. and SS energy: 0.211 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -591.333421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.333421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.452166 (E_RNA) where: Base-Base interactions energy: -429.482 where: short stacking energy: -167.042 Base-Backbone interact. energy: -0.041 local terms energy: -161.928569 where: bonds (distance) C4'-P energy: -23.340 bonds (distance) P-C4' energy: -27.233 flat angles C4'-P-C4' energy: -32.061 flat angles P-C4'-P energy: -30.404 tors. eta vs tors. theta energy: -48.890 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -580.832179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.832179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.979713 (E_RNA) where: Base-Base interactions energy: -426.984 where: short stacking energy: -162.172 Base-Backbone interact. energy: -0.001 local terms energy: -153.994691 where: bonds (distance) C4'-P energy: -27.298 bonds (distance) P-C4' energy: -24.316 flat angles C4'-P-C4' energy: -30.379 flat angles P-C4'-P energy: -23.407 tors. eta vs tors. theta energy: -48.594 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -577.220646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.220646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.589194 (E_RNA) where: Base-Base interactions energy: -421.871 where: short stacking energy: -164.417 Base-Backbone interact. energy: -0.001 local terms energy: -155.717281 where: bonds (distance) C4'-P energy: -24.912 bonds (distance) P-C4' energy: -24.652 flat angles C4'-P-C4' energy: -31.111 flat angles P-C4'-P energy: -25.801 tors. eta vs tors. theta energy: -49.240 Dist. restrs. and SS energy: 0.369 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -513.110878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -513.110878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.564599 (E_RNA) where: Base-Base interactions energy: -380.861 where: short stacking energy: -136.262 Base-Backbone interact. energy: 5.480 local terms energy: -138.184389 where: bonds (distance) C4'-P energy: -26.524 bonds (distance) P-C4' energy: -24.546 flat angles C4'-P-C4' energy: -27.921 flat angles P-C4'-P energy: -20.158 tors. eta vs tors. theta energy: -39.035 Dist. restrs. and SS energy: 0.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -514.952760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.952760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.780110 (E_RNA) where: Base-Base interactions energy: -385.010 where: short stacking energy: -142.729 Base-Backbone interact. energy: -1.835 local terms energy: -128.935195 where: bonds (distance) C4'-P energy: -23.214 bonds (distance) P-C4' energy: -28.786 flat angles C4'-P-C4' energy: -25.891 flat angles P-C4'-P energy: -13.319 tors. eta vs tors. theta energy: -37.724 Dist. restrs. and SS energy: 0.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -489.114330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -489.114330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.003613 (E_RNA) where: Base-Base interactions energy: -364.460 where: short stacking energy: -131.790 Base-Backbone interact. energy: 0.669 local terms energy: -127.212869 where: bonds (distance) C4'-P energy: -21.692 bonds (distance) P-C4' energy: -21.730 flat angles C4'-P-C4' energy: -29.816 flat angles P-C4'-P energy: -18.201 tors. eta vs tors. theta energy: -35.773 Dist. restrs. and SS energy: 1.889 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -479.229506 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.229506 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.171489 (E_RNA) where: Base-Base interactions energy: -363.396 where: short stacking energy: -136.514 Base-Backbone interact. energy: 1.990 local terms energy: -121.765880 where: bonds (distance) C4'-P energy: -20.106 bonds (distance) P-C4' energy: -18.164 flat angles C4'-P-C4' energy: -24.637 flat angles P-C4'-P energy: -18.321 tors. eta vs tors. theta energy: -40.538 Dist. restrs. and SS energy: 3.942 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -602.364491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.364491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.374571 (E_RNA) where: Base-Base interactions energy: -443.651 where: short stacking energy: -169.309 Base-Backbone interact. energy: -0.007 local terms energy: -158.715767 where: bonds (distance) C4'-P energy: -27.407 bonds (distance) P-C4' energy: -17.350 flat angles C4'-P-C4' energy: -33.997 flat angles P-C4'-P energy: -28.319 tors. eta vs tors. theta energy: -51.642 Dist. restrs. and SS energy: 0.010 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -597.937749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.937749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.037734 (E_RNA) where: Base-Base interactions energy: -445.740 where: short stacking energy: -169.689 Base-Backbone interact. energy: -0.001 local terms energy: -152.296793 where: bonds (distance) C4'-P energy: -27.232 bonds (distance) P-C4' energy: -18.580 flat angles C4'-P-C4' energy: -33.767 flat angles P-C4'-P energy: -22.130 tors. eta vs tors. theta energy: -50.587 Dist. restrs. and SS energy: 0.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -583.290415 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.290415 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.612858 (E_RNA) where: Base-Base interactions energy: -425.472 where: short stacking energy: -164.512 Base-Backbone interact. energy: -0.654 local terms energy: -157.486410 where: bonds (distance) C4'-P energy: -23.217 bonds (distance) P-C4' energy: -26.544 flat angles C4'-P-C4' energy: -33.663 flat angles P-C4'-P energy: -25.053 tors. eta vs tors. theta energy: -49.010 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -583.378011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.378011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.723638 (E_RNA) where: Base-Base interactions energy: -420.189 where: short stacking energy: -163.804 Base-Backbone interact. energy: -0.001 local terms energy: -163.532676 where: bonds (distance) C4'-P energy: -24.737 bonds (distance) P-C4' energy: -30.581 flat angles C4'-P-C4' energy: -32.446 flat angles P-C4'-P energy: -26.498 tors. eta vs tors. theta energy: -49.271 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -574.527308 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.527308 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.841019 (E_RNA) where: Base-Base interactions energy: -413.440 where: short stacking energy: -158.077 Base-Backbone interact. energy: -0.000 local terms energy: -161.401239 where: bonds (distance) C4'-P energy: -27.435 bonds (distance) P-C4' energy: -28.555 flat angles C4'-P-C4' energy: -34.780 flat angles P-C4'-P energy: -22.785 tors. eta vs tors. theta energy: -47.847 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -568.389391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.389391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.787436 (E_RNA) where: Base-Base interactions energy: -415.081 where: short stacking energy: -165.934 Base-Backbone interact. energy: -0.043 local terms energy: -153.662769 where: bonds (distance) C4'-P energy: -26.488 bonds (distance) P-C4' energy: -23.505 flat angles C4'-P-C4' energy: -32.504 flat angles P-C4'-P energy: -21.370 tors. eta vs tors. theta energy: -49.796 Dist. restrs. and SS energy: 0.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -516.824200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.824200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.134350 (E_RNA) where: Base-Base interactions energy: -386.509 where: short stacking energy: -148.342 Base-Backbone interact. energy: -0.044 local terms energy: -131.581387 where: bonds (distance) C4'-P energy: -22.349 bonds (distance) P-C4' energy: -28.455 flat angles C4'-P-C4' energy: -28.819 flat angles P-C4'-P energy: -14.401 tors. eta vs tors. theta energy: -37.557 Dist. restrs. and SS energy: 1.310 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -486.790943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.790943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.359866 (E_RNA) where: Base-Base interactions energy: -369.009 where: short stacking energy: -132.771 Base-Backbone interact. energy: 1.777 local terms energy: -121.128238 where: bonds (distance) C4'-P energy: -16.171 bonds (distance) P-C4' energy: -22.755 flat angles C4'-P-C4' energy: -26.310 flat angles P-C4'-P energy: -20.804 tors. eta vs tors. theta energy: -35.088 Dist. restrs. and SS energy: 1.569 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -495.838545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.838545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.642360 (E_RNA) where: Base-Base interactions energy: -376.112 where: short stacking energy: -136.299 Base-Backbone interact. energy: -1.026 local terms energy: -123.516977 where: bonds (distance) C4'-P energy: -20.327 bonds (distance) P-C4' energy: -30.228 flat angles C4'-P-C4' energy: -23.702 flat angles P-C4'-P energy: -12.299 tors. eta vs tors. theta energy: -36.962 Dist. restrs. and SS energy: 4.804 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.012 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -466.080446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.080446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.314386 (E_RNA) where: Base-Base interactions energy: -342.196 where: short stacking energy: -125.700 Base-Backbone interact. energy: -1.058 local terms energy: -126.060801 where: bonds (distance) C4'-P energy: -15.904 bonds (distance) P-C4' energy: -21.722 flat angles C4'-P-C4' energy: -31.567 flat angles P-C4'-P energy: -20.741 tors. eta vs tors. theta energy: -36.127 Dist. restrs. and SS energy: 3.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -599.936125 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.936125 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.398462 (E_RNA) where: Base-Base interactions energy: -434.657 where: short stacking energy: -165.321 Base-Backbone interact. energy: -0.001 local terms energy: -165.740475 where: bonds (distance) C4'-P energy: -32.133 bonds (distance) P-C4' energy: -25.843 flat angles C4'-P-C4' energy: -32.758 flat angles P-C4'-P energy: -23.747 tors. eta vs tors. theta energy: -51.259 Dist. restrs. and SS energy: 0.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -590.489396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.489396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.672500 (E_RNA) where: Base-Base interactions energy: -428.565 where: short stacking energy: -162.369 Base-Backbone interact. energy: -0.000 local terms energy: -162.107032 where: bonds (distance) C4'-P energy: -29.401 bonds (distance) P-C4' energy: -25.023 flat angles C4'-P-C4' energy: -31.257 flat angles P-C4'-P energy: -25.704 tors. eta vs tors. theta energy: -50.722 Dist. restrs. and SS energy: 0.183 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -597.225111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.225111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.422367 (E_RNA) where: Base-Base interactions energy: -428.880 where: short stacking energy: -165.010 Base-Backbone interact. energy: -0.002 local terms energy: -168.540281 where: bonds (distance) C4'-P energy: -27.986 bonds (distance) P-C4' energy: -32.399 flat angles C4'-P-C4' energy: -32.023 flat angles P-C4'-P energy: -24.339 tors. eta vs tors. theta energy: -51.793 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -579.567540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.567540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.268381 (E_RNA) where: Base-Base interactions energy: -420.170 where: short stacking energy: -160.789 Base-Backbone interact. energy: -0.008 local terms energy: -160.090777 where: bonds (distance) C4'-P energy: -30.578 bonds (distance) P-C4' energy: -28.192 flat angles C4'-P-C4' energy: -28.706 flat angles P-C4'-P energy: -23.802 tors. eta vs tors. theta energy: -48.812 Dist. restrs. and SS energy: 0.701 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -582.037282 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.037282 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.374651 (E_RNA) where: Base-Base interactions energy: -422.122 where: short stacking energy: -162.806 Base-Backbone interact. energy: -0.280 local terms energy: -160.244446 where: bonds (distance) C4'-P energy: -27.485 bonds (distance) P-C4' energy: -29.347 flat angles C4'-P-C4' energy: -34.832 flat angles P-C4'-P energy: -17.899 tors. eta vs tors. theta energy: -50.681 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.272 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -579.988588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.988588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.523765 (E_RNA) where: Base-Base interactions energy: -427.438 where: short stacking energy: -167.177 Base-Backbone interact. energy: -0.290 local terms energy: -152.796364 where: bonds (distance) C4'-P energy: -19.916 bonds (distance) P-C4' energy: -23.783 flat angles C4'-P-C4' energy: -32.450 flat angles P-C4'-P energy: -23.790 tors. eta vs tors. theta energy: -52.858 Dist. restrs. and SS energy: 0.535 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -516.146027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.146027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.145802 (E_RNA) where: Base-Base interactions energy: -388.698 where: short stacking energy: -151.549 Base-Backbone interact. energy: 1.967 local terms energy: -130.415050 where: bonds (distance) C4'-P energy: -26.769 bonds (distance) P-C4' energy: -28.113 flat angles C4'-P-C4' energy: -26.643 flat angles P-C4'-P energy: -11.311 tors. eta vs tors. theta energy: -37.579 Dist. restrs. and SS energy: 1.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -486.962119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.962119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.598672 (E_RNA) where: Base-Base interactions energy: -373.488 where: short stacking energy: -135.467 Base-Backbone interact. energy: -0.703 local terms energy: -113.408189 where: bonds (distance) C4'-P energy: -22.265 bonds (distance) P-C4' energy: -16.073 flat angles C4'-P-C4' energy: -22.277 flat angles P-C4'-P energy: -18.617 tors. eta vs tors. theta energy: -34.177 Dist. restrs. and SS energy: 0.637 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -497.435999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.435999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.393396 (E_RNA) where: Base-Base interactions energy: -375.021 where: short stacking energy: -136.926 Base-Backbone interact. energy: 4.154 local terms energy: -127.862732 where: bonds (distance) C4'-P energy: -13.407 bonds (distance) P-C4' energy: -24.021 flat angles C4'-P-C4' energy: -31.397 flat angles P-C4'-P energy: -19.125 tors. eta vs tors. theta energy: -39.912 Dist. restrs. and SS energy: 0.957 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.336 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -483.538083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.538083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.249653 (E_RNA) where: Base-Base interactions energy: -357.504 where: short stacking energy: -127.018 Base-Backbone interact. energy: -0.722 local terms energy: -127.023496 where: bonds (distance) C4'-P energy: -25.986 bonds (distance) P-C4' energy: -18.126 flat angles C4'-P-C4' energy: -26.840 flat angles P-C4'-P energy: -18.847 tors. eta vs tors. theta energy: -37.224 Dist. restrs. and SS energy: 1.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -611.175716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.175716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.244810 (E_RNA) where: Base-Base interactions energy: -437.783 where: short stacking energy: -167.291 Base-Backbone interact. energy: -0.042 local terms energy: -173.419543 where: bonds (distance) C4'-P energy: -33.417 bonds (distance) P-C4' energy: -31.767 flat angles C4'-P-C4' energy: -33.404 flat angles P-C4'-P energy: -25.171 tors. eta vs tors. theta energy: -49.661 Dist. restrs. and SS energy: 0.069 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -604.385220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.385220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.744285 (E_RNA) where: Base-Base interactions energy: -442.703 where: short stacking energy: -175.488 Base-Backbone interact. energy: -0.001 local terms energy: -162.040729 where: bonds (distance) C4'-P energy: -26.710 bonds (distance) P-C4' energy: -26.892 flat angles C4'-P-C4' energy: -32.286 flat angles P-C4'-P energy: -25.525 tors. eta vs tors. theta energy: -50.629 Dist. restrs. and SS energy: 0.359 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -594.548725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.548725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.677230 (E_RNA) where: Base-Base interactions energy: -431.824 where: short stacking energy: -161.033 Base-Backbone interact. energy: -0.001 local terms energy: -164.164547 where: bonds (distance) C4'-P energy: -24.742 bonds (distance) P-C4' energy: -26.453 flat angles C4'-P-C4' energy: -35.249 flat angles P-C4'-P energy: -26.225 tors. eta vs tors. theta energy: -51.495 Dist. restrs. and SS energy: 0.129 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.312 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -583.194426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.194426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.286294 (E_RNA) where: Base-Base interactions energy: -420.821 where: short stacking energy: -160.999 Base-Backbone interact. energy: -0.123 local terms energy: -162.342673 where: bonds (distance) C4'-P energy: -27.799 bonds (distance) P-C4' energy: -29.364 flat angles C4'-P-C4' energy: -31.981 flat angles P-C4'-P energy: -23.865 tors. eta vs tors. theta energy: -49.333 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -579.066196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.066196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.300086 (E_RNA) where: Base-Base interactions energy: -424.123 where: short stacking energy: -164.462 Base-Backbone interact. energy: -0.000 local terms energy: -155.177194 where: bonds (distance) C4'-P energy: -22.265 bonds (distance) P-C4' energy: -25.203 flat angles C4'-P-C4' energy: -30.885 flat angles P-C4'-P energy: -24.826 tors. eta vs tors. theta energy: -51.998 Dist. restrs. and SS energy: 0.234 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -574.287398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.287398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.105554 (E_RNA) where: Base-Base interactions energy: -405.530 where: short stacking energy: -158.787 Base-Backbone interact. energy: -0.910 local terms energy: -168.666321 where: bonds (distance) C4'-P energy: -29.133 bonds (distance) P-C4' energy: -35.396 flat angles C4'-P-C4' energy: -33.321 flat angles P-C4'-P energy: -21.725 tors. eta vs tors. theta energy: -49.091 Dist. restrs. and SS energy: 0.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -515.093364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.093364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.700585 (E_RNA) where: Base-Base interactions energy: -383.384 where: short stacking energy: -140.150 Base-Backbone interact. energy: 0.723 local terms energy: -135.211029 where: bonds (distance) C4'-P energy: -13.746 bonds (distance) P-C4' energy: -29.209 flat angles C4'-P-C4' energy: -29.709 flat angles P-C4'-P energy: -22.805 tors. eta vs tors. theta energy: -39.742 Dist. restrs. and SS energy: 2.607 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.172 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -522.026521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.026521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.441818 (E_RNA) where: Base-Base interactions energy: -394.053 where: short stacking energy: -149.714 Base-Backbone interact. energy: 0.401 local terms energy: -129.789922 where: bonds (distance) C4'-P energy: -22.753 bonds (distance) P-C4' energy: -20.284 flat angles C4'-P-C4' energy: -27.169 flat angles P-C4'-P energy: -22.781 tors. eta vs tors. theta energy: -36.803 Dist. restrs. and SS energy: 1.415 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -490.574381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.574381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.225701 (E_RNA) where: Base-Base interactions energy: -372.234 where: short stacking energy: -134.968 Base-Backbone interact. energy: 0.252 local terms energy: -119.242835 where: bonds (distance) C4'-P energy: -18.415 bonds (distance) P-C4' energy: -19.602 flat angles C4'-P-C4' energy: -31.217 flat angles P-C4'-P energy: -15.455 tors. eta vs tors. theta energy: -34.553 Dist. restrs. and SS energy: 0.651 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -477.891549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.891549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -478.651940 (E_RNA) where: Base-Base interactions energy: -363.153 where: short stacking energy: -127.424 Base-Backbone interact. energy: -1.109 local terms energy: -114.389571 where: bonds (distance) C4'-P energy: -20.860 bonds (distance) P-C4' energy: -18.104 flat angles C4'-P-C4' energy: -21.780 flat angles P-C4'-P energy: -17.147 tors. eta vs tors. theta energy: -36.498 Dist. restrs. and SS energy: 0.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -600.010374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.010374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.213107 (E_RNA) where: Base-Base interactions energy: -437.347 where: short stacking energy: -169.192 Base-Backbone interact. energy: -0.001 local terms energy: -162.865998 where: bonds (distance) C4'-P energy: -26.032 bonds (distance) P-C4' energy: -31.053 flat angles C4'-P-C4' energy: -31.930 flat angles P-C4'-P energy: -26.230 tors. eta vs tors. theta energy: -47.621 Dist. restrs. and SS energy: 0.203 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -596.763957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.763957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.891334 (E_RNA) where: Base-Base interactions energy: -434.225 where: short stacking energy: -163.301 Base-Backbone interact. energy: -0.015 local terms energy: -162.651274 where: bonds (distance) C4'-P energy: -30.301 bonds (distance) P-C4' energy: -28.571 flat angles C4'-P-C4' energy: -29.340 flat angles P-C4'-P energy: -25.266 tors. eta vs tors. theta energy: -49.174 Dist. restrs. and SS energy: 0.127 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -591.106807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.106807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.217230 (E_RNA) where: Base-Base interactions energy: -427.703 where: short stacking energy: -162.825 Base-Backbone interact. energy: -0.042 local terms energy: -163.472448 where: bonds (distance) C4'-P energy: -31.240 bonds (distance) P-C4' energy: -30.428 flat angles C4'-P-C4' energy: -32.517 flat angles P-C4'-P energy: -19.441 tors. eta vs tors. theta energy: -49.847 Dist. restrs. and SS energy: 0.110 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -584.473470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.473470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.907922 (E_RNA) where: Base-Base interactions energy: -427.084 where: short stacking energy: -164.604 Base-Backbone interact. energy: -0.000 local terms energy: -157.823995 where: bonds (distance) C4'-P energy: -28.742 bonds (distance) P-C4' energy: -21.832 flat angles C4'-P-C4' energy: -31.976 flat angles P-C4'-P energy: -23.897 tors. eta vs tors. theta energy: -51.376 Dist. restrs. and SS energy: 0.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -579.347600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.347600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.497109 (E_RNA) where: Base-Base interactions energy: -429.329 where: short stacking energy: -164.997 Base-Backbone interact. energy: -0.280 local terms energy: -149.888213 where: bonds (distance) C4'-P energy: -17.896 bonds (distance) P-C4' energy: -25.021 flat angles C4'-P-C4' energy: -35.034 flat angles P-C4'-P energy: -21.593 tors. eta vs tors. theta energy: -50.344 Dist. restrs. and SS energy: 0.150 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -577.637889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.637889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.304386 (E_RNA) where: Base-Base interactions energy: -421.030 where: short stacking energy: -163.074 Base-Backbone interact. energy: -0.122 local terms energy: -157.152433 where: bonds (distance) C4'-P energy: -26.922 bonds (distance) P-C4' energy: -26.298 flat angles C4'-P-C4' energy: -29.963 flat angles P-C4'-P energy: -23.065 tors. eta vs tors. theta energy: -50.904 Dist. restrs. and SS energy: 0.666 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -518.516940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.516940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.952556 (E_RNA) where: Base-Base interactions energy: -381.765 where: short stacking energy: -143.341 Base-Backbone interact. energy: 2.495 local terms energy: -140.682715 where: bonds (distance) C4'-P energy: -27.325 bonds (distance) P-C4' energy: -26.162 flat angles C4'-P-C4' energy: -28.031 flat angles P-C4'-P energy: -20.678 tors. eta vs tors. theta energy: -38.487 Dist. restrs. and SS energy: 1.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -526.957556 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -526.957556 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -528.203047 (E_RNA) where: Base-Base interactions energy: -382.094 where: short stacking energy: -145.954 Base-Backbone interact. energy: -0.387 local terms energy: -145.721916 where: bonds (distance) C4'-P energy: -28.799 bonds (distance) P-C4' energy: -23.766 flat angles C4'-P-C4' energy: -33.656 flat angles P-C4'-P energy: -21.635 tors. eta vs tors. theta energy: -37.865 Dist. restrs. and SS energy: 1.245 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -501.412910 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.412910 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.045006 (E_RNA) where: Base-Base interactions energy: -368.206 where: short stacking energy: -139.426 Base-Backbone interact. energy: 0.217 local terms energy: -136.056570 where: bonds (distance) C4'-P energy: -27.203 bonds (distance) P-C4' energy: -20.111 flat angles C4'-P-C4' energy: -29.207 flat angles P-C4'-P energy: -20.672 tors. eta vs tors. theta energy: -38.864 Dist. restrs. and SS energy: 2.632 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -488.732115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.732115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.154078 (E_RNA) where: Base-Base interactions energy: -363.949 where: short stacking energy: -133.610 Base-Backbone interact. energy: 4.398 local terms energy: -130.084980 where: bonds (distance) C4'-P energy: -17.296 bonds (distance) P-C4' energy: -25.747 flat angles C4'-P-C4' energy: -31.313 flat angles P-C4'-P energy: -18.739 tors. eta vs tors. theta energy: -36.990 Dist. restrs. and SS energy: 0.422 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.482 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -598.922487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.922487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.047573 (E_RNA) where: Base-Base interactions energy: -442.814 where: short stacking energy: -169.020 Base-Backbone interact. energy: -0.063 local terms energy: -156.170158 where: bonds (distance) C4'-P energy: -26.540 bonds (distance) P-C4' energy: -30.776 flat angles C4'-P-C4' energy: -30.371 flat angles P-C4'-P energy: -19.993 tors. eta vs tors. theta energy: -48.490 Dist. restrs. and SS energy: 0.125 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -598.794137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.794137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.126870 (E_RNA) where: Base-Base interactions energy: -431.357 where: short stacking energy: -164.107 Base-Backbone interact. energy: -0.000 local terms energy: -167.769979 where: bonds (distance) C4'-P energy: -27.558 bonds (distance) P-C4' energy: -27.781 flat angles C4'-P-C4' energy: -33.473 flat angles P-C4'-P energy: -28.094 tors. eta vs tors. theta energy: -50.864 Dist. restrs. and SS energy: 0.333 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -589.042787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.042787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.365569 (E_RNA) where: Base-Base interactions energy: -430.976 where: short stacking energy: -167.262 Base-Backbone interact. energy: -0.005 local terms energy: -158.383783 where: bonds (distance) C4'-P energy: -25.585 bonds (distance) P-C4' energy: -25.305 flat angles C4'-P-C4' energy: -31.500 flat angles P-C4'-P energy: -24.954 tors. eta vs tors. theta energy: -51.040 Dist. restrs. and SS energy: 0.323 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -592.536775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.536775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.922182 (E_RNA) where: Base-Base interactions energy: -426.509 where: short stacking energy: -166.404 Base-Backbone interact. energy: 1.561 local terms energy: -167.974315 where: bonds (distance) C4'-P energy: -29.013 bonds (distance) P-C4' energy: -30.506 flat angles C4'-P-C4' energy: -35.395 flat angles P-C4'-P energy: -23.076 tors. eta vs tors. theta energy: -49.983 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -589.059466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.059466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.248055 (E_RNA) where: Base-Base interactions energy: -428.106 where: short stacking energy: -164.402 Base-Backbone interact. energy: -0.002 local terms energy: -161.139716 where: bonds (distance) C4'-P energy: -29.822 bonds (distance) P-C4' energy: -28.538 flat angles C4'-P-C4' energy: -29.614 flat angles P-C4'-P energy: -24.982 tors. eta vs tors. theta energy: -48.184 Dist. restrs. and SS energy: 0.189 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -579.971721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.971721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.293425 (E_RNA) where: Base-Base interactions energy: -427.503 where: short stacking energy: -167.098 Base-Backbone interact. energy: -0.001 local terms energy: -152.789262 where: bonds (distance) C4'-P energy: -22.995 bonds (distance) P-C4' energy: -28.636 flat angles C4'-P-C4' energy: -29.950 flat angles P-C4'-P energy: -22.103 tors. eta vs tors. theta energy: -49.104 Dist. restrs. and SS energy: 0.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -506.242550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.242550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.609594 (E_RNA) where: Base-Base interactions energy: -386.558 where: short stacking energy: -141.891 Base-Backbone interact. energy: 3.960 local terms energy: -125.263365 where: bonds (distance) C4'-P energy: -17.557 bonds (distance) P-C4' energy: -19.727 flat angles C4'-P-C4' energy: -28.038 flat angles P-C4'-P energy: -19.205 tors. eta vs tors. theta energy: -40.737 Dist. restrs. and SS energy: 1.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.252 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -510.609176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.609176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.292732 (E_RNA) where: Base-Base interactions energy: -377.048 where: short stacking energy: -136.302 Base-Backbone interact. energy: 0.238 local terms energy: -134.482997 where: bonds (distance) C4'-P energy: -28.192 bonds (distance) P-C4' energy: -29.603 flat angles C4'-P-C4' energy: -21.587 flat angles P-C4'-P energy: -16.587 tors. eta vs tors. theta energy: -38.513 Dist. restrs. and SS energy: 0.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -509.495956 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.495956 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.590397 (E_RNA) where: Base-Base interactions energy: -379.803 where: short stacking energy: -144.629 Base-Backbone interact. energy: 0.771 local terms energy: -132.558398 where: bonds (distance) C4'-P energy: -21.172 bonds (distance) P-C4' energy: -23.531 flat angles C4'-P-C4' energy: -27.564 flat angles P-C4'-P energy: -21.753 tors. eta vs tors. theta energy: -38.539 Dist. restrs. and SS energy: 2.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -483.844065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.844065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.641590 (E_RNA) where: Base-Base interactions energy: -354.885 where: short stacking energy: -137.203 Base-Backbone interact. energy: 1.511 local terms energy: -133.268158 where: bonds (distance) C4'-P energy: -28.526 bonds (distance) P-C4' energy: -19.642 flat angles C4'-P-C4' energy: -28.081 flat angles P-C4'-P energy: -20.566 tors. eta vs tors. theta energy: -36.453 Dist. restrs. and SS energy: 2.798 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -605.445753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.445753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -605.737076 (E_RNA) where: Base-Base interactions energy: -430.556 where: short stacking energy: -170.753 Base-Backbone interact. energy: -0.001 local terms energy: -175.180303 where: bonds (distance) C4'-P energy: -28.767 bonds (distance) P-C4' energy: -30.240 flat angles C4'-P-C4' energy: -35.866 flat angles P-C4'-P energy: -28.107 tors. eta vs tors. theta energy: -52.199 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -591.502444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.502444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.958023 (E_RNA) where: Base-Base interactions energy: -434.786 where: short stacking energy: -165.386 Base-Backbone interact. energy: -0.042 local terms energy: -157.130288 where: bonds (distance) C4'-P energy: -26.130 bonds (distance) P-C4' energy: -26.769 flat angles C4'-P-C4' energy: -32.539 flat angles P-C4'-P energy: -23.536 tors. eta vs tors. theta energy: -48.156 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -596.240436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.240436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.581023 (E_RNA) where: Base-Base interactions energy: -439.963 where: short stacking energy: -171.007 Base-Backbone interact. energy: -0.334 local terms energy: -157.205662 where: bonds (distance) C4'-P energy: -22.380 bonds (distance) P-C4' energy: -29.992 flat angles C4'-P-C4' energy: -33.245 flat angles P-C4'-P energy: -24.103 tors. eta vs tors. theta energy: -47.486 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.921 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -571.802835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.802835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.134918 (E_RNA) where: Base-Base interactions energy: -429.722 where: short stacking energy: -161.763 Base-Backbone interact. energy: -0.156 local terms energy: -142.256972 where: bonds (distance) C4'-P energy: -30.777 bonds (distance) P-C4' energy: -19.170 flat angles C4'-P-C4' energy: -28.437 flat angles P-C4'-P energy: -17.917 tors. eta vs tors. theta energy: -45.956 Dist. restrs. and SS energy: 0.332 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -584.068708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.068708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.363703 (E_RNA) where: Base-Base interactions energy: -419.863 where: short stacking energy: -161.846 Base-Backbone interact. energy: -0.306 local terms energy: -164.194338 where: bonds (distance) C4'-P energy: -29.104 bonds (distance) P-C4' energy: -28.464 flat angles C4'-P-C4' energy: -32.426 flat angles P-C4'-P energy: -24.363 tors. eta vs tors. theta energy: -49.837 Dist. restrs. and SS energy: 0.295 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -570.041846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.041846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.245846 (E_RNA) where: Base-Base interactions energy: -420.349 where: short stacking energy: -160.817 Base-Backbone interact. energy: -0.000 local terms energy: -149.897078 where: bonds (distance) C4'-P energy: -28.382 bonds (distance) P-C4' energy: -19.017 flat angles C4'-P-C4' energy: -31.422 flat angles P-C4'-P energy: -22.904 tors. eta vs tors. theta energy: -48.174 Dist. restrs. and SS energy: 0.204 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -503.876886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.876886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.035145 (E_RNA) where: Base-Base interactions energy: -377.790 where: short stacking energy: -142.314 Base-Backbone interact. energy: -0.282 local terms energy: -126.963174 where: bonds (distance) C4'-P energy: -23.666 bonds (distance) P-C4' energy: -25.196 flat angles C4'-P-C4' energy: -25.143 flat angles P-C4'-P energy: -16.021 tors. eta vs tors. theta energy: -36.937 Dist. restrs. and SS energy: 1.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -520.633316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.633316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.292606 (E_RNA) where: Base-Base interactions energy: -383.502 where: short stacking energy: -142.344 Base-Backbone interact. energy: 1.905 local terms energy: -139.695327 where: bonds (distance) C4'-P energy: -25.981 bonds (distance) P-C4' energy: -29.590 flat angles C4'-P-C4' energy: -28.966 flat angles P-C4'-P energy: -17.798 tors. eta vs tors. theta energy: -37.360 Dist. restrs. and SS energy: 0.659 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -491.154581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.154581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.124574 (E_RNA) where: Base-Base interactions energy: -371.878 where: short stacking energy: -137.642 Base-Backbone interact. energy: -0.407 local terms energy: -120.839530 where: bonds (distance) C4'-P energy: -18.457 bonds (distance) P-C4' energy: -23.142 flat angles C4'-P-C4' energy: -27.011 flat angles P-C4'-P energy: -11.214 tors. eta vs tors. theta energy: -41.014 Dist. restrs. and SS energy: 1.970 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -490.018315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.018315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.980668 (E_RNA) where: Base-Base interactions energy: -371.581 where: short stacking energy: -138.423 Base-Backbone interact. energy: 0.292 local terms energy: -119.691439 where: bonds (distance) C4'-P energy: -19.949 bonds (distance) P-C4' energy: -16.739 flat angles C4'-P-C4' energy: -28.868 flat angles P-C4'-P energy: -16.223 tors. eta vs tors. theta energy: -37.913 Dist. restrs. and SS energy: 0.962 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -601.511050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.511050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.880862 (E_RNA) where: Base-Base interactions energy: -436.415 where: short stacking energy: -174.193 Base-Backbone interact. energy: -0.001 local terms energy: -165.465371 where: bonds (distance) C4'-P energy: -24.796 bonds (distance) P-C4' energy: -31.808 flat angles C4'-P-C4' energy: -34.001 flat angles P-C4'-P energy: -24.250 tors. eta vs tors. theta energy: -50.610 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -606.464329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.464329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.788580 (E_RNA) where: Base-Base interactions energy: -439.604 where: short stacking energy: -171.477 Base-Backbone interact. energy: -0.001 local terms energy: -167.632784 where: bonds (distance) C4'-P energy: -23.899 bonds (distance) P-C4' energy: -33.994 flat angles C4'-P-C4' energy: -35.654 flat angles P-C4'-P energy: -24.297 tors. eta vs tors. theta energy: -49.789 Dist. restrs. and SS energy: 0.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.449 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -586.622130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.622130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.936590 (E_RNA) where: Base-Base interactions energy: -427.306 where: short stacking energy: -164.715 Base-Backbone interact. energy: -0.000 local terms energy: -159.629994 where: bonds (distance) C4'-P energy: -32.117 bonds (distance) P-C4' energy: -25.010 flat angles C4'-P-C4' energy: -30.460 flat angles P-C4'-P energy: -21.507 tors. eta vs tors. theta energy: -50.536 Dist. restrs. and SS energy: 0.314 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -583.859948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.859948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.394196 (E_RNA) where: Base-Base interactions energy: -425.826 where: short stacking energy: -160.995 Base-Backbone interact. energy: -0.004 local terms energy: -158.564139 where: bonds (distance) C4'-P energy: -23.316 bonds (distance) P-C4' energy: -35.455 flat angles C4'-P-C4' energy: -30.755 flat angles P-C4'-P energy: -21.027 tors. eta vs tors. theta energy: -48.011 Dist. restrs. and SS energy: 0.534 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -575.176929 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.176929 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.444529 (E_RNA) where: Base-Base interactions energy: -422.939 where: short stacking energy: -158.914 Base-Backbone interact. energy: -0.001 local terms energy: -152.504232 where: bonds (distance) C4'-P energy: -21.597 bonds (distance) P-C4' energy: -20.597 flat angles C4'-P-C4' energy: -33.190 flat angles P-C4'-P energy: -26.468 tors. eta vs tors. theta energy: -50.652 Dist. restrs. and SS energy: 0.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -570.875430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.875430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.365176 (E_RNA) where: Base-Base interactions energy: -418.975 where: short stacking energy: -159.371 Base-Backbone interact. energy: -0.015 local terms energy: -152.374603 where: bonds (distance) C4'-P energy: -21.205 bonds (distance) P-C4' energy: -29.189 flat angles C4'-P-C4' energy: -28.939 flat angles P-C4'-P energy: -24.857 tors. eta vs tors. theta energy: -48.185 Dist. restrs. and SS energy: 0.490 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -512.709343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.709343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.117896 (E_RNA) where: Base-Base interactions energy: -375.918 where: short stacking energy: -137.330 Base-Backbone interact. energy: -0.223 local terms energy: -137.976763 where: bonds (distance) C4'-P energy: -24.508 bonds (distance) P-C4' energy: -26.813 flat angles C4'-P-C4' energy: -24.496 flat angles P-C4'-P energy: -22.549 tors. eta vs tors. theta energy: -39.611 Dist. restrs. and SS energy: 1.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -506.252971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.252971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.248125 (E_RNA) where: Base-Base interactions energy: -378.477 where: short stacking energy: -135.400 Base-Backbone interact. energy: -0.437 local terms energy: -128.334248 where: bonds (distance) C4'-P energy: -26.553 bonds (distance) P-C4' energy: -24.742 flat angles C4'-P-C4' energy: -23.524 flat angles P-C4'-P energy: -17.968 tors. eta vs tors. theta energy: -35.548 Dist. restrs. and SS energy: 0.995 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -511.085203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.085203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.291674 (E_RNA) where: Base-Base interactions energy: -382.843 where: short stacking energy: -146.563 Base-Backbone interact. energy: 0.754 local terms energy: -130.202771 where: bonds (distance) C4'-P energy: -19.615 bonds (distance) P-C4' energy: -25.957 flat angles C4'-P-C4' energy: -29.758 flat angles P-C4'-P energy: -16.846 tors. eta vs tors. theta energy: -38.027 Dist. restrs. and SS energy: 1.206 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -478.816501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.816501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.406497 (E_RNA) where: Base-Base interactions energy: -349.208 where: short stacking energy: -128.592 Base-Backbone interact. energy: -0.414 local terms energy: -130.784866 where: bonds (distance) C4'-P energy: -21.900 bonds (distance) P-C4' energy: -19.108 flat angles C4'-P-C4' energy: -29.784 flat angles P-C4'-P energy: -23.568 tors. eta vs tors. theta energy: -36.425 Dist. restrs. and SS energy: 1.590 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -603.757640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.757640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.337702 (E_RNA) where: Base-Base interactions energy: -436.916 where: short stacking energy: -168.368 Base-Backbone interact. energy: -0.002 local terms energy: -167.419787 where: bonds (distance) C4'-P energy: -30.532 bonds (distance) P-C4' energy: -29.731 flat angles C4'-P-C4' energy: -31.235 flat angles P-C4'-P energy: -25.183 tors. eta vs tors. theta energy: -50.739 Dist. restrs. and SS energy: 0.580 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -598.108200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.108200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.305525 (E_RNA) where: Base-Base interactions energy: -446.464 where: short stacking energy: -170.892 Base-Backbone interact. energy: -0.124 local terms energy: -152.429485 where: bonds (distance) C4'-P energy: -27.874 bonds (distance) P-C4' energy: -25.727 flat angles C4'-P-C4' energy: -30.568 flat angles P-C4'-P energy: -18.104 tors. eta vs tors. theta energy: -50.157 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.712 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -589.725710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.725710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.125824 (E_RNA) where: Base-Base interactions energy: -435.522 where: short stacking energy: -166.920 Base-Backbone interact. energy: -0.001 local terms energy: -154.603085 where: bonds (distance) C4'-P energy: -26.147 bonds (distance) P-C4' energy: -23.152 flat angles C4'-P-C4' energy: -31.343 flat angles P-C4'-P energy: -22.928 tors. eta vs tors. theta energy: -51.033 Dist. restrs. and SS energy: 0.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -583.806870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.806870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.180590 (E_RNA) where: Base-Base interactions energy: -430.422 where: short stacking energy: -164.930 Base-Backbone interact. energy: -0.004 local terms energy: -153.754638 where: bonds (distance) C4'-P energy: -22.868 bonds (distance) P-C4' energy: -31.224 flat angles C4'-P-C4' energy: -29.766 flat angles P-C4'-P energy: -20.638 tors. eta vs tors. theta energy: -49.258 Dist. restrs. and SS energy: 0.374 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -570.682181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.682181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.874411 (E_RNA) where: Base-Base interactions energy: -415.051 where: short stacking energy: -160.612 Base-Backbone interact. energy: -0.025 local terms energy: -155.798294 where: bonds (distance) C4'-P energy: -27.768 bonds (distance) P-C4' energy: -27.516 flat angles C4'-P-C4' energy: -28.298 flat angles P-C4'-P energy: -22.173 tors. eta vs tors. theta energy: -50.044 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -569.759871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.759871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.014142 (E_RNA) where: Base-Base interactions energy: -422.775 where: short stacking energy: -160.831 Base-Backbone interact. energy: -0.000 local terms energy: -147.238185 where: bonds (distance) C4'-P energy: -20.139 bonds (distance) P-C4' energy: -18.808 flat angles C4'-P-C4' energy: -31.589 flat angles P-C4'-P energy: -26.587 tors. eta vs tors. theta energy: -50.115 Dist. restrs. and SS energy: 0.254 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -509.999103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.999103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.553947 (E_RNA) where: Base-Base interactions energy: -379.404 where: short stacking energy: -130.751 Base-Backbone interact. energy: -0.003 local terms energy: -132.146902 where: bonds (distance) C4'-P energy: -20.420 bonds (distance) P-C4' energy: -27.161 flat angles C4'-P-C4' energy: -31.175 flat angles P-C4'-P energy: -16.317 tors. eta vs tors. theta energy: -37.075 Dist. restrs. and SS energy: 1.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -506.822611 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.822611 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -509.167520 (E_RNA) where: Base-Base interactions energy: -377.890 where: short stacking energy: -137.737 Base-Backbone interact. energy: 1.872 local terms energy: -133.149180 where: bonds (distance) C4'-P energy: -19.562 bonds (distance) P-C4' energy: -30.162 flat angles C4'-P-C4' energy: -24.088 flat angles P-C4'-P energy: -18.488 tors. eta vs tors. theta energy: -40.850 Dist. restrs. and SS energy: 2.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -510.827867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.827867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -512.146691 (E_RNA) where: Base-Base interactions energy: -386.336 where: short stacking energy: -141.112 Base-Backbone interact. energy: 2.160 local terms energy: -127.970462 where: bonds (distance) C4'-P energy: -26.846 bonds (distance) P-C4' energy: -20.716 flat angles C4'-P-C4' energy: -25.584 flat angles P-C4'-P energy: -16.703 tors. eta vs tors. theta energy: -38.121 Dist. restrs. and SS energy: 1.319 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -487.172635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.172635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.799710 (E_RNA) where: Base-Base interactions energy: -376.629 where: short stacking energy: -135.600 Base-Backbone interact. energy: 1.922 local terms energy: -113.092676 where: bonds (distance) C4'-P energy: -13.785 bonds (distance) P-C4' energy: -14.094 flat angles C4'-P-C4' energy: -27.364 flat angles P-C4'-P energy: -21.267 tors. eta vs tors. theta energy: -36.584 Dist. restrs. and SS energy: 0.627 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -607.393186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.393186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.467482 (E_RNA) where: Base-Base interactions energy: -445.973 where: short stacking energy: -171.572 Base-Backbone interact. energy: -0.239 local terms energy: -161.255522 where: bonds (distance) C4'-P energy: -25.182 bonds (distance) P-C4' energy: -28.515 flat angles C4'-P-C4' energy: -34.347 flat angles P-C4'-P energy: -20.168 tors. eta vs tors. theta energy: -53.044 Dist. restrs. and SS energy: 0.074 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -589.621774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.621774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.090568 (E_RNA) where: Base-Base interactions energy: -432.282 where: short stacking energy: -162.688 Base-Backbone interact. energy: -0.002 local terms energy: -159.887585 where: bonds (distance) C4'-P energy: -29.286 bonds (distance) P-C4' energy: -23.001 flat angles C4'-P-C4' energy: -31.670 flat angles P-C4'-P energy: -24.284 tors. eta vs tors. theta energy: -51.646 Dist. restrs. and SS energy: 0.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.082 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -596.986687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.986687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.396842 (E_RNA) where: Base-Base interactions energy: -433.827 where: short stacking energy: -169.078 Base-Backbone interact. energy: -0.730 local terms energy: -163.008272 where: bonds (distance) C4'-P energy: -29.450 bonds (distance) P-C4' energy: -29.311 flat angles C4'-P-C4' energy: -31.302 flat angles P-C4'-P energy: -22.011 tors. eta vs tors. theta energy: -50.934 Dist. restrs. and SS energy: 0.410 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.169 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -590.744532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -590.744532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.173473 (E_RNA) where: Base-Base interactions energy: -428.775 where: short stacking energy: -172.902 Base-Backbone interact. energy: -0.240 local terms energy: -162.158610 where: bonds (distance) C4'-P energy: -26.731 bonds (distance) P-C4' energy: -31.482 flat angles C4'-P-C4' energy: -33.046 flat angles P-C4'-P energy: -22.204 tors. eta vs tors. theta energy: -48.696 Dist. restrs. and SS energy: 0.429 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -572.407428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.407428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.719829 (E_RNA) where: Base-Base interactions energy: -429.119 where: short stacking energy: -161.399 Base-Backbone interact. energy: -0.011 local terms energy: -143.590238 where: bonds (distance) C4'-P energy: -20.007 bonds (distance) P-C4' energy: -29.338 flat angles C4'-P-C4' energy: -27.058 flat angles P-C4'-P energy: -19.215 tors. eta vs tors. theta energy: -47.973 Dist. restrs. and SS energy: 0.312 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -577.090318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.090318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.492129 (E_RNA) where: Base-Base interactions energy: -415.754 where: short stacking energy: -161.869 Base-Backbone interact. energy: -0.004 local terms energy: -161.734251 where: bonds (distance) C4'-P energy: -29.340 bonds (distance) P-C4' energy: -31.073 flat angles C4'-P-C4' energy: -32.139 flat angles P-C4'-P energy: -18.446 tors. eta vs tors. theta energy: -50.737 Dist. restrs. and SS energy: 0.402 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -503.897446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.897446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.992885 (E_RNA) where: Base-Base interactions energy: -379.593 where: short stacking energy: -138.177 Base-Backbone interact. energy: 0.078 local terms energy: -126.477968 where: bonds (distance) C4'-P energy: -21.892 bonds (distance) P-C4' energy: -27.908 flat angles C4'-P-C4' energy: -26.890 flat angles P-C4'-P energy: -13.521 tors. eta vs tors. theta energy: -36.267 Dist. restrs. and SS energy: 2.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -491.943560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.943560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.030339 (E_RNA) where: Base-Base interactions energy: -379.693 where: short stacking energy: -130.273 Base-Backbone interact. energy: 3.458 local terms energy: -118.710525 where: bonds (distance) C4'-P energy: -21.776 bonds (distance) P-C4' energy: -24.036 flat angles C4'-P-C4' energy: -15.176 flat angles P-C4'-P energy: -21.710 tors. eta vs tors. theta energy: -36.013 Dist. restrs. and SS energy: 2.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.915 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -499.961418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.961418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.489410 (E_RNA) where: Base-Base interactions energy: -372.810 where: short stacking energy: -137.997 Base-Backbone interact. energy: -0.233 local terms energy: -130.446440 where: bonds (distance) C4'-P energy: -23.855 bonds (distance) P-C4' energy: -26.924 flat angles C4'-P-C4' energy: -22.875 flat angles P-C4'-P energy: -15.607 tors. eta vs tors. theta energy: -41.186 Dist. restrs. and SS energy: 3.528 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -490.448208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.448208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.968388 (E_RNA) where: Base-Base interactions energy: -373.364 where: short stacking energy: -139.519 Base-Backbone interact. energy: 4.199 local terms energy: -123.802516 where: bonds (distance) C4'-P energy: -21.297 bonds (distance) P-C4' energy: -19.256 flat angles C4'-P-C4' energy: -28.443 flat angles P-C4'-P energy: -18.307 tors. eta vs tors. theta energy: -36.499 Dist. restrs. and SS energy: 2.520 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -595.128814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.128814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.476550 (E_RNA) where: Base-Base interactions energy: -430.476 where: short stacking energy: -167.162 Base-Backbone interact. energy: -0.046 local terms energy: -164.953992 where: bonds (distance) C4'-P energy: -25.559 bonds (distance) P-C4' energy: -29.580 flat angles C4'-P-C4' energy: -35.358 flat angles P-C4'-P energy: -22.638 tors. eta vs tors. theta energy: -51.819 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -599.670377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.670377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.199571 (E_RNA) where: Base-Base interactions energy: -436.832 where: short stacking energy: -163.005 Base-Backbone interact. energy: 0.299 local terms energy: -164.341042 where: bonds (distance) C4'-P energy: -26.549 bonds (distance) P-C4' energy: -31.895 flat angles C4'-P-C4' energy: -32.672 flat angles P-C4'-P energy: -24.239 tors. eta vs tors. theta energy: -48.986 Dist. restrs. and SS energy: 0.529 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.675 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -589.360275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.360275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.934158 (E_RNA) where: Base-Base interactions energy: -430.130 where: short stacking energy: -161.218 Base-Backbone interact. energy: -0.157 local terms energy: -159.647139 where: bonds (distance) C4'-P energy: -23.959 bonds (distance) P-C4' energy: -29.710 flat angles C4'-P-C4' energy: -29.711 flat angles P-C4'-P energy: -25.517 tors. eta vs tors. theta energy: -50.751 Dist. restrs. and SS energy: 0.574 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -582.998575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.998575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.079475 (E_RNA) where: Base-Base interactions energy: -432.244 where: short stacking energy: -163.872 Base-Backbone interact. energy: -0.001 local terms energy: -150.833869 where: bonds (distance) C4'-P energy: -19.870 bonds (distance) P-C4' energy: -34.108 flat angles C4'-P-C4' energy: -27.533 flat angles P-C4'-P energy: -22.260 tors. eta vs tors. theta energy: -47.063 Dist. restrs. and SS energy: 0.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -580.690881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.690881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.245811 (E_RNA) where: Base-Base interactions energy: -415.782 where: short stacking energy: -165.480 Base-Backbone interact. energy: -0.133 local terms energy: -166.330251 where: bonds (distance) C4'-P energy: -29.074 bonds (distance) P-C4' energy: -30.745 flat angles C4'-P-C4' energy: -35.133 flat angles P-C4'-P energy: -22.294 tors. eta vs tors. theta energy: -49.084 Dist. restrs. and SS energy: 1.555 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -571.202987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.202987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.392631 (E_RNA) where: Base-Base interactions energy: -425.752 where: short stacking energy: -161.188 Base-Backbone interact. energy: -0.239 local terms energy: -145.402296 where: bonds (distance) C4'-P energy: -29.025 bonds (distance) P-C4' energy: -20.621 flat angles C4'-P-C4' energy: -26.938 flat angles P-C4'-P energy: -20.098 tors. eta vs tors. theta energy: -48.721 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -504.403664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.403664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.321748 (E_RNA) where: Base-Base interactions energy: -370.947 where: short stacking energy: -143.044 Base-Backbone interact. energy: 0.139 local terms energy: -136.513620 where: bonds (distance) C4'-P energy: -25.587 bonds (distance) P-C4' energy: -25.843 flat angles C4'-P-C4' energy: -29.869 flat angles P-C4'-P energy: -16.748 tors. eta vs tors. theta energy: -38.467 Dist. restrs. and SS energy: 2.918 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -486.432173 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.432173 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.961805 (E_RNA) where: Base-Base interactions energy: -365.217 where: short stacking energy: -132.119 Base-Backbone interact. energy: 2.947 local terms energy: -126.691423 where: bonds (distance) C4'-P energy: -20.529 bonds (distance) P-C4' energy: -24.240 flat angles C4'-P-C4' energy: -24.735 flat angles P-C4'-P energy: -22.527 tors. eta vs tors. theta energy: -34.661 Dist. restrs. and SS energy: 2.530 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -495.755458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.755458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.366706 (E_RNA) where: Base-Base interactions energy: -365.330 where: short stacking energy: -131.090 Base-Backbone interact. energy: 4.045 local terms energy: -137.082357 where: bonds (distance) C4'-P energy: -25.468 bonds (distance) P-C4' energy: -21.137 flat angles C4'-P-C4' energy: -31.098 flat angles P-C4'-P energy: -22.499 tors. eta vs tors. theta energy: -36.880 Dist. restrs. and SS energy: 2.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -458.547204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.547204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.452183 (E_RNA) where: Base-Base interactions energy: -333.775 where: short stacking energy: -117.216 Base-Backbone interact. energy: 0.115 local terms energy: -128.792127 where: bonds (distance) C4'-P energy: -23.383 bonds (distance) P-C4' energy: -23.991 flat angles C4'-P-C4' energy: -24.416 flat angles P-C4'-P energy: -18.498 tors. eta vs tors. theta energy: -38.504 Dist. restrs. and SS energy: 3.905 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -611.911332 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.911332 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.012433 (E_RNA) where: Base-Base interactions energy: -441.656 where: short stacking energy: -168.792 Base-Backbone interact. energy: -0.001 local terms energy: -170.356212 where: bonds (distance) C4'-P energy: -29.865 bonds (distance) P-C4' energy: -31.388 flat angles C4'-P-C4' energy: -34.466 flat angles P-C4'-P energy: -24.020 tors. eta vs tors. theta energy: -50.617 Dist. restrs. and SS energy: 0.101 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -592.347682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.347682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.695398 (E_RNA) where: Base-Base interactions energy: -434.888 where: short stacking energy: -167.172 Base-Backbone interact. energy: -0.001 local terms energy: -157.805846 where: bonds (distance) C4'-P energy: -25.648 bonds (distance) P-C4' energy: -31.215 flat angles C4'-P-C4' energy: -28.747 flat angles P-C4'-P energy: -22.780 tors. eta vs tors. theta energy: -49.416 Dist. restrs. and SS energy: 0.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -591.294798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.294798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.530961 (E_RNA) where: Base-Base interactions energy: -436.522 where: short stacking energy: -165.196 Base-Backbone interact. energy: -0.001 local terms energy: -155.862722 where: bonds (distance) C4'-P energy: -26.471 bonds (distance) P-C4' energy: -29.372 flat angles C4'-P-C4' energy: -32.064 flat angles P-C4'-P energy: -22.502 tors. eta vs tors. theta energy: -45.453 Dist. restrs. and SS energy: 0.236 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.855 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -586.099925 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.099925 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.690527 (E_RNA) where: Base-Base interactions energy: -424.875 where: short stacking energy: -166.510 Base-Backbone interact. energy: -0.012 local terms energy: -161.803528 where: bonds (distance) C4'-P energy: -26.786 bonds (distance) P-C4' energy: -28.033 flat angles C4'-P-C4' energy: -33.987 flat angles P-C4'-P energy: -23.972 tors. eta vs tors. theta energy: -49.026 Dist. restrs. and SS energy: 0.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -574.232168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.232168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.463393 (E_RNA) where: Base-Base interactions energy: -419.668 where: short stacking energy: -158.620 Base-Backbone interact. energy: -0.002 local terms energy: -155.864513 where: bonds (distance) C4'-P energy: -23.020 bonds (distance) P-C4' energy: -30.326 flat angles C4'-P-C4' energy: -31.752 flat angles P-C4'-P energy: -19.473 tors. eta vs tors. theta energy: -51.294 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.071 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -510.320369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.320369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.045273 (E_RNA) where: Base-Base interactions energy: -381.108 where: short stacking energy: -142.019 Base-Backbone interact. energy: 0.804 local terms energy: -130.741539 where: bonds (distance) C4'-P energy: -22.682 bonds (distance) P-C4' energy: -31.955 flat angles C4'-P-C4' energy: -21.226 flat angles P-C4'-P energy: -19.019 tors. eta vs tors. theta energy: -35.859 Dist. restrs. and SS energy: 0.725 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -558.302898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.302898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.873939 (E_RNA) where: Base-Base interactions energy: -417.948 where: short stacking energy: -162.249 Base-Backbone interact. energy: -0.004 local terms energy: -140.922804 where: bonds (distance) C4'-P energy: -19.943 bonds (distance) P-C4' energy: -21.662 flat angles C4'-P-C4' energy: -30.051 flat angles P-C4'-P energy: -20.585 tors. eta vs tors. theta energy: -48.682 Dist. restrs. and SS energy: 0.571 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -499.273669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.273669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.537447 (E_RNA) where: Base-Base interactions energy: -369.127 where: short stacking energy: -131.718 Base-Backbone interact. energy: -0.129 local terms energy: -131.310545 where: bonds (distance) C4'-P energy: -24.879 bonds (distance) P-C4' energy: -22.510 flat angles C4'-P-C4' energy: -27.565 flat angles P-C4'-P energy: -19.838 tors. eta vs tors. theta energy: -36.519 Dist. restrs. and SS energy: 1.264 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.029 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -493.468541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.468541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.391788 (E_RNA) where: Base-Base interactions energy: -371.037 where: short stacking energy: -134.406 Base-Backbone interact. energy: 0.937 local terms energy: -125.291964 where: bonds (distance) C4'-P energy: -24.022 bonds (distance) P-C4' energy: -19.488 flat angles C4'-P-C4' energy: -29.686 flat angles P-C4'-P energy: -16.600 tors. eta vs tors. theta energy: -35.496 Dist. restrs. and SS energy: 1.923 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -477.861207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -477.861207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.679975 (E_RNA) where: Base-Base interactions energy: -349.423 where: short stacking energy: -132.391 Base-Backbone interact. energy: -0.068 local terms energy: -131.188547 where: bonds (distance) C4'-P energy: -21.776 bonds (distance) P-C4' energy: -29.379 flat angles C4'-P-C4' energy: -24.844 flat angles P-C4'-P energy: -17.001 tors. eta vs tors. theta energy: -38.189 Dist. restrs. and SS energy: 2.819 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -616.782893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -616.782893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -616.904798 (E_RNA) where: Base-Base interactions energy: -446.633 where: short stacking energy: -173.233 Base-Backbone interact. energy: -0.158 local terms energy: -170.114599 where: bonds (distance) C4'-P energy: -29.334 bonds (distance) P-C4' energy: -28.420 flat angles C4'-P-C4' energy: -35.459 flat angles P-C4'-P energy: -23.776 tors. eta vs tors. theta energy: -53.127 Dist. restrs. and SS energy: 0.122 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -600.317467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.317467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.517870 (E_RNA) where: Base-Base interactions energy: -433.705 where: short stacking energy: -169.464 Base-Backbone interact. energy: -0.001 local terms energy: -166.812058 where: bonds (distance) C4'-P energy: -28.273 bonds (distance) P-C4' energy: -26.821 flat angles C4'-P-C4' energy: -35.206 flat angles P-C4'-P energy: -24.989 tors. eta vs tors. theta energy: -51.523 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -591.393046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.393046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.732851 (E_RNA) where: Base-Base interactions energy: -426.310 where: short stacking energy: -160.130 Base-Backbone interact. energy: -0.006 local terms energy: -165.417132 where: bonds (distance) C4'-P energy: -26.497 bonds (distance) P-C4' energy: -30.786 flat angles C4'-P-C4' energy: -30.112 flat angles P-C4'-P energy: -28.289 tors. eta vs tors. theta energy: -49.734 Dist. restrs. and SS energy: 0.340 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -576.921606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.921606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.486487 (E_RNA) where: Base-Base interactions energy: -423.388 where: short stacking energy: -163.088 Base-Backbone interact. energy: -0.000 local terms energy: -154.853963 where: bonds (distance) C4'-P energy: -30.359 bonds (distance) P-C4' energy: -20.685 flat angles C4'-P-C4' energy: -31.381 flat angles P-C4'-P energy: -24.026 tors. eta vs tors. theta energy: -48.404 Dist. restrs. and SS energy: 0.565 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.756 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -571.705309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.705309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.153697 (E_RNA) where: Base-Base interactions energy: -418.432 where: short stacking energy: -159.824 Base-Backbone interact. energy: -0.001 local terms energy: -153.908077 where: bonds (distance) C4'-P energy: -20.702 bonds (distance) P-C4' energy: -25.878 flat angles C4'-P-C4' energy: -30.933 flat angles P-C4'-P energy: -26.265 tors. eta vs tors. theta energy: -50.130 Dist. restrs. and SS energy: 0.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.188 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -522.100909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.100909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -522.661656 (E_RNA) where: Base-Base interactions energy: -398.613 where: short stacking energy: -138.781 Base-Backbone interact. energy: -0.070 local terms energy: -123.977883 where: bonds (distance) C4'-P energy: -19.125 bonds (distance) P-C4' energy: -29.409 flat angles C4'-P-C4' energy: -25.697 flat angles P-C4'-P energy: -12.676 tors. eta vs tors. theta energy: -37.070 Dist. restrs. and SS energy: 0.561 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -505.128007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.128007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.174554 (E_RNA) where: Base-Base interactions energy: -376.522 where: short stacking energy: -124.024 Base-Backbone interact. energy: 2.588 local terms energy: -132.240951 where: bonds (distance) C4'-P energy: -24.799 bonds (distance) P-C4' energy: -29.351 flat angles C4'-P-C4' energy: -27.071 flat angles P-C4'-P energy: -15.997 tors. eta vs tors. theta energy: -35.023 Dist. restrs. and SS energy: 1.047 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -556.834603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -556.834603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -557.013730 (E_RNA) where: Base-Base interactions energy: -404.973 where: short stacking energy: -153.388 Base-Backbone interact. energy: -0.004 local terms energy: -152.036830 where: bonds (distance) C4'-P energy: -27.708 bonds (distance) P-C4' energy: -20.843 flat angles C4'-P-C4' energy: -33.570 flat angles P-C4'-P energy: -20.853 tors. eta vs tors. theta energy: -49.062 Dist. restrs. and SS energy: 0.179 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -498.627341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.627341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.716181 (E_RNA) where: Base-Base interactions energy: -373.448 where: short stacking energy: -144.530 Base-Backbone interact. energy: -1.160 local terms energy: -127.108019 where: bonds (distance) C4'-P energy: -25.332 bonds (distance) P-C4' energy: -15.185 flat angles C4'-P-C4' energy: -29.256 flat angles P-C4'-P energy: -21.087 tors. eta vs tors. theta energy: -36.247 Dist. restrs. and SS energy: 3.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -460.834717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.834717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.896513 (E_RNA) where: Base-Base interactions energy: -351.638 where: short stacking energy: -129.561 Base-Backbone interact. energy: 0.074 local terms energy: -112.450827 where: bonds (distance) C4'-P energy: -26.193 bonds (distance) P-C4' energy: -18.955 flat angles C4'-P-C4' energy: -21.621 flat angles P-C4'-P energy: -12.541 tors. eta vs tors. theta energy: -33.140 Dist. restrs. and SS energy: 2.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.118 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -595.897536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.897536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.228299 (E_RNA) where: Base-Base interactions energy: -431.523 where: short stacking energy: -164.282 Base-Backbone interact. energy: -0.002 local terms energy: -164.702886 where: bonds (distance) C4'-P energy: -30.376 bonds (distance) P-C4' energy: -31.482 flat angles C4'-P-C4' energy: -29.420 flat angles P-C4'-P energy: -22.711 tors. eta vs tors. theta energy: -50.714 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -600.127180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.127180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.231383 (E_RNA) where: Base-Base interactions energy: -439.704 where: short stacking energy: -169.668 Base-Backbone interact. energy: -0.001 local terms energy: -160.527229 where: bonds (distance) C4'-P energy: -27.537 bonds (distance) P-C4' energy: -26.327 flat angles C4'-P-C4' energy: -33.601 flat angles P-C4'-P energy: -24.683 tors. eta vs tors. theta energy: -48.380 Dist. restrs. and SS energy: 0.104 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -582.727236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.727236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.968221 (E_RNA) where: Base-Base interactions energy: -431.146 where: short stacking energy: -165.895 Base-Backbone interact. energy: -0.010 local terms energy: -151.812887 where: bonds (distance) C4'-P energy: -23.635 bonds (distance) P-C4' energy: -26.043 flat angles C4'-P-C4' energy: -28.421 flat angles P-C4'-P energy: -24.741 tors. eta vs tors. theta energy: -48.974 Dist. restrs. and SS energy: 0.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -583.515748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.515748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.786555 (E_RNA) where: Base-Base interactions energy: -423.575 where: short stacking energy: -163.982 Base-Backbone interact. energy: -0.008 local terms energy: -160.203819 where: bonds (distance) C4'-P energy: -25.149 bonds (distance) P-C4' energy: -29.923 flat angles C4'-P-C4' energy: -32.510 flat angles P-C4'-P energy: -22.992 tors. eta vs tors. theta energy: -49.628 Dist. restrs. and SS energy: 0.271 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -578.266093 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.266093 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.974447 (E_RNA) where: Base-Base interactions energy: -429.297 where: short stacking energy: -167.507 Base-Backbone interact. energy: -0.001 local terms energy: -149.688198 where: bonds (distance) C4'-P energy: -18.492 bonds (distance) P-C4' energy: -25.504 flat angles C4'-P-C4' energy: -32.446 flat angles P-C4'-P energy: -24.889 tors. eta vs tors. theta energy: -48.357 Dist. restrs. and SS energy: 0.708 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.012 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -516.912263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.912263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.919642 (E_RNA) where: Base-Base interactions energy: -375.281 where: short stacking energy: -145.418 Base-Backbone interact. energy: 0.718 local terms energy: -144.356893 where: bonds (distance) C4'-P energy: -26.570 bonds (distance) P-C4' energy: -29.900 flat angles C4'-P-C4' energy: -26.646 flat angles P-C4'-P energy: -22.934 tors. eta vs tors. theta energy: -38.307 Dist. restrs. and SS energy: 2.007 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -516.168723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.168723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.424835 (E_RNA) where: Base-Base interactions energy: -375.163 where: short stacking energy: -141.836 Base-Backbone interact. energy: -0.036 local terms energy: -142.226422 where: bonds (distance) C4'-P energy: -27.199 bonds (distance) P-C4' energy: -26.186 flat angles C4'-P-C4' energy: -30.114 flat angles P-C4'-P energy: -20.021 tors. eta vs tors. theta energy: -38.706 Dist. restrs. and SS energy: 1.256 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -549.132583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.132583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.920874 (E_RNA) where: Base-Base interactions energy: -408.245 where: short stacking energy: -153.925 Base-Backbone interact. energy: -0.000 local terms energy: -141.675822 where: bonds (distance) C4'-P energy: -26.633 bonds (distance) P-C4' energy: -18.972 flat angles C4'-P-C4' energy: -32.177 flat angles P-C4'-P energy: -16.586 tors. eta vs tors. theta energy: -47.308 Dist. restrs. and SS energy: 0.788 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -512.313862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.313862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.560366 (E_RNA) where: Base-Base interactions energy: -381.789 where: short stacking energy: -141.030 Base-Backbone interact. energy: 1.868 local terms energy: -133.639641 where: bonds (distance) C4'-P energy: -22.017 bonds (distance) P-C4' energy: -31.575 flat angles C4'-P-C4' energy: -23.416 flat angles P-C4'-P energy: -19.037 tors. eta vs tors. theta energy: -37.594 Dist. restrs. and SS energy: 1.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -482.706189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.706189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.477567 (E_RNA) where: Base-Base interactions energy: -352.651 where: short stacking energy: -125.579 Base-Backbone interact. energy: 0.540 local terms energy: -131.366513 where: bonds (distance) C4'-P energy: -20.732 bonds (distance) P-C4' energy: -27.143 flat angles C4'-P-C4' energy: -30.041 flat angles P-C4'-P energy: -19.150 tors. eta vs tors. theta energy: -34.300 Dist. restrs. and SS energy: 0.771 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -600.470457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.470457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.832536 (E_RNA) where: Base-Base interactions energy: -435.884 where: short stacking energy: -169.517 Base-Backbone interact. energy: -0.868 local terms energy: -164.637387 where: bonds (distance) C4'-P energy: -27.349 bonds (distance) P-C4' energy: -32.861 flat angles C4'-P-C4' energy: -29.880 flat angles P-C4'-P energy: -22.964 tors. eta vs tors. theta energy: -51.583 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.557 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -594.960763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.960763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.173353 (E_RNA) where: Base-Base interactions energy: -431.385 where: short stacking energy: -165.194 Base-Backbone interact. energy: -0.002 local terms energy: -163.786370 where: bonds (distance) C4'-P energy: -27.721 bonds (distance) P-C4' energy: -30.340 flat angles C4'-P-C4' energy: -30.659 flat angles P-C4'-P energy: -25.574 tors. eta vs tors. theta energy: -49.493 Dist. restrs. and SS energy: 0.213 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -582.275610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.275610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.868816 (E_RNA) where: Base-Base interactions energy: -431.195 where: short stacking energy: -170.079 Base-Backbone interact. energy: -0.002 local terms energy: -151.671225 where: bonds (distance) C4'-P energy: -20.228 bonds (distance) P-C4' energy: -26.491 flat angles C4'-P-C4' energy: -29.764 flat angles P-C4'-P energy: -25.538 tors. eta vs tors. theta energy: -49.649 Dist. restrs. and SS energy: 0.593 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -588.119676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.119676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.292994 (E_RNA) where: Base-Base interactions energy: -431.852 where: short stacking energy: -167.637 Base-Backbone interact. energy: -0.239 local terms energy: -156.713652 where: bonds (distance) C4'-P energy: -30.433 bonds (distance) P-C4' energy: -24.222 flat angles C4'-P-C4' energy: -27.819 flat angles P-C4'-P energy: -23.859 tors. eta vs tors. theta energy: -50.381 Dist. restrs. and SS energy: 0.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.512 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -532.363756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -532.363756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.961243 (E_RNA) where: Base-Base interactions energy: -390.257 where: short stacking energy: -149.624 Base-Backbone interact. energy: 2.966 local terms energy: -146.670444 where: bonds (distance) C4'-P energy: -24.566 bonds (distance) P-C4' energy: -30.718 flat angles C4'-P-C4' energy: -31.330 flat angles P-C4'-P energy: -22.651 tors. eta vs tors. theta energy: -37.404 Dist. restrs. and SS energy: 1.597 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -572.273302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.273302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.631425 (E_RNA) where: Base-Base interactions energy: -430.253 where: short stacking energy: -169.659 Base-Backbone interact. energy: -0.001 local terms energy: -142.377336 where: bonds (distance) C4'-P energy: -20.430 bonds (distance) P-C4' energy: -22.210 flat angles C4'-P-C4' energy: -31.578 flat angles P-C4'-P energy: -19.221 tors. eta vs tors. theta energy: -48.938 Dist. restrs. and SS energy: 0.358 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -555.219141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.219141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.544667 (E_RNA) where: Base-Base interactions energy: -409.170 where: short stacking energy: -155.263 Base-Backbone interact. energy: -0.001 local terms energy: -146.373541 where: bonds (distance) C4'-P energy: -26.227 bonds (distance) P-C4' energy: -22.778 flat angles C4'-P-C4' energy: -28.487 flat angles P-C4'-P energy: -22.571 tors. eta vs tors. theta energy: -46.311 Dist. restrs. and SS energy: 0.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -498.153568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.153568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.475128 (E_RNA) where: Base-Base interactions energy: -372.290 where: short stacking energy: -130.461 Base-Backbone interact. energy: -0.487 local terms energy: -126.698113 where: bonds (distance) C4'-P energy: -23.104 bonds (distance) P-C4' energy: -21.440 flat angles C4'-P-C4' energy: -31.441 flat angles P-C4'-P energy: -11.231 tors. eta vs tors. theta energy: -39.482 Dist. restrs. and SS energy: 1.322 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -485.974429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.974429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.797374 (E_RNA) where: Base-Base interactions energy: -361.582 where: short stacking energy: -123.839 Base-Backbone interact. energy: 0.194 local terms energy: -125.409678 where: bonds (distance) C4'-P energy: -24.351 bonds (distance) P-C4' energy: -14.652 flat angles C4'-P-C4' energy: -27.503 flat angles P-C4'-P energy: -21.606 tors. eta vs tors. theta energy: -37.298 Dist. restrs. and SS energy: 0.823 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -493.817726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.817726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.360912 (E_RNA) where: Base-Base interactions energy: -373.786 where: short stacking energy: -132.188 Base-Backbone interact. energy: 0.442 local terms energy: -123.017490 where: bonds (distance) C4'-P energy: -14.205 bonds (distance) P-C4' energy: -22.215 flat angles C4'-P-C4' energy: -28.952 flat angles P-C4'-P energy: -19.086 tors. eta vs tors. theta energy: -38.559 Dist. restrs. and SS energy: 2.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -603.158492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.158492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.433579 (E_RNA) where: Base-Base interactions energy: -438.382 where: short stacking energy: -169.307 Base-Backbone interact. energy: -0.001 local terms energy: -165.508378 where: bonds (distance) C4'-P energy: -26.392 bonds (distance) P-C4' energy: -28.194 flat angles C4'-P-C4' energy: -34.215 flat angles P-C4'-P energy: -25.441 tors. eta vs tors. theta energy: -51.267 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.458 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -592.561146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.561146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.648055 (E_RNA) where: Base-Base interactions energy: -433.390 where: short stacking energy: -163.764 Base-Backbone interact. energy: -0.405 local terms energy: -158.917971 where: bonds (distance) C4'-P energy: -26.543 bonds (distance) P-C4' energy: -30.885 flat angles C4'-P-C4' energy: -28.748 flat angles P-C4'-P energy: -22.318 tors. eta vs tors. theta energy: -50.424 Dist. restrs. and SS energy: 0.087 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.066 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -589.257981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.257981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.451098 (E_RNA) where: Base-Base interactions energy: -430.919 where: short stacking energy: -167.876 Base-Backbone interact. energy: -0.005 local terms energy: -158.527033 where: bonds (distance) C4'-P energy: -20.898 bonds (distance) P-C4' energy: -26.436 flat angles C4'-P-C4' energy: -35.487 flat angles P-C4'-P energy: -24.208 tors. eta vs tors. theta energy: -51.497 Dist. restrs. and SS energy: 0.193 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -588.399160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.399160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.477070 (E_RNA) where: Base-Base interactions energy: -428.236 where: short stacking energy: -162.629 Base-Backbone interact. energy: -0.002 local terms energy: -160.238997 where: bonds (distance) C4'-P energy: -26.555 bonds (distance) P-C4' energy: -26.213 flat angles C4'-P-C4' energy: -32.970 flat angles P-C4'-P energy: -22.480 tors. eta vs tors. theta energy: -52.021 Dist. restrs. and SS energy: 0.078 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -536.109487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -536.109487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -536.623498 (E_RNA) where: Base-Base interactions energy: -410.251 where: short stacking energy: -151.939 Base-Backbone interact. energy: 1.691 local terms energy: -128.064145 where: bonds (distance) C4'-P energy: -19.647 bonds (distance) P-C4' energy: -23.337 flat angles C4'-P-C4' energy: -29.285 flat angles P-C4'-P energy: -18.287 tors. eta vs tors. theta energy: -37.508 Dist. restrs. and SS energy: 0.514 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -569.197861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.197861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.316718 (E_RNA) where: Base-Base interactions energy: -423.003 where: short stacking energy: -166.926 Base-Backbone interact. energy: -0.003 local terms energy: -146.310668 where: bonds (distance) C4'-P energy: -19.525 bonds (distance) P-C4' energy: -27.832 flat angles C4'-P-C4' energy: -28.912 flat angles P-C4'-P energy: -22.003 tors. eta vs tors. theta energy: -48.038 Dist. restrs. and SS energy: 0.119 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -558.524432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.524432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.060094 (E_RNA) where: Base-Base interactions energy: -405.265 where: short stacking energy: -148.607 Base-Backbone interact. energy: -0.001 local terms energy: -153.793912 where: bonds (distance) C4'-P energy: -24.600 bonds (distance) P-C4' energy: -27.397 flat angles C4'-P-C4' energy: -31.287 flat angles P-C4'-P energy: -20.306 tors. eta vs tors. theta energy: -50.203 Dist. restrs. and SS energy: 0.536 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -510.210252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.210252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.491753 (E_RNA) where: Base-Base interactions energy: -378.101 where: short stacking energy: -142.364 Base-Backbone interact. energy: 0.748 local terms energy: -134.138259 where: bonds (distance) C4'-P energy: -28.293 bonds (distance) P-C4' energy: -23.184 flat angles C4'-P-C4' energy: -26.676 flat angles P-C4'-P energy: -16.613 tors. eta vs tors. theta energy: -39.372 Dist. restrs. and SS energy: 1.282 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -479.226799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -479.226799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.069344 (E_RNA) where: Base-Base interactions energy: -360.176 where: short stacking energy: -126.859 Base-Backbone interact. energy: 1.058 local terms energy: -122.951326 where: bonds (distance) C4'-P energy: -20.406 bonds (distance) P-C4' energy: -24.947 flat angles C4'-P-C4' energy: -24.951 flat angles P-C4'-P energy: -14.079 tors. eta vs tors. theta energy: -38.568 Dist. restrs. and SS energy: 2.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -471.753088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.753088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.135159 (E_RNA) where: Base-Base interactions energy: -352.571 where: short stacking energy: -129.046 Base-Backbone interact. energy: 0.799 local terms energy: -124.362898 where: bonds (distance) C4'-P energy: -18.199 bonds (distance) P-C4' energy: -24.006 flat angles C4'-P-C4' energy: -29.624 flat angles P-C4'-P energy: -19.163 tors. eta vs tors. theta energy: -33.371 Dist. restrs. and SS energy: 4.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -608.899949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.899949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.997606 (E_RNA) where: Base-Base interactions energy: -444.716 where: short stacking energy: -172.370 Base-Backbone interact. energy: -0.001 local terms energy: -164.280253 where: bonds (distance) C4'-P energy: -29.335 bonds (distance) P-C4' energy: -31.477 flat angles C4'-P-C4' energy: -32.786 flat angles P-C4'-P energy: -21.583 tors. eta vs tors. theta energy: -49.099 Dist. restrs. and SS energy: 0.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -589.564155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.564155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.822517 (E_RNA) where: Base-Base interactions energy: -439.337 where: short stacking energy: -168.471 Base-Backbone interact. energy: -0.002 local terms energy: -151.433708 where: bonds (distance) C4'-P energy: -23.672 bonds (distance) P-C4' energy: -24.363 flat angles C4'-P-C4' energy: -31.634 flat angles P-C4'-P energy: -22.372 tors. eta vs tors. theta energy: -49.393 Dist. restrs. and SS energy: 0.258 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.950 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -601.666024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.666024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.772819 (E_RNA) where: Base-Base interactions energy: -438.021 where: short stacking energy: -166.596 Base-Backbone interact. energy: -0.004 local terms energy: -163.747194 where: bonds (distance) C4'-P energy: -31.522 bonds (distance) P-C4' energy: -27.110 flat angles C4'-P-C4' energy: -32.322 flat angles P-C4'-P energy: -23.137 tors. eta vs tors. theta energy: -49.655 Dist. restrs. and SS energy: 0.107 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -582.464877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.464877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.590530 (E_RNA) where: Base-Base interactions energy: -429.955 where: short stacking energy: -165.647 Base-Backbone interact. energy: -0.001 local terms energy: -152.635233 where: bonds (distance) C4'-P energy: -25.951 bonds (distance) P-C4' energy: -24.548 flat angles C4'-P-C4' energy: -32.561 flat angles P-C4'-P energy: -21.257 tors. eta vs tors. theta energy: -48.318 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -579.082727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.082727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.457605 (E_RNA) where: Base-Base interactions energy: -428.961 where: short stacking energy: -164.838 Base-Backbone interact. energy: -0.000 local terms energy: -152.015209 where: bonds (distance) C4'-P energy: -26.153 bonds (distance) P-C4' energy: -23.989 flat angles C4'-P-C4' energy: -29.024 flat angles P-C4'-P energy: -22.354 tors. eta vs tors. theta energy: -50.496 Dist. restrs. and SS energy: 0.375 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.519 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -529.635193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -529.635193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.038143 (E_RNA) where: Base-Base interactions energy: -395.930 where: short stacking energy: -150.731 Base-Backbone interact. energy: 0.194 local terms energy: -134.301538 where: bonds (distance) C4'-P energy: -24.661 bonds (distance) P-C4' energy: -26.151 flat angles C4'-P-C4' energy: -26.283 flat angles P-C4'-P energy: -19.734 tors. eta vs tors. theta energy: -37.473 Dist. restrs. and SS energy: 0.403 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -565.248187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.248187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.943362 (E_RNA) where: Base-Base interactions energy: -417.367 where: short stacking energy: -162.163 Base-Backbone interact. energy: -0.004 local terms energy: -148.572381 where: bonds (distance) C4'-P energy: -24.774 bonds (distance) P-C4' energy: -23.140 flat angles C4'-P-C4' energy: -28.920 flat angles P-C4'-P energy: -21.565 tors. eta vs tors. theta energy: -50.173 Dist. restrs. and SS energy: 0.695 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -506.364951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.364951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.806737 (E_RNA) where: Base-Base interactions energy: -378.466 where: short stacking energy: -142.475 Base-Backbone interact. energy: -0.626 local terms energy: -127.714908 where: bonds (distance) C4'-P energy: -19.538 bonds (distance) P-C4' energy: -25.629 flat angles C4'-P-C4' energy: -29.444 flat angles P-C4'-P energy: -16.520 tors. eta vs tors. theta energy: -36.585 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -503.610317 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -503.610317 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -505.830055 (E_RNA) where: Base-Base interactions energy: -370.917 where: short stacking energy: -132.409 Base-Backbone interact. energy: -2.424 local terms energy: -132.489391 where: bonds (distance) C4'-P energy: -18.112 bonds (distance) P-C4' energy: -31.995 flat angles C4'-P-C4' energy: -21.970 flat angles P-C4'-P energy: -22.025 tors. eta vs tors. theta energy: -38.388 Dist. restrs. and SS energy: 2.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -490.468475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.468475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.910171 (E_RNA) where: Base-Base interactions energy: -365.692 where: short stacking energy: -130.312 Base-Backbone interact. energy: 0.261 local terms energy: -125.478973 where: bonds (distance) C4'-P energy: -15.799 bonds (distance) P-C4' energy: -25.065 flat angles C4'-P-C4' energy: -22.722 flat angles P-C4'-P energy: -23.116 tors. eta vs tors. theta energy: -38.779 Dist. restrs. and SS energy: 0.442 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -612.796679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.796679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.158399 (E_RNA) where: Base-Base interactions energy: -441.905 where: short stacking energy: -172.031 Base-Backbone interact. energy: -0.002 local terms energy: -171.250939 where: bonds (distance) C4'-P energy: -33.580 bonds (distance) P-C4' energy: -29.345 flat angles C4'-P-C4' energy: -34.007 flat angles P-C4'-P energy: -23.830 tors. eta vs tors. theta energy: -50.489 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -601.174625 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.174625 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.374915 (E_RNA) where: Base-Base interactions energy: -443.394 where: short stacking energy: -170.260 Base-Backbone interact. energy: -0.005 local terms energy: -157.976463 where: bonds (distance) C4'-P energy: -26.342 bonds (distance) P-C4' energy: -29.082 flat angles C4'-P-C4' energy: -30.656 flat angles P-C4'-P energy: -22.123 tors. eta vs tors. theta energy: -49.773 Dist. restrs. and SS energy: 0.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -588.022356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.022356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.187778 (E_RNA) where: Base-Base interactions energy: -433.077 where: short stacking energy: -164.145 Base-Backbone interact. energy: -0.001 local terms energy: -159.214799 where: bonds (distance) C4'-P energy: -26.565 bonds (distance) P-C4' energy: -22.855 flat angles C4'-P-C4' energy: -31.963 flat angles P-C4'-P energy: -27.367 tors. eta vs tors. theta energy: -50.466 Dist. restrs. and SS energy: 0.165 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 4.104 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -588.927811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.927811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.021463 (E_RNA) where: Base-Base interactions energy: -427.261 where: short stacking energy: -166.664 Base-Backbone interact. energy: -0.000 local terms energy: -161.760159 where: bonds (distance) C4'-P energy: -27.522 bonds (distance) P-C4' energy: -27.001 flat angles C4'-P-C4' energy: -34.319 flat angles P-C4'-P energy: -22.175 tors. eta vs tors. theta energy: -50.743 Dist. restrs. and SS energy: 0.094 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -569.945763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.945763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.263956 (E_RNA) where: Base-Base interactions energy: -422.627 where: short stacking energy: -164.874 Base-Backbone interact. energy: -0.001 local terms energy: -147.635776 where: bonds (distance) C4'-P energy: -27.904 bonds (distance) P-C4' energy: -21.248 flat angles C4'-P-C4' energy: -32.810 flat angles P-C4'-P energy: -18.698 tors. eta vs tors. theta energy: -46.975 Dist. restrs. and SS energy: 0.318 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -570.723375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.723375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.604219 (E_RNA) where: Base-Base interactions energy: -416.444 where: short stacking energy: -163.654 Base-Backbone interact. energy: -0.076 local terms energy: -155.084028 where: bonds (distance) C4'-P energy: -25.413 bonds (distance) P-C4' energy: -30.740 flat angles C4'-P-C4' energy: -30.243 flat angles P-C4'-P energy: -21.578 tors. eta vs tors. theta energy: -47.110 Dist. restrs. and SS energy: 0.881 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -512.244572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.244572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.821795 (E_RNA) where: Base-Base interactions energy: -371.246 where: short stacking energy: -134.429 Base-Backbone interact. energy: -0.518 local terms energy: -144.057908 where: bonds (distance) C4'-P energy: -29.924 bonds (distance) P-C4' energy: -25.003 flat angles C4'-P-C4' energy: -30.682 flat angles P-C4'-P energy: -22.923 tors. eta vs tors. theta energy: -35.526 Dist. restrs. and SS energy: 3.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -504.759521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.759521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.608325 (E_RNA) where: Base-Base interactions energy: -359.629 where: short stacking energy: -131.583 Base-Backbone interact. energy: -0.866 local terms energy: -148.113643 where: bonds (distance) C4'-P energy: -27.254 bonds (distance) P-C4' energy: -28.955 flat angles C4'-P-C4' energy: -29.516 flat angles P-C4'-P energy: -23.424 tors. eta vs tors. theta energy: -38.965 Dist. restrs. and SS energy: 3.849 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -509.456881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.456881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.509362 (E_RNA) where: Base-Base interactions energy: -385.311 where: short stacking energy: -140.860 Base-Backbone interact. energy: -0.106 local terms energy: -125.092398 where: bonds (distance) C4'-P energy: -18.021 bonds (distance) P-C4' energy: -25.220 flat angles C4'-P-C4' energy: -28.617 flat angles P-C4'-P energy: -14.442 tors. eta vs tors. theta energy: -38.792 Dist. restrs. and SS energy: 1.052 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -466.714702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.714702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.239885 (E_RNA) where: Base-Base interactions energy: -340.393 where: short stacking energy: -129.157 Base-Backbone interact. energy: -0.476 local terms energy: -128.370850 where: bonds (distance) C4'-P energy: -24.430 bonds (distance) P-C4' energy: -22.985 flat angles C4'-P-C4' energy: -31.374 flat angles P-C4'-P energy: -11.147 tors. eta vs tors. theta energy: -38.434 Dist. restrs. and SS energy: 2.525 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -600.555713 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.555713 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.790552 (E_RNA) where: Base-Base interactions energy: -435.744 where: short stacking energy: -166.705 Base-Backbone interact. energy: -0.002 local terms energy: -165.044194 where: bonds (distance) C4'-P energy: -28.693 bonds (distance) P-C4' energy: -31.097 flat angles C4'-P-C4' energy: -32.147 flat angles P-C4'-P energy: -24.220 tors. eta vs tors. theta energy: -48.888 Dist. restrs. and SS energy: 0.235 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -592.060145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.060145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.331790 (E_RNA) where: Base-Base interactions energy: -431.777 where: short stacking energy: -163.529 Base-Backbone interact. energy: -0.002 local terms energy: -160.552788 where: bonds (distance) C4'-P energy: -24.826 bonds (distance) P-C4' energy: -29.823 flat angles C4'-P-C4' energy: -32.504 flat angles P-C4'-P energy: -23.555 tors. eta vs tors. theta energy: -49.846 Dist. restrs. and SS energy: 0.272 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -584.878325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.878325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.098425 (E_RNA) where: Base-Base interactions energy: -433.603 where: short stacking energy: -170.030 Base-Backbone interact. energy: -0.005 local terms energy: -151.490875 where: bonds (distance) C4'-P energy: -27.059 bonds (distance) P-C4' energy: -23.076 flat angles C4'-P-C4' energy: -33.352 flat angles P-C4'-P energy: -17.767 tors. eta vs tors. theta energy: -50.237 Dist. restrs. and SS energy: 0.220 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -584.647379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.647379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.402701 (E_RNA) where: Base-Base interactions energy: -433.175 where: short stacking energy: -170.807 Base-Backbone interact. energy: -0.001 local terms energy: -152.226687 where: bonds (distance) C4'-P energy: -23.582 bonds (distance) P-C4' energy: -23.134 flat angles C4'-P-C4' energy: -32.269 flat angles P-C4'-P energy: -23.437 tors. eta vs tors. theta energy: -49.804 Dist. restrs. and SS energy: 0.755 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -579.678030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.678030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.056998 (E_RNA) where: Base-Base interactions energy: -415.284 where: short stacking energy: -163.096 Base-Backbone interact. energy: -0.239 local terms energy: -164.533586 where: bonds (distance) C4'-P energy: -24.726 bonds (distance) P-C4' energy: -34.081 flat angles C4'-P-C4' energy: -32.773 flat angles P-C4'-P energy: -23.580 tors. eta vs tors. theta energy: -49.373 Dist. restrs. and SS energy: 0.379 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -568.781462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.781462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.680118 (E_RNA) where: Base-Base interactions energy: -414.047 where: short stacking energy: -160.589 Base-Backbone interact. energy: -0.002 local terms energy: -156.270794 where: bonds (distance) C4'-P energy: -25.658 bonds (distance) P-C4' energy: -28.602 flat angles C4'-P-C4' energy: -27.397 flat angles P-C4'-P energy: -23.473 tors. eta vs tors. theta energy: -51.141 Dist. restrs. and SS energy: 0.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.639 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -511.852641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -511.852641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.063059 (E_RNA) where: Base-Base interactions energy: -376.984 where: short stacking energy: -140.377 Base-Backbone interact. energy: 1.644 local terms energy: -138.722510 where: bonds (distance) C4'-P energy: -20.406 bonds (distance) P-C4' energy: -27.279 flat angles C4'-P-C4' energy: -29.686 flat angles P-C4'-P energy: -21.213 tors. eta vs tors. theta energy: -40.139 Dist. restrs. and SS energy: 2.210 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -517.386664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.386664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.576872 (E_RNA) where: Base-Base interactions energy: -386.959 where: short stacking energy: -143.179 Base-Backbone interact. energy: -0.092 local terms energy: -130.526386 where: bonds (distance) C4'-P energy: -16.036 bonds (distance) P-C4' energy: -23.386 flat angles C4'-P-C4' energy: -27.631 flat angles P-C4'-P energy: -23.614 tors. eta vs tors. theta energy: -39.859 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -498.413875 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -498.413875 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.810916 (E_RNA) where: Base-Base interactions energy: -377.524 where: short stacking energy: -146.343 Base-Backbone interact. energy: 2.687 local terms energy: -124.973334 where: bonds (distance) C4'-P energy: -17.320 bonds (distance) P-C4' energy: -24.983 flat angles C4'-P-C4' energy: -27.052 flat angles P-C4'-P energy: -16.547 tors. eta vs tors. theta energy: -39.071 Dist. restrs. and SS energy: 1.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -470.233780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.233780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.025911 (E_RNA) where: Base-Base interactions energy: -363.900 where: short stacking energy: -132.594 Base-Backbone interact. energy: -0.085 local terms energy: -108.040077 where: bonds (distance) C4'-P energy: -19.062 bonds (distance) P-C4' energy: -17.226 flat angles C4'-P-C4' energy: -24.625 flat angles P-C4'-P energy: -14.215 tors. eta vs tors. theta energy: -32.912 Dist. restrs. and SS energy: 1.792 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -597.973333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.973333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.093780 (E_RNA) where: Base-Base interactions energy: -433.916 where: short stacking energy: -166.488 Base-Backbone interact. energy: -0.238 local terms energy: -163.939527 where: bonds (distance) C4'-P energy: -28.773 bonds (distance) P-C4' energy: -32.473 flat angles C4'-P-C4' energy: -31.276 flat angles P-C4'-P energy: -23.193 tors. eta vs tors. theta energy: -48.225 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -597.060216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.060216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.529315 (E_RNA) where: Base-Base interactions energy: -436.461 where: short stacking energy: -165.363 Base-Backbone interact. energy: -0.002 local terms energy: -161.066102 where: bonds (distance) C4'-P energy: -29.164 bonds (distance) P-C4' energy: -30.374 flat angles C4'-P-C4' energy: -30.915 flat angles P-C4'-P energy: -20.619 tors. eta vs tors. theta energy: -49.994 Dist. restrs. and SS energy: 0.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -588.704253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.704253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.885292 (E_RNA) where: Base-Base interactions energy: -437.420 where: short stacking energy: -169.152 Base-Backbone interact. energy: -0.042 local terms energy: -152.728271 where: bonds (distance) C4'-P energy: -19.116 bonds (distance) P-C4' energy: -30.552 flat angles C4'-P-C4' energy: -28.161 flat angles P-C4'-P energy: -24.230 tors. eta vs tors. theta energy: -50.668 Dist. restrs. and SS energy: 0.181 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.305 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -586.951969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.951969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.342302 (E_RNA) where: Base-Base interactions energy: -429.913 where: short stacking energy: -169.445 Base-Backbone interact. energy: -0.122 local terms energy: -157.307972 where: bonds (distance) C4'-P energy: -24.567 bonds (distance) P-C4' energy: -26.743 flat angles C4'-P-C4' energy: -33.073 flat angles P-C4'-P energy: -23.306 tors. eta vs tors. theta energy: -49.619 Dist. restrs. and SS energy: 0.390 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -580.778279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.778279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.384131 (E_RNA) where: Base-Base interactions energy: -428.202 where: short stacking energy: -168.515 Base-Backbone interact. energy: -0.123 local terms energy: -153.059392 where: bonds (distance) C4'-P energy: -18.985 bonds (distance) P-C4' energy: -27.068 flat angles C4'-P-C4' energy: -32.615 flat angles P-C4'-P energy: -23.301 tors. eta vs tors. theta energy: -51.090 Dist. restrs. and SS energy: 0.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -578.903831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.903831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.248936 (E_RNA) where: Base-Base interactions energy: -420.464 where: short stacking energy: -160.384 Base-Backbone interact. energy: -0.004 local terms energy: -158.780637 where: bonds (distance) C4'-P energy: -24.281 bonds (distance) P-C4' energy: -26.475 flat angles C4'-P-C4' energy: -33.020 flat angles P-C4'-P energy: -23.318 tors. eta vs tors. theta energy: -51.687 Dist. restrs. and SS energy: 0.345 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -518.323313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.323313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.082368 (E_RNA) where: Base-Base interactions energy: -387.381 where: short stacking energy: -138.336 Base-Backbone interact. energy: 0.173 local terms energy: -132.874828 where: bonds (distance) C4'-P energy: -21.843 bonds (distance) P-C4' energy: -28.114 flat angles C4'-P-C4' energy: -30.820 flat angles P-C4'-P energy: -12.583 tors. eta vs tors. theta energy: -39.515 Dist. restrs. and SS energy: 1.759 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -482.922167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.922167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.765027 (E_RNA) where: Base-Base interactions energy: -348.327 where: short stacking energy: -131.792 Base-Backbone interact. energy: -2.330 local terms energy: -138.129217 where: bonds (distance) C4'-P energy: -26.499 bonds (distance) P-C4' energy: -26.976 flat angles C4'-P-C4' energy: -26.964 flat angles P-C4'-P energy: -20.588 tors. eta vs tors. theta energy: -37.103 Dist. restrs. and SS energy: 5.843 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.021 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -494.191472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -494.191472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.537895 (E_RNA) where: Base-Base interactions energy: -369.902 where: short stacking energy: -126.841 Base-Backbone interact. energy: 4.504 local terms energy: -129.139843 where: bonds (distance) C4'-P energy: -20.477 bonds (distance) P-C4' energy: -26.420 flat angles C4'-P-C4' energy: -28.824 flat angles P-C4'-P energy: -14.857 tors. eta vs tors. theta energy: -38.561 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -481.135734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.135734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.611957 (E_RNA) where: Base-Base interactions energy: -355.653 where: short stacking energy: -132.178 Base-Backbone interact. energy: 0.795 local terms energy: -127.754076 where: bonds (distance) C4'-P energy: -27.650 bonds (distance) P-C4' energy: -23.116 flat angles C4'-P-C4' energy: -31.260 flat angles P-C4'-P energy: -8.838 tors. eta vs tors. theta energy: -36.890 Dist. restrs. and SS energy: 1.476 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -598.856055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.856055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.920677 (E_RNA) where: Base-Base interactions energy: -434.701 where: short stacking energy: -166.236 Base-Backbone interact. energy: -0.000 local terms energy: -164.218948 where: bonds (distance) C4'-P energy: -23.726 bonds (distance) P-C4' energy: -31.373 flat angles C4'-P-C4' energy: -32.474 flat angles P-C4'-P energy: -27.138 tors. eta vs tors. theta energy: -49.509 Dist. restrs. and SS energy: 0.065 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -592.331704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.331704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.868569 (E_RNA) where: Base-Base interactions energy: -426.784 where: short stacking energy: -168.111 Base-Backbone interact. energy: -0.004 local terms energy: -166.081061 where: bonds (distance) C4'-P energy: -26.280 bonds (distance) P-C4' energy: -29.944 flat angles C4'-P-C4' energy: -33.835 flat angles P-C4'-P energy: -24.642 tors. eta vs tors. theta energy: -51.379 Dist. restrs. and SS energy: 0.537 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -591.079462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.079462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.450633 (E_RNA) where: Base-Base interactions energy: -432.092 where: short stacking energy: -169.849 Base-Backbone interact. energy: -0.002 local terms energy: -160.071248 where: bonds (distance) C4'-P energy: -23.942 bonds (distance) P-C4' energy: -27.973 flat angles C4'-P-C4' energy: -34.110 flat angles P-C4'-P energy: -23.170 tors. eta vs tors. theta energy: -50.876 Dist. restrs. and SS energy: 0.371 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.714 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -589.897657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.897657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -590.170892 (E_RNA) where: Base-Base interactions energy: -427.242 where: short stacking energy: -166.064 Base-Backbone interact. energy: -0.167 local terms energy: -162.762141 where: bonds (distance) C4'-P energy: -26.641 bonds (distance) P-C4' energy: -27.546 flat angles C4'-P-C4' energy: -32.759 flat angles P-C4'-P energy: -24.543 tors. eta vs tors. theta energy: -51.273 Dist. restrs. and SS energy: 0.273 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -583.647251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.647251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.843652 (E_RNA) where: Base-Base interactions energy: -418.218 where: short stacking energy: -158.638 Base-Backbone interact. energy: -0.280 local terms energy: -165.346035 where: bonds (distance) C4'-P energy: -29.563 bonds (distance) P-C4' energy: -30.287 flat angles C4'-P-C4' energy: -31.056 flat angles P-C4'-P energy: -23.244 tors. eta vs tors. theta energy: -51.196 Dist. restrs. and SS energy: 0.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -570.602230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.602230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.106033 (E_RNA) where: Base-Base interactions energy: -417.839 where: short stacking energy: -160.532 Base-Backbone interact. energy: -0.125 local terms energy: -153.142390 where: bonds (distance) C4'-P energy: -19.251 bonds (distance) P-C4' energy: -29.496 flat angles C4'-P-C4' energy: -33.219 flat angles P-C4'-P energy: -21.857 tors. eta vs tors. theta energy: -49.319 Dist. restrs. and SS energy: 0.504 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -515.453930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.453930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.820030 (E_RNA) where: Base-Base interactions energy: -379.995 where: short stacking energy: -145.582 Base-Backbone interact. energy: 0.069 local terms energy: -137.893892 where: bonds (distance) C4'-P energy: -20.994 bonds (distance) P-C4' energy: -24.837 flat angles C4'-P-C4' energy: -28.268 flat angles P-C4'-P energy: -22.519 tors. eta vs tors. theta energy: -41.277 Dist. restrs. and SS energy: 2.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -493.848183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.848183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.391540 (E_RNA) where: Base-Base interactions energy: -372.204 where: short stacking energy: -129.978 Base-Backbone interact. energy: 1.123 local terms energy: -125.310834 where: bonds (distance) C4'-P energy: -13.629 bonds (distance) P-C4' energy: -24.165 flat angles C4'-P-C4' energy: -30.782 flat angles P-C4'-P energy: -15.653 tors. eta vs tors. theta energy: -41.081 Dist. restrs. and SS energy: 2.543 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -502.934470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.934470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.608553 (E_RNA) where: Base-Base interactions energy: -361.444 where: short stacking energy: -131.091 Base-Backbone interact. energy: -1.012 local terms energy: -142.152772 where: bonds (distance) C4'-P energy: -23.720 bonds (distance) P-C4' energy: -26.606 flat angles C4'-P-C4' energy: -33.294 flat angles P-C4'-P energy: -19.683 tors. eta vs tors. theta energy: -38.850 Dist. restrs. and SS energy: 1.674 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -478.374276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.374276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -482.086748 (E_RNA) where: Base-Base interactions energy: -360.160 where: short stacking energy: -126.236 Base-Backbone interact. energy: 2.460 local terms energy: -124.386408 where: bonds (distance) C4'-P energy: -20.851 bonds (distance) P-C4' energy: -21.268 flat angles C4'-P-C4' energy: -25.721 flat angles P-C4'-P energy: -16.645 tors. eta vs tors. theta energy: -39.901 Dist. restrs. and SS energy: 3.712 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -608.594824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -608.594824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -608.771259 (E_RNA) where: Base-Base interactions energy: -436.123 where: short stacking energy: -167.373 Base-Backbone interact. energy: -0.001 local terms energy: -172.646858 where: bonds (distance) C4'-P energy: -29.000 bonds (distance) P-C4' energy: -31.103 flat angles C4'-P-C4' energy: -33.210 flat angles P-C4'-P energy: -28.801 tors. eta vs tors. theta energy: -50.533 Dist. restrs. and SS energy: 0.176 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -594.344362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.344362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.366309 (E_RNA) where: Base-Base interactions energy: -432.309 where: short stacking energy: -163.874 Base-Backbone interact. energy: -0.002 local terms energy: -162.054922 where: bonds (distance) C4'-P energy: -28.847 bonds (distance) P-C4' energy: -27.123 flat angles C4'-P-C4' energy: -29.716 flat angles P-C4'-P energy: -27.037 tors. eta vs tors. theta energy: -49.333 Dist. restrs. and SS energy: 0.022 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -586.649830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.649830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.050450 (E_RNA) where: Base-Base interactions energy: -424.757 where: short stacking energy: -163.257 Base-Backbone interact. energy: -0.043 local terms energy: -162.250520 where: bonds (distance) C4'-P energy: -28.081 bonds (distance) P-C4' energy: -27.430 flat angles C4'-P-C4' energy: -32.663 flat angles P-C4'-P energy: -23.316 tors. eta vs tors. theta energy: -50.761 Dist. restrs. and SS energy: 0.401 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -584.435991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.435991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.798145 (E_RNA) where: Base-Base interactions energy: -423.354 where: short stacking energy: -164.213 Base-Backbone interact. energy: -0.002 local terms energy: -161.442110 where: bonds (distance) C4'-P energy: -30.270 bonds (distance) P-C4' energy: -31.891 flat angles C4'-P-C4' energy: -33.285 flat angles P-C4'-P energy: -19.780 tors. eta vs tors. theta energy: -46.215 Dist. restrs. and SS energy: 0.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -574.170432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -574.170432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.008827 (E_RNA) where: Base-Base interactions energy: -424.065 where: short stacking energy: -168.197 Base-Backbone interact. energy: -0.027 local terms energy: -151.571804 where: bonds (distance) C4'-P energy: -30.536 bonds (distance) P-C4' energy: -21.590 flat angles C4'-P-C4' energy: -30.682 flat angles P-C4'-P energy: -20.782 tors. eta vs tors. theta energy: -47.982 Dist. restrs. and SS energy: 0.838 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.655 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -571.394495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.394495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.728327 (E_RNA) where: Base-Base interactions energy: -418.976 where: short stacking energy: -162.160 Base-Backbone interact. energy: -0.290 local terms energy: -152.462102 where: bonds (distance) C4'-P energy: -24.800 bonds (distance) P-C4' energy: -24.720 flat angles C4'-P-C4' energy: -31.047 flat angles P-C4'-P energy: -22.029 tors. eta vs tors. theta energy: -49.866 Dist. restrs. and SS energy: 0.334 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -520.758805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.758805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.216000 (E_RNA) where: Base-Base interactions energy: -377.513 where: short stacking energy: -132.683 Base-Backbone interact. energy: 0.413 local terms energy: -144.115607 where: bonds (distance) C4'-P energy: -28.603 bonds (distance) P-C4' energy: -29.819 flat angles C4'-P-C4' energy: -28.161 flat angles P-C4'-P energy: -21.496 tors. eta vs tors. theta energy: -36.036 Dist. restrs. and SS energy: 0.457 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -506.738810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.738810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.480213 (E_RNA) where: Base-Base interactions energy: -386.255 where: short stacking energy: -141.297 Base-Backbone interact. energy: 5.903 local terms energy: -128.421238 where: bonds (distance) C4'-P energy: -19.799 bonds (distance) P-C4' energy: -24.046 flat angles C4'-P-C4' energy: -27.106 flat angles P-C4'-P energy: -16.601 tors. eta vs tors. theta energy: -40.870 Dist. restrs. and SS energy: 0.741 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.293 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -496.499878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.499878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.948526 (E_RNA) where: Base-Base interactions energy: -354.708 where: short stacking energy: -137.132 Base-Backbone interact. energy: 0.750 local terms energy: -143.990082 where: bonds (distance) C4'-P energy: -32.202 bonds (distance) P-C4' energy: -27.834 flat angles C4'-P-C4' energy: -28.700 flat angles P-C4'-P energy: -15.971 tors. eta vs tors. theta energy: -39.283 Dist. restrs. and SS energy: 1.449 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -483.572747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.572747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.221327 (E_RNA) where: Base-Base interactions energy: -358.190 where: short stacking energy: -135.197 Base-Backbone interact. energy: 3.381 local terms energy: -129.412793 where: bonds (distance) C4'-P energy: -24.566 bonds (distance) P-C4' energy: -21.317 flat angles C4'-P-C4' energy: -29.561 flat angles P-C4'-P energy: -17.928 tors. eta vs tors. theta energy: -36.041 Dist. restrs. and SS energy: 0.649 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -594.125536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.125536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.400181 (E_RNA) where: Base-Base interactions energy: -437.715 where: short stacking energy: -165.441 Base-Backbone interact. energy: -0.001 local terms energy: -156.684500 where: bonds (distance) C4'-P energy: -25.862 bonds (distance) P-C4' energy: -27.611 flat angles C4'-P-C4' energy: -31.193 flat angles P-C4'-P energy: -20.880 tors. eta vs tors. theta energy: -51.138 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -597.382215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.382215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.661275 (E_RNA) where: Base-Base interactions energy: -433.859 where: short stacking energy: -161.970 Base-Backbone interact. energy: -0.001 local terms energy: -163.802092 where: bonds (distance) C4'-P energy: -25.029 bonds (distance) P-C4' energy: -30.054 flat angles C4'-P-C4' energy: -32.196 flat angles P-C4'-P energy: -25.260 tors. eta vs tors. theta energy: -51.263 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -596.373553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.373553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.504155 (E_RNA) where: Base-Base interactions energy: -441.468 where: short stacking energy: -168.003 Base-Backbone interact. energy: -0.001 local terms energy: -155.035383 where: bonds (distance) C4'-P energy: -25.169 bonds (distance) P-C4' energy: -26.068 flat angles C4'-P-C4' energy: -29.808 flat angles P-C4'-P energy: -24.159 tors. eta vs tors. theta energy: -49.832 Dist. restrs. and SS energy: 0.131 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -581.278466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -581.278466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -581.396465 (E_RNA) where: Base-Base interactions energy: -434.741 where: short stacking energy: -168.795 Base-Backbone interact. energy: -0.016 local terms energy: -148.711564 where: bonds (distance) C4'-P energy: -23.722 bonds (distance) P-C4' energy: -21.088 flat angles C4'-P-C4' energy: -31.872 flat angles P-C4'-P energy: -24.333 tors. eta vs tors. theta energy: -47.695 Dist. restrs. and SS energy: 0.118 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.072 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -577.659310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.659310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.012948 (E_RNA) where: Base-Base interactions energy: -417.349 where: short stacking energy: -157.696 Base-Backbone interact. energy: -0.001 local terms energy: -160.663217 where: bonds (distance) C4'-P energy: -23.216 bonds (distance) P-C4' energy: -32.065 flat angles C4'-P-C4' energy: -27.476 flat angles P-C4'-P energy: -26.858 tors. eta vs tors. theta energy: -51.048 Dist. restrs. and SS energy: 0.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -575.779329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.779329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.865141 (E_RNA) where: Base-Base interactions energy: -435.710 where: short stacking energy: -165.343 Base-Backbone interact. energy: -0.001 local terms energy: -140.153963 where: bonds (distance) C4'-P energy: -18.062 bonds (distance) P-C4' energy: -21.061 flat angles C4'-P-C4' energy: -29.314 flat angles P-C4'-P energy: -22.615 tors. eta vs tors. theta energy: -49.103 Dist. restrs. and SS energy: 0.086 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -512.346462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.346462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.071962 (E_RNA) where: Base-Base interactions energy: -367.756 where: short stacking energy: -127.338 Base-Backbone interact. energy: 2.578 local terms energy: -147.894327 where: bonds (distance) C4'-P energy: -24.620 bonds (distance) P-C4' energy: -24.659 flat angles C4'-P-C4' energy: -34.385 flat angles P-C4'-P energy: -23.243 tors. eta vs tors. theta energy: -40.988 Dist. restrs. and SS energy: 0.725 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -509.804014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.804014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.151897 (E_RNA) where: Base-Base interactions energy: -374.541 where: short stacking energy: -138.965 Base-Backbone interact. energy: 1.356 local terms energy: -137.967104 where: bonds (distance) C4'-P energy: -20.634 bonds (distance) P-C4' energy: -24.229 flat angles C4'-P-C4' energy: -30.450 flat angles P-C4'-P energy: -25.804 tors. eta vs tors. theta energy: -36.851 Dist. restrs. and SS energy: 1.348 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -485.839961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.839961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.556254 (E_RNA) where: Base-Base interactions energy: -355.991 where: short stacking energy: -130.207 Base-Backbone interact. energy: -0.438 local terms energy: -130.127725 where: bonds (distance) C4'-P energy: -23.086 bonds (distance) P-C4' energy: -21.417 flat angles C4'-P-C4' energy: -27.582 flat angles P-C4'-P energy: -20.947 tors. eta vs tors. theta energy: -37.096 Dist. restrs. and SS energy: 0.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -469.946619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.946619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -473.346483 (E_RNA) where: Base-Base interactions energy: -346.528 where: short stacking energy: -132.008 Base-Backbone interact. energy: -0.822 local terms energy: -125.996012 where: bonds (distance) C4'-P energy: -25.305 bonds (distance) P-C4' energy: -16.664 flat angles C4'-P-C4' energy: -27.957 flat angles P-C4'-P energy: -17.712 tors. eta vs tors. theta energy: -38.357 Dist. restrs. and SS energy: 3.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -607.293727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.293727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.510317 (E_RNA) where: Base-Base interactions energy: -446.107 where: short stacking energy: -168.966 Base-Backbone interact. energy: -0.003 local terms energy: -161.400191 where: bonds (distance) C4'-P energy: -23.017 bonds (distance) P-C4' energy: -33.360 flat angles C4'-P-C4' energy: -32.681 flat angles P-C4'-P energy: -25.178 tors. eta vs tors. theta energy: -47.165 Dist. restrs. and SS energy: 0.217 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -589.806566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.806566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.984501 (E_RNA) where: Base-Base interactions energy: -429.540 where: short stacking energy: -159.658 Base-Backbone interact. energy: -0.001 local terms energy: -160.444119 where: bonds (distance) C4'-P energy: -27.237 bonds (distance) P-C4' energy: -26.230 flat angles C4'-P-C4' energy: -33.499 flat angles P-C4'-P energy: -22.392 tors. eta vs tors. theta energy: -51.087 Dist. restrs. and SS energy: 0.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -588.276355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.276355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.531146 (E_RNA) where: Base-Base interactions energy: -427.935 where: short stacking energy: -165.475 Base-Backbone interact. energy: -0.001 local terms energy: -160.594958 where: bonds (distance) C4'-P energy: -27.434 bonds (distance) P-C4' energy: -29.949 flat angles C4'-P-C4' energy: -30.017 flat angles P-C4'-P energy: -24.459 tors. eta vs tors. theta energy: -48.737 Dist. restrs. and SS energy: 0.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -582.288402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.288402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.377685 (E_RNA) where: Base-Base interactions energy: -427.805 where: short stacking energy: -162.781 Base-Backbone interact. energy: -0.041 local terms energy: -154.531132 where: bonds (distance) C4'-P energy: -28.719 bonds (distance) P-C4' energy: -20.982 flat angles C4'-P-C4' energy: -31.287 flat angles P-C4'-P energy: -24.870 tors. eta vs tors. theta energy: -48.673 Dist. restrs. and SS energy: 0.089 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -575.317294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.317294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.716192 (E_RNA) where: Base-Base interactions energy: -417.099 where: short stacking energy: -163.371 Base-Backbone interact. energy: -0.001 local terms energy: -158.950864 where: bonds (distance) C4'-P energy: -24.754 bonds (distance) P-C4' energy: -32.451 flat angles C4'-P-C4' energy: -30.213 flat angles P-C4'-P energy: -22.756 tors. eta vs tors. theta energy: -48.778 Dist. restrs. and SS energy: 0.399 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.334 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -575.827444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.827444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.026020 (E_RNA) where: Base-Base interactions energy: -419.031 where: short stacking energy: -159.746 Base-Backbone interact. energy: -0.003 local terms energy: -156.992413 where: bonds (distance) C4'-P energy: -24.759 bonds (distance) P-C4' energy: -27.009 flat angles C4'-P-C4' energy: -33.082 flat angles P-C4'-P energy: -23.880 tors. eta vs tors. theta energy: -48.262 Dist. restrs. and SS energy: 0.199 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -516.638527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.638527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.145578 (E_RNA) where: Base-Base interactions energy: -381.890 where: short stacking energy: -142.850 Base-Backbone interact. energy: -0.822 local terms energy: -138.433770 where: bonds (distance) C4'-P energy: -22.516 bonds (distance) P-C4' energy: -30.576 flat angles C4'-P-C4' energy: -28.007 flat angles P-C4'-P energy: -18.352 tors. eta vs tors. theta energy: -38.982 Dist. restrs. and SS energy: 4.507 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -499.114869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.114869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.381196 (E_RNA) where: Base-Base interactions energy: -378.357 where: short stacking energy: -139.697 Base-Backbone interact. energy: 0.756 local terms energy: -122.779990 where: bonds (distance) C4'-P energy: -24.233 bonds (distance) P-C4' energy: -18.619 flat angles C4'-P-C4' energy: -28.706 flat angles P-C4'-P energy: -13.600 tors. eta vs tors. theta energy: -37.622 Dist. restrs. and SS energy: 1.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -504.686745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.686745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.871310 (E_RNA) where: Base-Base interactions energy: -385.521 where: short stacking energy: -139.060 Base-Backbone interact. energy: 0.021 local terms energy: -120.283478 where: bonds (distance) C4'-P energy: -22.541 bonds (distance) P-C4' energy: -23.213 flat angles C4'-P-C4' energy: -28.714 flat angles P-C4'-P energy: -10.239 tors. eta vs tors. theta energy: -35.576 Dist. restrs. and SS energy: 0.185 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.912 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -481.607201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.607201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.213618 (E_RNA) where: Base-Base interactions energy: -361.980 where: short stacking energy: -138.338 Base-Backbone interact. energy: 0.102 local terms energy: -122.335911 where: bonds (distance) C4'-P energy: -8.886 bonds (distance) P-C4' energy: -24.043 flat angles C4'-P-C4' energy: -30.716 flat angles P-C4'-P energy: -19.884 tors. eta vs tors. theta energy: -38.806 Dist. restrs. and SS energy: 2.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -598.304953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.304953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.465454 (E_RNA) where: Base-Base interactions energy: -444.079 where: short stacking energy: -170.089 Base-Backbone interact. energy: -0.001 local terms energy: -154.385470 where: bonds (distance) C4'-P energy: -23.971 bonds (distance) P-C4' energy: -28.678 flat angles C4'-P-C4' energy: -30.201 flat angles P-C4'-P energy: -22.929 tors. eta vs tors. theta energy: -48.606 Dist. restrs. and SS energy: 0.161 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -592.749072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.749072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.869260 (E_RNA) where: Base-Base interactions energy: -426.590 where: short stacking energy: -159.970 Base-Backbone interact. energy: -0.002 local terms energy: -166.277459 where: bonds (distance) C4'-P energy: -28.681 bonds (distance) P-C4' energy: -32.381 flat angles C4'-P-C4' energy: -28.445 flat angles P-C4'-P energy: -25.793 tors. eta vs tors. theta energy: -50.977 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -592.461451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.461451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.521904 (E_RNA) where: Base-Base interactions energy: -435.768 where: short stacking energy: -163.012 Base-Backbone interact. energy: -0.013 local terms energy: -156.741189 where: bonds (distance) C4'-P energy: -26.867 bonds (distance) P-C4' energy: -21.476 flat angles C4'-P-C4' energy: -33.677 flat angles P-C4'-P energy: -25.857 tors. eta vs tors. theta energy: -48.864 Dist. restrs. and SS energy: 0.060 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -586.354731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.354731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.659855 (E_RNA) where: Base-Base interactions energy: -421.203 where: short stacking energy: -163.748 Base-Backbone interact. energy: -0.003 local terms energy: -165.453634 where: bonds (distance) C4'-P energy: -29.266 bonds (distance) P-C4' energy: -30.287 flat angles C4'-P-C4' energy: -30.737 flat angles P-C4'-P energy: -26.067 tors. eta vs tors. theta energy: -49.096 Dist. restrs. and SS energy: 0.305 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -563.918591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.918591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.044154 (E_RNA) where: Base-Base interactions energy: -421.283 where: short stacking energy: -158.486 Base-Backbone interact. energy: -0.004 local terms energy: -142.756872 where: bonds (distance) C4'-P energy: -18.617 bonds (distance) P-C4' energy: -31.324 flat angles C4'-P-C4' energy: -27.387 flat angles P-C4'-P energy: -20.832 tors. eta vs tors. theta energy: -44.596 Dist. restrs. and SS energy: 0.126 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -568.543333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.543333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.168462 (E_RNA) where: Base-Base interactions energy: -418.348 where: short stacking energy: -162.572 Base-Backbone interact. energy: -0.218 local terms energy: -150.601841 where: bonds (distance) C4'-P energy: -25.829 bonds (distance) P-C4' energy: -24.630 flat angles C4'-P-C4' energy: -30.105 flat angles P-C4'-P energy: -22.071 tors. eta vs tors. theta energy: -47.966 Dist. restrs. and SS energy: 0.625 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -517.919748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.919748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.693991 (E_RNA) where: Base-Base interactions energy: -373.530 where: short stacking energy: -139.225 Base-Backbone interact. energy: 0.301 local terms energy: -145.464443 where: bonds (distance) C4'-P energy: -32.193 bonds (distance) P-C4' energy: -27.270 flat angles C4'-P-C4' energy: -26.611 flat angles P-C4'-P energy: -22.053 tors. eta vs tors. theta energy: -37.338 Dist. restrs. and SS energy: 0.774 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -496.172077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.172077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.134827 (E_RNA) where: Base-Base interactions energy: -371.207 where: short stacking energy: -134.377 Base-Backbone interact. energy: 0.312 local terms energy: -128.029119 where: bonds (distance) C4'-P energy: -21.833 bonds (distance) P-C4' energy: -29.307 flat angles C4'-P-C4' energy: -22.233 flat angles P-C4'-P energy: -17.560 tors. eta vs tors. theta energy: -37.097 Dist. restrs. and SS energy: 1.963 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.790 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -486.941161 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.941161 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.200042 (E_RNA) where: Base-Base interactions energy: -356.528 where: short stacking energy: -133.906 Base-Backbone interact. energy: 0.787 local terms energy: -132.459161 where: bonds (distance) C4'-P energy: -26.818 bonds (distance) P-C4' energy: -18.550 flat angles C4'-P-C4' energy: -28.765 flat angles P-C4'-P energy: -21.638 tors. eta vs tors. theta energy: -36.688 Dist. restrs. and SS energy: 1.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -481.047309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.047309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -485.628728 (E_RNA) where: Base-Base interactions energy: -356.291 where: short stacking energy: -127.682 Base-Backbone interact. energy: 1.001 local terms energy: -131.377821 where: bonds (distance) C4'-P energy: -21.366 bonds (distance) P-C4' energy: -25.115 flat angles C4'-P-C4' energy: -28.492 flat angles P-C4'-P energy: -16.277 tors. eta vs tors. theta energy: -40.127 Dist. restrs. and SS energy: 4.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.040 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -596.417939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.417939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.501207 (E_RNA) where: Base-Base interactions energy: -436.818 where: short stacking energy: -165.350 Base-Backbone interact. energy: -0.001 local terms energy: -159.682886 where: bonds (distance) C4'-P energy: -28.351 bonds (distance) P-C4' energy: -31.512 flat angles C4'-P-C4' energy: -29.824 flat angles P-C4'-P energy: -23.330 tors. eta vs tors. theta energy: -46.665 Dist. restrs. and SS energy: 0.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -593.981377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.981377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.322074 (E_RNA) where: Base-Base interactions energy: -431.250 where: short stacking energy: -163.564 Base-Backbone interact. energy: -0.042 local terms energy: -163.030012 where: bonds (distance) C4'-P energy: -22.637 bonds (distance) P-C4' energy: -31.379 flat angles C4'-P-C4' energy: -33.550 flat angles P-C4'-P energy: -24.683 tors. eta vs tors. theta energy: -50.781 Dist. restrs. and SS energy: 0.341 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -583.521278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.521278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.912621 (E_RNA) where: Base-Base interactions energy: -425.876 where: short stacking energy: -162.548 Base-Backbone interact. energy: -0.007 local terms energy: -158.029371 where: bonds (distance) C4'-P energy: -25.188 bonds (distance) P-C4' energy: -27.127 flat angles C4'-P-C4' energy: -31.754 flat angles P-C4'-P energy: -25.740 tors. eta vs tors. theta energy: -48.219 Dist. restrs. and SS energy: 0.391 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -579.837127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.837127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.940410 (E_RNA) where: Base-Base interactions energy: -420.802 where: short stacking energy: -162.066 Base-Backbone interact. energy: -0.074 local terms energy: -159.064033 where: bonds (distance) C4'-P energy: -27.091 bonds (distance) P-C4' energy: -30.279 flat angles C4'-P-C4' energy: -34.407 flat angles P-C4'-P energy: -18.116 tors. eta vs tors. theta energy: -49.172 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -572.590131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.590131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.108830 (E_RNA) where: Base-Base interactions energy: -418.078 where: short stacking energy: -161.218 Base-Backbone interact. energy: -0.002 local terms energy: -155.028564 where: bonds (distance) C4'-P energy: -21.079 bonds (distance) P-C4' energy: -27.310 flat angles C4'-P-C4' energy: -34.414 flat angles P-C4'-P energy: -25.106 tors. eta vs tors. theta energy: -47.119 Dist. restrs. and SS energy: 0.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -567.709328 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.709328 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.814079 (E_RNA) where: Base-Base interactions energy: -417.181 where: short stacking energy: -153.976 Base-Backbone interact. energy: -0.043 local terms energy: -150.589821 where: bonds (distance) C4'-P energy: -18.113 bonds (distance) P-C4' energy: -30.393 flat angles C4'-P-C4' energy: -29.136 flat angles P-C4'-P energy: -25.058 tors. eta vs tors. theta energy: -47.890 Dist. restrs. and SS energy: 0.105 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -506.820874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.820874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.795615 (E_RNA) where: Base-Base interactions energy: -375.499 where: short stacking energy: -133.872 Base-Backbone interact. energy: -0.350 local terms energy: -131.945821 where: bonds (distance) C4'-P energy: -20.113 bonds (distance) P-C4' energy: -28.109 flat angles C4'-P-C4' energy: -29.808 flat angles P-C4'-P energy: -17.047 tors. eta vs tors. theta energy: -36.870 Dist. restrs. and SS energy: 0.975 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -497.710502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.710502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.663592 (E_RNA) where: Base-Base interactions energy: -362.598 where: short stacking energy: -132.031 Base-Backbone interact. energy: -0.600 local terms energy: -135.465323 where: bonds (distance) C4'-P energy: -22.571 bonds (distance) P-C4' energy: -25.730 flat angles C4'-P-C4' energy: -28.481 flat angles P-C4'-P energy: -21.163 tors. eta vs tors. theta energy: -37.521 Dist. restrs. and SS energy: 0.953 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -476.311029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.311029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.979700 (E_RNA) where: Base-Base interactions energy: -360.331 where: short stacking energy: -129.781 Base-Backbone interact. energy: 0.176 local terms energy: -116.825449 where: bonds (distance) C4'-P energy: -19.857 bonds (distance) P-C4' energy: -19.748 flat angles C4'-P-C4' energy: -21.344 flat angles P-C4'-P energy: -19.479 tors. eta vs tors. theta energy: -36.398 Dist. restrs. and SS energy: 0.669 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -492.701580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.701580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.771342 (E_RNA) where: Base-Base interactions energy: -369.522 where: short stacking energy: -139.249 Base-Backbone interact. energy: 1.254 local terms energy: -125.946700 where: bonds (distance) C4'-P energy: -19.133 bonds (distance) P-C4' energy: -26.703 flat angles C4'-P-C4' energy: -27.260 flat angles P-C4'-P energy: -15.025 tors. eta vs tors. theta energy: -37.826 Dist. restrs. and SS energy: 1.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.444 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -604.203954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.203954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.425390 (E_RNA) where: Base-Base interactions energy: -436.223 where: short stacking energy: -169.358 Base-Backbone interact. energy: -0.001 local terms energy: -168.200921 where: bonds (distance) C4'-P energy: -28.997 bonds (distance) P-C4' energy: -32.130 flat angles C4'-P-C4' energy: -33.296 flat angles P-C4'-P energy: -24.605 tors. eta vs tors. theta energy: -49.173 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -586.253993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.253993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.541844 (E_RNA) where: Base-Base interactions energy: -433.881 where: short stacking energy: -169.166 Base-Backbone interact. energy: -0.289 local terms energy: -152.372079 where: bonds (distance) C4'-P energy: -20.831 bonds (distance) P-C4' energy: -24.440 flat angles C4'-P-C4' energy: -33.362 flat angles P-C4'-P energy: -26.016 tors. eta vs tors. theta energy: -47.723 Dist. restrs. and SS energy: 0.288 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -588.735649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.735649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.927680 (E_RNA) where: Base-Base interactions energy: -431.787 where: short stacking energy: -167.024 Base-Backbone interact. energy: -0.003 local terms energy: -157.138561 where: bonds (distance) C4'-P energy: -26.990 bonds (distance) P-C4' energy: -30.772 flat angles C4'-P-C4' energy: -30.256 flat angles P-C4'-P energy: -22.641 tors. eta vs tors. theta energy: -46.479 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -570.472920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.472920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.926821 (E_RNA) where: Base-Base interactions energy: -416.757 where: short stacking energy: -156.735 Base-Backbone interact. energy: -0.003 local terms energy: -154.166801 where: bonds (distance) C4'-P energy: -23.714 bonds (distance) P-C4' energy: -26.248 flat angles C4'-P-C4' energy: -29.277 flat angles P-C4'-P energy: -24.053 tors. eta vs tors. theta energy: -50.874 Dist. restrs. and SS energy: 0.454 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -568.656139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -568.656139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.025794 (E_RNA) where: Base-Base interactions energy: -412.485 where: short stacking energy: -162.537 Base-Backbone interact. energy: -0.003 local terms energy: -156.537589 where: bonds (distance) C4'-P energy: -26.771 bonds (distance) P-C4' energy: -26.137 flat angles C4'-P-C4' energy: -32.319 flat angles P-C4'-P energy: -23.501 tors. eta vs tors. theta energy: -47.810 Dist. restrs. and SS energy: 0.370 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -573.396505 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.396505 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.629823 (E_RNA) where: Base-Base interactions energy: -416.528 where: short stacking energy: -159.005 Base-Backbone interact. energy: -0.010 local terms energy: -157.092014 where: bonds (distance) C4'-P energy: -23.904 bonds (distance) P-C4' energy: -32.356 flat angles C4'-P-C4' energy: -31.837 flat angles P-C4'-P energy: -19.095 tors. eta vs tors. theta energy: -49.900 Dist. restrs. and SS energy: 0.233 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -507.291373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.291373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.969620 (E_RNA) where: Base-Base interactions energy: -374.863 where: short stacking energy: -141.990 Base-Backbone interact. energy: -0.318 local terms energy: -133.789017 where: bonds (distance) C4'-P energy: -20.087 bonds (distance) P-C4' energy: -24.268 flat angles C4'-P-C4' energy: -30.935 flat angles P-C4'-P energy: -20.651 tors. eta vs tors. theta energy: -37.848 Dist. restrs. and SS energy: 1.678 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -509.799189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -509.799189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -510.994729 (E_RNA) where: Base-Base interactions energy: -387.072 where: short stacking energy: -136.111 Base-Backbone interact. energy: -0.073 local terms energy: -123.850047 where: bonds (distance) C4'-P energy: -18.196 bonds (distance) P-C4' energy: -19.797 flat angles C4'-P-C4' energy: -23.958 flat angles P-C4'-P energy: -24.879 tors. eta vs tors. theta energy: -37.020 Dist. restrs. and SS energy: 1.196 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -500.930118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.930118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.687967 (E_RNA) where: Base-Base interactions energy: -371.263 where: short stacking energy: -136.921 Base-Backbone interact. energy: 5.374 local terms energy: -135.799032 where: bonds (distance) C4'-P energy: -21.034 bonds (distance) P-C4' energy: -27.010 flat angles C4'-P-C4' energy: -26.830 flat angles P-C4'-P energy: -21.600 tors. eta vs tors. theta energy: -39.326 Dist. restrs. and SS energy: 0.758 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -483.910079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.910079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.990625 (E_RNA) where: Base-Base interactions energy: -364.510 where: short stacking energy: -134.073 Base-Backbone interact. energy: -0.099 local terms energy: -123.382554 where: bonds (distance) C4'-P energy: -26.754 bonds (distance) P-C4' energy: -18.319 flat angles C4'-P-C4' energy: -21.160 flat angles P-C4'-P energy: -19.416 tors. eta vs tors. theta energy: -37.734 Dist. restrs. and SS energy: 4.081 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -601.798018 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.798018 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.930076 (E_RNA) where: Base-Base interactions energy: -436.909 where: short stacking energy: -165.967 Base-Backbone interact. energy: -0.002 local terms energy: -165.019117 where: bonds (distance) C4'-P energy: -27.808 bonds (distance) P-C4' energy: -27.856 flat angles C4'-P-C4' energy: -34.606 flat angles P-C4'-P energy: -24.612 tors. eta vs tors. theta energy: -50.137 Dist. restrs. and SS energy: 0.132 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -595.908714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.908714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.389264 (E_RNA) where: Base-Base interactions energy: -440.359 where: short stacking energy: -161.004 Base-Backbone interact. energy: -0.001 local terms energy: -156.029689 where: bonds (distance) C4'-P energy: -28.756 bonds (distance) P-C4' energy: -22.880 flat angles C4'-P-C4' energy: -32.496 flat angles P-C4'-P energy: -22.886 tors. eta vs tors. theta energy: -49.011 Dist. restrs. and SS energy: 0.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -597.354478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.354478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.620869 (E_RNA) where: Base-Base interactions energy: -435.404 where: short stacking energy: -170.895 Base-Backbone interact. energy: -0.002 local terms energy: -162.215064 where: bonds (distance) C4'-P energy: -23.337 bonds (distance) P-C4' energy: -29.568 flat angles C4'-P-C4' energy: -33.394 flat angles P-C4'-P energy: -25.358 tors. eta vs tors. theta energy: -50.559 Dist. restrs. and SS energy: 0.266 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -583.639610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.639610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.918547 (E_RNA) where: Base-Base interactions energy: -432.421 where: short stacking energy: -162.646 Base-Backbone interact. energy: -0.575 local terms energy: -150.923050 where: bonds (distance) C4'-P energy: -24.180 bonds (distance) P-C4' energy: -28.399 flat angles C4'-P-C4' energy: -29.165 flat angles P-C4'-P energy: -17.312 tors. eta vs tors. theta energy: -51.867 Dist. restrs. and SS energy: 0.279 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -575.845434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.845434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.035991 (E_RNA) where: Base-Base interactions energy: -413.271 where: short stacking energy: -156.672 Base-Backbone interact. energy: -0.503 local terms energy: -162.261544 where: bonds (distance) C4'-P energy: -30.491 bonds (distance) P-C4' energy: -32.493 flat angles C4'-P-C4' energy: -28.565 flat angles P-C4'-P energy: -21.302 tors. eta vs tors. theta energy: -49.411 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -555.456265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -555.456265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -555.793737 (E_RNA) where: Base-Base interactions energy: -422.284 where: short stacking energy: -158.983 Base-Backbone interact. energy: -0.003 local terms energy: -133.506508 where: bonds (distance) C4'-P energy: -23.756 bonds (distance) P-C4' energy: -20.448 flat angles C4'-P-C4' energy: -28.212 flat angles P-C4'-P energy: -12.486 tors. eta vs tors. theta energy: -48.605 Dist. restrs. and SS energy: 0.337 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -510.486387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.486387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.171565 (E_RNA) where: Base-Base interactions energy: -375.309 where: short stacking energy: -140.645 Base-Backbone interact. energy: 2.031 local terms energy: -140.483751 where: bonds (distance) C4'-P energy: -25.913 bonds (distance) P-C4' energy: -23.240 flat angles C4'-P-C4' energy: -32.703 flat angles P-C4'-P energy: -20.036 tors. eta vs tors. theta energy: -38.592 Dist. restrs. and SS energy: 2.685 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.590 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -516.615737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.615737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -517.697889 (E_RNA) where: Base-Base interactions energy: -397.819 where: short stacking energy: -152.735 Base-Backbone interact. energy: 3.326 local terms energy: -123.205575 where: bonds (distance) C4'-P energy: -16.799 bonds (distance) P-C4' energy: -17.804 flat angles C4'-P-C4' energy: -31.599 flat angles P-C4'-P energy: -16.588 tors. eta vs tors. theta energy: -40.416 Dist. restrs. and SS energy: 1.082 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -480.965760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.965760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.571297 (E_RNA) where: Base-Base interactions energy: -364.436 where: short stacking energy: -128.721 Base-Backbone interact. energy: 2.075 local terms energy: -126.210069 where: bonds (distance) C4'-P energy: -24.359 bonds (distance) P-C4' energy: -18.624 flat angles C4'-P-C4' energy: -27.391 flat angles P-C4'-P energy: -19.542 tors. eta vs tors. theta energy: -36.293 Dist. restrs. and SS energy: 7.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -434.124031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.124031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.486222 (E_RNA) where: Base-Base interactions energy: -322.188 where: short stacking energy: -126.998 Base-Backbone interact. energy: -0.180 local terms energy: -125.117929 where: bonds (distance) C4'-P energy: -22.446 bonds (distance) P-C4' energy: -25.912 flat angles C4'-P-C4' energy: -23.494 flat angles P-C4'-P energy: -16.400 tors. eta vs tors. theta energy: -36.865 Dist. restrs. and SS energy: 13.362 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -602.740025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.740025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.086083 (E_RNA) where: Base-Base interactions energy: -441.689 where: short stacking energy: -175.918 Base-Backbone interact. energy: -0.002 local terms energy: -161.395470 where: bonds (distance) C4'-P energy: -25.599 bonds (distance) P-C4' energy: -26.470 flat angles C4'-P-C4' energy: -34.147 flat angles P-C4'-P energy: -24.297 tors. eta vs tors. theta energy: -50.882 Dist. restrs. and SS energy: 0.346 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -596.158167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.158167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.603380 (E_RNA) where: Base-Base interactions energy: -424.762 where: short stacking energy: -161.871 Base-Backbone interact. energy: -0.000 local terms energy: -173.139608 where: bonds (distance) C4'-P energy: -28.451 bonds (distance) P-C4' energy: -32.114 flat angles C4'-P-C4' energy: -34.893 flat angles P-C4'-P energy: -25.895 tors. eta vs tors. theta energy: -51.788 Dist. restrs. and SS energy: 0.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.298 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -587.255378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -587.255378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.444999 (E_RNA) where: Base-Base interactions energy: -430.691 where: short stacking energy: -161.271 Base-Backbone interact. energy: -0.006 local terms energy: -156.748603 where: bonds (distance) C4'-P energy: -21.093 bonds (distance) P-C4' energy: -33.654 flat angles C4'-P-C4' energy: -32.330 flat angles P-C4'-P energy: -22.166 tors. eta vs tors. theta energy: -47.505 Dist. restrs. and SS energy: 0.190 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -577.276775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.276775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.471903 (E_RNA) where: Base-Base interactions energy: -424.867 where: short stacking energy: -159.132 Base-Backbone interact. energy: -0.002 local terms energy: -152.603053 where: bonds (distance) C4'-P energy: -23.826 bonds (distance) P-C4' energy: -27.637 flat angles C4'-P-C4' energy: -32.695 flat angles P-C4'-P energy: -21.668 tors. eta vs tors. theta energy: -46.777 Dist. restrs. and SS energy: 0.195 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -579.002278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.002278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.175717 (E_RNA) where: Base-Base interactions energy: -423.513 where: short stacking energy: -164.559 Base-Backbone interact. energy: -0.017 local terms energy: -155.645801 where: bonds (distance) C4'-P energy: -26.226 bonds (distance) P-C4' energy: -27.161 flat angles C4'-P-C4' energy: -30.443 flat angles P-C4'-P energy: -22.487 tors. eta vs tors. theta energy: -49.328 Dist. restrs. and SS energy: 0.173 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -560.727375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.727375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.184970 (E_RNA) where: Base-Base interactions energy: -423.081 where: short stacking energy: -161.235 Base-Backbone interact. energy: -0.046 local terms energy: -138.057713 where: bonds (distance) C4'-P energy: -15.541 bonds (distance) P-C4' energy: -27.793 flat angles C4'-P-C4' energy: -27.622 flat angles P-C4'-P energy: -18.329 tors. eta vs tors. theta energy: -48.772 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -519.375690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.375690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -521.068097 (E_RNA) where: Base-Base interactions energy: -377.897 where: short stacking energy: -146.848 Base-Backbone interact. energy: 0.276 local terms energy: -143.447002 where: bonds (distance) C4'-P energy: -23.126 bonds (distance) P-C4' energy: -28.353 flat angles C4'-P-C4' energy: -30.168 flat angles P-C4'-P energy: -22.182 tors. eta vs tors. theta energy: -39.619 Dist. restrs. and SS energy: 1.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -501.421693 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.421693 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -503.137668 (E_RNA) where: Base-Base interactions energy: -364.519 where: short stacking energy: -135.705 Base-Backbone interact. energy: 0.630 local terms energy: -141.303171 where: bonds (distance) C4'-P energy: -31.335 bonds (distance) P-C4' energy: -28.122 flat angles C4'-P-C4' energy: -26.365 flat angles P-C4'-P energy: -17.544 tors. eta vs tors. theta energy: -37.937 Dist. restrs. and SS energy: 1.716 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 2.055 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -482.147516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -482.147516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.406554 (E_RNA) where: Base-Base interactions energy: -357.195 where: short stacking energy: -129.707 Base-Backbone interact. energy: 0.364 local terms energy: -130.575973 where: bonds (distance) C4'-P energy: -20.587 bonds (distance) P-C4' energy: -29.576 flat angles C4'-P-C4' energy: -25.015 flat angles P-C4'-P energy: -20.472 tors. eta vs tors. theta energy: -34.925 Dist. restrs. and SS energy: 5.259 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -493.549114 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -493.549114 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.692427 (E_RNA) where: Base-Base interactions energy: -364.483 where: short stacking energy: -132.458 Base-Backbone interact. energy: 0.556 local terms energy: -130.765619 where: bonds (distance) C4'-P energy: -21.947 bonds (distance) P-C4' energy: -27.717 flat angles C4'-P-C4' energy: -24.869 flat angles P-C4'-P energy: -17.052 tors. eta vs tors. theta energy: -39.180 Dist. restrs. and SS energy: 1.143 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -603.623766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.623766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.715535 (E_RNA) where: Base-Base interactions energy: -439.813 where: short stacking energy: -166.824 Base-Backbone interact. energy: -0.001 local terms energy: -163.901957 where: bonds (distance) C4'-P energy: -29.414 bonds (distance) P-C4' energy: -27.148 flat angles C4'-P-C4' energy: -31.825 flat angles P-C4'-P energy: -25.472 tors. eta vs tors. theta energy: -50.043 Dist. restrs. and SS energy: 0.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -598.362897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.362897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.599899 (E_RNA) where: Base-Base interactions energy: -440.021 where: short stacking energy: -171.042 Base-Backbone interact. energy: -0.001 local terms energy: -158.577494 where: bonds (distance) C4'-P energy: -27.737 bonds (distance) P-C4' energy: -26.896 flat angles C4'-P-C4' energy: -29.735 flat angles P-C4'-P energy: -25.458 tors. eta vs tors. theta energy: -48.752 Dist. restrs. and SS energy: 0.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -588.086870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.086870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.545323 (E_RNA) where: Base-Base interactions energy: -432.152 where: short stacking energy: -169.775 Base-Backbone interact. energy: -0.042 local terms energy: -156.351961 where: bonds (distance) C4'-P energy: -25.763 bonds (distance) P-C4' energy: -22.465 flat angles C4'-P-C4' energy: -31.451 flat angles P-C4'-P energy: -26.177 tors. eta vs tors. theta energy: -50.495 Dist. restrs. and SS energy: 0.458 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -584.086564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.086564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.261534 (E_RNA) where: Base-Base interactions energy: -432.302 where: short stacking energy: -168.732 Base-Backbone interact. energy: -0.000 local terms energy: -151.958955 where: bonds (distance) C4'-P energy: -22.557 bonds (distance) P-C4' energy: -27.415 flat angles C4'-P-C4' energy: -29.713 flat angles P-C4'-P energy: -22.625 tors. eta vs tors. theta energy: -49.648 Dist. restrs. and SS energy: 0.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -575.246143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.246143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.313037 (E_RNA) where: Base-Base interactions energy: -426.181 where: short stacking energy: -164.904 Base-Backbone interact. energy: 1.058 local terms energy: -150.190255 where: bonds (distance) C4'-P energy: -18.583 bonds (distance) P-C4' energy: -24.305 flat angles C4'-P-C4' energy: -30.918 flat angles P-C4'-P energy: -25.444 tors. eta vs tors. theta energy: -50.940 Dist. restrs. and SS energy: 0.067 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -522.803571 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.803571 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -523.109647 (E_RNA) where: Base-Base interactions energy: -394.947 where: short stacking energy: -138.566 Base-Backbone interact. energy: -0.592 local terms energy: -127.571074 where: bonds (distance) C4'-P energy: -18.803 bonds (distance) P-C4' energy: -27.165 flat angles C4'-P-C4' energy: -25.409 flat angles P-C4'-P energy: -17.154 tors. eta vs tors. theta energy: -39.040 Dist. restrs. and SS energy: 0.306 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -563.237260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.237260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.634280 (E_RNA) where: Base-Base interactions energy: -417.255 where: short stacking energy: -164.830 Base-Backbone interact. energy: -0.010 local terms energy: -146.369666 where: bonds (distance) C4'-P energy: -14.912 bonds (distance) P-C4' energy: -23.064 flat angles C4'-P-C4' energy: -32.402 flat angles P-C4'-P energy: -26.159 tors. eta vs tors. theta energy: -49.833 Dist. restrs. and SS energy: 0.397 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -495.759219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.759219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.786842 (E_RNA) where: Base-Base interactions energy: -373.974 where: short stacking energy: -141.480 Base-Backbone interact. energy: 0.420 local terms energy: -123.232199 where: bonds (distance) C4'-P energy: -20.336 bonds (distance) P-C4' energy: -24.158 flat angles C4'-P-C4' energy: -26.077 flat angles P-C4'-P energy: -15.440 tors. eta vs tors. theta energy: -37.221 Dist. restrs. and SS energy: 1.028 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -499.396092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.396092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.574095 (E_RNA) where: Base-Base interactions energy: -370.524 where: short stacking energy: -133.460 Base-Backbone interact. energy: 2.201 local terms energy: -132.250814 where: bonds (distance) C4'-P energy: -22.555 bonds (distance) P-C4' energy: -25.589 flat angles C4'-P-C4' energy: -30.835 flat angles P-C4'-P energy: -20.355 tors. eta vs tors. theta energy: -32.915 Dist. restrs. and SS energy: 1.178 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -486.217149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.217149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.610334 (E_RNA) where: Base-Base interactions energy: -362.337 where: short stacking energy: -134.209 Base-Backbone interact. energy: 0.194 local terms energy: -128.882890 where: bonds (distance) C4'-P energy: -17.883 bonds (distance) P-C4' energy: -22.955 flat angles C4'-P-C4' energy: -28.380 flat angles P-C4'-P energy: -19.046 tors. eta vs tors. theta energy: -40.619 Dist. restrs. and SS energy: 4.393 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.416 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -601.264341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.264341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.680170 (E_RNA) where: Base-Base interactions energy: -435.924 where: short stacking energy: -170.585 Base-Backbone interact. energy: -0.002 local terms energy: -165.754171 where: bonds (distance) C4'-P energy: -29.391 bonds (distance) P-C4' energy: -28.399 flat angles C4'-P-C4' energy: -33.177 flat angles P-C4'-P energy: -23.591 tors. eta vs tors. theta energy: -51.196 Dist. restrs. and SS energy: 0.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -604.324547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.324547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.395418 (E_RNA) where: Base-Base interactions energy: -443.087 where: short stacking energy: -173.356 Base-Backbone interact. energy: -0.000 local terms energy: -161.308265 where: bonds (distance) C4'-P energy: -26.209 bonds (distance) P-C4' energy: -32.002 flat angles C4'-P-C4' energy: -32.313 flat angles P-C4'-P energy: -21.833 tors. eta vs tors. theta energy: -48.952 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -593.034102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.034102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.246454 (E_RNA) where: Base-Base interactions energy: -434.991 where: short stacking energy: -163.919 Base-Backbone interact. energy: -0.000 local terms energy: -158.778924 where: bonds (distance) C4'-P energy: -28.830 bonds (distance) P-C4' energy: -26.232 flat angles C4'-P-C4' energy: -31.757 flat angles P-C4'-P energy: -21.992 tors. eta vs tors. theta energy: -49.968 Dist. restrs. and SS energy: 0.212 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.524 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -584.865482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.865482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.685727 (E_RNA) where: Base-Base interactions energy: -425.531 where: short stacking energy: -167.566 Base-Backbone interact. energy: -0.007 local terms energy: -160.147497 where: bonds (distance) C4'-P energy: -27.921 bonds (distance) P-C4' energy: -27.269 flat angles C4'-P-C4' energy: -29.608 flat angles P-C4'-P energy: -23.408 tors. eta vs tors. theta energy: -51.942 Dist. restrs. and SS energy: 0.820 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -579.697058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.697058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.003568 (E_RNA) where: Base-Base interactions energy: -429.240 where: short stacking energy: -162.193 Base-Backbone interact. energy: -0.157 local terms energy: -150.606993 where: bonds (distance) C4'-P energy: -24.336 bonds (distance) P-C4' energy: -25.041 flat angles C4'-P-C4' energy: -29.857 flat angles P-C4'-P energy: -23.643 tors. eta vs tors. theta energy: -47.730 Dist. restrs. and SS energy: 0.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -510.465081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.465081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -511.617080 (E_RNA) where: Base-Base interactions energy: -378.554 where: short stacking energy: -142.425 Base-Backbone interact. energy: 0.262 local terms energy: -133.324956 where: bonds (distance) C4'-P energy: -18.139 bonds (distance) P-C4' energy: -22.291 flat angles C4'-P-C4' energy: -30.817 flat angles P-C4'-P energy: -23.043 tors. eta vs tors. theta energy: -39.036 Dist. restrs. and SS energy: 1.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -551.202919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -551.202919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -551.587668 (E_RNA) where: Base-Base interactions energy: -410.669 where: short stacking energy: -157.720 Base-Backbone interact. energy: -0.001 local terms energy: -140.918308 where: bonds (distance) C4'-P energy: -26.340 bonds (distance) P-C4' energy: -25.996 flat angles C4'-P-C4' energy: -28.410 flat angles P-C4'-P energy: -13.042 tors. eta vs tors. theta energy: -47.130 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -517.719159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -517.719159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -518.512496 (E_RNA) where: Base-Base interactions energy: -383.787 where: short stacking energy: -143.395 Base-Backbone interact. energy: 2.609 local terms energy: -137.335021 where: bonds (distance) C4'-P energy: -31.827 bonds (distance) P-C4' energy: -23.291 flat angles C4'-P-C4' energy: -28.499 flat angles P-C4'-P energy: -17.671 tors. eta vs tors. theta energy: -36.047 Dist. restrs. and SS energy: 0.793 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -487.552084 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -487.552084 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.950498 (E_RNA) where: Base-Base interactions energy: -356.685 where: short stacking energy: -132.131 Base-Backbone interact. energy: -1.034 local terms energy: -132.231933 where: bonds (distance) C4'-P energy: -24.009 bonds (distance) P-C4' energy: -19.347 flat angles C4'-P-C4' energy: -27.852 flat angles P-C4'-P energy: -20.873 tors. eta vs tors. theta energy: -40.151 Dist. restrs. and SS energy: 2.398 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -473.122551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -473.122551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.118913 (E_RNA) where: Base-Base interactions energy: -353.987 where: short stacking energy: -118.865 Base-Backbone interact. energy: -1.095 local terms energy: -120.036745 where: bonds (distance) C4'-P energy: -24.015 bonds (distance) P-C4' energy: -24.579 flat angles C4'-P-C4' energy: -23.669 flat angles P-C4'-P energy: -12.649 tors. eta vs tors. theta energy: -35.124 Dist. restrs. and SS energy: 1.996 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -602.477599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -602.477599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.580477 (E_RNA) where: Base-Base interactions energy: -436.729 where: short stacking energy: -170.633 Base-Backbone interact. energy: -0.242 local terms energy: -165.610193 where: bonds (distance) C4'-P energy: -27.109 bonds (distance) P-C4' energy: -33.586 flat angles C4'-P-C4' energy: -30.071 flat angles P-C4'-P energy: -26.017 tors. eta vs tors. theta energy: -48.828 Dist. restrs. and SS energy: 0.103 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -594.417007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.417007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.640756 (E_RNA) where: Base-Base interactions energy: -435.688 where: short stacking energy: -171.989 Base-Backbone interact. energy: -0.001 local terms energy: -158.952480 where: bonds (distance) C4'-P energy: -21.152 bonds (distance) P-C4' energy: -27.604 flat angles C4'-P-C4' energy: -35.044 flat angles P-C4'-P energy: -25.250 tors. eta vs tors. theta energy: -49.903 Dist. restrs. and SS energy: 0.224 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -594.605022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.605022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.037867 (E_RNA) where: Base-Base interactions energy: -429.751 where: short stacking energy: -168.753 Base-Backbone interact. energy: -0.001 local terms energy: -165.285878 where: bonds (distance) C4'-P energy: -32.788 bonds (distance) P-C4' energy: -25.851 flat angles C4'-P-C4' energy: -32.462 flat angles P-C4'-P energy: -26.300 tors. eta vs tors. theta energy: -47.886 Dist. restrs. and SS energy: 0.433 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -585.330068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.330068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.772812 (E_RNA) where: Base-Base interactions energy: -429.655 where: short stacking energy: -168.583 Base-Backbone interact. energy: -0.240 local terms energy: -155.878224 where: bonds (distance) C4'-P energy: -27.050 bonds (distance) P-C4' energy: -25.274 flat angles C4'-P-C4' energy: -33.738 flat angles P-C4'-P energy: -21.880 tors. eta vs tors. theta energy: -47.935 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -575.457691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.457691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.748282 (E_RNA) where: Base-Base interactions energy: -421.815 where: short stacking energy: -165.060 Base-Backbone interact. energy: -0.006 local terms energy: -154.087603 where: bonds (distance) C4'-P energy: -26.384 bonds (distance) P-C4' energy: -28.881 flat angles C4'-P-C4' energy: -25.163 flat angles P-C4'-P energy: -25.441 tors. eta vs tors. theta energy: -48.219 Dist. restrs. and SS energy: 0.291 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.161 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -567.637971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.637971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -568.287763 (E_RNA) where: Base-Base interactions energy: -416.610 where: short stacking energy: -159.179 Base-Backbone interact. energy: -0.445 local terms energy: -151.233154 where: bonds (distance) C4'-P energy: -24.049 bonds (distance) P-C4' energy: -21.951 flat angles C4'-P-C4' energy: -33.349 flat angles P-C4'-P energy: -22.714 tors. eta vs tors. theta energy: -49.171 Dist. restrs. and SS energy: 0.650 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -502.859904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.859904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.386424 (E_RNA) where: Base-Base interactions energy: -371.397 where: short stacking energy: -137.311 Base-Backbone interact. energy: -0.087 local terms energy: -132.903107 where: bonds (distance) C4'-P energy: -27.130 bonds (distance) P-C4' energy: -17.639 flat angles C4'-P-C4' energy: -30.158 flat angles P-C4'-P energy: -19.182 tors. eta vs tors. theta energy: -38.794 Dist. restrs. and SS energy: 1.527 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -518.372242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -518.372242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -520.297554 (E_RNA) where: Base-Base interactions energy: -385.670 where: short stacking energy: -145.913 Base-Backbone interact. energy: 1.710 local terms energy: -136.490087 where: bonds (distance) C4'-P energy: -27.115 bonds (distance) P-C4' energy: -25.257 flat angles C4'-P-C4' energy: -25.141 flat angles P-C4'-P energy: -20.731 tors. eta vs tors. theta energy: -38.245 Dist. restrs. and SS energy: 1.925 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.152 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -488.104019 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.104019 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.357067 (E_RNA) where: Base-Base interactions energy: -369.268 where: short stacking energy: -139.043 Base-Backbone interact. energy: -0.009 local terms energy: -121.473531 where: bonds (distance) C4'-P energy: -14.119 bonds (distance) P-C4' energy: -18.522 flat angles C4'-P-C4' energy: -28.856 flat angles P-C4'-P energy: -22.073 tors. eta vs tors. theta energy: -37.904 Dist. restrs. and SS energy: 2.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.394 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -452.729192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.729192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.640690 (E_RNA) where: Base-Base interactions energy: -348.000 where: short stacking energy: -121.149 Base-Backbone interact. energy: -0.034 local terms energy: -106.606836 where: bonds (distance) C4'-P energy: -21.073 bonds (distance) P-C4' energy: -19.048 flat angles C4'-P-C4' energy: -12.410 flat angles P-C4'-P energy: -14.727 tors. eta vs tors. theta energy: -39.349 Dist. restrs. and SS energy: 1.911 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -607.635063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.635063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.786444 (E_RNA) where: Base-Base interactions energy: -439.222 where: short stacking energy: -170.376 Base-Backbone interact. energy: -0.001 local terms energy: -168.564263 where: bonds (distance) C4'-P energy: -32.274 bonds (distance) P-C4' energy: -31.073 flat angles C4'-P-C4' energy: -31.495 flat angles P-C4'-P energy: -24.159 tors. eta vs tors. theta energy: -49.563 Dist. restrs. and SS energy: 0.151 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -604.359517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.359517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.785525 (E_RNA) where: Base-Base interactions energy: -437.167 where: short stacking energy: -170.413 Base-Backbone interact. energy: -0.001 local terms energy: -167.617758 where: bonds (distance) C4'-P energy: -25.795 bonds (distance) P-C4' energy: -28.805 flat angles C4'-P-C4' energy: -36.280 flat angles P-C4'-P energy: -24.533 tors. eta vs tors. theta energy: -52.205 Dist. restrs. and SS energy: 0.426 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -591.939428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.939428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.269990 (E_RNA) where: Base-Base interactions energy: -427.033 where: short stacking energy: -162.546 Base-Backbone interact. energy: -0.000 local terms energy: -165.236040 where: bonds (distance) C4'-P energy: -26.741 bonds (distance) P-C4' energy: -32.001 flat angles C4'-P-C4' energy: -31.434 flat angles P-C4'-P energy: -24.691 tors. eta vs tors. theta energy: -50.369 Dist. restrs. and SS energy: 0.331 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -589.110230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.110230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.325727 (E_RNA) where: Base-Base interactions energy: -434.860 where: short stacking energy: -168.002 Base-Backbone interact. energy: -0.001 local terms energy: -154.464332 where: bonds (distance) C4'-P energy: -23.779 bonds (distance) P-C4' energy: -21.579 flat angles C4'-P-C4' energy: -32.975 flat angles P-C4'-P energy: -25.743 tors. eta vs tors. theta energy: -50.389 Dist. restrs. and SS energy: 0.215 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -579.777234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.777234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.968525 (E_RNA) where: Base-Base interactions energy: -422.449 where: short stacking energy: -162.414 Base-Backbone interact. energy: -0.001 local terms energy: -157.518927 where: bonds (distance) C4'-P energy: -29.112 bonds (distance) P-C4' energy: -27.709 flat angles C4'-P-C4' energy: -32.782 flat angles P-C4'-P energy: -20.613 tors. eta vs tors. theta energy: -47.303 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -566.840975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.840975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.060112 (E_RNA) where: Base-Base interactions energy: -426.813 where: short stacking energy: -165.038 Base-Backbone interact. energy: -0.001 local terms energy: -141.802190 where: bonds (distance) C4'-P energy: -20.987 bonds (distance) P-C4' energy: -20.488 flat angles C4'-P-C4' energy: -28.600 flat angles P-C4'-P energy: -23.221 tors. eta vs tors. theta energy: -48.507 Dist. restrs. and SS energy: 0.219 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.556 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -502.073541 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.073541 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.007125 (E_RNA) where: Base-Base interactions energy: -370.727 where: short stacking energy: -135.317 Base-Backbone interact. energy: 1.125 local terms energy: -134.404556 where: bonds (distance) C4'-P energy: -27.708 bonds (distance) P-C4' energy: -23.981 flat angles C4'-P-C4' energy: -25.115 flat angles P-C4'-P energy: -21.623 tors. eta vs tors. theta energy: -35.977 Dist. restrs. and SS energy: 1.934 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -506.378765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -506.378765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -507.051392 (E_RNA) where: Base-Base interactions energy: -376.274 where: short stacking energy: -139.758 Base-Backbone interact. energy: 0.692 local terms energy: -132.516845 where: bonds (distance) C4'-P energy: -28.061 bonds (distance) P-C4' energy: -22.009 flat angles C4'-P-C4' energy: -26.409 flat angles P-C4'-P energy: -21.581 tors. eta vs tors. theta energy: -34.458 Dist. restrs. and SS energy: 0.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.048 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -443.236346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.236346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.270881 (E_RNA) where: Base-Base interactions energy: -329.410 where: short stacking energy: -117.643 Base-Backbone interact. energy: -0.008 local terms energy: -120.852257 where: bonds (distance) C4'-P energy: -12.888 bonds (distance) P-C4' energy: -29.382 flat angles C4'-P-C4' energy: -25.796 flat angles P-C4'-P energy: -16.063 tors. eta vs tors. theta energy: -36.723 Dist. restrs. and SS energy: 7.035 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -492.559525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.559525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.297446 (E_RNA) where: Base-Base interactions energy: -360.102 where: short stacking energy: -132.368 Base-Backbone interact. energy: -0.644 local terms energy: -132.691820 where: bonds (distance) C4'-P energy: -21.598 bonds (distance) P-C4' energy: -27.026 flat angles C4'-P-C4' energy: -28.534 flat angles P-C4'-P energy: -17.731 tors. eta vs tors. theta energy: -37.802 Dist. restrs. and SS energy: 0.738 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.140 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 5 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -595.193532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.193532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.628500 (E_RNA) where: Base-Base interactions energy: -428.000 where: short stacking energy: -169.284 Base-Backbone interact. energy: -0.122 local terms energy: -167.506558 where: bonds (distance) C4'-P energy: -27.404 bonds (distance) P-C4' energy: -32.650 flat angles C4'-P-C4' energy: -32.289 flat angles P-C4'-P energy: -24.608 tors. eta vs tors. theta energy: -50.556 Dist. restrs. and SS energy: 0.435 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -596.898289 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.898289 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.340864 (E_RNA) where: Base-Base interactions energy: -431.775 where: short stacking energy: -166.794 Base-Backbone interact. energy: -0.002 local terms energy: -165.563411 where: bonds (distance) C4'-P energy: -24.511 bonds (distance) P-C4' energy: -24.725 flat angles C4'-P-C4' energy: -36.491 flat angles P-C4'-P energy: -28.378 tors. eta vs tors. theta energy: -51.457 Dist. restrs. and SS energy: 0.443 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -588.822531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.822531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.231550 (E_RNA) where: Base-Base interactions energy: -427.333 where: short stacking energy: -164.793 Base-Backbone interact. energy: -0.004 local terms energy: -161.894837 where: bonds (distance) C4'-P energy: -24.188 bonds (distance) P-C4' energy: -30.221 flat angles C4'-P-C4' energy: -35.068 flat angles P-C4'-P energy: -19.046 tors. eta vs tors. theta energy: -53.371 Dist. restrs. and SS energy: 0.409 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -585.895277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.895277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.015139 (E_RNA) where: Base-Base interactions energy: -427.102 where: short stacking energy: -164.137 Base-Backbone interact. energy: -0.001 local terms energy: -158.912172 where: bonds (distance) C4'-P energy: -31.118 bonds (distance) P-C4' energy: -27.729 flat angles C4'-P-C4' energy: -26.893 flat angles P-C4'-P energy: -25.640 tors. eta vs tors. theta energy: -47.530 Dist. restrs. and SS energy: 0.120 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -577.347186 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.347186 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.616921 (E_RNA) where: Base-Base interactions energy: -425.869 where: short stacking energy: -161.564 Base-Backbone interact. energy: -0.589 local terms energy: -151.159539 where: bonds (distance) C4'-P energy: -24.960 bonds (distance) P-C4' energy: -26.748 flat angles C4'-P-C4' energy: -28.067 flat angles P-C4'-P energy: -21.725 tors. eta vs tors. theta energy: -49.658 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -580.061273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -580.061273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.221623 (E_RNA) where: Base-Base interactions energy: -423.814 where: short stacking energy: -158.910 Base-Backbone interact. energy: -0.008 local terms energy: -156.688587 where: bonds (distance) C4'-P energy: -20.722 bonds (distance) P-C4' energy: -31.848 flat angles C4'-P-C4' energy: -31.210 flat angles P-C4'-P energy: -24.615 tors. eta vs tors. theta energy: -48.293 Dist. restrs. and SS energy: 0.160 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.288 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -501.584066 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.584066 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.515283 (E_RNA) where: Base-Base interactions energy: -382.450 where: short stacking energy: -135.506 Base-Backbone interact. energy: 0.352 local terms energy: -120.416673 where: bonds (distance) C4'-P energy: -18.811 bonds (distance) P-C4' energy: -23.833 flat angles C4'-P-C4' energy: -21.595 flat angles P-C4'-P energy: -18.723 tors. eta vs tors. theta energy: -37.455 Dist. restrs. and SS energy: 0.931 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -500.839121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.839121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.840084 (E_RNA) where: Base-Base interactions energy: -366.036 where: short stacking energy: -134.718 Base-Backbone interact. energy: 0.563 local terms energy: -136.367044 where: bonds (distance) C4'-P energy: -30.622 bonds (distance) P-C4' energy: -22.798 flat angles C4'-P-C4' energy: -23.953 flat angles P-C4'-P energy: -19.008 tors. eta vs tors. theta energy: -39.986 Dist. restrs. and SS energy: 1.001 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -459.191085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.191085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.868412 (E_RNA) where: Base-Base interactions energy: -336.164 where: short stacking energy: -121.111 Base-Backbone interact. energy: -0.176 local terms energy: -129.528080 where: bonds (distance) C4'-P energy: -24.111 bonds (distance) P-C4' energy: -27.392 flat angles C4'-P-C4' energy: -29.993 flat angles P-C4'-P energy: -10.114 tors. eta vs tors. theta energy: -37.918 Dist. restrs. and SS energy: 6.677 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -485.017705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.017705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -487.146101 (E_RNA) where: Base-Base interactions energy: -365.530 where: short stacking energy: -143.146 Base-Backbone interact. energy: -0.001 local terms energy: -122.387603 where: bonds (distance) C4'-P energy: -15.760 bonds (distance) P-C4' energy: -17.621 flat angles C4'-P-C4' energy: -25.110 flat angles P-C4'-P energy: -18.724 tors. eta vs tors. theta energy: -45.173 Dist. restrs. and SS energy: 2.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.772 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -611.593189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.593189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -612.049446 (E_RNA) where: Base-Base interactions energy: -444.058 where: short stacking energy: -170.447 Base-Backbone interact. energy: -0.002 local terms energy: -167.989296 where: bonds (distance) C4'-P energy: -29.347 bonds (distance) P-C4' energy: -34.995 flat angles C4'-P-C4' energy: -32.625 flat angles P-C4'-P energy: -22.774 tors. eta vs tors. theta energy: -48.248 Dist. restrs. and SS energy: 0.456 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 5 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -591.182954 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -591.182954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -591.278689 (E_RNA) where: Base-Base interactions energy: -437.182 where: short stacking energy: -170.530 Base-Backbone interact. energy: -0.002 local terms energy: -154.094631 where: bonds (distance) C4'-P energy: -20.414 bonds (distance) P-C4' energy: -25.244 flat angles C4'-P-C4' energy: -31.470 flat angles P-C4'-P energy: -26.099 tors. eta vs tors. theta energy: -50.867 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -592.457523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.457523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.654591 (E_RNA) where: Base-Base interactions energy: -432.919 where: short stacking energy: -167.634 Base-Backbone interact. energy: -0.002 local terms energy: -159.733288 where: bonds (distance) C4'-P energy: -26.383 bonds (distance) P-C4' energy: -27.784 flat angles C4'-P-C4' energy: -32.004 flat angles P-C4'-P energy: -24.666 tors. eta vs tors. theta energy: -48.896 Dist. restrs. and SS energy: 0.197 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -579.711182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -579.711182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -580.748998 (E_RNA) where: Base-Base interactions energy: -415.902 where: short stacking energy: -162.177 Base-Backbone interact. energy: -0.010 local terms energy: -164.837513 where: bonds (distance) C4'-P energy: -31.326 bonds (distance) P-C4' energy: -22.158 flat angles C4'-P-C4' energy: -34.559 flat angles P-C4'-P energy: -27.393 tors. eta vs tors. theta energy: -49.402 Dist. restrs. and SS energy: 1.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -582.391355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.391355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -582.487249 (E_RNA) where: Base-Base interactions energy: -427.603 where: short stacking energy: -161.881 Base-Backbone interact. energy: -0.001 local terms energy: -154.883574 where: bonds (distance) C4'-P energy: -25.410 bonds (distance) P-C4' energy: -22.882 flat angles C4'-P-C4' energy: -28.966 flat angles P-C4'-P energy: -28.309 tors. eta vs tors. theta energy: -49.317 Dist. restrs. and SS energy: 0.096 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -563.690381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.690381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.881071 (E_RNA) where: Base-Base interactions energy: -417.671 where: short stacking energy: -155.591 Base-Backbone interact. energy: -0.122 local terms energy: -146.128505 where: bonds (distance) C4'-P energy: -26.413 bonds (distance) P-C4' energy: -19.463 flat angles C4'-P-C4' energy: -31.610 flat angles P-C4'-P energy: -20.512 tors. eta vs tors. theta energy: -48.131 Dist. restrs. and SS energy: 0.191 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.041 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -515.063261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -515.063261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.324546 (E_RNA) where: Base-Base interactions energy: -382.597 where: short stacking energy: -136.169 Base-Backbone interact. energy: 0.148 local terms energy: -133.687619 where: bonds (distance) C4'-P energy: -20.402 bonds (distance) P-C4' energy: -27.580 flat angles C4'-P-C4' energy: -31.977 flat angles P-C4'-P energy: -16.269 tors. eta vs tors. theta energy: -37.459 Dist. restrs. and SS energy: 0.261 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.812 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -497.297357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.297357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.007718 (E_RNA) where: Base-Base interactions energy: -369.989 where: short stacking energy: -137.171 Base-Backbone interact. energy: -0.411 local terms energy: -128.606876 where: bonds (distance) C4'-P energy: -19.070 bonds (distance) P-C4' energy: -25.418 flat angles C4'-P-C4' energy: -27.303 flat angles P-C4'-P energy: -22.055 tors. eta vs tors. theta energy: -34.760 Dist. restrs. and SS energy: 1.710 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -488.999494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.999494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -489.689825 (E_RNA) where: Base-Base interactions energy: -365.070 where: short stacking energy: -139.644 Base-Backbone interact. energy: -0.358 local terms energy: -124.262053 where: bonds (distance) C4'-P energy: -18.393 bonds (distance) P-C4' energy: -22.342 flat angles C4'-P-C4' energy: -27.738 flat angles P-C4'-P energy: -17.895 tors. eta vs tors. theta energy: -37.894 Dist. restrs. and SS energy: 0.690 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -446.217674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.217674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.415873 (E_RNA) where: Base-Base interactions energy: -331.070 where: short stacking energy: -111.723 Base-Backbone interact. energy: -0.204 local terms energy: -118.142038 where: bonds (distance) C4'-P energy: -24.844 bonds (distance) P-C4' energy: -24.046 flat angles C4'-P-C4' energy: -19.670 flat angles P-C4'-P energy: -13.413 tors. eta vs tors. theta energy: -36.169 Dist. restrs. and SS energy: 3.198 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -600.501918 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.501918 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -601.119849 (E_RNA) where: Base-Base interactions energy: -437.245 where: short stacking energy: -172.900 Base-Backbone interact. energy: -0.042 local terms energy: -163.832675 where: bonds (distance) C4'-P energy: -27.185 bonds (distance) P-C4' energy: -24.402 flat angles C4'-P-C4' energy: -33.863 flat angles P-C4'-P energy: -26.258 tors. eta vs tors. theta energy: -52.125 Dist. restrs. and SS energy: 0.618 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -595.178020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.178020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.314378 (E_RNA) where: Base-Base interactions energy: -432.439 where: short stacking energy: -162.128 Base-Backbone interact. energy: -0.001 local terms energy: -162.874342 where: bonds (distance) C4'-P energy: -25.213 bonds (distance) P-C4' energy: -26.229 flat angles C4'-P-C4' energy: -31.784 flat angles P-C4'-P energy: -29.441 tors. eta vs tors. theta energy: -50.208 Dist. restrs. and SS energy: 0.136 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -599.730940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -599.730940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -599.922711 (E_RNA) where: Base-Base interactions energy: -428.460 where: short stacking energy: -162.011 Base-Backbone interact. energy: -0.216 local terms energy: -171.533036 where: bonds (distance) C4'-P energy: -28.247 bonds (distance) P-C4' energy: -33.853 flat angles C4'-P-C4' energy: -33.775 flat angles P-C4'-P energy: -26.467 tors. eta vs tors. theta energy: -49.191 Dist. restrs. and SS energy: 0.192 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.286 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -578.871050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.871050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -579.201058 (E_RNA) where: Base-Base interactions energy: -422.933 where: short stacking energy: -160.025 Base-Backbone interact. energy: -0.486 local terms energy: -155.782563 where: bonds (distance) C4'-P energy: -22.417 bonds (distance) P-C4' energy: -27.033 flat angles C4'-P-C4' energy: -35.803 flat angles P-C4'-P energy: -21.918 tors. eta vs tors. theta energy: -48.612 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -583.974488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.974488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.216064 (E_RNA) where: Base-Base interactions energy: -421.253 where: short stacking energy: -165.828 Base-Backbone interact. energy: -0.011 local terms energy: -162.951582 where: bonds (distance) C4'-P energy: -27.282 bonds (distance) P-C4' energy: -28.717 flat angles C4'-P-C4' energy: -33.129 flat angles P-C4'-P energy: -23.171 tors. eta vs tors. theta energy: -50.652 Dist. restrs. and SS energy: 0.242 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -553.048889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.048889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.659540 (E_RNA) where: Base-Base interactions energy: -402.132 where: short stacking energy: -155.862 Base-Backbone interact. energy: -0.005 local terms energy: -151.522580 where: bonds (distance) C4'-P energy: -26.178 bonds (distance) P-C4' energy: -24.944 flat angles C4'-P-C4' energy: -30.666 flat angles P-C4'-P energy: -23.399 tors. eta vs tors. theta energy: -46.336 Dist. restrs. and SS energy: 0.611 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -512.587335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.587335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.651540 (E_RNA) where: Base-Base interactions energy: -391.026 where: short stacking energy: -142.965 Base-Backbone interact. energy: 1.228 local terms energy: -124.025211 where: bonds (distance) C4'-P energy: -14.807 bonds (distance) P-C4' energy: -23.392 flat angles C4'-P-C4' energy: -27.630 flat angles P-C4'-P energy: -18.860 tors. eta vs tors. theta energy: -39.336 Dist. restrs. and SS energy: 1.064 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.172 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -507.915058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.915058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.913558 (E_RNA) where: Base-Base interactions energy: -384.641 where: short stacking energy: -138.870 Base-Backbone interact. energy: 0.774 local terms energy: -125.046679 where: bonds (distance) C4'-P energy: -14.007 bonds (distance) P-C4' energy: -24.429 flat angles C4'-P-C4' energy: -30.178 flat angles P-C4'-P energy: -17.937 tors. eta vs tors. theta energy: -38.495 Dist. restrs. and SS energy: 0.998 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -499.945077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.945077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.502920 (E_RNA) where: Base-Base interactions energy: -372.356 where: short stacking energy: -130.300 Base-Backbone interact. energy: -0.090 local terms energy: -129.056837 where: bonds (distance) C4'-P energy: -23.540 bonds (distance) P-C4' energy: -17.579 flat angles C4'-P-C4' energy: -28.264 flat angles P-C4'-P energy: -18.418 tors. eta vs tors. theta energy: -41.256 Dist. restrs. and SS energy: 1.558 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -456.644136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.644136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.885557 (E_RNA) where: Base-Base interactions energy: -344.975 where: short stacking energy: -130.202 Base-Backbone interact. energy: -0.559 local terms energy: -117.351587 where: bonds (distance) C4'-P energy: -13.623 bonds (distance) P-C4' energy: -23.922 flat angles C4'-P-C4' energy: -26.631 flat angles P-C4'-P energy: -14.025 tors. eta vs tors. theta energy: -39.151 Dist. restrs. and SS energy: 6.241 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -596.325376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.325376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.437201 (E_RNA) where: Base-Base interactions energy: -429.974 where: short stacking energy: -165.059 Base-Backbone interact. energy: -0.003 local terms energy: -166.460604 where: bonds (distance) C4'-P energy: -25.720 bonds (distance) P-C4' energy: -28.895 flat angles C4'-P-C4' energy: -31.875 flat angles P-C4'-P energy: -30.101 tors. eta vs tors. theta energy: -49.870 Dist. restrs. and SS energy: 0.112 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -601.779182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -601.779182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -602.215257 (E_RNA) where: Base-Base interactions energy: -434.050 where: short stacking energy: -165.212 Base-Backbone interact. energy: -0.000 local terms energy: -168.165045 where: bonds (distance) C4'-P energy: -25.760 bonds (distance) P-C4' energy: -29.810 flat angles C4'-P-C4' energy: -33.396 flat angles P-C4'-P energy: -27.922 tors. eta vs tors. theta energy: -51.278 Dist. restrs. and SS energy: 0.436 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -598.280199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -598.280199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -598.666868 (E_RNA) where: Base-Base interactions energy: -431.686 where: short stacking energy: -167.813 Base-Backbone interact. energy: -0.075 local terms energy: -166.906746 where: bonds (distance) C4'-P energy: -27.451 bonds (distance) P-C4' energy: -27.817 flat angles C4'-P-C4' energy: -33.384 flat angles P-C4'-P energy: -26.692 tors. eta vs tors. theta energy: -51.563 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -577.294398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.294398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.621875 (E_RNA) where: Base-Base interactions energy: -425.928 where: short stacking energy: -160.195 Base-Backbone interact. energy: -0.537 local terms energy: -151.156804 where: bonds (distance) C4'-P energy: -26.071 bonds (distance) P-C4' energy: -29.240 flat angles C4'-P-C4' energy: -29.407 flat angles P-C4'-P energy: -19.751 tors. eta vs tors. theta energy: -46.688 Dist. restrs. and SS energy: 0.327 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 10 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -577.040444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.040444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -577.631157 (E_RNA) where: Base-Base interactions energy: -417.948 where: short stacking energy: -161.132 Base-Backbone interact. energy: -0.212 local terms energy: -159.471104 where: bonds (distance) C4'-P energy: -31.425 bonds (distance) P-C4' energy: -27.710 flat angles C4'-P-C4' energy: -29.944 flat angles P-C4'-P energy: -20.101 tors. eta vs tors. theta energy: -50.291 Dist. restrs. and SS energy: 0.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -567.078530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.078530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.495618 (E_RNA) where: Base-Base interactions energy: -414.851 where: short stacking energy: -152.478 Base-Backbone interact. energy: -0.158 local terms energy: -152.486943 where: bonds (distance) C4'-P energy: -28.135 bonds (distance) P-C4' energy: -27.065 flat angles C4'-P-C4' energy: -29.636 flat angles P-C4'-P energy: -21.770 tors. eta vs tors. theta energy: -45.881 Dist. restrs. and SS energy: 0.417 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -514.459668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -514.459668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.803941 (E_RNA) where: Base-Base interactions energy: -389.306 where: short stacking energy: -143.843 Base-Backbone interact. energy: 1.070 local terms energy: -126.567465 where: bonds (distance) C4'-P energy: -16.383 bonds (distance) P-C4' energy: -23.076 flat angles C4'-P-C4' energy: -31.096 flat angles P-C4'-P energy: -20.762 tors. eta vs tors. theta energy: -35.250 Dist. restrs. and SS energy: 0.344 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 7 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -512.303636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.303636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.524744 (E_RNA) where: Base-Base interactions energy: -378.226 where: short stacking energy: -136.391 Base-Backbone interact. energy: 1.856 local terms energy: -139.241025 where: bonds (distance) C4'-P energy: -23.180 bonds (distance) P-C4' energy: -23.349 flat angles C4'-P-C4' energy: -30.879 flat angles P-C4'-P energy: -22.393 tors. eta vs tors. theta energy: -39.440 Dist. restrs. and SS energy: 2.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.087 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -520.444189 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -520.444189 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.649348 (E_RNA) where: Base-Base interactions energy: -378.496 where: short stacking energy: -143.614 Base-Backbone interact. energy: -0.252 local terms energy: -145.901415 where: bonds (distance) C4'-P energy: -29.451 bonds (distance) P-C4' energy: -26.858 flat angles C4'-P-C4' energy: -26.060 flat angles P-C4'-P energy: -24.139 tors. eta vs tors. theta energy: -39.394 Dist. restrs. and SS energy: 4.205 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -485.018135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.018135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.566380 (E_RNA) where: Base-Base interactions energy: -362.975 where: short stacking energy: -132.440 Base-Backbone interact. energy: -0.161 local terms energy: -125.128191 where: bonds (distance) C4'-P energy: -22.765 bonds (distance) P-C4' energy: -19.653 flat angles C4'-P-C4' energy: -28.327 flat angles P-C4'-P energy: -14.935 tors. eta vs tors. theta energy: -39.448 Dist. restrs. and SS energy: 1.548 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.698 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -615.536943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.536943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.588351 (E_RNA) where: Base-Base interactions energy: -444.272 where: short stacking energy: -173.924 Base-Backbone interact. energy: -0.122 local terms energy: -171.194856 where: bonds (distance) C4'-P energy: -27.228 bonds (distance) P-C4' energy: -28.797 flat angles C4'-P-C4' energy: -35.886 flat angles P-C4'-P energy: -28.442 tors. eta vs tors. theta energy: -50.842 Dist. restrs. and SS energy: 0.051 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -605.894207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.894207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.001916 (E_RNA) where: Base-Base interactions energy: -437.896 where: short stacking energy: -166.614 Base-Backbone interact. energy: -0.001 local terms energy: -168.105410 where: bonds (distance) C4'-P energy: -23.868 bonds (distance) P-C4' energy: -32.770 flat angles C4'-P-C4' energy: -34.217 flat angles P-C4'-P energy: -26.933 tors. eta vs tors. theta energy: -50.318 Dist. restrs. and SS energy: 0.108 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -586.665297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.665297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.995752 (E_RNA) where: Base-Base interactions energy: -423.932 where: short stacking energy: -160.854 Base-Backbone interact. energy: -0.123 local terms energy: -162.941125 where: bonds (distance) C4'-P energy: -30.504 bonds (distance) P-C4' energy: -29.267 flat angles C4'-P-C4' energy: -29.915 flat angles P-C4'-P energy: -25.584 tors. eta vs tors. theta energy: -47.670 Dist. restrs. and SS energy: 0.330 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 10 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -577.565749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.565749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.326222 (E_RNA) where: Base-Base interactions energy: -416.840 where: short stacking energy: -161.921 Base-Backbone interact. energy: -0.280 local terms energy: -161.206969 where: bonds (distance) C4'-P energy: -21.850 bonds (distance) P-C4' energy: -29.401 flat angles C4'-P-C4' energy: -32.729 flat angles P-C4'-P energy: -25.312 tors. eta vs tors. theta energy: -51.915 Dist. restrs. and SS energy: 0.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -577.955689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -577.955689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.342697 (E_RNA) where: Base-Base interactions energy: -422.542 where: short stacking energy: -160.913 Base-Backbone interact. energy: -0.000 local terms energy: -155.800278 where: bonds (distance) C4'-P energy: -26.625 bonds (distance) P-C4' energy: -23.519 flat angles C4'-P-C4' energy: -29.269 flat angles P-C4'-P energy: -26.842 tors. eta vs tors. theta energy: -49.546 Dist. restrs. and SS energy: 0.387 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -569.339109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -569.339109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -569.945445 (E_RNA) where: Base-Base interactions energy: -412.909 where: short stacking energy: -159.389 Base-Backbone interact. energy: -0.001 local terms energy: -157.035417 where: bonds (distance) C4'-P energy: -25.482 bonds (distance) P-C4' energy: -31.843 flat angles C4'-P-C4' energy: -29.173 flat angles P-C4'-P energy: -22.040 tors. eta vs tors. theta energy: -48.496 Dist. restrs. and SS energy: 0.606 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -512.892938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -512.892938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -514.259432 (E_RNA) where: Base-Base interactions energy: -376.447 where: short stacking energy: -137.843 Base-Backbone interact. energy: -1.180 local terms energy: -136.632456 where: bonds (distance) C4'-P energy: -19.855 bonds (distance) P-C4' energy: -25.989 flat angles C4'-P-C4' energy: -32.219 flat angles P-C4'-P energy: -21.021 tors. eta vs tors. theta energy: -37.548 Dist. restrs. and SS energy: 1.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -491.134508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.134508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -494.226577 (E_RNA) where: Base-Base interactions energy: -366.941 where: short stacking energy: -140.982 Base-Backbone interact. energy: -0.496 local terms energy: -126.790067 where: bonds (distance) C4'-P energy: -21.857 bonds (distance) P-C4' energy: -22.476 flat angles C4'-P-C4' energy: -30.918 flat angles P-C4'-P energy: -10.568 tors. eta vs tors. theta energy: -40.971 Dist. restrs. and SS energy: 3.092 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -510.735936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -510.735936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -513.061485 (E_RNA) where: Base-Base interactions energy: -372.492 where: short stacking energy: -144.375 Base-Backbone interact. energy: -0.329 local terms energy: -140.240692 where: bonds (distance) C4'-P energy: -25.982 bonds (distance) P-C4' energy: -26.867 flat angles C4'-P-C4' energy: -25.312 flat angles P-C4'-P energy: -24.993 tors. eta vs tors. theta energy: -37.085 Dist. restrs. and SS energy: 2.326 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -476.368315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.368315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -477.972800 (E_RNA) where: Base-Base interactions energy: -355.857 where: short stacking energy: -129.261 Base-Backbone interact. energy: -0.156 local terms energy: -121.959779 where: bonds (distance) C4'-P energy: -20.836 bonds (distance) P-C4' energy: -20.910 flat angles C4'-P-C4' energy: -27.811 flat angles P-C4'-P energy: -13.179 tors. eta vs tors. theta energy: -39.224 Dist. restrs. and SS energy: 1.604 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -600.532279 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.532279 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.853486 (E_RNA) where: Base-Base interactions energy: -438.169 where: short stacking energy: -166.692 Base-Backbone interact. energy: -0.239 local terms energy: -162.446017 where: bonds (distance) C4'-P energy: -27.935 bonds (distance) P-C4' energy: -30.381 flat angles C4'-P-C4' energy: -30.024 flat angles P-C4'-P energy: -25.139 tors. eta vs tors. theta energy: -48.966 Dist. restrs. and SS energy: 0.321 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -607.419896 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -607.419896 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -607.531096 (E_RNA) where: Base-Base interactions energy: -439.176 where: short stacking energy: -170.128 Base-Backbone interact. energy: -0.148 local terms energy: -168.207019 where: bonds (distance) C4'-P energy: -28.358 bonds (distance) P-C4' energy: -30.086 flat angles C4'-P-C4' energy: -33.950 flat angles P-C4'-P energy: -23.850 tors. eta vs tors. theta energy: -51.963 Dist. restrs. and SS energy: 0.111 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 10 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -593.504901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.504901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.833604 (E_RNA) where: Base-Base interactions energy: -431.694 where: short stacking energy: -165.925 Base-Backbone interact. energy: -0.001 local terms energy: -162.139194 where: bonds (distance) C4'-P energy: -24.815 bonds (distance) P-C4' energy: -27.842 flat angles C4'-P-C4' energy: -33.295 flat angles P-C4'-P energy: -25.876 tors. eta vs tors. theta energy: -50.310 Dist. restrs. and SS energy: 0.329 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -583.937388 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.937388 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.376259 (E_RNA) where: Base-Base interactions energy: -419.767 where: short stacking energy: -160.627 Base-Backbone interact. energy: -0.001 local terms energy: -164.607901 where: bonds (distance) C4'-P energy: -32.245 bonds (distance) P-C4' energy: -30.409 flat angles C4'-P-C4' energy: -28.181 flat angles P-C4'-P energy: -23.675 tors. eta vs tors. theta energy: -50.097 Dist. restrs. and SS energy: 0.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -594.327646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.327646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.607467 (E_RNA) where: Base-Base interactions energy: -442.856 where: short stacking energy: -170.677 Base-Backbone interact. energy: -0.163 local terms energy: -151.588859 where: bonds (distance) C4'-P energy: -23.112 bonds (distance) P-C4' energy: -20.110 flat angles C4'-P-C4' energy: -32.959 flat angles P-C4'-P energy: -23.961 tors. eta vs tors. theta energy: -51.447 Dist. restrs. and SS energy: 0.280 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -561.109397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -561.109397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.323803 (E_RNA) where: Base-Base interactions energy: -409.044 where: short stacking energy: -154.778 Base-Backbone interact. energy: -0.001 local terms energy: -152.278794 where: bonds (distance) C4'-P energy: -26.138 bonds (distance) P-C4' energy: -21.792 flat angles C4'-P-C4' energy: -33.535 flat angles P-C4'-P energy: -22.493 tors. eta vs tors. theta energy: -48.321 Dist. restrs. and SS energy: 0.214 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -524.437272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -524.437272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.765341 (E_RNA) where: Base-Base interactions energy: -401.032 where: short stacking energy: -147.867 Base-Backbone interact. energy: -0.568 local terms energy: -123.165412 where: bonds (distance) C4'-P energy: -15.084 bonds (distance) P-C4' energy: -25.391 flat angles C4'-P-C4' energy: -27.654 flat angles P-C4'-P energy: -17.534 tors. eta vs tors. theta energy: -37.502 Dist. restrs. and SS energy: 0.328 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -530.574547 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.574547 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -531.851502 (E_RNA) where: Base-Base interactions energy: -393.758 where: short stacking energy: -155.631 Base-Backbone interact. energy: -0.130 local terms energy: -137.962977 where: bonds (distance) C4'-P energy: -22.746 bonds (distance) P-C4' energy: -23.525 flat angles C4'-P-C4' energy: -27.153 flat angles P-C4'-P energy: -20.309 tors. eta vs tors. theta energy: -44.231 Dist. restrs. and SS energy: 1.277 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -496.275183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.275183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.092719 (E_RNA) where: Base-Base interactions energy: -365.148 where: short stacking energy: -137.126 Base-Backbone interact. energy: 0.422 local terms energy: -135.467930 where: bonds (distance) C4'-P energy: -18.008 bonds (distance) P-C4' energy: -28.753 flat angles C4'-P-C4' energy: -32.080 flat angles P-C4'-P energy: -17.050 tors. eta vs tors. theta energy: -39.577 Dist. restrs. and SS energy: 3.818 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.101 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -476.595040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.595040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.186162 (E_RNA) where: Base-Base interactions energy: -352.678 where: short stacking energy: -124.812 Base-Backbone interact. energy: -0.276 local terms energy: -128.231952 where: bonds (distance) C4'-P energy: -20.678 bonds (distance) P-C4' energy: -27.993 flat angles C4'-P-C4' energy: -23.259 flat angles P-C4'-P energy: -17.558 tors. eta vs tors. theta energy: -38.744 Dist. restrs. and SS energy: 4.591 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -597.004398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -597.004398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.288923 (E_RNA) where: Base-Base interactions energy: -438.070 where: short stacking energy: -162.139 Base-Backbone interact. energy: -0.001 local terms energy: -159.217864 where: bonds (distance) C4'-P energy: -26.470 bonds (distance) P-C4' energy: -30.455 flat angles C4'-P-C4' energy: -29.468 flat angles P-C4'-P energy: -24.009 tors. eta vs tors. theta energy: -48.816 Dist. restrs. and SS energy: 0.285 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -596.703778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -596.703778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.070262 (E_RNA) where: Base-Base interactions energy: -438.004 where: short stacking energy: -169.640 Base-Backbone interact. energy: -0.002 local terms energy: -159.063421 where: bonds (distance) C4'-P energy: -26.225 bonds (distance) P-C4' energy: -31.385 flat angles C4'-P-C4' energy: -28.223 flat angles P-C4'-P energy: -23.625 tors. eta vs tors. theta energy: -49.606 Dist. restrs. and SS energy: 0.366 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -594.267574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.267574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -594.559888 (E_RNA) where: Base-Base interactions energy: -430.881 where: short stacking energy: -160.659 Base-Backbone interact. energy: -0.001 local terms energy: -163.677658 where: bonds (distance) C4'-P energy: -22.339 bonds (distance) P-C4' energy: -32.861 flat angles C4'-P-C4' energy: -33.293 flat angles P-C4'-P energy: -24.268 tors. eta vs tors. theta energy: -50.917 Dist. restrs. and SS energy: 0.292 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -584.366829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.366829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.472852 (E_RNA) where: Base-Base interactions energy: -423.090 where: short stacking energy: -161.407 Base-Backbone interact. energy: -0.002 local terms energy: -161.380731 where: bonds (distance) C4'-P energy: -31.349 bonds (distance) P-C4' energy: -29.139 flat angles C4'-P-C4' energy: -28.819 flat angles P-C4'-P energy: -22.307 tors. eta vs tors. theta energy: -49.767 Dist. restrs. and SS energy: 0.106 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -573.852443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.852443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -574.021035 (E_RNA) where: Base-Base interactions energy: -418.629 where: short stacking energy: -159.875 Base-Backbone interact. energy: -0.001 local terms energy: -155.472640 where: bonds (distance) C4'-P energy: -25.042 bonds (distance) P-C4' energy: -22.732 flat angles C4'-P-C4' energy: -28.917 flat angles P-C4'-P energy: -27.262 tors. eta vs tors. theta energy: -51.520 Dist. restrs. and SS energy: 0.169 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.082 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -570.384306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -570.384306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -570.815543 (E_RNA) where: Base-Base interactions energy: -426.902 where: short stacking energy: -164.194 Base-Backbone interact. energy: -0.001 local terms energy: -144.357109 where: bonds (distance) C4'-P energy: -26.888 bonds (distance) P-C4' energy: -24.658 flat angles C4'-P-C4' energy: -26.752 flat angles P-C4'-P energy: -16.740 tors. eta vs tors. theta energy: -49.319 Dist. restrs. and SS energy: 0.431 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.445 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -507.352249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -507.352249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -508.480307 (E_RNA) where: Base-Base interactions energy: -375.681 where: short stacking energy: -138.128 Base-Backbone interact. energy: -0.829 local terms energy: -131.969434 where: bonds (distance) C4'-P energy: -22.686 bonds (distance) P-C4' energy: -23.480 flat angles C4'-P-C4' energy: -31.135 flat angles P-C4'-P energy: -17.903 tors. eta vs tors. theta energy: -36.765 Dist. restrs. and SS energy: 1.128 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -542.887560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.887560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.446582 (E_RNA) where: Base-Base interactions energy: -406.475 where: short stacking energy: -157.772 Base-Backbone interact. energy: -0.076 local terms energy: -136.895069 where: bonds (distance) C4'-P energy: -22.984 bonds (distance) P-C4' energy: -20.092 flat angles C4'-P-C4' energy: -26.073 flat angles P-C4'-P energy: -20.797 tors. eta vs tors. theta energy: -46.949 Dist. restrs. and SS energy: 0.559 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -496.559099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.559099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -498.325353 (E_RNA) where: Base-Base interactions energy: -367.217 where: short stacking energy: -129.346 Base-Backbone interact. energy: -0.795 local terms energy: -131.389053 where: bonds (distance) C4'-P energy: -26.807 bonds (distance) P-C4' energy: -23.994 flat angles C4'-P-C4' energy: -28.490 flat angles P-C4'-P energy: -12.348 tors. eta vs tors. theta energy: -39.751 Dist. restrs. and SS energy: 1.766 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.076 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 2 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -485.983152 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -485.983152 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.494054 (E_RNA) where: Base-Base interactions energy: -361.728 where: short stacking energy: -136.635 Base-Backbone interact. energy: 0.589 local terms energy: -127.355378 where: bonds (distance) C4'-P energy: -21.315 bonds (distance) P-C4' energy: -23.178 flat angles C4'-P-C4' energy: -20.653 flat angles P-C4'-P energy: -20.177 tors. eta vs tors. theta energy: -42.033 Dist. restrs. and SS energy: 2.511 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -600.149960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -600.149960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -600.425352 (E_RNA) where: Base-Base interactions energy: -440.343 where: short stacking energy: -165.752 Base-Backbone interact. energy: -0.001 local terms energy: -160.081479 where: bonds (distance) C4'-P energy: -30.863 bonds (distance) P-C4' energy: -21.772 flat angles C4'-P-C4' energy: -33.292 flat angles P-C4'-P energy: -23.493 tors. eta vs tors. theta energy: -50.662 Dist. restrs. and SS energy: 0.275 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -584.646934 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.646934 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.763522 (E_RNA) where: Base-Base interactions energy: -435.234 where: short stacking energy: -169.209 Base-Backbone interact. energy: -0.001 local terms energy: -149.528190 where: bonds (distance) C4'-P energy: -25.874 bonds (distance) P-C4' energy: -23.352 flat angles C4'-P-C4' energy: -26.625 flat angles P-C4'-P energy: -25.435 tors. eta vs tors. theta energy: -48.241 Dist. restrs. and SS energy: 0.117 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -592.503850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.503850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.854449 (E_RNA) where: Base-Base interactions energy: -433.433 where: short stacking energy: -167.665 Base-Backbone interact. energy: -0.000 local terms energy: -159.421304 where: bonds (distance) C4'-P energy: -22.911 bonds (distance) P-C4' energy: -30.411 flat angles C4'-P-C4' energy: -29.391 flat angles P-C4'-P energy: -26.429 tors. eta vs tors. theta energy: -50.279 Dist. restrs. and SS energy: 0.351 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -589.372610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -589.372610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -589.783399 (E_RNA) where: Base-Base interactions energy: -422.264 where: short stacking energy: -161.288 Base-Backbone interact. energy: -0.043 local terms energy: -167.927830 where: bonds (distance) C4'-P energy: -28.123 bonds (distance) P-C4' energy: -27.751 flat angles C4'-P-C4' energy: -34.002 flat angles P-C4'-P energy: -25.942 tors. eta vs tors. theta energy: -52.110 Dist. restrs. and SS energy: 0.411 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.451 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -582.744596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -582.744596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -583.129842 (E_RNA) where: Base-Base interactions energy: -431.739 where: short stacking energy: -167.051 Base-Backbone interact. energy: -0.001 local terms energy: -151.799837 where: bonds (distance) C4'-P energy: -25.038 bonds (distance) P-C4' energy: -23.857 flat angles C4'-P-C4' energy: -32.827 flat angles P-C4'-P energy: -21.986 tors. eta vs tors. theta energy: -48.092 Dist. restrs. and SS energy: 0.385 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.410 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -564.831702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.831702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -566.048160 (E_RNA) where: Base-Base interactions energy: -417.853 where: short stacking energy: -163.786 Base-Backbone interact. energy: -0.007 local terms energy: -148.188010 where: bonds (distance) C4'-P energy: -23.133 bonds (distance) P-C4' energy: -24.204 flat angles C4'-P-C4' energy: -28.528 flat angles P-C4'-P energy: -23.049 tors. eta vs tors. theta energy: -49.273 Dist. restrs. and SS energy: 1.216 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -522.884222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -522.884222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -524.789774 (E_RNA) where: Base-Base interactions energy: -391.285 where: short stacking energy: -150.966 Base-Backbone interact. energy: -0.148 local terms energy: -133.356703 where: bonds (distance) C4'-P energy: -20.513 bonds (distance) P-C4' energy: -27.746 flat angles C4'-P-C4' energy: -23.442 flat angles P-C4'-P energy: -22.694 tors. eta vs tors. theta energy: -38.961 Dist. restrs. and SS energy: 1.906 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 1 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -491.561303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.561303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.533264 (E_RNA) where: Base-Base interactions energy: -363.858 where: short stacking energy: -127.449 Base-Backbone interact. energy: 0.821 local terms energy: -129.495788 where: bonds (distance) C4'-P energy: -27.029 bonds (distance) P-C4' energy: -26.482 flat angles C4'-P-C4' energy: -23.006 flat angles P-C4'-P energy: -18.127 tors. eta vs tors. theta energy: -34.852 Dist. restrs. and SS energy: 0.972 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 2 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -547.517269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -547.517269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -548.402657 (E_RNA) where: Base-Base interactions energy: -407.010 where: short stacking energy: -158.962 Base-Backbone interact. energy: -0.000 local terms energy: -141.391812 where: bonds (distance) C4'-P energy: -21.217 bonds (distance) P-C4' energy: -23.724 flat angles C4'-P-C4' energy: -29.727 flat angles P-C4'-P energy: -20.470 tors. eta vs tors. theta energy: -46.254 Dist. restrs. and SS energy: 0.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -495.345176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.345176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.399281 (E_RNA) where: Base-Base interactions energy: -375.508 where: short stacking energy: -138.363 Base-Backbone interact. energy: -0.428 local terms energy: -120.462933 where: bonds (distance) C4'-P energy: -10.635 bonds (distance) P-C4' energy: -24.233 flat angles C4'-P-C4' energy: -29.058 flat angles P-C4'-P energy: -21.792 tors. eta vs tors. theta energy: -34.745 Dist. restrs. and SS energy: 1.054 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -612.964788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -612.964788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.434779 (E_RNA) where: Base-Base interactions energy: -443.809 where: short stacking energy: -166.686 Base-Backbone interact. energy: -0.000 local terms energy: -169.626074 where: bonds (distance) C4'-P energy: -27.065 bonds (distance) P-C4' energy: -31.555 flat angles C4'-P-C4' energy: -35.309 flat angles P-C4'-P energy: -25.944 tors. eta vs tors. theta energy: -49.753 Dist. restrs. and SS energy: 0.470 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 10 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -588.518485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -588.518485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -588.739597 (E_RNA) where: Base-Base interactions energy: -427.900 where: short stacking energy: -167.721 Base-Backbone interact. energy: -0.454 local terms energy: -160.754269 where: bonds (distance) C4'-P energy: -28.288 bonds (distance) P-C4' energy: -27.563 flat angles C4'-P-C4' energy: -30.563 flat angles P-C4'-P energy: -24.414 tors. eta vs tors. theta energy: -49.925 Dist. restrs. and SS energy: 0.221 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.369 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 5 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -586.874158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.874158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -587.246937 (E_RNA) where: Base-Base interactions energy: -426.015 where: short stacking energy: -165.869 Base-Backbone interact. energy: -0.131 local terms energy: -161.101383 where: bonds (distance) C4'-P energy: -30.217 bonds (distance) P-C4' energy: -28.146 flat angles C4'-P-C4' energy: -30.331 flat angles P-C4'-P energy: -24.008 tors. eta vs tors. theta energy: -48.400 Dist. restrs. and SS energy: 0.373 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -585.041422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -585.041422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -585.112354 (E_RNA) where: Base-Base interactions energy: -432.877 where: short stacking energy: -162.475 Base-Backbone interact. energy: -0.000 local terms energy: -152.234704 where: bonds (distance) C4'-P energy: -20.115 bonds (distance) P-C4' energy: -23.488 flat angles C4'-P-C4' energy: -34.217 flat angles P-C4'-P energy: -26.390 tors. eta vs tors. theta energy: -48.024 Dist. restrs. and SS energy: 0.071 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -573.149380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -573.149380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.343078 (E_RNA) where: Base-Base interactions energy: -418.654 where: short stacking energy: -153.657 Base-Backbone interact. energy: -0.001 local terms energy: -154.688514 where: bonds (distance) C4'-P energy: -23.412 bonds (distance) P-C4' energy: -28.910 flat angles C4'-P-C4' energy: -30.887 flat angles P-C4'-P energy: -23.733 tors. eta vs tors. theta energy: -47.747 Dist. restrs. and SS energy: 0.194 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -562.803905 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -562.803905 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.034580 (E_RNA) where: Base-Base interactions energy: -426.873 where: short stacking energy: -160.808 Base-Backbone interact. energy: -0.002 local terms energy: -136.159736 where: bonds (distance) C4'-P energy: -13.418 bonds (distance) P-C4' energy: -24.924 flat angles C4'-P-C4' energy: -31.150 flat angles P-C4'-P energy: -20.424 tors. eta vs tors. theta energy: -46.243 Dist. restrs. and SS energy: 0.231 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -571.354955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -571.354955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -571.874371 (E_RNA) where: Base-Base interactions energy: -417.380 where: short stacking energy: -166.225 Base-Backbone interact. energy: -0.001 local terms energy: -154.493273 where: bonds (distance) C4'-P energy: -25.153 bonds (distance) P-C4' energy: -20.398 flat angles C4'-P-C4' energy: -31.139 flat angles P-C4'-P energy: -27.699 tors. eta vs tors. theta energy: -50.103 Dist. restrs. and SS energy: 0.519 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 2 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -560.295600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.295600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.444451 (E_RNA) where: Base-Base interactions energy: -410.686 where: short stacking energy: -152.115 Base-Backbone interact. energy: -0.642 local terms energy: -150.249830 where: bonds (distance) C4'-P energy: -23.085 bonds (distance) P-C4' energy: -26.045 flat angles C4'-P-C4' energy: -30.451 flat angles P-C4'-P energy: -20.769 tors. eta vs tors. theta energy: -49.900 Dist. restrs. and SS energy: 0.149 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.133 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 1 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -483.375789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -483.375789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.216485 (E_RNA) where: Base-Base interactions energy: -367.609 where: short stacking energy: -137.055 Base-Backbone interact. energy: 2.253 local terms energy: -118.860661 where: bonds (distance) C4'-P energy: -20.543 bonds (distance) P-C4' energy: -18.705 flat angles C4'-P-C4' energy: -26.267 flat angles P-C4'-P energy: -16.122 tors. eta vs tors. theta energy: -37.223 Dist. restrs. and SS energy: 0.841 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 7 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -491.263474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.263474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.725027 (E_RNA) where: Base-Base interactions energy: -370.718 where: short stacking energy: -136.112 Base-Backbone interact. energy: 2.215 local terms energy: -131.009848 where: bonds (distance) C4'-P energy: -17.167 bonds (distance) P-C4' energy: -29.402 flat angles C4'-P-C4' energy: -31.783 flat angles P-C4'-P energy: -16.603 tors. eta vs tors. theta energy: -36.055 Dist. restrs. and SS energy: 6.462 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.789 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 102 Temperature: 0.900000 Total energy: -605.959392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -605.959392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.124980 (E_RNA) where: Base-Base interactions energy: -439.787 where: short stacking energy: -167.615 Base-Backbone interact. energy: -0.001 local terms energy: -166.337175 where: bonds (distance) C4'-P energy: -26.161 bonds (distance) P-C4' energy: -27.907 flat angles C4'-P-C4' energy: -35.326 flat angles P-C4'-P energy: -24.771 tors. eta vs tors. theta energy: -52.173 Dist. restrs. and SS energy: 0.166 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 102 Temperature: 0.950000 Total energy: -594.904769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -594.904769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -595.151456 (E_RNA) where: Base-Base interactions energy: -424.352 where: short stacking energy: -166.649 Base-Backbone interact. energy: -0.002 local terms energy: -170.797356 where: bonds (distance) C4'-P energy: -31.412 bonds (distance) P-C4' energy: -28.690 flat angles C4'-P-C4' energy: -32.262 flat angles P-C4'-P energy: -29.608 tors. eta vs tors. theta energy: -48.826 Dist. restrs. and SS energy: 0.247 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 102 Temperature: 1.000000 Total energy: -583.254185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -583.254185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.174594 (E_RNA) where: Base-Base interactions energy: -417.570 where: short stacking energy: -166.066 Base-Backbone interact. energy: -0.590 local terms energy: -166.015089 where: bonds (distance) C4'-P energy: -26.510 bonds (distance) P-C4' energy: -28.880 flat angles C4'-P-C4' energy: -34.536 flat angles P-C4'-P energy: -24.606 tors. eta vs tors. theta energy: -51.483 Dist. restrs. and SS energy: 0.920 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 102 Temperature: 1.050000 Total energy: -576.212452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.212452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.482304 (E_RNA) where: Base-Base interactions energy: -416.820 where: short stacking energy: -153.709 Base-Backbone interact. energy: -0.002 local terms energy: -159.661057 where: bonds (distance) C4'-P energy: -22.748 bonds (distance) P-C4' energy: -29.102 flat angles C4'-P-C4' energy: -31.951 flat angles P-C4'-P energy: -26.458 tors. eta vs tors. theta energy: -49.401 Dist. restrs. and SS energy: 0.270 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 102 Temperature: 1.100000 Total energy: -572.788360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.788360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -573.328380 (E_RNA) where: Base-Base interactions energy: -421.201 where: short stacking energy: -162.738 Base-Backbone interact. energy: -0.007 local terms energy: -152.297711 where: bonds (distance) C4'-P energy: -18.625 bonds (distance) P-C4' energy: -28.618 flat angles C4'-P-C4' energy: -29.570 flat angles P-C4'-P energy: -25.997 tors. eta vs tors. theta energy: -49.488 Dist. restrs. and SS energy: 0.540 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.178 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 102 Temperature: 1.150000 Total energy: -563.300249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -563.300249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -563.448482 (E_RNA) where: Base-Base interactions energy: -415.658 where: short stacking energy: -156.963 Base-Backbone interact. energy: -0.282 local terms energy: -147.507879 where: bonds (distance) C4'-P energy: -23.783 bonds (distance) P-C4' energy: -26.639 flat angles C4'-P-C4' energy: -27.378 flat angles P-C4'-P energy: -20.556 tors. eta vs tors. theta energy: -49.152 Dist. restrs. and SS energy: 0.148 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 102 Temperature: 1.200000 Total energy: -560.509631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.509631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -560.876992 (E_RNA) where: Base-Base interactions energy: -412.389 where: short stacking energy: -153.088 Base-Backbone interact. energy: -0.607 local terms energy: -147.880258 where: bonds (distance) C4'-P energy: -20.527 bonds (distance) P-C4' energy: -25.989 flat angles C4'-P-C4' energy: -28.479 flat angles P-C4'-P energy: -24.215 tors. eta vs tors. theta energy: -48.672 Dist. restrs. and SS energy: 0.367 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 102 Temperature: 1.250000 Total energy: -552.761349 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -552.761349 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.195306 (E_RNA) where: Base-Base interactions energy: -406.144 where: short stacking energy: -149.202 Base-Backbone interact. energy: -0.047 local terms energy: -147.004476 where: bonds (distance) C4'-P energy: -19.467 bonds (distance) P-C4' energy: -27.910 flat angles C4'-P-C4' energy: -29.908 flat angles P-C4'-P energy: -22.971 tors. eta vs tors. theta energy: -46.749 Dist. restrs. and SS energy: 0.434 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 102 Temperature: 1.300000 Total energy: -505.712387 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -505.712387 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -506.732407 (E_RNA) where: Base-Base interactions energy: -374.246 where: short stacking energy: -134.030 Base-Backbone interact. energy: -0.433 local terms energy: -132.053010 where: bonds (distance) C4'-P energy: -22.753 bonds (distance) P-C4' energy: -21.769 flat angles C4'-P-C4' energy: -29.414 flat angles P-C4'-P energy: -20.403 tors. eta vs tors. theta energy: -37.714 Dist. restrs. and SS energy: 1.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 102 Temperature: 1.350000 Total energy: -490.216891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.216891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.120883 (E_RNA) where: Base-Base interactions energy: -377.414 where: short stacking energy: -139.040 Base-Backbone interact. energy: 3.967 local terms energy: -117.674403 where: bonds (distance) C4'-P energy: -20.581 bonds (distance) P-C4' energy: -22.523 flat angles C4'-P-C4' energy: -28.140 flat angles P-C4'-P energy: -10.216 tors. eta vs tors. theta energy: -36.215 Dist. restrs. and SS energy: 0.904 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 10 ===================================== Write number: 103 Temperature: 0.900000 Total energy: -603.586083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -603.586083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -603.722788 (E_RNA) where: Base-Base interactions energy: -440.524 where: short stacking energy: -167.741 Base-Backbone interact. energy: -0.157 local terms energy: -163.423302 where: bonds (distance) C4'-P energy: -30.944 bonds (distance) P-C4' energy: -30.040 flat angles C4'-P-C4' energy: -31.844 flat angles P-C4'-P energy: -23.097 tors. eta vs tors. theta energy: -47.498 Dist. restrs. and SS energy: 0.137 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.382 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 103 Temperature: 0.950000 Total energy: -595.787420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -595.787420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -596.295938 (E_RNA) where: Base-Base interactions energy: -434.609 where: short stacking energy: -168.512 Base-Backbone interact. energy: -0.123 local terms energy: -161.563913 where: bonds (distance) C4'-P energy: -27.572 bonds (distance) P-C4' energy: -26.255 flat angles C4'-P-C4' energy: -32.749 flat angles P-C4'-P energy: -25.666 tors. eta vs tors. theta energy: -49.321 Dist. restrs. and SS energy: 0.509 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 103 Temperature: 1.000000 Total energy: -586.388422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -586.388422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.653388 (E_RNA) where: Base-Base interactions energy: -426.634 where: short stacking energy: -165.057 Base-Backbone interact. energy: -0.000 local terms energy: -160.019204 where: bonds (distance) C4'-P energy: -27.727 bonds (distance) P-C4' energy: -24.692 flat angles C4'-P-C4' energy: -32.728 flat angles P-C4'-P energy: -22.605 tors. eta vs tors. theta energy: -52.267 Dist. restrs. and SS energy: 0.265 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 103 Temperature: 1.050000 Total energy: -576.707907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.707907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.838241 (E_RNA) where: Base-Base interactions energy: -425.933 where: short stacking energy: -159.110 Base-Backbone interact. energy: -0.007 local terms energy: -150.898045 where: bonds (distance) C4'-P energy: -22.827 bonds (distance) P-C4' energy: -27.419 flat angles C4'-P-C4' energy: -30.981 flat angles P-C4'-P energy: -22.548 tors. eta vs tors. theta energy: -47.124 Dist. restrs. and SS energy: 0.130 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 103 Temperature: 1.100000 Total energy: -578.418385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.418385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.539484 (E_RNA) where: Base-Base interactions energy: -432.534 where: short stacking energy: -164.788 Base-Backbone interact. energy: -0.001 local terms energy: -146.005291 where: bonds (distance) C4'-P energy: -27.402 bonds (distance) P-C4' energy: -23.357 flat angles C4'-P-C4' energy: -24.619 flat angles P-C4'-P energy: -23.021 tors. eta vs tors. theta energy: -47.606 Dist. restrs. and SS energy: 0.121 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 103 Temperature: 1.150000 Total energy: -572.453825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -572.453825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -572.835353 (E_RNA) where: Base-Base interactions energy: -415.722 where: short stacking energy: -154.267 Base-Backbone interact. energy: -0.003 local terms energy: -158.184962 where: bonds (distance) C4'-P energy: -25.058 bonds (distance) P-C4' energy: -29.782 flat angles C4'-P-C4' energy: -31.816 flat angles P-C4'-P energy: -20.552 tors. eta vs tors. theta energy: -50.976 Dist. restrs. and SS energy: 0.382 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 1.074 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 2 ===================================== Write number: 103 Temperature: 1.200000 Total energy: -560.825521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -560.825521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -561.138590 (E_RNA) where: Base-Base interactions energy: -419.579 where: short stacking energy: -161.728 Base-Backbone interact. energy: -0.012 local terms energy: -141.546901 where: bonds (distance) C4'-P energy: -26.620 bonds (distance) P-C4' energy: -18.374 flat angles C4'-P-C4' energy: -28.860 flat angles P-C4'-P energy: -20.872 tors. eta vs tors. theta energy: -46.820 Dist. restrs. and SS energy: 0.313 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 103 Temperature: 1.250000 Total energy: -558.199065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.199065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.671751 (E_RNA) where: Base-Base interactions energy: -406.892 where: short stacking energy: -158.184 Base-Backbone interact. energy: -0.001 local terms energy: -151.778880 where: bonds (distance) C4'-P energy: -28.642 bonds (distance) P-C4' energy: -24.704 flat angles C4'-P-C4' energy: -28.260 flat angles P-C4'-P energy: -23.860 tors. eta vs tors. theta energy: -46.313 Dist. restrs. and SS energy: 0.473 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 7 ===================================== Write number: 103 Temperature: 1.300000 Total energy: -501.681237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.681237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.354237 (E_RNA) where: Base-Base interactions energy: -380.122 where: short stacking energy: -139.249 Base-Backbone interact. energy: 0.474 local terms energy: -122.706046 where: bonds (distance) C4'-P energy: -22.766 bonds (distance) P-C4' energy: -16.568 flat angles C4'-P-C4' energy: -28.283 flat angles P-C4'-P energy: -17.553 tors. eta vs tors. theta energy: -37.537 Dist. restrs. and SS energy: 0.673 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 1 ===================================== Write number: 103 Temperature: 1.350000 Total energy: -478.994102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -478.994102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.318563 (E_RNA) where: Base-Base interactions energy: -350.314 where: short stacking energy: -125.581 Base-Backbone interact. energy: -0.479 local terms energy: -129.524863 where: bonds (distance) C4'-P energy: -20.707 bonds (distance) P-C4' energy: -24.190 flat angles C4'-P-C4' energy: -28.147 flat angles P-C4'-P energy: -18.664 tors. eta vs tors. theta energy: -37.816 Dist. restrs. and SS energy: 1.324 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: -0.000 (S_LIMSPR_RNA)