SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/ID1203-3c86ce96/inputs/seq.fa: 1 curr_seq: _GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GCCCGGAUAGCUCAGUCGGUAGAGCAGCGGGCACUAUGGGCGCAGUGUCAAUGGACGCUGACGGUACAGGCCAGACAAUUAUUGUCUGGUAUAGUGCCCGCGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 134 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 675 n_atoms_counter: 675 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 134.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -539.791893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -539.791893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -539.791893 (E_RNA) where: Base-Base interactions energy: -18.085 where: short stacking energy: -18.085 Base-Backbone interact. energy: -0.000 local terms energy: -521.706891 where: bonds (distance) C4'-P energy: -130.191 bonds (distance) P-C4' energy: -120.778 flat angles C4'-P-C4' energy: -98.386 flat angles P-C4'-P energy: -112.543 tors. eta vs tors. theta energy: -59.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -715.719003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.719003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.719003 (E_RNA) where: Base-Base interactions energy: -331.501 where: short stacking energy: -295.287 Base-Backbone interact. energy: -0.757 local terms energy: -383.460809 where: bonds (distance) C4'-P energy: -89.028 bonds (distance) P-C4' energy: -88.202 flat angles C4'-P-C4' energy: -86.392 flat angles P-C4'-P energy: -56.244 tors. eta vs tors. theta energy: -63.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -681.778786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -681.778786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -681.778786 (E_RNA) where: Base-Base interactions energy: -309.564 where: short stacking energy: -303.328 Base-Backbone interact. energy: -0.319 local terms energy: -371.895592 where: bonds (distance) C4'-P energy: -84.520 bonds (distance) P-C4' energy: -77.499 flat angles C4'-P-C4' energy: -91.750 flat angles P-C4'-P energy: -54.392 tors. eta vs tors. theta energy: -63.734 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -644.437679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -644.437679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -644.437679 (E_RNA) where: Base-Base interactions energy: -286.567 where: short stacking energy: -279.976 Base-Backbone interact. energy: -0.245 local terms energy: -357.626174 where: bonds (distance) C4'-P energy: -78.238 bonds (distance) P-C4' energy: -82.229 flat angles C4'-P-C4' energy: -70.206 flat angles P-C4'-P energy: -55.680 tors. eta vs tors. theta energy: -71.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -592.615846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.615846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.615846 (E_RNA) where: Base-Base interactions energy: -234.609 where: short stacking energy: -234.355 Base-Backbone interact. energy: -0.207 local terms energy: -357.800503 where: bonds (distance) C4'-P energy: -80.480 bonds (distance) P-C4' energy: -96.116 flat angles C4'-P-C4' energy: -85.125 flat angles P-C4'-P energy: -55.330 tors. eta vs tors. theta energy: -40.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -553.438573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -553.438573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -553.438573 (E_RNA) where: Base-Base interactions energy: -212.125 where: short stacking energy: -207.112 Base-Backbone interact. energy: -0.149 local terms energy: -341.164389 where: bonds (distance) C4'-P energy: -91.513 bonds (distance) P-C4' energy: -80.412 flat angles C4'-P-C4' energy: -82.216 flat angles P-C4'-P energy: -39.980 tors. eta vs tors. theta energy: -47.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -545.883632 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -545.883632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -545.883632 (E_RNA) where: Base-Base interactions energy: -63.221 where: short stacking energy: -63.221 Base-Backbone interact. energy: -0.000 local terms energy: -482.662654 where: bonds (distance) C4'-P energy: -112.909 bonds (distance) P-C4' energy: -104.508 flat angles C4'-P-C4' energy: -97.864 flat angles P-C4'-P energy: -105.911 tors. eta vs tors. theta energy: -61.470 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -540.780857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.780857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -540.780857 (E_RNA) where: Base-Base interactions energy: -27.923 where: short stacking energy: -27.923 Base-Backbone interact. energy: -0.000 local terms energy: -512.857328 where: bonds (distance) C4'-P energy: -127.082 bonds (distance) P-C4' energy: -116.210 flat angles C4'-P-C4' energy: -96.974 flat angles P-C4'-P energy: -111.501 tors. eta vs tors. theta energy: -61.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -542.563380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -542.563380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -542.563380 (E_RNA) where: Base-Base interactions energy: -29.841 where: short stacking energy: -29.841 Base-Backbone interact. energy: -0.000 local terms energy: -512.722354 where: bonds (distance) C4'-P energy: -127.082 bonds (distance) P-C4' energy: -116.210 flat angles C4'-P-C4' energy: -96.974 flat angles P-C4'-P energy: -111.366 tors. eta vs tors. theta energy: -61.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -543.120981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.120981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.120981 (E_RNA) where: Base-Base interactions energy: -28.266 where: short stacking energy: -28.266 Base-Backbone interact. energy: -0.000 local terms energy: -514.854504 where: bonds (distance) C4'-P energy: -128.287 bonds (distance) P-C4' energy: -116.471 flat angles C4'-P-C4' energy: -97.702 flat angles P-C4'-P energy: -111.269 tors. eta vs tors. theta energy: -61.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -543.882765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -543.882765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -543.882765 (E_RNA) where: Base-Base interactions energy: -58.997 where: short stacking energy: -58.997 Base-Backbone interact. energy: -0.000 local terms energy: -484.885120 where: bonds (distance) C4'-P energy: -116.867 bonds (distance) P-C4' energy: -101.623 flat angles C4'-P-C4' energy: -98.685 flat angles P-C4'-P energy: -106.071 tors. eta vs tors. theta energy: -61.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -829.429999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -829.429999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -829.429999 (E_RNA) where: Base-Base interactions energy: -433.819 where: short stacking energy: -333.757 Base-Backbone interact. energy: -0.671 local terms energy: -394.939963 where: bonds (distance) C4'-P energy: -85.189 bonds (distance) P-C4' energy: -79.849 flat angles C4'-P-C4' energy: -94.408 flat angles P-C4'-P energy: -57.111 tors. eta vs tors. theta energy: -78.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -688.784533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.784533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.784533 (E_RNA) where: Base-Base interactions energy: -310.089 where: short stacking energy: -305.914 Base-Backbone interact. energy: -0.233 local terms energy: -378.462745 where: bonds (distance) C4'-P energy: -75.143 bonds (distance) P-C4' energy: -81.911 flat angles C4'-P-C4' energy: -79.648 flat angles P-C4'-P energy: -64.197 tors. eta vs tors. theta energy: -77.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -695.775774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -695.775774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -695.775774 (E_RNA) where: Base-Base interactions energy: -342.553 where: short stacking energy: -276.760 Base-Backbone interact. energy: 0.031 local terms energy: -353.253582 where: bonds (distance) C4'-P energy: -81.934 bonds (distance) P-C4' energy: -79.874 flat angles C4'-P-C4' energy: -90.227 flat angles P-C4'-P energy: -55.351 tors. eta vs tors. theta energy: -45.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -584.489653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -584.489653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -584.489653 (E_RNA) where: Base-Base interactions energy: -262.825 where: short stacking energy: -229.317 Base-Backbone interact. energy: -1.013 local terms energy: -320.651227 where: bonds (distance) C4'-P energy: -75.079 bonds (distance) P-C4' energy: -69.986 flat angles C4'-P-C4' energy: -90.667 flat angles P-C4'-P energy: -49.365 tors. eta vs tors. theta energy: -35.555 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -575.207341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.207341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.207341 (E_RNA) where: Base-Base interactions energy: -267.806 where: short stacking energy: -222.599 Base-Backbone interact. energy: 1.370 local terms energy: -308.770754 where: bonds (distance) C4'-P energy: -72.464 bonds (distance) P-C4' energy: -69.871 flat angles C4'-P-C4' energy: -80.017 flat angles P-C4'-P energy: -46.137 tors. eta vs tors. theta energy: -40.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -504.811069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -504.811069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.811069 (E_RNA) where: Base-Base interactions energy: -207.837 where: short stacking energy: -178.111 Base-Backbone interact. energy: -1.069 local terms energy: -295.905314 where: bonds (distance) C4'-P energy: -67.390 bonds (distance) P-C4' energy: -80.767 flat angles C4'-P-C4' energy: -76.421 flat angles P-C4'-P energy: -44.745 tors. eta vs tors. theta energy: -26.582 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -437.139796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.139796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.139796 (E_RNA) where: Base-Base interactions energy: -178.726 where: short stacking energy: -164.380 Base-Backbone interact. energy: -1.033 local terms energy: -257.381473 where: bonds (distance) C4'-P energy: -58.844 bonds (distance) P-C4' energy: -71.299 flat angles C4'-P-C4' energy: -74.344 flat angles P-C4'-P energy: -48.386 tors. eta vs tors. theta energy: -4.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -433.044731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.044731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.044731 (E_RNA) where: Base-Base interactions energy: -166.720 where: short stacking energy: -148.522 Base-Backbone interact. energy: -0.497 local terms energy: -265.827169 where: bonds (distance) C4'-P energy: -77.323 bonds (distance) P-C4' energy: -76.354 flat angles C4'-P-C4' energy: -55.162 flat angles P-C4'-P energy: -44.535 tors. eta vs tors. theta energy: -12.453 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -406.333080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.333080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.333080 (E_RNA) where: Base-Base interactions energy: -189.474 where: short stacking energy: -132.336 Base-Backbone interact. energy: -0.841 local terms energy: -216.017478 where: bonds (distance) C4'-P energy: -57.446 bonds (distance) P-C4' energy: -74.745 flat angles C4'-P-C4' energy: -52.448 flat angles P-C4'-P energy: -35.502 tors. eta vs tors. theta energy: 4.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -386.850017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.850017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.850017 (E_RNA) where: Base-Base interactions energy: -145.209 where: short stacking energy: -111.697 Base-Backbone interact. energy: 0.444 local terms energy: -242.084944 where: bonds (distance) C4'-P energy: -79.398 bonds (distance) P-C4' energy: -60.485 flat angles C4'-P-C4' energy: -60.158 flat angles P-C4'-P energy: -36.748 tors. eta vs tors. theta energy: -5.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -898.916853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.916853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.916853 (E_RNA) where: Base-Base interactions energy: -480.787 where: short stacking energy: -346.496 Base-Backbone interact. energy: -1.408 local terms energy: -416.721549 where: bonds (distance) C4'-P energy: -88.898 bonds (distance) P-C4' energy: -82.097 flat angles C4'-P-C4' energy: -87.488 flat angles P-C4'-P energy: -63.193 tors. eta vs tors. theta energy: -95.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -716.519780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -716.519780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -716.519780 (E_RNA) where: Base-Base interactions energy: -343.481 where: short stacking energy: -279.155 Base-Backbone interact. energy: -1.607 local terms energy: -371.432673 where: bonds (distance) C4'-P energy: -90.681 bonds (distance) P-C4' energy: -78.172 flat angles C4'-P-C4' energy: -90.437 flat angles P-C4'-P energy: -53.644 tors. eta vs tors. theta energy: -58.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -720.482162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.482162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.482162 (E_RNA) where: Base-Base interactions energy: -355.323 where: short stacking energy: -291.837 Base-Backbone interact. energy: -1.999 local terms energy: -363.159826 where: bonds (distance) C4'-P energy: -76.048 bonds (distance) P-C4' energy: -82.380 flat angles C4'-P-C4' energy: -88.633 flat angles P-C4'-P energy: -54.852 tors. eta vs tors. theta energy: -61.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -660.682883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -660.682883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -660.682883 (E_RNA) where: Base-Base interactions energy: -311.621 where: short stacking energy: -251.822 Base-Backbone interact. energy: -0.730 local terms energy: -348.331461 where: bonds (distance) C4'-P energy: -78.010 bonds (distance) P-C4' energy: -88.570 flat angles C4'-P-C4' energy: -80.197 flat angles P-C4'-P energy: -49.305 tors. eta vs tors. theta energy: -52.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -622.027302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -622.027302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -622.027302 (E_RNA) where: Base-Base interactions energy: -299.429 where: short stacking energy: -221.875 Base-Backbone interact. energy: -1.590 local terms energy: -321.008814 where: bonds (distance) C4'-P energy: -74.712 bonds (distance) P-C4' energy: -78.682 flat angles C4'-P-C4' energy: -86.659 flat angles P-C4'-P energy: -45.736 tors. eta vs tors. theta energy: -35.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -559.027520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.027520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.027520 (E_RNA) where: Base-Base interactions energy: -256.279 where: short stacking energy: -187.034 Base-Backbone interact. energy: 1.109 local terms energy: -303.857473 where: bonds (distance) C4'-P energy: -65.788 bonds (distance) P-C4' energy: -86.214 flat angles C4'-P-C4' energy: -85.608 flat angles P-C4'-P energy: -46.257 tors. eta vs tors. theta energy: -19.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -492.418266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -492.418266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -492.418266 (E_RNA) where: Base-Base interactions energy: -236.464 where: short stacking energy: -171.432 Base-Backbone interact. energy: 1.627 local terms energy: -257.580866 where: bonds (distance) C4'-P energy: -73.305 bonds (distance) P-C4' energy: -72.846 flat angles C4'-P-C4' energy: -73.067 flat angles P-C4'-P energy: -22.220 tors. eta vs tors. theta energy: -16.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -443.783008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.783008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.783008 (E_RNA) where: Base-Base interactions energy: -196.004 where: short stacking energy: -148.446 Base-Backbone interact. energy: 4.800 local terms energy: -252.578708 where: bonds (distance) C4'-P energy: -65.283 bonds (distance) P-C4' energy: -76.835 flat angles C4'-P-C4' energy: -68.568 flat angles P-C4'-P energy: -32.580 tors. eta vs tors. theta energy: -9.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -423.607450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.607450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.607450 (E_RNA) where: Base-Base interactions energy: -199.988 where: short stacking energy: -165.761 Base-Backbone interact. energy: 1.711 local terms energy: -225.330072 where: bonds (distance) C4'-P energy: -59.010 bonds (distance) P-C4' energy: -71.051 flat angles C4'-P-C4' energy: -56.810 flat angles P-C4'-P energy: -41.437 tors. eta vs tors. theta energy: 2.979 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -351.455856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.455856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.455856 (E_RNA) where: Base-Base interactions energy: -162.143 where: short stacking energy: -129.048 Base-Backbone interact. energy: 4.640 local terms energy: -193.953034 where: bonds (distance) C4'-P energy: -70.502 bonds (distance) P-C4' energy: -55.110 flat angles C4'-P-C4' energy: -52.154 flat angles P-C4'-P energy: -29.125 tors. eta vs tors. theta energy: 12.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -901.105969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.105969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.105969 (E_RNA) where: Base-Base interactions energy: -487.606 where: short stacking energy: -353.018 Base-Backbone interact. energy: -1.099 local terms energy: -412.401574 where: bonds (distance) C4'-P energy: -99.484 bonds (distance) P-C4' energy: -91.569 flat angles C4'-P-C4' energy: -89.533 flat angles P-C4'-P energy: -59.442 tors. eta vs tors. theta energy: -72.373 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -768.330145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.330145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.330145 (E_RNA) where: Base-Base interactions energy: -379.431 where: short stacking energy: -303.432 Base-Backbone interact. energy: -1.407 local terms energy: -387.491926 where: bonds (distance) C4'-P energy: -80.098 bonds (distance) P-C4' energy: -83.950 flat angles C4'-P-C4' energy: -85.919 flat angles P-C4'-P energy: -57.896 tors. eta vs tors. theta energy: -79.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -766.137682 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.137682 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.137682 (E_RNA) where: Base-Base interactions energy: -387.482 where: short stacking energy: -284.300 Base-Backbone interact. energy: -1.337 local terms energy: -377.318887 where: bonds (distance) C4'-P energy: -79.670 bonds (distance) P-C4' energy: -79.872 flat angles C4'-P-C4' energy: -82.294 flat angles P-C4'-P energy: -57.770 tors. eta vs tors. theta energy: -77.713 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -691.808943 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.808943 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.808943 (E_RNA) where: Base-Base interactions energy: -352.634 where: short stacking energy: -261.963 Base-Backbone interact. energy: -1.351 local terms energy: -337.823367 where: bonds (distance) C4'-P energy: -82.102 bonds (distance) P-C4' energy: -64.646 flat angles C4'-P-C4' energy: -87.063 flat angles P-C4'-P energy: -45.607 tors. eta vs tors. theta energy: -58.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -630.917403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.917403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.917403 (E_RNA) where: Base-Base interactions energy: -300.216 where: short stacking energy: -228.526 Base-Backbone interact. energy: 0.784 local terms energy: -331.485107 where: bonds (distance) C4'-P energy: -83.119 bonds (distance) P-C4' energy: -73.620 flat angles C4'-P-C4' energy: -77.492 flat angles P-C4'-P energy: -49.797 tors. eta vs tors. theta energy: -47.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -636.173232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.173232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.173232 (E_RNA) where: Base-Base interactions energy: -325.155 where: short stacking energy: -215.412 Base-Backbone interact. energy: 1.978 local terms energy: -312.996581 where: bonds (distance) C4'-P energy: -79.744 bonds (distance) P-C4' energy: -79.854 flat angles C4'-P-C4' energy: -67.017 flat angles P-C4'-P energy: -43.863 tors. eta vs tors. theta energy: -42.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -621.449542 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -621.449542 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -621.449542 (E_RNA) where: Base-Base interactions energy: -332.803 where: short stacking energy: -207.404 Base-Backbone interact. energy: 0.996 local terms energy: -289.643101 where: bonds (distance) C4'-P energy: -80.637 bonds (distance) P-C4' energy: -78.116 flat angles C4'-P-C4' energy: -59.106 flat angles P-C4'-P energy: -34.438 tors. eta vs tors. theta energy: -37.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -516.076033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -516.076033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -516.076033 (E_RNA) where: Base-Base interactions energy: -273.588 where: short stacking energy: -163.823 Base-Backbone interact. energy: -0.437 local terms energy: -242.050489 where: bonds (distance) C4'-P energy: -57.084 bonds (distance) P-C4' energy: -82.117 flat angles C4'-P-C4' energy: -59.698 flat angles P-C4'-P energy: -33.249 tors. eta vs tors. theta energy: -9.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -438.630307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.630307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.630307 (E_RNA) where: Base-Base interactions energy: -203.876 where: short stacking energy: -142.242 Base-Backbone interact. energy: 1.862 local terms energy: -236.616874 where: bonds (distance) C4'-P energy: -60.192 bonds (distance) P-C4' energy: -90.132 flat angles C4'-P-C4' energy: -56.543 flat angles P-C4'-P energy: -24.308 tors. eta vs tors. theta energy: -5.441 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -390.097844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.097844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.097844 (E_RNA) where: Base-Base interactions energy: -164.919 where: short stacking energy: -127.698 Base-Backbone interact. energy: -0.782 local terms energy: -224.396539 where: bonds (distance) C4'-P energy: -70.883 bonds (distance) P-C4' energy: -52.403 flat angles C4'-P-C4' energy: -66.260 flat angles P-C4'-P energy: -42.530 tors. eta vs tors. theta energy: 7.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -989.153448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -989.153448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -989.153448 (E_RNA) where: Base-Base interactions energy: -566.540 where: short stacking energy: -341.428 Base-Backbone interact. energy: 0.743 local terms energy: -423.355916 where: bonds (distance) C4'-P energy: -89.611 bonds (distance) P-C4' energy: -91.202 flat angles C4'-P-C4' energy: -98.865 flat angles P-C4'-P energy: -55.164 tors. eta vs tors. theta energy: -88.514 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -803.583708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -803.583708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -803.583708 (E_RNA) where: Base-Base interactions energy: -418.700 where: short stacking energy: -291.769 Base-Backbone interact. energy: -1.383 local terms energy: -383.500950 where: bonds (distance) C4'-P energy: -84.429 bonds (distance) P-C4' energy: -97.327 flat angles C4'-P-C4' energy: -91.590 flat angles P-C4'-P energy: -51.397 tors. eta vs tors. theta energy: -58.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -770.770144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.770144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.770144 (E_RNA) where: Base-Base interactions energy: -419.542 where: short stacking energy: -299.964 Base-Backbone interact. energy: -0.605 local terms energy: -350.623388 where: bonds (distance) C4'-P energy: -71.114 bonds (distance) P-C4' energy: -84.145 flat angles C4'-P-C4' energy: -80.506 flat angles P-C4'-P energy: -48.791 tors. eta vs tors. theta energy: -66.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -756.114986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -756.114986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -756.114986 (E_RNA) where: Base-Base interactions energy: -407.602 where: short stacking energy: -261.223 Base-Backbone interact. energy: -1.591 local terms energy: -346.921647 where: bonds (distance) C4'-P energy: -68.266 bonds (distance) P-C4' energy: -80.023 flat angles C4'-P-C4' energy: -82.011 flat angles P-C4'-P energy: -53.991 tors. eta vs tors. theta energy: -62.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -762.178552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -762.178552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -762.178552 (E_RNA) where: Base-Base interactions energy: -444.420 where: short stacking energy: -228.340 Base-Backbone interact. energy: 1.544 local terms energy: -319.301893 where: bonds (distance) C4'-P energy: -62.509 bonds (distance) P-C4' energy: -83.887 flat angles C4'-P-C4' energy: -76.947 flat angles P-C4'-P energy: -51.965 tors. eta vs tors. theta energy: -43.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -559.138683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -559.138683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -559.138683 (E_RNA) where: Base-Base interactions energy: -253.495 where: short stacking energy: -194.445 Base-Backbone interact. energy: -0.166 local terms energy: -305.476985 where: bonds (distance) C4'-P energy: -83.062 bonds (distance) P-C4' energy: -83.136 flat angles C4'-P-C4' energy: -81.281 flat angles P-C4'-P energy: -29.374 tors. eta vs tors. theta energy: -28.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -684.467151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -684.467151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -684.467151 (E_RNA) where: Base-Base interactions energy: -418.978 where: short stacking energy: -204.779 Base-Backbone interact. energy: -0.445 local terms energy: -265.043159 where: bonds (distance) C4'-P energy: -60.564 bonds (distance) P-C4' energy: -66.067 flat angles C4'-P-C4' energy: -71.924 flat angles P-C4'-P energy: -37.122 tors. eta vs tors. theta energy: -29.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -519.898396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.898396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.898396 (E_RNA) where: Base-Base interactions energy: -248.293 where: short stacking energy: -180.062 Base-Backbone interact. energy: 3.771 local terms energy: -275.376399 where: bonds (distance) C4'-P energy: -66.170 bonds (distance) P-C4' energy: -75.765 flat angles C4'-P-C4' energy: -77.277 flat angles P-C4'-P energy: -35.636 tors. eta vs tors. theta energy: -20.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -431.465729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.465729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.465729 (E_RNA) where: Base-Base interactions energy: -210.662 where: short stacking energy: -148.709 Base-Backbone interact. energy: 3.822 local terms energy: -224.626622 where: bonds (distance) C4'-P energy: -80.003 bonds (distance) P-C4' energy: -50.313 flat angles C4'-P-C4' energy: -65.488 flat angles P-C4'-P energy: -25.517 tors. eta vs tors. theta energy: -3.306 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -380.438780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.438780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.438780 (E_RNA) where: Base-Base interactions energy: -167.777 where: short stacking energy: -128.119 Base-Backbone interact. energy: -1.673 local terms energy: -210.989113 where: bonds (distance) C4'-P energy: -49.747 bonds (distance) P-C4' energy: -79.878 flat angles C4'-P-C4' energy: -51.737 flat angles P-C4'-P energy: -26.897 tors. eta vs tors. theta energy: -2.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -978.853913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.853913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -978.853913 (E_RNA) where: Base-Base interactions energy: -569.926 where: short stacking energy: -333.115 Base-Backbone interact. energy: -0.948 local terms energy: -407.979530 where: bonds (distance) C4'-P energy: -91.555 bonds (distance) P-C4' energy: -88.578 flat angles C4'-P-C4' energy: -94.619 flat angles P-C4'-P energy: -59.679 tors. eta vs tors. theta energy: -73.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -847.226806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.226806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.226806 (E_RNA) where: Base-Base interactions energy: -482.836 where: short stacking energy: -291.507 Base-Backbone interact. energy: -1.397 local terms energy: -362.994144 where: bonds (distance) C4'-P energy: -89.115 bonds (distance) P-C4' energy: -79.258 flat angles C4'-P-C4' energy: -88.953 flat angles P-C4'-P energy: -52.110 tors. eta vs tors. theta energy: -53.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -765.600648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -765.600648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -765.600648 (E_RNA) where: Base-Base interactions energy: -431.445 where: short stacking energy: -289.961 Base-Backbone interact. energy: -0.091 local terms energy: -334.064980 where: bonds (distance) C4'-P energy: -64.263 bonds (distance) P-C4' energy: -82.867 flat angles C4'-P-C4' energy: -83.634 flat angles P-C4'-P energy: -43.995 tors. eta vs tors. theta energy: -59.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -954.277796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.277796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.277796 (E_RNA) where: Base-Base interactions energy: -600.251 where: short stacking energy: -305.197 Base-Backbone interact. energy: -0.530 local terms energy: -353.497111 where: bonds (distance) C4'-P energy: -76.343 bonds (distance) P-C4' energy: -81.130 flat angles C4'-P-C4' energy: -81.898 flat angles P-C4'-P energy: -42.206 tors. eta vs tors. theta energy: -71.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -653.257346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -653.257346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -653.257346 (E_RNA) where: Base-Base interactions energy: -358.417 where: short stacking energy: -224.841 Base-Backbone interact. energy: -1.723 local terms energy: -293.116989 where: bonds (distance) C4'-P energy: -74.684 bonds (distance) P-C4' energy: -77.420 flat angles C4'-P-C4' energy: -73.506 flat angles P-C4'-P energy: -29.187 tors. eta vs tors. theta energy: -38.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -844.802691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -844.802691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -844.802691 (E_RNA) where: Base-Base interactions energy: -515.986 where: short stacking energy: -257.424 Base-Backbone interact. energy: 1.356 local terms energy: -330.173225 where: bonds (distance) C4'-P energy: -63.810 bonds (distance) P-C4' energy: -85.493 flat angles C4'-P-C4' energy: -76.884 flat angles P-C4'-P energy: -39.046 tors. eta vs tors. theta energy: -64.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -501.684534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -501.684534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.684534 (E_RNA) where: Base-Base interactions energy: -236.545 where: short stacking energy: -148.592 Base-Backbone interact. energy: -1.297 local terms energy: -263.843070 where: bonds (distance) C4'-P energy: -72.618 bonds (distance) P-C4' energy: -62.554 flat angles C4'-P-C4' energy: -65.007 flat angles P-C4'-P energy: -51.775 tors. eta vs tors. theta energy: -11.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -604.593766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.593766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -604.593766 (E_RNA) where: Base-Base interactions energy: -355.286 where: short stacking energy: -210.654 Base-Backbone interact. energy: 2.606 local terms energy: -251.913580 where: bonds (distance) C4'-P energy: -52.549 bonds (distance) P-C4' energy: -76.337 flat angles C4'-P-C4' energy: -59.686 flat angles P-C4'-P energy: -38.226 tors. eta vs tors. theta energy: -25.115 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -475.932325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.932325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.932325 (E_RNA) where: Base-Base interactions energy: -268.637 where: short stacking energy: -172.582 Base-Backbone interact. energy: -0.835 local terms energy: -206.460529 where: bonds (distance) C4'-P energy: -43.271 bonds (distance) P-C4' energy: -55.648 flat angles C4'-P-C4' energy: -67.741 flat angles P-C4'-P energy: -32.165 tors. eta vs tors. theta energy: -7.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -358.420987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.420987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.420987 (E_RNA) where: Base-Base interactions energy: -152.413 where: short stacking energy: -115.993 Base-Backbone interact. energy: 0.424 local terms energy: -206.431133 where: bonds (distance) C4'-P energy: -62.245 bonds (distance) P-C4' energy: -68.460 flat angles C4'-P-C4' energy: -54.322 flat angles P-C4'-P energy: -28.627 tors. eta vs tors. theta energy: 7.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -984.357271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.357271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.357271 (E_RNA) where: Base-Base interactions energy: -561.636 where: short stacking energy: -352.893 Base-Backbone interact. energy: -3.445 local terms energy: -419.275766 where: bonds (distance) C4'-P energy: -87.939 bonds (distance) P-C4' energy: -82.711 flat angles C4'-P-C4' energy: -92.422 flat angles P-C4'-P energy: -56.624 tors. eta vs tors. theta energy: -99.580 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -880.848870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -880.848870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -880.848870 (E_RNA) where: Base-Base interactions energy: -503.914 where: short stacking energy: -284.165 Base-Backbone interact. energy: -1.280 local terms energy: -375.655015 where: bonds (distance) C4'-P energy: -84.106 bonds (distance) P-C4' energy: -83.592 flat angles C4'-P-C4' energy: -85.123 flat angles P-C4'-P energy: -59.140 tors. eta vs tors. theta energy: -63.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -1029.160154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.160154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.160154 (E_RNA) where: Base-Base interactions energy: -665.404 where: short stacking energy: -310.860 Base-Backbone interact. energy: -2.470 local terms energy: -361.285898 where: bonds (distance) C4'-P energy: -82.071 bonds (distance) P-C4' energy: -86.121 flat angles C4'-P-C4' energy: -76.532 flat angles P-C4'-P energy: -54.330 tors. eta vs tors. theta energy: -62.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -754.457527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.457527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.457527 (E_RNA) where: Base-Base interactions energy: -423.543 where: short stacking energy: -267.539 Base-Backbone interact. energy: 1.077 local terms energy: -331.990753 where: bonds (distance) C4'-P energy: -73.514 bonds (distance) P-C4' energy: -89.763 flat angles C4'-P-C4' energy: -81.502 flat angles P-C4'-P energy: -45.120 tors. eta vs tors. theta energy: -42.092 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -947.577262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.577262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.577262 (E_RNA) where: Base-Base interactions energy: -603.037 where: short stacking energy: -307.321 Base-Backbone interact. energy: 0.688 local terms energy: -345.228569 where: bonds (distance) C4'-P energy: -79.758 bonds (distance) P-C4' energy: -76.894 flat angles C4'-P-C4' energy: -71.431 flat angles P-C4'-P energy: -51.754 tors. eta vs tors. theta energy: -65.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -630.573677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.573677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -630.573677 (E_RNA) where: Base-Base interactions energy: -325.698 where: short stacking energy: -218.321 Base-Backbone interact. energy: 0.638 local terms energy: -305.514186 where: bonds (distance) C4'-P energy: -77.489 bonds (distance) P-C4' energy: -71.995 flat angles C4'-P-C4' energy: -71.492 flat angles P-C4'-P energy: -46.990 tors. eta vs tors. theta energy: -37.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -663.273754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -663.273754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -663.273754 (E_RNA) where: Base-Base interactions energy: -371.427 where: short stacking energy: -209.066 Base-Backbone interact. energy: -0.383 local terms energy: -291.463888 where: bonds (distance) C4'-P energy: -70.061 bonds (distance) P-C4' energy: -79.841 flat angles C4'-P-C4' energy: -69.913 flat angles P-C4'-P energy: -36.824 tors. eta vs tors. theta energy: -34.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -519.143153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -519.143153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -519.143153 (E_RNA) where: Base-Base interactions energy: -248.994 where: short stacking energy: -140.737 Base-Backbone interact. energy: -3.190 local terms energy: -266.959894 where: bonds (distance) C4'-P energy: -84.444 bonds (distance) P-C4' energy: -77.344 flat angles C4'-P-C4' energy: -56.917 flat angles P-C4'-P energy: -36.210 tors. eta vs tors. theta energy: -12.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -444.712435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.712435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.712435 (E_RNA) where: Base-Base interactions energy: -209.218 where: short stacking energy: -112.492 Base-Backbone interact. energy: -1.016 local terms energy: -234.478509 where: bonds (distance) C4'-P energy: -56.577 bonds (distance) P-C4' energy: -73.327 flat angles C4'-P-C4' energy: -68.027 flat angles P-C4'-P energy: -38.524 tors. eta vs tors. theta energy: 1.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -393.303733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.303733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.303733 (E_RNA) where: Base-Base interactions energy: -188.989 where: short stacking energy: -113.905 Base-Backbone interact. energy: -0.486 local terms energy: -203.829269 where: bonds (distance) C4'-P energy: -69.582 bonds (distance) P-C4' energy: -72.712 flat angles C4'-P-C4' energy: -56.468 flat angles P-C4'-P energy: -29.896 tors. eta vs tors. theta energy: 24.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -973.915691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -973.915691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -973.915691 (E_RNA) where: Base-Base interactions energy: -571.556 where: short stacking energy: -333.005 Base-Backbone interact. energy: -0.878 local terms energy: -401.481711 where: bonds (distance) C4'-P energy: -82.594 bonds (distance) P-C4' energy: -85.663 flat angles C4'-P-C4' energy: -97.315 flat angles P-C4'-P energy: -56.388 tors. eta vs tors. theta energy: -79.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -1109.282128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1109.282128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.282128 (E_RNA) where: Base-Base interactions energy: -705.252 where: short stacking energy: -339.057 Base-Backbone interact. energy: -1.438 local terms energy: -402.592485 where: bonds (distance) C4'-P energy: -91.052 bonds (distance) P-C4' energy: -80.750 flat angles C4'-P-C4' energy: -84.220 flat angles P-C4'-P energy: -64.926 tors. eta vs tors. theta energy: -81.644 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -840.491823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.491823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.491823 (E_RNA) where: Base-Base interactions energy: -493.894 where: short stacking energy: -293.037 Base-Backbone interact. energy: -1.782 local terms energy: -344.815262 where: bonds (distance) C4'-P energy: -72.959 bonds (distance) P-C4' energy: -82.277 flat angles C4'-P-C4' energy: -73.721 flat angles P-C4'-P energy: -47.788 tors. eta vs tors. theta energy: -68.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 8 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -963.996580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.996580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.996580 (E_RNA) where: Base-Base interactions energy: -622.083 where: short stacking energy: -290.909 Base-Backbone interact. energy: 0.924 local terms energy: -342.837471 where: bonds (distance) C4'-P energy: -79.024 bonds (distance) P-C4' energy: -76.729 flat angles C4'-P-C4' energy: -76.190 flat angles P-C4'-P energy: -45.772 tors. eta vs tors. theta energy: -65.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -715.645005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -715.645005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -715.645005 (E_RNA) where: Base-Base interactions energy: -392.878 where: short stacking energy: -243.522 Base-Backbone interact. energy: 1.617 local terms energy: -324.384329 where: bonds (distance) C4'-P energy: -75.328 bonds (distance) P-C4' energy: -74.483 flat angles C4'-P-C4' energy: -83.960 flat angles P-C4'-P energy: -42.021 tors. eta vs tors. theta energy: -48.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -793.322753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -793.322753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -793.322753 (E_RNA) where: Base-Base interactions energy: -482.991 where: short stacking energy: -248.183 Base-Backbone interact. energy: 1.250 local terms energy: -311.581714 where: bonds (distance) C4'-P energy: -68.251 bonds (distance) P-C4' energy: -86.867 flat angles C4'-P-C4' energy: -77.171 flat angles P-C4'-P energy: -35.281 tors. eta vs tors. theta energy: -44.012 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -578.291194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.291194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.291194 (E_RNA) where: Base-Base interactions energy: -305.276 where: short stacking energy: -167.423 Base-Backbone interact. energy: 0.995 local terms energy: -274.010484 where: bonds (distance) C4'-P energy: -72.968 bonds (distance) P-C4' energy: -76.613 flat angles C4'-P-C4' energy: -71.850 flat angles P-C4'-P energy: -39.874 tors. eta vs tors. theta energy: -12.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -497.470800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -497.470800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -497.470800 (E_RNA) where: Base-Base interactions energy: -231.831 where: short stacking energy: -158.634 Base-Backbone interact. energy: -2.146 local terms energy: -263.493762 where: bonds (distance) C4'-P energy: -66.690 bonds (distance) P-C4' energy: -82.360 flat angles C4'-P-C4' energy: -73.591 flat angles P-C4'-P energy: -24.046 tors. eta vs tors. theta energy: -16.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -417.175037 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.175037 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.175037 (E_RNA) where: Base-Base interactions energy: -172.464 where: short stacking energy: -128.871 Base-Backbone interact. energy: 2.038 local terms energy: -246.748987 where: bonds (distance) C4'-P energy: -73.823 bonds (distance) P-C4' energy: -68.143 flat angles C4'-P-C4' energy: -74.355 flat angles P-C4'-P energy: -43.260 tors. eta vs tors. theta energy: 12.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 9 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -442.661833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.661833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.661833 (E_RNA) where: Base-Base interactions energy: -186.147 where: short stacking energy: -122.906 Base-Backbone interact. energy: -1.465 local terms energy: -255.050087 where: bonds (distance) C4'-P energy: -69.301 bonds (distance) P-C4' energy: -67.074 flat angles C4'-P-C4' energy: -70.302 flat angles P-C4'-P energy: -52.575 tors. eta vs tors. theta energy: 4.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -1216.595044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.595044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.595044 (E_RNA) where: Base-Base interactions energy: -793.420 where: short stacking energy: -376.723 Base-Backbone interact. energy: 6.168 local terms energy: -429.342317 where: bonds (distance) C4'-P energy: -82.197 bonds (distance) P-C4' energy: -86.878 flat angles C4'-P-C4' energy: -99.556 flat angles P-C4'-P energy: -60.569 tors. eta vs tors. theta energy: -100.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -1001.209730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.209730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1001.209730 (E_RNA) where: Base-Base interactions energy: -606.806 where: short stacking energy: -350.467 Base-Backbone interact. energy: -0.774 local terms energy: -393.630590 where: bonds (distance) C4'-P energy: -82.631 bonds (distance) P-C4' energy: -97.030 flat angles C4'-P-C4' energy: -73.753 flat angles P-C4'-P energy: -52.544 tors. eta vs tors. theta energy: -87.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 8 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -1073.181877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.181877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.181877 (E_RNA) where: Base-Base interactions energy: -694.669 where: short stacking energy: -341.888 Base-Backbone interact. energy: -1.982 local terms energy: -376.530225 where: bonds (distance) C4'-P energy: -78.766 bonds (distance) P-C4' energy: -86.806 flat angles C4'-P-C4' energy: -90.482 flat angles P-C4'-P energy: -49.072 tors. eta vs tors. theta energy: -71.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -814.404658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.404658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.404658 (E_RNA) where: Base-Base interactions energy: -453.035 where: short stacking energy: -258.929 Base-Backbone interact. energy: -2.957 local terms energy: -358.413174 where: bonds (distance) C4'-P energy: -87.133 bonds (distance) P-C4' energy: -67.477 flat angles C4'-P-C4' energy: -87.777 flat angles P-C4'-P energy: -60.168 tors. eta vs tors. theta energy: -55.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -889.314365 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.314365 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.314365 (E_RNA) where: Base-Base interactions energy: -550.713 where: short stacking energy: -256.896 Base-Backbone interact. energy: 0.758 local terms energy: -339.359877 where: bonds (distance) C4'-P energy: -75.235 bonds (distance) P-C4' energy: -83.782 flat angles C4'-P-C4' energy: -77.419 flat angles P-C4'-P energy: -50.461 tors. eta vs tors. theta energy: -52.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -636.805383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.805383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.805383 (E_RNA) where: Base-Base interactions energy: -343.105 where: short stacking energy: -223.127 Base-Backbone interact. energy: -0.920 local terms energy: -292.780558 where: bonds (distance) C4'-P energy: -77.085 bonds (distance) P-C4' energy: -76.400 flat angles C4'-P-C4' energy: -60.844 flat angles P-C4'-P energy: -42.484 tors. eta vs tors. theta energy: -35.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -649.243410 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -649.243410 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -649.243410 (E_RNA) where: Base-Base interactions energy: -345.908 where: short stacking energy: -209.408 Base-Backbone interact. energy: 2.059 local terms energy: -305.394112 where: bonds (distance) C4'-P energy: -64.580 bonds (distance) P-C4' energy: -81.779 flat angles C4'-P-C4' energy: -74.749 flat angles P-C4'-P energy: -47.678 tors. eta vs tors. theta energy: -36.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -564.285013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -564.285013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -564.285013 (E_RNA) where: Base-Base interactions energy: -328.721 where: short stacking energy: -185.134 Base-Backbone interact. energy: -1.323 local terms energy: -234.241257 where: bonds (distance) C4'-P energy: -73.680 bonds (distance) P-C4' energy: -64.651 flat angles C4'-P-C4' energy: -50.386 flat angles P-C4'-P energy: -32.478 tors. eta vs tors. theta energy: -13.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -530.450272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -530.450272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -530.450272 (E_RNA) where: Base-Base interactions energy: -274.817 where: short stacking energy: -141.762 Base-Backbone interact. energy: 0.784 local terms energy: -256.416842 where: bonds (distance) C4'-P energy: -65.763 bonds (distance) P-C4' energy: -75.081 flat angles C4'-P-C4' energy: -66.176 flat angles P-C4'-P energy: -45.346 tors. eta vs tors. theta energy: -4.051 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -431.922588 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.922588 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.922588 (E_RNA) where: Base-Base interactions energy: -201.593 where: short stacking energy: -125.052 Base-Backbone interact. energy: 4.173 local terms energy: -234.502202 where: bonds (distance) C4'-P energy: -66.206 bonds (distance) P-C4' energy: -65.415 flat angles C4'-P-C4' energy: -69.849 flat angles P-C4'-P energy: -27.573 tors. eta vs tors. theta energy: -5.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -1211.976725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1211.976725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1211.976725 (E_RNA) where: Base-Base interactions energy: -800.872 where: short stacking energy: -372.526 Base-Backbone interact. energy: -3.492 local terms energy: -407.613639 where: bonds (distance) C4'-P energy: -80.722 bonds (distance) P-C4' energy: -85.880 flat angles C4'-P-C4' energy: -78.711 flat angles P-C4'-P energy: -56.642 tors. eta vs tors. theta energy: -105.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -1177.675342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1177.675342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1177.675342 (E_RNA) where: Base-Base interactions energy: -768.695 where: short stacking energy: -383.686 Base-Backbone interact. energy: -1.796 local terms energy: -407.183963 where: bonds (distance) C4'-P energy: -85.358 bonds (distance) P-C4' energy: -83.985 flat angles C4'-P-C4' energy: -87.864 flat angles P-C4'-P energy: -55.714 tors. eta vs tors. theta energy: -94.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -996.315722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -996.315722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -996.315722 (E_RNA) where: Base-Base interactions energy: -610.626 where: short stacking energy: -327.093 Base-Backbone interact. energy: -1.723 local terms energy: -383.966066 where: bonds (distance) C4'-P energy: -74.378 bonds (distance) P-C4' energy: -86.236 flat angles C4'-P-C4' energy: -94.232 flat angles P-C4'-P energy: -52.744 tors. eta vs tors. theta energy: -76.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -949.324763 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -949.324763 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -949.324763 (E_RNA) where: Base-Base interactions energy: -595.730 where: short stacking energy: -289.068 Base-Backbone interact. energy: 3.510 local terms energy: -357.104880 where: bonds (distance) C4'-P energy: -83.116 bonds (distance) P-C4' energy: -81.108 flat angles C4'-P-C4' energy: -72.728 flat angles P-C4'-P energy: -57.578 tors. eta vs tors. theta energy: -62.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -741.896834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -741.896834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -741.896834 (E_RNA) where: Base-Base interactions energy: -426.317 where: short stacking energy: -252.691 Base-Backbone interact. energy: -3.320 local terms energy: -312.260322 where: bonds (distance) C4'-P energy: -85.179 bonds (distance) P-C4' energy: -70.655 flat angles C4'-P-C4' energy: -76.891 flat angles P-C4'-P energy: -32.686 tors. eta vs tors. theta energy: -46.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -700.729916 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -700.729916 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -700.729916 (E_RNA) where: Base-Base interactions energy: -415.377 where: short stacking energy: -215.153 Base-Backbone interact. energy: -1.109 local terms energy: -284.243808 where: bonds (distance) C4'-P energy: -67.974 bonds (distance) P-C4' energy: -78.925 flat angles C4'-P-C4' energy: -73.272 flat angles P-C4'-P energy: -45.309 tors. eta vs tors. theta energy: -18.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -592.304208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -592.304208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -592.304208 (E_RNA) where: Base-Base interactions energy: -305.219 where: short stacking energy: -185.538 Base-Backbone interact. energy: -1.701 local terms energy: -285.384501 where: bonds (distance) C4'-P energy: -72.388 bonds (distance) P-C4' energy: -71.578 flat angles C4'-P-C4' energy: -67.719 flat angles P-C4'-P energy: -45.700 tors. eta vs tors. theta energy: -28.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -575.566709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -575.566709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -575.566709 (E_RNA) where: Base-Base interactions energy: -316.900 where: short stacking energy: -194.681 Base-Backbone interact. energy: -1.284 local terms energy: -257.382494 where: bonds (distance) C4'-P energy: -67.306 bonds (distance) P-C4' energy: -73.586 flat angles C4'-P-C4' energy: -58.592 flat angles P-C4'-P energy: -49.056 tors. eta vs tors. theta energy: -8.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -496.950618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.950618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.950618 (E_RNA) where: Base-Base interactions energy: -247.327 where: short stacking energy: -154.818 Base-Backbone interact. energy: -0.746 local terms energy: -248.878053 where: bonds (distance) C4'-P energy: -72.628 bonds (distance) P-C4' energy: -72.316 flat angles C4'-P-C4' energy: -65.546 flat angles P-C4'-P energy: -33.586 tors. eta vs tors. theta energy: -4.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -428.733158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.733158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.733158 (E_RNA) where: Base-Base interactions energy: -205.709 where: short stacking energy: -107.222 Base-Backbone interact. energy: -2.576 local terms energy: -220.447764 where: bonds (distance) C4'-P energy: -72.638 bonds (distance) P-C4' energy: -73.458 flat angles C4'-P-C4' energy: -47.936 flat angles P-C4'-P energy: -36.993 tors. eta vs tors. theta energy: 10.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -1220.359665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1220.359665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1220.359665 (E_RNA) where: Base-Base interactions energy: -799.099 where: short stacking energy: -369.172 Base-Backbone interact. energy: -2.313 local terms energy: -418.948231 where: bonds (distance) C4'-P energy: -79.501 bonds (distance) P-C4' energy: -91.015 flat angles C4'-P-C4' energy: -94.161 flat angles P-C4'-P energy: -54.228 tors. eta vs tors. theta energy: -100.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -1174.686797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.686797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.686797 (E_RNA) where: Base-Base interactions energy: -764.131 where: short stacking energy: -361.006 Base-Backbone interact. energy: -1.571 local terms energy: -408.985093 where: bonds (distance) C4'-P energy: -86.273 bonds (distance) P-C4' energy: -85.813 flat angles C4'-P-C4' energy: -96.359 flat angles P-C4'-P energy: -66.273 tors. eta vs tors. theta energy: -74.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -968.871736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -968.871736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -968.871736 (E_RNA) where: Base-Base interactions energy: -597.995 where: short stacking energy: -295.846 Base-Backbone interact. energy: -1.904 local terms energy: -368.971835 where: bonds (distance) C4'-P energy: -77.130 bonds (distance) P-C4' energy: -92.491 flat angles C4'-P-C4' energy: -89.758 flat angles P-C4'-P energy: -47.277 tors. eta vs tors. theta energy: -62.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -961.141354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.141354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.141354 (E_RNA) where: Base-Base interactions energy: -590.348 where: short stacking energy: -317.047 Base-Backbone interact. energy: -0.295 local terms energy: -370.498700 where: bonds (distance) C4'-P energy: -83.395 bonds (distance) P-C4' energy: -72.118 flat angles C4'-P-C4' energy: -83.546 flat angles P-C4'-P energy: -54.224 tors. eta vs tors. theta energy: -77.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -730.124858 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -730.124858 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -730.124858 (E_RNA) where: Base-Base interactions energy: -402.425 where: short stacking energy: -218.684 Base-Backbone interact. energy: 0.648 local terms energy: -328.347658 where: bonds (distance) C4'-P energy: -78.816 bonds (distance) P-C4' energy: -81.954 flat angles C4'-P-C4' energy: -88.776 flat angles P-C4'-P energy: -38.672 tors. eta vs tors. theta energy: -40.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -625.938439 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -625.938439 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -625.938439 (E_RNA) where: Base-Base interactions energy: -346.085 where: short stacking energy: -189.389 Base-Backbone interact. energy: -1.163 local terms energy: -278.690738 where: bonds (distance) C4'-P energy: -73.720 bonds (distance) P-C4' energy: -70.973 flat angles C4'-P-C4' energy: -72.170 flat angles P-C4'-P energy: -51.337 tors. eta vs tors. theta energy: -10.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -613.828303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -613.828303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -613.828303 (E_RNA) where: Base-Base interactions energy: -329.050 where: short stacking energy: -200.464 Base-Backbone interact. energy: -1.914 local terms energy: -282.863851 where: bonds (distance) C4'-P energy: -66.993 bonds (distance) P-C4' energy: -86.180 flat angles C4'-P-C4' energy: -67.831 flat angles P-C4'-P energy: -44.684 tors. eta vs tors. theta energy: -17.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -549.222247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -549.222247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -549.222247 (E_RNA) where: Base-Base interactions energy: -299.256 where: short stacking energy: -157.801 Base-Backbone interact. energy: -0.154 local terms energy: -249.812422 where: bonds (distance) C4'-P energy: -73.346 bonds (distance) P-C4' energy: -58.210 flat angles C4'-P-C4' energy: -82.842 flat angles P-C4'-P energy: -28.509 tors. eta vs tors. theta energy: -6.906 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -441.690964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.690964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.690964 (E_RNA) where: Base-Base interactions energy: -219.336 where: short stacking energy: -136.000 Base-Backbone interact. energy: -1.028 local terms energy: -221.327072 where: bonds (distance) C4'-P energy: -81.203 bonds (distance) P-C4' energy: -67.283 flat angles C4'-P-C4' energy: -52.411 flat angles P-C4'-P energy: -32.595 tors. eta vs tors. theta energy: 12.165 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -385.354168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.354168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.354168 (E_RNA) where: Base-Base interactions energy: -155.327 where: short stacking energy: -114.823 Base-Backbone interact. energy: 1.121 local terms energy: -231.148013 where: bonds (distance) C4'-P energy: -75.083 bonds (distance) P-C4' energy: -80.700 flat angles C4'-P-C4' energy: -57.906 flat angles P-C4'-P energy: -30.547 tors. eta vs tors. theta energy: 13.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -1226.535025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.535025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.535025 (E_RNA) where: Base-Base interactions energy: -809.334 where: short stacking energy: -402.237 Base-Backbone interact. energy: -3.158 local terms energy: -414.042477 where: bonds (distance) C4'-P energy: -88.287 bonds (distance) P-C4' energy: -75.846 flat angles C4'-P-C4' energy: -100.474 flat angles P-C4'-P energy: -56.626 tors. eta vs tors. theta energy: -92.810 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -1196.491909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.491909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.491909 (E_RNA) where: Base-Base interactions energy: -782.454 where: short stacking energy: -373.762 Base-Backbone interact. energy: -1.151 local terms energy: -412.887472 where: bonds (distance) C4'-P energy: -82.387 bonds (distance) P-C4' energy: -90.164 flat angles C4'-P-C4' energy: -96.721 flat angles P-C4'-P energy: -55.273 tors. eta vs tors. theta energy: -88.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -1039.330047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.330047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.330047 (E_RNA) where: Base-Base interactions energy: -654.476 where: short stacking energy: -348.946 Base-Backbone interact. energy: -0.215 local terms energy: -384.638853 where: bonds (distance) C4'-P energy: -77.707 bonds (distance) P-C4' energy: -84.154 flat angles C4'-P-C4' energy: -82.451 flat angles P-C4'-P energy: -64.993 tors. eta vs tors. theta energy: -75.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -961.096215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -961.096215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -961.096215 (E_RNA) where: Base-Base interactions energy: -590.896 where: short stacking energy: -286.690 Base-Backbone interact. energy: -3.026 local terms energy: -367.174966 where: bonds (distance) C4'-P energy: -85.878 bonds (distance) P-C4' energy: -81.566 flat angles C4'-P-C4' energy: -83.315 flat angles P-C4'-P energy: -49.925 tors. eta vs tors. theta energy: -66.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -836.065057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.065057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.065057 (E_RNA) where: Base-Base interactions energy: -492.963 where: short stacking energy: -229.065 Base-Backbone interact. energy: -1.838 local terms energy: -341.263979 where: bonds (distance) C4'-P energy: -74.600 bonds (distance) P-C4' energy: -84.193 flat angles C4'-P-C4' energy: -78.437 flat angles P-C4'-P energy: -61.201 tors. eta vs tors. theta energy: -42.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -693.980015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -693.980015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -693.980015 (E_RNA) where: Base-Base interactions energy: -392.377 where: short stacking energy: -223.519 Base-Backbone interact. energy: -2.331 local terms energy: -299.271411 where: bonds (distance) C4'-P energy: -71.171 bonds (distance) P-C4' energy: -71.983 flat angles C4'-P-C4' energy: -82.134 flat angles P-C4'-P energy: -45.091 tors. eta vs tors. theta energy: -28.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -615.087567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -615.087567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.087567 (E_RNA) where: Base-Base interactions energy: -334.870 where: short stacking energy: -206.427 Base-Backbone interact. energy: -1.378 local terms energy: -278.839620 where: bonds (distance) C4'-P energy: -73.264 bonds (distance) P-C4' energy: -67.867 flat angles C4'-P-C4' energy: -74.548 flat angles P-C4'-P energy: -39.087 tors. eta vs tors. theta energy: -24.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -593.237251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -593.237251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -593.237251 (E_RNA) where: Base-Base interactions energy: -321.809 where: short stacking energy: -172.452 Base-Backbone interact. energy: 0.882 local terms energy: -272.310070 where: bonds (distance) C4'-P energy: -76.504 bonds (distance) P-C4' energy: -78.392 flat angles C4'-P-C4' energy: -54.266 flat angles P-C4'-P energy: -47.862 tors. eta vs tors. theta energy: -15.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -411.336049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.336049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.336049 (E_RNA) where: Base-Base interactions energy: -173.596 where: short stacking energy: -101.787 Base-Backbone interact. energy: 1.234 local terms energy: -238.974141 where: bonds (distance) C4'-P energy: -58.335 bonds (distance) P-C4' energy: -83.118 flat angles C4'-P-C4' energy: -81.680 flat angles P-C4'-P energy: -23.168 tors. eta vs tors. theta energy: 7.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -474.132834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.132834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.132834 (E_RNA) where: Base-Base interactions energy: -224.293 where: short stacking energy: -125.614 Base-Backbone interact. energy: 0.931 local terms energy: -250.770583 where: bonds (distance) C4'-P energy: -63.935 bonds (distance) P-C4' energy: -75.629 flat angles C4'-P-C4' energy: -66.003 flat angles P-C4'-P energy: -36.910 tors. eta vs tors. theta energy: -8.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -1200.621306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.621306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.621306 (E_RNA) where: Base-Base interactions energy: -809.560 where: short stacking energy: -374.805 Base-Backbone interact. energy: -0.009 local terms energy: -391.051352 where: bonds (distance) C4'-P energy: -61.749 bonds (distance) P-C4' energy: -78.906 flat angles C4'-P-C4' energy: -83.424 flat angles P-C4'-P energy: -72.734 tors. eta vs tors. theta energy: -94.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -1264.622637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.622637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.622637 (E_RNA) where: Base-Base interactions energy: -854.462 where: short stacking energy: -374.377 Base-Backbone interact. energy: 0.676 local terms energy: -410.836614 where: bonds (distance) C4'-P energy: -77.535 bonds (distance) P-C4' energy: -88.907 flat angles C4'-P-C4' energy: -90.966 flat angles P-C4'-P energy: -56.461 tors. eta vs tors. theta energy: -96.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -1072.948381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.948381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.948381 (E_RNA) where: Base-Base interactions energy: -698.777 where: short stacking energy: -350.244 Base-Backbone interact. energy: 1.158 local terms energy: -375.328688 where: bonds (distance) C4'-P energy: -80.030 bonds (distance) P-C4' energy: -81.265 flat angles C4'-P-C4' energy: -79.061 flat angles P-C4'-P energy: -60.396 tors. eta vs tors. theta energy: -74.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -1040.250718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.250718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.250718 (E_RNA) where: Base-Base interactions energy: -689.069 where: short stacking energy: -333.759 Base-Backbone interact. energy: -0.519 local terms energy: -350.662422 where: bonds (distance) C4'-P energy: -72.154 bonds (distance) P-C4' energy: -81.972 flat angles C4'-P-C4' energy: -79.724 flat angles P-C4'-P energy: -46.603 tors. eta vs tors. theta energy: -70.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -957.766426 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.766426 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.766426 (E_RNA) where: Base-Base interactions energy: -584.773 where: short stacking energy: -309.835 Base-Backbone interact. energy: -1.035 local terms energy: -371.958453 where: bonds (distance) C4'-P energy: -88.701 bonds (distance) P-C4' energy: -78.482 flat angles C4'-P-C4' energy: -78.014 flat angles P-C4'-P energy: -55.681 tors. eta vs tors. theta energy: -71.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -709.988573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.988573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.988573 (E_RNA) where: Base-Base interactions energy: -409.980 where: short stacking energy: -202.218 Base-Backbone interact. energy: -4.211 local terms energy: -295.797395 where: bonds (distance) C4'-P energy: -70.785 bonds (distance) P-C4' energy: -87.436 flat angles C4'-P-C4' energy: -72.824 flat angles P-C4'-P energy: -42.775 tors. eta vs tors. theta energy: -21.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -645.263683 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -645.263683 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -645.263683 (E_RNA) where: Base-Base interactions energy: -357.263 where: short stacking energy: -167.117 Base-Backbone interact. energy: 0.056 local terms energy: -288.056581 where: bonds (distance) C4'-P energy: -67.570 bonds (distance) P-C4' energy: -85.617 flat angles C4'-P-C4' energy: -65.338 flat angles P-C4'-P energy: -48.837 tors. eta vs tors. theta energy: -20.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -578.264074 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.264074 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.264074 (E_RNA) where: Base-Base interactions energy: -307.746 where: short stacking energy: -180.777 Base-Backbone interact. energy: 1.052 local terms energy: -271.570318 where: bonds (distance) C4'-P energy: -79.483 bonds (distance) P-C4' energy: -68.356 flat angles C4'-P-C4' energy: -63.492 flat angles P-C4'-P energy: -34.407 tors. eta vs tors. theta energy: -25.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -470.457997 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.457997 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.457997 (E_RNA) where: Base-Base interactions energy: -235.756 where: short stacking energy: -165.481 Base-Backbone interact. energy: 2.422 local terms energy: -237.124406 where: bonds (distance) C4'-P energy: -58.821 bonds (distance) P-C4' energy: -64.722 flat angles C4'-P-C4' energy: -73.887 flat angles P-C4'-P energy: -37.860 tors. eta vs tors. theta energy: -1.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -337.252913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.252913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.252913 (E_RNA) where: Base-Base interactions energy: -131.948 where: short stacking energy: -118.914 Base-Backbone interact. energy: 0.910 local terms energy: -206.214738 where: bonds (distance) C4'-P energy: -62.401 bonds (distance) P-C4' energy: -66.277 flat angles C4'-P-C4' energy: -57.243 flat angles P-C4'-P energy: -28.647 tors. eta vs tors. theta energy: 8.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -1184.065638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.065638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.065638 (E_RNA) where: Base-Base interactions energy: -775.689 where: short stacking energy: -333.352 Base-Backbone interact. energy: 0.017 local terms energy: -408.393657 where: bonds (distance) C4'-P energy: -95.542 bonds (distance) P-C4' energy: -87.344 flat angles C4'-P-C4' energy: -97.781 flat angles P-C4'-P energy: -53.279 tors. eta vs tors. theta energy: -74.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -1262.405013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.405013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.405013 (E_RNA) where: Base-Base interactions energy: -870.951 where: short stacking energy: -376.752 Base-Backbone interact. energy: -1.571 local terms energy: -389.883082 where: bonds (distance) C4'-P energy: -83.031 bonds (distance) P-C4' energy: -86.486 flat angles C4'-P-C4' energy: -76.635 flat angles P-C4'-P energy: -52.814 tors. eta vs tors. theta energy: -90.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -1059.527348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.527348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.527348 (E_RNA) where: Base-Base interactions energy: -674.787 where: short stacking energy: -346.855 Base-Backbone interact. energy: 2.306 local terms energy: -387.047279 where: bonds (distance) C4'-P energy: -71.370 bonds (distance) P-C4' energy: -78.967 flat angles C4'-P-C4' energy: -94.456 flat angles P-C4'-P energy: -52.968 tors. eta vs tors. theta energy: -89.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -1130.209461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1130.209461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1130.209461 (E_RNA) where: Base-Base interactions energy: -745.389 where: short stacking energy: -328.654 Base-Backbone interact. energy: -1.678 local terms energy: -383.141767 where: bonds (distance) C4'-P energy: -83.156 bonds (distance) P-C4' energy: -80.242 flat angles C4'-P-C4' energy: -94.411 flat angles P-C4'-P energy: -47.632 tors. eta vs tors. theta energy: -77.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -934.656023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -934.656023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -934.656023 (E_RNA) where: Base-Base interactions energy: -610.989 where: short stacking energy: -315.485 Base-Backbone interact. energy: -1.074 local terms energy: -322.592981 where: bonds (distance) C4'-P energy: -65.043 bonds (distance) P-C4' energy: -76.188 flat angles C4'-P-C4' energy: -69.476 flat angles P-C4'-P energy: -46.145 tors. eta vs tors. theta energy: -65.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -728.093836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -728.093836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -728.093836 (E_RNA) where: Base-Base interactions energy: -430.044 where: short stacking energy: -205.692 Base-Backbone interact. energy: -2.729 local terms energy: -295.320831 where: bonds (distance) C4'-P energy: -63.361 bonds (distance) P-C4' energy: -78.395 flat angles C4'-P-C4' energy: -80.445 flat angles P-C4'-P energy: -44.578 tors. eta vs tors. theta energy: -28.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -720.961729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.961729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.961729 (E_RNA) where: Base-Base interactions energy: -475.940 where: short stacking energy: -230.610 Base-Backbone interact. energy: 1.592 local terms energy: -246.613788 where: bonds (distance) C4'-P energy: -58.664 bonds (distance) P-C4' energy: -59.598 flat angles C4'-P-C4' energy: -62.147 flat angles P-C4'-P energy: -35.525 tors. eta vs tors. theta energy: -30.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -650.997250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -650.997250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.997250 (E_RNA) where: Base-Base interactions energy: -388.730 where: short stacking energy: -178.717 Base-Backbone interact. energy: -2.310 local terms energy: -259.957743 where: bonds (distance) C4'-P energy: -57.360 bonds (distance) P-C4' energy: -69.844 flat angles C4'-P-C4' energy: -71.524 flat angles P-C4'-P energy: -45.474 tors. eta vs tors. theta energy: -15.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -533.766015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -533.766015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -533.766015 (E_RNA) where: Base-Base interactions energy: -276.755 where: short stacking energy: -156.225 Base-Backbone interact. energy: -2.921 local terms energy: -254.090176 where: bonds (distance) C4'-P energy: -66.284 bonds (distance) P-C4' energy: -70.325 flat angles C4'-P-C4' energy: -72.248 flat angles P-C4'-P energy: -31.212 tors. eta vs tors. theta energy: -14.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -420.012679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.012679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.012679 (E_RNA) where: Base-Base interactions energy: -195.313 where: short stacking energy: -141.038 Base-Backbone interact. energy: 2.047 local terms energy: -226.746185 where: bonds (distance) C4'-P energy: -65.223 bonds (distance) P-C4' energy: -81.409 flat angles C4'-P-C4' energy: -57.396 flat angles P-C4'-P energy: -28.519 tors. eta vs tors. theta energy: 5.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -1322.008274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.008274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.008274 (E_RNA) where: Base-Base interactions energy: -903.339 where: short stacking energy: -417.504 Base-Backbone interact. energy: -0.676 local terms energy: -417.993131 where: bonds (distance) C4'-P energy: -83.317 bonds (distance) P-C4' energy: -76.302 flat angles C4'-P-C4' energy: -94.430 flat angles P-C4'-P energy: -58.969 tors. eta vs tors. theta energy: -104.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -1219.666334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.666334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.666334 (E_RNA) where: Base-Base interactions energy: -837.176 where: short stacking energy: -350.380 Base-Backbone interact. energy: -2.040 local terms energy: -380.450527 where: bonds (distance) C4'-P energy: -74.177 bonds (distance) P-C4' energy: -85.552 flat angles C4'-P-C4' energy: -87.371 flat angles P-C4'-P energy: -56.811 tors. eta vs tors. theta energy: -76.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -1188.373889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1188.373889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.373889 (E_RNA) where: Base-Base interactions energy: -808.653 where: short stacking energy: -366.048 Base-Backbone interact. energy: -3.137 local terms energy: -376.584622 where: bonds (distance) C4'-P energy: -69.965 bonds (distance) P-C4' energy: -85.399 flat angles C4'-P-C4' energy: -86.808 flat angles P-C4'-P energy: -44.674 tors. eta vs tors. theta energy: -89.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -1027.339312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1027.339312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1027.339312 (E_RNA) where: Base-Base interactions energy: -660.581 where: short stacking energy: -332.870 Base-Backbone interact. energy: -0.937 local terms energy: -365.820991 where: bonds (distance) C4'-P energy: -71.288 bonds (distance) P-C4' energy: -84.781 flat angles C4'-P-C4' energy: -77.418 flat angles P-C4'-P energy: -56.061 tors. eta vs tors. theta energy: -76.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -1025.270067 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.270067 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.270067 (E_RNA) where: Base-Base interactions energy: -652.574 where: short stacking energy: -297.094 Base-Backbone interact. energy: -1.722 local terms energy: -370.973689 where: bonds (distance) C4'-P energy: -68.521 bonds (distance) P-C4' energy: -81.556 flat angles C4'-P-C4' energy: -86.669 flat angles P-C4'-P energy: -45.691 tors. eta vs tors. theta energy: -88.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -804.437688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.437688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.437688 (E_RNA) where: Base-Base interactions energy: -465.775 where: short stacking energy: -246.511 Base-Backbone interact. energy: -1.390 local terms energy: -337.272806 where: bonds (distance) C4'-P energy: -84.306 bonds (distance) P-C4' energy: -73.219 flat angles C4'-P-C4' energy: -65.980 flat angles P-C4'-P energy: -58.449 tors. eta vs tors. theta energy: -55.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -772.943639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.943639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.943639 (E_RNA) where: Base-Base interactions energy: -466.583 where: short stacking energy: -243.750 Base-Backbone interact. energy: -1.830 local terms energy: -304.531109 where: bonds (distance) C4'-P energy: -50.518 bonds (distance) P-C4' energy: -75.859 flat angles C4'-P-C4' energy: -83.974 flat angles P-C4'-P energy: -50.141 tors. eta vs tors. theta energy: -44.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -685.762360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.762360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.762360 (E_RNA) where: Base-Base interactions energy: -399.331 where: short stacking energy: -190.886 Base-Backbone interact. energy: -0.190 local terms energy: -286.241542 where: bonds (distance) C4'-P energy: -60.898 bonds (distance) P-C4' energy: -79.085 flat angles C4'-P-C4' energy: -76.448 flat angles P-C4'-P energy: -42.195 tors. eta vs tors. theta energy: -27.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -578.005798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -578.005798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -578.005798 (E_RNA) where: Base-Base interactions energy: -317.208 where: short stacking energy: -177.579 Base-Backbone interact. energy: 1.055 local terms energy: -261.852760 where: bonds (distance) C4'-P energy: -79.187 bonds (distance) P-C4' energy: -81.362 flat angles C4'-P-C4' energy: -56.497 flat angles P-C4'-P energy: -41.102 tors. eta vs tors. theta energy: -3.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -405.513848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.513848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.513848 (E_RNA) where: Base-Base interactions energy: -174.998 where: short stacking energy: -122.811 Base-Backbone interact. energy: 3.451 local terms energy: -233.966885 where: bonds (distance) C4'-P energy: -65.272 bonds (distance) P-C4' energy: -71.642 flat angles C4'-P-C4' energy: -63.920 flat angles P-C4'-P energy: -31.922 tors. eta vs tors. theta energy: -1.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -1330.775047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.775047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.775047 (E_RNA) where: Base-Base interactions energy: -889.422 where: short stacking energy: -421.366 Base-Backbone interact. energy: -1.922 local terms energy: -439.430798 where: bonds (distance) C4'-P energy: -79.617 bonds (distance) P-C4' energy: -81.772 flat angles C4'-P-C4' energy: -101.518 flat angles P-C4'-P energy: -62.480 tors. eta vs tors. theta energy: -114.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -1253.759798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.759798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.759798 (E_RNA) where: Base-Base interactions energy: -864.509 where: short stacking energy: -385.935 Base-Backbone interact. energy: -2.036 local terms energy: -387.215208 where: bonds (distance) C4'-P energy: -78.722 bonds (distance) P-C4' energy: -79.145 flat angles C4'-P-C4' energy: -84.657 flat angles P-C4'-P energy: -54.097 tors. eta vs tors. theta energy: -90.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -1195.572367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.572367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.572367 (E_RNA) where: Base-Base interactions energy: -802.337 where: short stacking energy: -329.104 Base-Backbone interact. energy: 5.327 local terms energy: -398.561994 where: bonds (distance) C4'-P energy: -78.170 bonds (distance) P-C4' energy: -89.325 flat angles C4'-P-C4' energy: -94.769 flat angles P-C4'-P energy: -58.736 tors. eta vs tors. theta energy: -77.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -1076.887744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1076.887744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1076.887744 (E_RNA) where: Base-Base interactions energy: -700.433 where: short stacking energy: -343.057 Base-Backbone interact. energy: 0.704 local terms energy: -377.158968 where: bonds (distance) C4'-P energy: -65.086 bonds (distance) P-C4' energy: -85.398 flat angles C4'-P-C4' energy: -80.954 flat angles P-C4'-P energy: -60.698 tors. eta vs tors. theta energy: -85.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -991.597603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -991.597603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -991.597603 (E_RNA) where: Base-Base interactions energy: -635.804 where: short stacking energy: -323.280 Base-Backbone interact. energy: 0.084 local terms energy: -355.877680 where: bonds (distance) C4'-P energy: -72.817 bonds (distance) P-C4' energy: -67.308 flat angles C4'-P-C4' energy: -68.895 flat angles P-C4'-P energy: -55.039 tors. eta vs tors. theta energy: -91.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -764.550372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -764.550372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -764.550372 (E_RNA) where: Base-Base interactions energy: -474.253 where: short stacking energy: -234.236 Base-Backbone interact. energy: -0.211 local terms energy: -290.086372 where: bonds (distance) C4'-P energy: -72.583 bonds (distance) P-C4' energy: -77.005 flat angles C4'-P-C4' energy: -63.033 flat angles P-C4'-P energy: -40.519 tors. eta vs tors. theta energy: -36.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -799.885870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -799.885870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -799.885870 (E_RNA) where: Base-Base interactions energy: -481.588 where: short stacking energy: -224.044 Base-Backbone interact. energy: -1.519 local terms energy: -316.779230 where: bonds (distance) C4'-P energy: -81.747 bonds (distance) P-C4' energy: -89.938 flat angles C4'-P-C4' energy: -69.288 flat angles P-C4'-P energy: -37.670 tors. eta vs tors. theta energy: -38.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -744.783694 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -744.783694 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -744.783694 (E_RNA) where: Base-Base interactions energy: -482.105 where: short stacking energy: -216.619 Base-Backbone interact. energy: -1.379 local terms energy: -261.299714 where: bonds (distance) C4'-P energy: -61.995 bonds (distance) P-C4' energy: -71.233 flat angles C4'-P-C4' energy: -66.852 flat angles P-C4'-P energy: -40.828 tors. eta vs tors. theta energy: -20.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -565.719633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -565.719633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -565.719633 (E_RNA) where: Base-Base interactions energy: -326.840 where: short stacking energy: -191.433 Base-Backbone interact. energy: 1.241 local terms energy: -240.120607 where: bonds (distance) C4'-P energy: -71.689 bonds (distance) P-C4' energy: -63.979 flat angles C4'-P-C4' energy: -70.775 flat angles P-C4'-P energy: -20.542 tors. eta vs tors. theta energy: -13.135 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -404.651664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.651664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.651664 (E_RNA) where: Base-Base interactions energy: -197.125 where: short stacking energy: -116.434 Base-Backbone interact. energy: 6.189 local terms energy: -213.715778 where: bonds (distance) C4'-P energy: -68.514 bonds (distance) P-C4' energy: -55.171 flat angles C4'-P-C4' energy: -72.937 flat angles P-C4'-P energy: -38.094 tors. eta vs tors. theta energy: 21.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -1375.349685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.349685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.349685 (E_RNA) where: Base-Base interactions energy: -911.242 where: short stacking energy: -427.408 Base-Backbone interact. energy: -1.183 local terms energy: -462.924639 where: bonds (distance) C4'-P energy: -91.409 bonds (distance) P-C4' energy: -95.460 flat angles C4'-P-C4' energy: -87.698 flat angles P-C4'-P energy: -72.572 tors. eta vs tors. theta energy: -115.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -1264.719211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1264.719211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1264.719211 (E_RNA) where: Base-Base interactions energy: -849.121 where: short stacking energy: -381.453 Base-Backbone interact. energy: 0.205 local terms energy: -415.803520 where: bonds (distance) C4'-P energy: -80.331 bonds (distance) P-C4' energy: -89.950 flat angles C4'-P-C4' energy: -86.909 flat angles P-C4'-P energy: -62.974 tors. eta vs tors. theta energy: -95.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -1216.132942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.132942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.132942 (E_RNA) where: Base-Base interactions energy: -813.465 where: short stacking energy: -343.953 Base-Backbone interact. energy: -3.199 local terms energy: -399.469422 where: bonds (distance) C4'-P energy: -79.272 bonds (distance) P-C4' energy: -86.517 flat angles C4'-P-C4' energy: -80.396 flat angles P-C4'-P energy: -61.258 tors. eta vs tors. theta energy: -92.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -1073.367245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1073.367245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1073.367245 (E_RNA) where: Base-Base interactions energy: -691.978 where: short stacking energy: -335.294 Base-Backbone interact. energy: -0.989 local terms energy: -380.400349 where: bonds (distance) C4'-P energy: -77.296 bonds (distance) P-C4' energy: -85.533 flat angles C4'-P-C4' energy: -81.400 flat angles P-C4'-P energy: -53.466 tors. eta vs tors. theta energy: -82.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -960.948852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -960.948852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.948852 (E_RNA) where: Base-Base interactions energy: -618.318 where: short stacking energy: -299.739 Base-Backbone interact. energy: -1.077 local terms energy: -341.553198 where: bonds (distance) C4'-P energy: -66.648 bonds (distance) P-C4' energy: -84.438 flat angles C4'-P-C4' energy: -65.676 flat angles P-C4'-P energy: -55.174 tors. eta vs tors. theta energy: -69.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -781.170484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.170484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.170484 (E_RNA) where: Base-Base interactions energy: -474.847 where: short stacking energy: -246.586 Base-Backbone interact. energy: -1.557 local terms energy: -304.765678 where: bonds (distance) C4'-P energy: -53.562 bonds (distance) P-C4' energy: -72.675 flat angles C4'-P-C4' energy: -75.419 flat angles P-C4'-P energy: -51.226 tors. eta vs tors. theta energy: -51.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -747.999222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -747.999222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -747.999222 (E_RNA) where: Base-Base interactions energy: -441.145 where: short stacking energy: -212.878 Base-Backbone interact. energy: 0.954 local terms energy: -307.808001 where: bonds (distance) C4'-P energy: -63.767 bonds (distance) P-C4' energy: -74.003 flat angles C4'-P-C4' energy: -79.263 flat angles P-C4'-P energy: -47.590 tors. eta vs tors. theta energy: -43.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -691.217293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.217293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.217293 (E_RNA) where: Base-Base interactions energy: -400.926 where: short stacking energy: -203.679 Base-Backbone interact. energy: -1.410 local terms energy: -288.881034 where: bonds (distance) C4'-P energy: -71.158 bonds (distance) P-C4' energy: -72.483 flat angles C4'-P-C4' energy: -71.398 flat angles P-C4'-P energy: -48.645 tors. eta vs tors. theta energy: -25.197 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -626.756038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -626.756038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -626.756038 (E_RNA) where: Base-Base interactions energy: -339.069 where: short stacking energy: -168.100 Base-Backbone interact. energy: -0.618 local terms energy: -287.068497 where: bonds (distance) C4'-P energy: -65.859 bonds (distance) P-C4' energy: -84.689 flat angles C4'-P-C4' energy: -70.582 flat angles P-C4'-P energy: -50.583 tors. eta vs tors. theta energy: -15.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -403.040747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.040747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.040747 (E_RNA) where: Base-Base interactions energy: -147.042 where: short stacking energy: -99.197 Base-Backbone interact. energy: -1.187 local terms energy: -254.811616 where: bonds (distance) C4'-P energy: -60.834 bonds (distance) P-C4' energy: -72.742 flat angles C4'-P-C4' energy: -78.274 flat angles P-C4'-P energy: -42.922 tors. eta vs tors. theta energy: -0.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -1379.900286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.900286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.900286 (E_RNA) where: Base-Base interactions energy: -952.671 where: short stacking energy: -431.170 Base-Backbone interact. energy: -1.244 local terms energy: -425.984864 where: bonds (distance) C4'-P energy: -82.309 bonds (distance) P-C4' energy: -82.575 flat angles C4'-P-C4' energy: -86.436 flat angles P-C4'-P energy: -67.836 tors. eta vs tors. theta energy: -106.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -1269.155109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1269.155109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1269.155109 (E_RNA) where: Base-Base interactions energy: -860.698 where: short stacking energy: -380.497 Base-Backbone interact. energy: -0.678 local terms energy: -407.778521 where: bonds (distance) C4'-P energy: -77.755 bonds (distance) P-C4' energy: -89.136 flat angles C4'-P-C4' energy: -87.468 flat angles P-C4'-P energy: -53.376 tors. eta vs tors. theta energy: -100.044 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -1206.341913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.341913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1206.341913 (E_RNA) where: Base-Base interactions energy: -799.278 where: short stacking energy: -353.905 Base-Backbone interact. energy: -3.760 local terms energy: -403.304314 where: bonds (distance) C4'-P energy: -76.739 bonds (distance) P-C4' energy: -84.187 flat angles C4'-P-C4' energy: -89.116 flat angles P-C4'-P energy: -63.068 tors. eta vs tors. theta energy: -90.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -1084.187626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.187626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.187626 (E_RNA) where: Base-Base interactions energy: -701.229 where: short stacking energy: -345.448 Base-Backbone interact. energy: -1.619 local terms energy: -381.339841 where: bonds (distance) C4'-P energy: -84.687 bonds (distance) P-C4' energy: -75.738 flat angles C4'-P-C4' energy: -78.421 flat angles P-C4'-P energy: -56.574 tors. eta vs tors. theta energy: -85.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -951.581765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -951.581765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -951.581765 (E_RNA) where: Base-Base interactions energy: -597.900 where: short stacking energy: -281.165 Base-Backbone interact. energy: -1.116 local terms energy: -352.564980 where: bonds (distance) C4'-P energy: -73.819 bonds (distance) P-C4' energy: -81.665 flat angles C4'-P-C4' energy: -78.083 flat angles P-C4'-P energy: -50.798 tors. eta vs tors. theta energy: -68.200 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -792.514104 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.514104 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.514104 (E_RNA) where: Base-Base interactions energy: -463.256 where: short stacking energy: -268.361 Base-Backbone interact. energy: -1.905 local terms energy: -327.353107 where: bonds (distance) C4'-P energy: -80.035 bonds (distance) P-C4' energy: -76.986 flat angles C4'-P-C4' energy: -73.241 flat angles P-C4'-P energy: -43.802 tors. eta vs tors. theta energy: -53.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -776.325738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -776.325738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -776.325738 (E_RNA) where: Base-Base interactions energy: -444.072 where: short stacking energy: -242.653 Base-Backbone interact. energy: -2.543 local terms energy: -329.711177 where: bonds (distance) C4'-P energy: -78.118 bonds (distance) P-C4' energy: -66.475 flat angles C4'-P-C4' energy: -85.611 flat angles P-C4'-P energy: -43.268 tors. eta vs tors. theta energy: -56.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -672.874316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -672.874316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -672.874316 (E_RNA) where: Base-Base interactions energy: -398.853 where: short stacking energy: -199.082 Base-Backbone interact. energy: -1.811 local terms energy: -272.210928 where: bonds (distance) C4'-P energy: -77.492 bonds (distance) P-C4' energy: -59.874 flat angles C4'-P-C4' energy: -66.471 flat angles P-C4'-P energy: -33.608 tors. eta vs tors. theta energy: -34.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -624.737834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -624.737834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -624.737834 (E_RNA) where: Base-Base interactions energy: -368.957 where: short stacking energy: -193.577 Base-Backbone interact. energy: 0.738 local terms energy: -256.518691 where: bonds (distance) C4'-P energy: -58.038 bonds (distance) P-C4' energy: -69.170 flat angles C4'-P-C4' energy: -68.069 flat angles P-C4'-P energy: -39.729 tors. eta vs tors. theta energy: -21.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -384.129649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.129649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.129649 (E_RNA) where: Base-Base interactions energy: -163.890 where: short stacking energy: -120.383 Base-Backbone interact. energy: -1.475 local terms energy: -218.764107 where: bonds (distance) C4'-P energy: -59.752 bonds (distance) P-C4' energy: -71.701 flat angles C4'-P-C4' energy: -61.114 flat angles P-C4'-P energy: -28.619 tors. eta vs tors. theta energy: 2.422 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -1374.046465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.046465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.046465 (E_RNA) where: Base-Base interactions energy: -941.784 where: short stacking energy: -424.071 Base-Backbone interact. energy: -0.211 local terms energy: -432.051794 where: bonds (distance) C4'-P energy: -83.625 bonds (distance) P-C4' energy: -75.660 flat angles C4'-P-C4' energy: -92.495 flat angles P-C4'-P energy: -64.630 tors. eta vs tors. theta energy: -115.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -1292.183473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.183473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.183473 (E_RNA) where: Base-Base interactions energy: -882.961 where: short stacking energy: -362.972 Base-Backbone interact. energy: -2.917 local terms energy: -406.304839 where: bonds (distance) C4'-P energy: -84.357 bonds (distance) P-C4' energy: -72.990 flat angles C4'-P-C4' energy: -99.483 flat angles P-C4'-P energy: -52.966 tors. eta vs tors. theta energy: -96.510 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -1225.084770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.084770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.084770 (E_RNA) where: Base-Base interactions energy: -837.676 where: short stacking energy: -385.936 Base-Backbone interact. energy: -2.149 local terms energy: -385.260185 where: bonds (distance) C4'-P energy: -85.434 bonds (distance) P-C4' energy: -71.860 flat angles C4'-P-C4' energy: -83.297 flat angles P-C4'-P energy: -52.506 tors. eta vs tors. theta energy: -92.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -1043.111512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.111512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.111512 (E_RNA) where: Base-Base interactions energy: -675.388 where: short stacking energy: -323.416 Base-Backbone interact. energy: -1.052 local terms energy: -366.671707 where: bonds (distance) C4'-P energy: -79.221 bonds (distance) P-C4' energy: -87.198 flat angles C4'-P-C4' energy: -84.650 flat angles P-C4'-P energy: -44.432 tors. eta vs tors. theta energy: -71.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -1017.379455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.379455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.379455 (E_RNA) where: Base-Base interactions energy: -655.393 where: short stacking energy: -318.925 Base-Backbone interact. energy: -1.442 local terms energy: -360.544551 where: bonds (distance) C4'-P energy: -67.397 bonds (distance) P-C4' energy: -78.627 flat angles C4'-P-C4' energy: -82.029 flat angles P-C4'-P energy: -53.100 tors. eta vs tors. theta energy: -79.391 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -804.902136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -804.902136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -804.902136 (E_RNA) where: Base-Base interactions energy: -519.773 where: short stacking energy: -254.149 Base-Backbone interact. energy: -0.293 local terms energy: -284.835647 where: bonds (distance) C4'-P energy: -49.130 bonds (distance) P-C4' energy: -69.894 flat angles C4'-P-C4' energy: -76.542 flat angles P-C4'-P energy: -41.572 tors. eta vs tors. theta energy: -47.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -729.208743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -729.208743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -729.208743 (E_RNA) where: Base-Base interactions energy: -449.541 where: short stacking energy: -223.825 Base-Backbone interact. energy: -0.128 local terms energy: -279.540099 where: bonds (distance) C4'-P energy: -60.943 bonds (distance) P-C4' energy: -68.701 flat angles C4'-P-C4' energy: -69.990 flat angles P-C4'-P energy: -44.010 tors. eta vs tors. theta energy: -35.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -642.567194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -642.567194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -642.567194 (E_RNA) where: Base-Base interactions energy: -381.158 where: short stacking energy: -189.443 Base-Backbone interact. energy: -2.642 local terms energy: -258.767710 where: bonds (distance) C4'-P energy: -56.247 bonds (distance) P-C4' energy: -78.457 flat angles C4'-P-C4' energy: -60.936 flat angles P-C4'-P energy: -54.936 tors. eta vs tors. theta energy: -8.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -638.348799 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -638.348799 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -638.348799 (E_RNA) where: Base-Base interactions energy: -370.510 where: short stacking energy: -193.015 Base-Backbone interact. energy: 1.767 local terms energy: -269.605475 where: bonds (distance) C4'-P energy: -73.205 bonds (distance) P-C4' energy: -66.631 flat angles C4'-P-C4' energy: -70.977 flat angles P-C4'-P energy: -38.215 tors. eta vs tors. theta energy: -20.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -391.901662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.901662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.901662 (E_RNA) where: Base-Base interactions energy: -156.184 where: short stacking energy: -119.358 Base-Backbone interact. energy: 0.082 local terms energy: -235.799773 where: bonds (distance) C4'-P energy: -60.248 bonds (distance) P-C4' energy: -72.307 flat angles C4'-P-C4' energy: -64.125 flat angles P-C4'-P energy: -40.713 tors. eta vs tors. theta energy: 1.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -1363.113824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.113824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.113824 (E_RNA) where: Base-Base interactions energy: -945.529 where: short stacking energy: -421.555 Base-Backbone interact. energy: -0.938 local terms energy: -416.646711 where: bonds (distance) C4'-P energy: -77.575 bonds (distance) P-C4' energy: -76.256 flat angles C4'-P-C4' energy: -91.905 flat angles P-C4'-P energy: -59.715 tors. eta vs tors. theta energy: -111.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -1307.954220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.954220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.954220 (E_RNA) where: Base-Base interactions energy: -882.438 where: short stacking energy: -381.358 Base-Backbone interact. energy: 0.618 local terms energy: -426.133370 where: bonds (distance) C4'-P energy: -88.328 bonds (distance) P-C4' energy: -80.726 flat angles C4'-P-C4' energy: -94.664 flat angles P-C4'-P energy: -58.907 tors. eta vs tors. theta energy: -103.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -1176.664906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1176.664906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.664906 (E_RNA) where: Base-Base interactions energy: -787.701 where: short stacking energy: -352.444 Base-Backbone interact. energy: 0.124 local terms energy: -389.088213 where: bonds (distance) C4'-P energy: -73.082 bonds (distance) P-C4' energy: -88.193 flat angles C4'-P-C4' energy: -89.198 flat angles P-C4'-P energy: -57.824 tors. eta vs tors. theta energy: -80.791 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -1104.921538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.921538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.921538 (E_RNA) where: Base-Base interactions energy: -720.671 where: short stacking energy: -341.587 Base-Backbone interact. energy: -0.153 local terms energy: -384.096780 where: bonds (distance) C4'-P energy: -89.150 bonds (distance) P-C4' energy: -77.758 flat angles C4'-P-C4' energy: -85.356 flat angles P-C4'-P energy: -51.427 tors. eta vs tors. theta energy: -80.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -1004.623230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.623230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.623230 (E_RNA) where: Base-Base interactions energy: -649.784 where: short stacking energy: -284.161 Base-Backbone interact. energy: 1.043 local terms energy: -355.882771 where: bonds (distance) C4'-P energy: -84.627 bonds (distance) P-C4' energy: -79.953 flat angles C4'-P-C4' energy: -72.214 flat angles P-C4'-P energy: -56.169 tors. eta vs tors. theta energy: -62.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -862.733403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.733403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.733403 (E_RNA) where: Base-Base interactions energy: -541.223 where: short stacking energy: -270.473 Base-Backbone interact. energy: -1.739 local terms energy: -319.772066 where: bonds (distance) C4'-P energy: -72.228 bonds (distance) P-C4' energy: -70.552 flat angles C4'-P-C4' energy: -66.323 flat angles P-C4'-P energy: -58.788 tors. eta vs tors. theta energy: -51.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -785.661277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -785.661277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -785.661277 (E_RNA) where: Base-Base interactions energy: -492.213 where: short stacking energy: -242.985 Base-Backbone interact. energy: -3.723 local terms energy: -289.724806 where: bonds (distance) C4'-P energy: -66.574 bonds (distance) P-C4' energy: -66.436 flat angles C4'-P-C4' energy: -71.307 flat angles P-C4'-P energy: -41.522 tors. eta vs tors. theta energy: -43.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -720.746271 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -720.746271 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -720.746271 (E_RNA) where: Base-Base interactions energy: -427.800 where: short stacking energy: -207.066 Base-Backbone interact. energy: -2.654 local terms energy: -290.292208 where: bonds (distance) C4'-P energy: -66.224 bonds (distance) P-C4' energy: -63.070 flat angles C4'-P-C4' energy: -64.442 flat angles P-C4'-P energy: -53.582 tors. eta vs tors. theta energy: -42.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -606.277610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -606.277610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -606.277610 (E_RNA) where: Base-Base interactions energy: -352.350 where: short stacking energy: -199.383 Base-Backbone interact. energy: 1.027 local terms energy: -254.954908 where: bonds (distance) C4'-P energy: -64.315 bonds (distance) P-C4' energy: -75.369 flat angles C4'-P-C4' energy: -54.842 flat angles P-C4'-P energy: -42.114 tors. eta vs tors. theta energy: -18.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -363.614431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.614431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.614431 (E_RNA) where: Base-Base interactions energy: -162.282 where: short stacking energy: -111.965 Base-Backbone interact. energy: 2.189 local terms energy: -203.520517 where: bonds (distance) C4'-P energy: -57.211 bonds (distance) P-C4' energy: -80.599 flat angles C4'-P-C4' energy: -64.970 flat angles P-C4'-P energy: -18.259 tors. eta vs tors. theta energy: 17.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -1356.776895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1356.776895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1356.776895 (E_RNA) where: Base-Base interactions energy: -930.963 where: short stacking energy: -407.807 Base-Backbone interact. energy: -0.402 local terms energy: -425.411689 where: bonds (distance) C4'-P energy: -81.687 bonds (distance) P-C4' energy: -79.832 flat angles C4'-P-C4' energy: -90.351 flat angles P-C4'-P energy: -69.856 tors. eta vs tors. theta energy: -103.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -1323.901491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1323.901491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1323.901491 (E_RNA) where: Base-Base interactions energy: -912.656 where: short stacking energy: -403.609 Base-Backbone interact. energy: -1.638 local terms energy: -409.607597 where: bonds (distance) C4'-P energy: -78.888 bonds (distance) P-C4' energy: -84.596 flat angles C4'-P-C4' energy: -84.867 flat angles P-C4'-P energy: -56.068 tors. eta vs tors. theta energy: -105.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -1152.862139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1152.862139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1152.862139 (E_RNA) where: Base-Base interactions energy: -767.297 where: short stacking energy: -319.647 Base-Backbone interact. energy: -3.613 local terms energy: -381.951223 where: bonds (distance) C4'-P energy: -74.918 bonds (distance) P-C4' energy: -77.794 flat angles C4'-P-C4' energy: -83.385 flat angles P-C4'-P energy: -60.033 tors. eta vs tors. theta energy: -85.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -1084.447573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1084.447573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1084.447573 (E_RNA) where: Base-Base interactions energy: -698.340 where: short stacking energy: -316.192 Base-Backbone interact. energy: -2.139 local terms energy: -383.968480 where: bonds (distance) C4'-P energy: -84.109 bonds (distance) P-C4' energy: -88.173 flat angles C4'-P-C4' energy: -75.508 flat angles P-C4'-P energy: -50.892 tors. eta vs tors. theta energy: -85.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -1025.024745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.024745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.024745 (E_RNA) where: Base-Base interactions energy: -664.033 where: short stacking energy: -314.950 Base-Backbone interact. energy: -1.551 local terms energy: -359.440102 where: bonds (distance) C4'-P energy: -80.159 bonds (distance) P-C4' energy: -78.969 flat angles C4'-P-C4' energy: -86.455 flat angles P-C4'-P energy: -49.282 tors. eta vs tors. theta energy: -64.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -822.930478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.930478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.930478 (E_RNA) where: Base-Base interactions energy: -482.085 where: short stacking energy: -248.351 Base-Backbone interact. energy: -2.929 local terms energy: -337.916817 where: bonds (distance) C4'-P energy: -68.815 bonds (distance) P-C4' energy: -89.888 flat angles C4'-P-C4' energy: -81.893 flat angles P-C4'-P energy: -42.842 tors. eta vs tors. theta energy: -54.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -788.172838 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -788.172838 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -788.172838 (E_RNA) where: Base-Base interactions energy: -515.831 where: short stacking energy: -256.285 Base-Backbone interact. energy: -0.602 local terms energy: -271.739771 where: bonds (distance) C4'-P energy: -57.034 bonds (distance) P-C4' energy: -65.200 flat angles C4'-P-C4' energy: -72.557 flat angles P-C4'-P energy: -38.134 tors. eta vs tors. theta energy: -38.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -703.381615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -703.381615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -703.381615 (E_RNA) where: Base-Base interactions energy: -415.482 where: short stacking energy: -228.874 Base-Backbone interact. energy: -0.205 local terms energy: -287.693862 where: bonds (distance) C4'-P energy: -71.572 bonds (distance) P-C4' energy: -65.124 flat angles C4'-P-C4' energy: -73.682 flat angles P-C4'-P energy: -50.649 tors. eta vs tors. theta energy: -26.667 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -567.731099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -567.731099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -567.731099 (E_RNA) where: Base-Base interactions energy: -309.255 where: short stacking energy: -175.751 Base-Backbone interact. energy: -2.171 local terms energy: -256.305089 where: bonds (distance) C4'-P energy: -62.019 bonds (distance) P-C4' energy: -81.664 flat angles C4'-P-C4' energy: -52.707 flat angles P-C4'-P energy: -48.502 tors. eta vs tors. theta energy: -11.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -459.344407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.344407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.344407 (E_RNA) where: Base-Base interactions energy: -243.218 where: short stacking energy: -131.692 Base-Backbone interact. energy: -2.584 local terms energy: -213.541564 where: bonds (distance) C4'-P energy: -65.251 bonds (distance) P-C4' energy: -58.417 flat angles C4'-P-C4' energy: -61.579 flat angles P-C4'-P energy: -33.847 tors. eta vs tors. theta energy: 5.552 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -1345.877056 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.877056 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.877056 (E_RNA) where: Base-Base interactions energy: -891.913 where: short stacking energy: -414.302 Base-Backbone interact. energy: 0.623 local terms energy: -454.587546 where: bonds (distance) C4'-P energy: -93.029 bonds (distance) P-C4' energy: -92.607 flat angles C4'-P-C4' energy: -97.332 flat angles P-C4'-P energy: -54.930 tors. eta vs tors. theta energy: -116.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -1298.665449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.665449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.665449 (E_RNA) where: Base-Base interactions energy: -913.151 where: short stacking energy: -399.789 Base-Backbone interact. energy: -1.970 local terms energy: -383.544511 where: bonds (distance) C4'-P energy: -74.250 bonds (distance) P-C4' energy: -74.070 flat angles C4'-P-C4' energy: -83.572 flat angles P-C4'-P energy: -54.119 tors. eta vs tors. theta energy: -97.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -1157.177843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.177843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.177843 (E_RNA) where: Base-Base interactions energy: -769.247 where: short stacking energy: -335.457 Base-Backbone interact. energy: -0.761 local terms energy: -387.169906 where: bonds (distance) C4'-P energy: -71.680 bonds (distance) P-C4' energy: -80.130 flat angles C4'-P-C4' energy: -87.903 flat angles P-C4'-P energy: -54.636 tors. eta vs tors. theta energy: -92.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -1131.133462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.133462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.133462 (E_RNA) where: Base-Base interactions energy: -749.611 where: short stacking energy: -366.524 Base-Backbone interact. energy: -0.691 local terms energy: -380.831061 where: bonds (distance) C4'-P energy: -74.214 bonds (distance) P-C4' energy: -78.865 flat angles C4'-P-C4' energy: -86.339 flat angles P-C4'-P energy: -51.436 tors. eta vs tors. theta energy: -89.977 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -994.962472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.962472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.962472 (E_RNA) where: Base-Base interactions energy: -668.113 where: short stacking energy: -297.827 Base-Backbone interact. energy: -1.370 local terms energy: -325.479667 where: bonds (distance) C4'-P energy: -67.529 bonds (distance) P-C4' energy: -76.902 flat angles C4'-P-C4' energy: -72.211 flat angles P-C4'-P energy: -47.939 tors. eta vs tors. theta energy: -60.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -808.994135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -808.994135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -808.994135 (E_RNA) where: Base-Base interactions energy: -499.291 where: short stacking energy: -264.343 Base-Backbone interact. energy: -1.425 local terms energy: -308.278485 where: bonds (distance) C4'-P energy: -81.185 bonds (distance) P-C4' energy: -74.760 flat angles C4'-P-C4' energy: -65.360 flat angles P-C4'-P energy: -42.332 tors. eta vs tors. theta energy: -44.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -759.374582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -759.374582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -759.374582 (E_RNA) where: Base-Base interactions energy: -480.292 where: short stacking energy: -227.071 Base-Backbone interact. energy: 3.153 local terms energy: -282.235766 where: bonds (distance) C4'-P energy: -73.273 bonds (distance) P-C4' energy: -70.702 flat angles C4'-P-C4' energy: -66.640 flat angles P-C4'-P energy: -39.090 tors. eta vs tors. theta energy: -32.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -710.467448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -710.467448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -710.467448 (E_RNA) where: Base-Base interactions energy: -420.753 where: short stacking energy: -202.170 Base-Backbone interact. energy: 0.432 local terms energy: -290.146554 where: bonds (distance) C4'-P energy: -64.163 bonds (distance) P-C4' energy: -70.107 flat angles C4'-P-C4' energy: -74.030 flat angles P-C4'-P energy: -53.935 tors. eta vs tors. theta energy: -27.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -639.960054 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -639.960054 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -639.960054 (E_RNA) where: Base-Base interactions energy: -362.556 where: short stacking energy: -198.903 Base-Backbone interact. energy: 0.636 local terms energy: -278.040025 where: bonds (distance) C4'-P energy: -77.122 bonds (distance) P-C4' energy: -60.783 flat angles C4'-P-C4' energy: -65.357 flat angles P-C4'-P energy: -34.654 tors. eta vs tors. theta energy: -40.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -441.584217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.584217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.584217 (E_RNA) where: Base-Base interactions energy: -203.948 where: short stacking energy: -131.820 Base-Backbone interact. energy: -1.009 local terms energy: -236.626821 where: bonds (distance) C4'-P energy: -69.776 bonds (distance) P-C4' energy: -66.091 flat angles C4'-P-C4' energy: -54.630 flat angles P-C4'-P energy: -42.292 tors. eta vs tors. theta energy: -3.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -1397.482665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1397.482665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1397.482665 (E_RNA) where: Base-Base interactions energy: -944.874 where: short stacking energy: -415.212 Base-Backbone interact. energy: -1.228 local terms energy: -451.380968 where: bonds (distance) C4'-P energy: -86.712 bonds (distance) P-C4' energy: -89.698 flat angles C4'-P-C4' energy: -97.474 flat angles P-C4'-P energy: -65.169 tors. eta vs tors. theta energy: -112.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -1292.388299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.388299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.388299 (E_RNA) where: Base-Base interactions energy: -879.781 where: short stacking energy: -388.293 Base-Backbone interact. energy: -0.512 local terms energy: -412.095001 where: bonds (distance) C4'-P energy: -84.622 bonds (distance) P-C4' energy: -73.891 flat angles C4'-P-C4' energy: -95.530 flat angles P-C4'-P energy: -58.799 tors. eta vs tors. theta energy: -99.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -1118.444826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1118.444826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1118.444826 (E_RNA) where: Base-Base interactions energy: -730.372 where: short stacking energy: -344.341 Base-Backbone interact. energy: -0.583 local terms energy: -387.489301 where: bonds (distance) C4'-P energy: -67.398 bonds (distance) P-C4' energy: -86.866 flat angles C4'-P-C4' energy: -83.516 flat angles P-C4'-P energy: -63.339 tors. eta vs tors. theta energy: -86.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -1143.262281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.262281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.262281 (E_RNA) where: Base-Base interactions energy: -765.539 where: short stacking energy: -363.459 Base-Backbone interact. energy: 2.469 local terms energy: -380.192495 where: bonds (distance) C4'-P energy: -81.958 bonds (distance) P-C4' energy: -70.859 flat angles C4'-P-C4' energy: -83.979 flat angles P-C4'-P energy: -46.260 tors. eta vs tors. theta energy: -97.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -958.644848 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -958.644848 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -958.644848 (E_RNA) where: Base-Base interactions energy: -640.151 where: short stacking energy: -317.093 Base-Backbone interact. energy: 1.229 local terms energy: -319.723136 where: bonds (distance) C4'-P energy: -63.482 bonds (distance) P-C4' energy: -85.039 flat angles C4'-P-C4' energy: -59.862 flat angles P-C4'-P energy: -45.206 tors. eta vs tors. theta energy: -66.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -900.264358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -900.264358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -900.264358 (E_RNA) where: Base-Base interactions energy: -574.618 where: short stacking energy: -293.721 Base-Backbone interact. energy: -2.843 local terms energy: -322.803262 where: bonds (distance) C4'-P energy: -55.165 bonds (distance) P-C4' energy: -73.382 flat angles C4'-P-C4' energy: -76.021 flat angles P-C4'-P energy: -55.594 tors. eta vs tors. theta energy: -62.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -795.410414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.410414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.410414 (E_RNA) where: Base-Base interactions energy: -519.259 where: short stacking energy: -227.218 Base-Backbone interact. energy: 0.651 local terms energy: -276.803117 where: bonds (distance) C4'-P energy: -65.412 bonds (distance) P-C4' energy: -64.654 flat angles C4'-P-C4' energy: -74.057 flat angles P-C4'-P energy: -44.950 tors. eta vs tors. theta energy: -27.731 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -698.855246 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -698.855246 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -698.855246 (E_RNA) where: Base-Base interactions energy: -394.502 where: short stacking energy: -206.153 Base-Backbone interact. energy: -2.143 local terms energy: -302.210122 where: bonds (distance) C4'-P energy: -84.559 bonds (distance) P-C4' energy: -66.418 flat angles C4'-P-C4' energy: -77.304 flat angles P-C4'-P energy: -42.174 tors. eta vs tors. theta energy: -31.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -749.547569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -749.547569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -749.547569 (E_RNA) where: Base-Base interactions energy: -475.079 where: short stacking energy: -214.462 Base-Backbone interact. energy: -3.477 local terms energy: -270.991471 where: bonds (distance) C4'-P energy: -51.924 bonds (distance) P-C4' energy: -88.032 flat angles C4'-P-C4' energy: -61.399 flat angles P-C4'-P energy: -35.915 tors. eta vs tors. theta energy: -33.722 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -369.579220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.579220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.579220 (E_RNA) where: Base-Base interactions energy: -164.218 where: short stacking energy: -111.859 Base-Backbone interact. energy: -1.875 local terms energy: -203.486195 where: bonds (distance) C4'-P energy: -50.231 bonds (distance) P-C4' energy: -59.706 flat angles C4'-P-C4' energy: -58.465 flat angles P-C4'-P energy: -37.385 tors. eta vs tors. theta energy: 2.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -1409.833128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.833128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.833128 (E_RNA) where: Base-Base interactions energy: -964.041 where: short stacking energy: -412.342 Base-Backbone interact. energy: -1.405 local terms energy: -444.386666 where: bonds (distance) C4'-P energy: -88.840 bonds (distance) P-C4' energy: -85.929 flat angles C4'-P-C4' energy: -90.692 flat angles P-C4'-P energy: -65.160 tors. eta vs tors. theta energy: -113.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -1302.971776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.971776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.971776 (E_RNA) where: Base-Base interactions energy: -891.562 where: short stacking energy: -394.489 Base-Backbone interact. energy: -2.900 local terms energy: -408.509516 where: bonds (distance) C4'-P energy: -76.041 bonds (distance) P-C4' energy: -74.800 flat angles C4'-P-C4' energy: -92.371 flat angles P-C4'-P energy: -57.245 tors. eta vs tors. theta energy: -108.052 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -1117.034048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.034048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.034048 (E_RNA) where: Base-Base interactions energy: -715.672 where: short stacking energy: -342.752 Base-Backbone interact. energy: 3.153 local terms energy: -404.514666 where: bonds (distance) C4'-P energy: -83.695 bonds (distance) P-C4' energy: -90.164 flat angles C4'-P-C4' energy: -93.296 flat angles P-C4'-P energy: -51.602 tors. eta vs tors. theta energy: -85.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -1139.562516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.562516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.562516 (E_RNA) where: Base-Base interactions energy: -745.714 where: short stacking energy: -334.883 Base-Backbone interact. energy: -1.445 local terms energy: -392.403391 where: bonds (distance) C4'-P energy: -89.804 bonds (distance) P-C4' energy: -73.036 flat angles C4'-P-C4' energy: -91.740 flat angles P-C4'-P energy: -53.544 tors. eta vs tors. theta energy: -84.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -1008.134662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.134662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.134662 (E_RNA) where: Base-Base interactions energy: -648.308 where: short stacking energy: -288.954 Base-Backbone interact. energy: -0.294 local terms energy: -359.532656 where: bonds (distance) C4'-P energy: -69.481 bonds (distance) P-C4' energy: -82.089 flat angles C4'-P-C4' energy: -93.538 flat angles P-C4'-P energy: -46.608 tors. eta vs tors. theta energy: -67.817 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -881.972371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.972371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.972371 (E_RNA) where: Base-Base interactions energy: -533.255 where: short stacking energy: -282.100 Base-Backbone interact. energy: 0.518 local terms energy: -349.235484 where: bonds (distance) C4'-P energy: -83.311 bonds (distance) P-C4' energy: -68.782 flat angles C4'-P-C4' energy: -79.465 flat angles P-C4'-P energy: -57.041 tors. eta vs tors. theta energy: -60.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -845.091942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -845.091942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -845.091942 (E_RNA) where: Base-Base interactions energy: -549.016 where: short stacking energy: -244.050 Base-Backbone interact. energy: 0.690 local terms energy: -296.765339 where: bonds (distance) C4'-P energy: -71.006 bonds (distance) P-C4' energy: -70.939 flat angles C4'-P-C4' energy: -79.502 flat angles P-C4'-P energy: -47.075 tors. eta vs tors. theta energy: -28.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -781.073498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -781.073498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -781.073498 (E_RNA) where: Base-Base interactions energy: -507.383 where: short stacking energy: -254.741 Base-Backbone interact. energy: -1.266 local terms energy: -272.423887 where: bonds (distance) C4'-P energy: -57.886 bonds (distance) P-C4' energy: -67.338 flat angles C4'-P-C4' energy: -64.706 flat angles P-C4'-P energy: -41.085 tors. eta vs tors. theta energy: -41.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -704.818281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.818281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.818281 (E_RNA) where: Base-Base interactions energy: -434.719 where: short stacking energy: -228.793 Base-Backbone interact. energy: -1.343 local terms energy: -268.756028 where: bonds (distance) C4'-P energy: -52.988 bonds (distance) P-C4' energy: -74.649 flat angles C4'-P-C4' energy: -74.076 flat angles P-C4'-P energy: -33.904 tors. eta vs tors. theta energy: -33.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -422.145670 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.145670 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.145670 (E_RNA) where: Base-Base interactions energy: -190.028 where: short stacking energy: -139.568 Base-Backbone interact. energy: 5.147 local terms energy: -237.265211 where: bonds (distance) C4'-P energy: -57.419 bonds (distance) P-C4' energy: -75.903 flat angles C4'-P-C4' energy: -58.176 flat angles P-C4'-P energy: -46.260 tors. eta vs tors. theta energy: 0.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -1420.621962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.621962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.621962 (E_RNA) where: Base-Base interactions energy: -954.290 where: short stacking energy: -421.135 Base-Backbone interact. energy: -3.321 local terms energy: -463.010926 where: bonds (distance) C4'-P energy: -85.609 bonds (distance) P-C4' energy: -88.156 flat angles C4'-P-C4' energy: -96.798 flat angles P-C4'-P energy: -66.468 tors. eta vs tors. theta energy: -125.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -1299.256515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1299.256515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1299.256515 (E_RNA) where: Base-Base interactions energy: -897.585 where: short stacking energy: -401.625 Base-Backbone interact. energy: 0.124 local terms energy: -401.795214 where: bonds (distance) C4'-P energy: -71.269 bonds (distance) P-C4' energy: -85.131 flat angles C4'-P-C4' energy: -85.274 flat angles P-C4'-P energy: -56.455 tors. eta vs tors. theta energy: -103.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -1186.477532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.477532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.477532 (E_RNA) where: Base-Base interactions energy: -802.151 where: short stacking energy: -359.081 Base-Backbone interact. energy: -1.747 local terms energy: -382.579130 where: bonds (distance) C4'-P energy: -77.739 bonds (distance) P-C4' energy: -74.219 flat angles C4'-P-C4' energy: -86.168 flat angles P-C4'-P energy: -47.904 tors. eta vs tors. theta energy: -96.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -1097.562202 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1097.562202 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1097.562202 (E_RNA) where: Base-Base interactions energy: -700.795 where: short stacking energy: -327.809 Base-Backbone interact. energy: -0.771 local terms energy: -395.995568 where: bonds (distance) C4'-P energy: -85.266 bonds (distance) P-C4' energy: -78.765 flat angles C4'-P-C4' energy: -83.787 flat angles P-C4'-P energy: -62.389 tors. eta vs tors. theta energy: -85.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -1014.072008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.072008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1014.072008 (E_RNA) where: Base-Base interactions energy: -662.866 where: short stacking energy: -332.055 Base-Backbone interact. energy: 1.339 local terms energy: -352.545436 where: bonds (distance) C4'-P energy: -56.952 bonds (distance) P-C4' energy: -76.046 flat angles C4'-P-C4' energy: -93.059 flat angles P-C4'-P energy: -53.814 tors. eta vs tors. theta energy: -72.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -896.139692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.139692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.139692 (E_RNA) where: Base-Base interactions energy: -564.826 where: short stacking energy: -281.523 Base-Backbone interact. energy: -1.210 local terms energy: -330.104224 where: bonds (distance) C4'-P energy: -60.895 bonds (distance) P-C4' energy: -74.356 flat angles C4'-P-C4' energy: -82.725 flat angles P-C4'-P energy: -50.487 tors. eta vs tors. theta energy: -61.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -868.640855 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.640855 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.640855 (E_RNA) where: Base-Base interactions energy: -568.457 where: short stacking energy: -237.966 Base-Backbone interact. energy: 1.822 local terms energy: -302.006392 where: bonds (distance) C4'-P energy: -63.979 bonds (distance) P-C4' energy: -66.350 flat angles C4'-P-C4' energy: -76.009 flat angles P-C4'-P energy: -50.315 tors. eta vs tors. theta energy: -45.354 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -810.279324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -810.279324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -810.279324 (E_RNA) where: Base-Base interactions energy: -527.384 where: short stacking energy: -263.099 Base-Backbone interact. energy: -0.464 local terms energy: -282.431263 where: bonds (distance) C4'-P energy: -66.082 bonds (distance) P-C4' energy: -71.101 flat angles C4'-P-C4' energy: -73.479 flat angles P-C4'-P energy: -32.853 tors. eta vs tors. theta energy: -38.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -670.961521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -670.961521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -670.961521 (E_RNA) where: Base-Base interactions energy: -395.857 where: short stacking energy: -215.319 Base-Backbone interact. energy: 2.106 local terms energy: -277.210406 where: bonds (distance) C4'-P energy: -60.941 bonds (distance) P-C4' energy: -76.295 flat angles C4'-P-C4' energy: -68.474 flat angles P-C4'-P energy: -45.283 tors. eta vs tors. theta energy: -26.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -387.845154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.845154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.845154 (E_RNA) where: Base-Base interactions energy: -149.476 where: short stacking energy: -95.799 Base-Backbone interact. energy: 0.927 local terms energy: -239.296863 where: bonds (distance) C4'-P energy: -72.321 bonds (distance) P-C4' energy: -76.754 flat angles C4'-P-C4' energy: -60.616 flat angles P-C4'-P energy: -39.460 tors. eta vs tors. theta energy: 9.855 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -1411.621815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.621815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.621815 (E_RNA) where: Base-Base interactions energy: -957.490 where: short stacking energy: -427.858 Base-Backbone interact. energy: -0.805 local terms energy: -453.326698 where: bonds (distance) C4'-P energy: -88.363 bonds (distance) P-C4' energy: -82.485 flat angles C4'-P-C4' energy: -100.593 flat angles P-C4'-P energy: -56.388 tors. eta vs tors. theta energy: -125.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -1332.382136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.382136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.382136 (E_RNA) where: Base-Base interactions energy: -919.290 where: short stacking energy: -417.936 Base-Backbone interact. energy: -1.517 local terms energy: -411.575353 where: bonds (distance) C4'-P energy: -69.201 bonds (distance) P-C4' energy: -85.578 flat angles C4'-P-C4' energy: -85.674 flat angles P-C4'-P energy: -62.737 tors. eta vs tors. theta energy: -108.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -1183.665774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1183.665774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1183.665774 (E_RNA) where: Base-Base interactions energy: -782.496 where: short stacking energy: -339.721 Base-Backbone interact. energy: -2.834 local terms energy: -398.336089 where: bonds (distance) C4'-P energy: -85.473 bonds (distance) P-C4' energy: -79.540 flat angles C4'-P-C4' energy: -90.832 flat angles P-C4'-P energy: -54.321 tors. eta vs tors. theta energy: -88.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -1064.298852 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.298852 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.298852 (E_RNA) where: Base-Base interactions energy: -671.436 where: short stacking energy: -336.229 Base-Backbone interact. energy: 0.141 local terms energy: -393.003295 where: bonds (distance) C4'-P energy: -79.021 bonds (distance) P-C4' energy: -77.321 flat angles C4'-P-C4' energy: -91.235 flat angles P-C4'-P energy: -56.741 tors. eta vs tors. theta energy: -88.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -1019.286313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.286313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.286313 (E_RNA) where: Base-Base interactions energy: -646.588 where: short stacking energy: -291.756 Base-Backbone interact. energy: -3.007 local terms energy: -369.690974 where: bonds (distance) C4'-P energy: -83.117 bonds (distance) P-C4' energy: -80.066 flat angles C4'-P-C4' energy: -74.463 flat angles P-C4'-P energy: -58.118 tors. eta vs tors. theta energy: -73.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -917.110318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.110318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -917.110318 (E_RNA) where: Base-Base interactions energy: -581.876 where: short stacking energy: -279.158 Base-Backbone interact. energy: -1.731 local terms energy: -333.502606 where: bonds (distance) C4'-P energy: -80.676 bonds (distance) P-C4' energy: -73.625 flat angles C4'-P-C4' energy: -71.817 flat angles P-C4'-P energy: -46.851 tors. eta vs tors. theta energy: -60.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -835.360448 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.360448 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.360448 (E_RNA) where: Base-Base interactions energy: -494.515 where: short stacking energy: -266.117 Base-Backbone interact. energy: 0.449 local terms energy: -341.294120 where: bonds (distance) C4'-P energy: -72.864 bonds (distance) P-C4' energy: -71.088 flat angles C4'-P-C4' energy: -88.372 flat angles P-C4'-P energy: -53.315 tors. eta vs tors. theta energy: -55.655 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -814.642483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.642483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.642483 (E_RNA) where: Base-Base interactions energy: -528.575 where: short stacking energy: -251.170 Base-Backbone interact. energy: -1.508 local terms energy: -284.558572 where: bonds (distance) C4'-P energy: -66.343 bonds (distance) P-C4' energy: -72.133 flat angles C4'-P-C4' energy: -66.912 flat angles P-C4'-P energy: -37.209 tors. eta vs tors. theta energy: -41.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -654.684579 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -654.684579 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -654.684579 (E_RNA) where: Base-Base interactions energy: -361.533 where: short stacking energy: -188.375 Base-Backbone interact. energy: -2.623 local terms energy: -290.529005 where: bonds (distance) C4'-P energy: -71.391 bonds (distance) P-C4' energy: -64.411 flat angles C4'-P-C4' energy: -68.990 flat angles P-C4'-P energy: -44.313 tors. eta vs tors. theta energy: -41.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -426.165655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.165655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.165655 (E_RNA) where: Base-Base interactions energy: -195.037 where: short stacking energy: -128.988 Base-Backbone interact. energy: -1.041 local terms energy: -230.087194 where: bonds (distance) C4'-P energy: -78.185 bonds (distance) P-C4' energy: -66.511 flat angles C4'-P-C4' energy: -52.598 flat angles P-C4'-P energy: -28.437 tors. eta vs tors. theta energy: -4.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -1426.257710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.257710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.257710 (E_RNA) where: Base-Base interactions energy: -981.146 where: short stacking energy: -410.710 Base-Backbone interact. energy: -0.625 local terms energy: -444.487007 where: bonds (distance) C4'-P energy: -85.974 bonds (distance) P-C4' energy: -87.177 flat angles C4'-P-C4' energy: -90.806 flat angles P-C4'-P energy: -63.919 tors. eta vs tors. theta energy: -116.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -1314.732936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.732936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.732936 (E_RNA) where: Base-Base interactions energy: -891.231 where: short stacking energy: -407.147 Base-Backbone interact. energy: 0.159 local terms energy: -423.660561 where: bonds (distance) C4'-P energy: -81.633 bonds (distance) P-C4' energy: -76.356 flat angles C4'-P-C4' energy: -99.378 flat angles P-C4'-P energy: -55.310 tors. eta vs tors. theta energy: -110.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -1210.137876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1210.137876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.137876 (E_RNA) where: Base-Base interactions energy: -801.924 where: short stacking energy: -366.264 Base-Backbone interact. energy: -1.868 local terms energy: -406.346274 where: bonds (distance) C4'-P energy: -80.732 bonds (distance) P-C4' energy: -88.977 flat angles C4'-P-C4' energy: -83.449 flat angles P-C4'-P energy: -60.683 tors. eta vs tors. theta energy: -92.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -1102.303642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.303642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.303642 (E_RNA) where: Base-Base interactions energy: -707.371 where: short stacking energy: -356.919 Base-Backbone interact. energy: -0.252 local terms energy: -394.680612 where: bonds (distance) C4'-P energy: -75.876 bonds (distance) P-C4' energy: -87.223 flat angles C4'-P-C4' energy: -93.626 flat angles P-C4'-P energy: -48.685 tors. eta vs tors. theta energy: -89.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -1008.072454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1008.072454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1008.072454 (E_RNA) where: Base-Base interactions energy: -644.877 where: short stacking energy: -312.387 Base-Backbone interact. energy: 1.369 local terms energy: -364.565111 where: bonds (distance) C4'-P energy: -91.323 bonds (distance) P-C4' energy: -78.178 flat angles C4'-P-C4' energy: -79.115 flat angles P-C4'-P energy: -48.687 tors. eta vs tors. theta energy: -67.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -1029.295536 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.295536 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.295536 (E_RNA) where: Base-Base interactions energy: -683.472 where: short stacking energy: -309.650 Base-Backbone interact. energy: -0.368 local terms energy: -345.456191 where: bonds (distance) C4'-P energy: -73.054 bonds (distance) P-C4' energy: -71.318 flat angles C4'-P-C4' energy: -65.606 flat angles P-C4'-P energy: -61.021 tors. eta vs tors. theta energy: -74.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -835.941638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -835.941638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -835.941638 (E_RNA) where: Base-Base interactions energy: -500.000 where: short stacking energy: -262.422 Base-Backbone interact. energy: -0.489 local terms energy: -335.452374 where: bonds (distance) C4'-P energy: -77.720 bonds (distance) P-C4' energy: -66.800 flat angles C4'-P-C4' energy: -80.994 flat angles P-C4'-P energy: -46.962 tors. eta vs tors. theta energy: -62.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -826.394577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -826.394577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -826.394577 (E_RNA) where: Base-Base interactions energy: -517.037 where: short stacking energy: -244.634 Base-Backbone interact. energy: -0.985 local terms energy: -308.372353 where: bonds (distance) C4'-P energy: -71.740 bonds (distance) P-C4' energy: -60.504 flat angles C4'-P-C4' energy: -67.667 flat angles P-C4'-P energy: -58.248 tors. eta vs tors. theta energy: -50.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -611.770109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -611.770109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -611.770109 (E_RNA) where: Base-Base interactions energy: -321.561 where: short stacking energy: -156.180 Base-Backbone interact. energy: -2.700 local terms energy: -287.509150 where: bonds (distance) C4'-P energy: -64.347 bonds (distance) P-C4' energy: -88.531 flat angles C4'-P-C4' energy: -75.543 flat angles P-C4'-P energy: -46.254 tors. eta vs tors. theta energy: -12.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -428.226294 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.226294 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.226294 (E_RNA) where: Base-Base interactions energy: -227.698 where: short stacking energy: -134.199 Base-Backbone interact. energy: -0.328 local terms energy: -200.199622 where: bonds (distance) C4'-P energy: -62.006 bonds (distance) P-C4' energy: -72.839 flat angles C4'-P-C4' energy: -62.357 flat angles P-C4'-P energy: -13.104 tors. eta vs tors. theta energy: 10.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -1417.871118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.871118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.871118 (E_RNA) where: Base-Base interactions energy: -967.655 where: short stacking energy: -414.774 Base-Backbone interact. energy: -1.700 local terms energy: -448.516806 where: bonds (distance) C4'-P energy: -81.323 bonds (distance) P-C4' energy: -85.990 flat angles C4'-P-C4' energy: -105.055 flat angles P-C4'-P energy: -57.303 tors. eta vs tors. theta energy: -118.846 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -1352.489266 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.489266 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.489266 (E_RNA) where: Base-Base interactions energy: -923.062 where: short stacking energy: -417.351 Base-Backbone interact. energy: -0.130 local terms energy: -429.297302 where: bonds (distance) C4'-P energy: -76.695 bonds (distance) P-C4' energy: -92.152 flat angles C4'-P-C4' energy: -88.760 flat angles P-C4'-P energy: -56.695 tors. eta vs tors. theta energy: -114.995 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -1197.236062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.236062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.236062 (E_RNA) where: Base-Base interactions energy: -804.566 where: short stacking energy: -374.261 Base-Backbone interact. energy: -2.841 local terms energy: -389.828641 where: bonds (distance) C4'-P energy: -75.629 bonds (distance) P-C4' energy: -76.052 flat angles C4'-P-C4' energy: -80.744 flat angles P-C4'-P energy: -53.884 tors. eta vs tors. theta energy: -103.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -1090.805412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.805412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.805412 (E_RNA) where: Base-Base interactions energy: -741.267 where: short stacking energy: -339.973 Base-Backbone interact. energy: -0.262 local terms energy: -349.276004 where: bonds (distance) C4'-P energy: -70.785 bonds (distance) P-C4' energy: -73.427 flat angles C4'-P-C4' energy: -79.418 flat angles P-C4'-P energy: -56.303 tors. eta vs tors. theta energy: -69.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -1090.496314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.496314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.496314 (E_RNA) where: Base-Base interactions energy: -730.137 where: short stacking energy: -335.377 Base-Backbone interact. energy: 0.408 local terms energy: -360.767150 where: bonds (distance) C4'-P energy: -73.452 bonds (distance) P-C4' energy: -68.790 flat angles C4'-P-C4' energy: -86.901 flat angles P-C4'-P energy: -48.416 tors. eta vs tors. theta energy: -83.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -1037.544489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1037.544489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1037.544489 (E_RNA) where: Base-Base interactions energy: -712.264 where: short stacking energy: -304.476 Base-Backbone interact. energy: -2.382 local terms energy: -322.898914 where: bonds (distance) C4'-P energy: -62.466 bonds (distance) P-C4' energy: -79.072 flat angles C4'-P-C4' energy: -77.296 flat angles P-C4'-P energy: -39.681 tors. eta vs tors. theta energy: -64.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -825.543586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.543586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -825.543586 (E_RNA) where: Base-Base interactions energy: -524.313 where: short stacking energy: -256.952 Base-Backbone interact. energy: -0.525 local terms energy: -300.705637 where: bonds (distance) C4'-P energy: -64.028 bonds (distance) P-C4' energy: -67.647 flat angles C4'-P-C4' energy: -80.532 flat angles P-C4'-P energy: -50.410 tors. eta vs tors. theta energy: -38.087 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -815.033804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -815.033804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -815.033804 (E_RNA) where: Base-Base interactions energy: -513.278 where: short stacking energy: -260.864 Base-Backbone interact. energy: 2.320 local terms energy: -304.075578 where: bonds (distance) C4'-P energy: -78.533 bonds (distance) P-C4' energy: -63.920 flat angles C4'-P-C4' energy: -71.494 flat angles P-C4'-P energy: -40.484 tors. eta vs tors. theta energy: -49.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -636.103829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -636.103829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -636.103829 (E_RNA) where: Base-Base interactions energy: -343.785 where: short stacking energy: -169.908 Base-Backbone interact. energy: -1.826 local terms energy: -290.492791 where: bonds (distance) C4'-P energy: -73.036 bonds (distance) P-C4' energy: -74.354 flat angles C4'-P-C4' energy: -80.584 flat angles P-C4'-P energy: -44.871 tors. eta vs tors. theta energy: -17.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -461.313669 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.313669 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.313669 (E_RNA) where: Base-Base interactions energy: -220.360 where: short stacking energy: -144.741 Base-Backbone interact. energy: 0.600 local terms energy: -241.554422 where: bonds (distance) C4'-P energy: -59.707 bonds (distance) P-C4' energy: -72.957 flat angles C4'-P-C4' energy: -60.172 flat angles P-C4'-P energy: -42.620 tors. eta vs tors. theta energy: -6.099 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -1421.985627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.985627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.985627 (E_RNA) where: Base-Base interactions energy: -991.369 where: short stacking energy: -424.472 Base-Backbone interact. energy: -1.739 local terms energy: -428.876795 where: bonds (distance) C4'-P energy: -77.666 bonds (distance) P-C4' energy: -89.258 flat angles C4'-P-C4' energy: -88.481 flat angles P-C4'-P energy: -57.565 tors. eta vs tors. theta energy: -115.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -1324.463950 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.463950 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.463950 (E_RNA) where: Base-Base interactions energy: -894.564 where: short stacking energy: -400.972 Base-Backbone interact. energy: -3.759 local terms energy: -426.141096 where: bonds (distance) C4'-P energy: -80.374 bonds (distance) P-C4' energy: -86.349 flat angles C4'-P-C4' energy: -98.610 flat angles P-C4'-P energy: -50.046 tors. eta vs tors. theta energy: -110.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -1195.766213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1195.766213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1195.766213 (E_RNA) where: Base-Base interactions energy: -798.807 where: short stacking energy: -375.705 Base-Backbone interact. energy: -0.215 local terms energy: -396.743932 where: bonds (distance) C4'-P energy: -75.470 bonds (distance) P-C4' energy: -84.661 flat angles C4'-P-C4' energy: -86.864 flat angles P-C4'-P energy: -55.439 tors. eta vs tors. theta energy: -94.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -1059.136144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.136144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.136144 (E_RNA) where: Base-Base interactions energy: -706.338 where: short stacking energy: -323.210 Base-Backbone interact. energy: 2.902 local terms energy: -355.700183 where: bonds (distance) C4'-P energy: -82.970 bonds (distance) P-C4' energy: -77.563 flat angles C4'-P-C4' energy: -79.307 flat angles P-C4'-P energy: -50.067 tors. eta vs tors. theta energy: -65.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -1129.062137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.062137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1129.062137 (E_RNA) where: Base-Base interactions energy: -750.106 where: short stacking energy: -337.904 Base-Backbone interact. energy: 1.316 local terms energy: -380.272088 where: bonds (distance) C4'-P energy: -81.977 bonds (distance) P-C4' energy: -78.189 flat angles C4'-P-C4' energy: -87.377 flat angles P-C4'-P energy: -44.866 tors. eta vs tors. theta energy: -87.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -1051.100111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1051.100111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.100111 (E_RNA) where: Base-Base interactions energy: -721.690 where: short stacking energy: -298.513 Base-Backbone interact. energy: -2.663 local terms energy: -326.747262 where: bonds (distance) C4'-P energy: -66.349 bonds (distance) P-C4' energy: -77.789 flat angles C4'-P-C4' energy: -83.156 flat angles P-C4'-P energy: -43.496 tors. eta vs tors. theta energy: -55.958 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -780.587528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.587528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.587528 (E_RNA) where: Base-Base interactions energy: -476.507 where: short stacking energy: -244.630 Base-Backbone interact. energy: -1.921 local terms energy: -302.158948 where: bonds (distance) C4'-P energy: -75.971 bonds (distance) P-C4' energy: -63.205 flat angles C4'-P-C4' energy: -81.699 flat angles P-C4'-P energy: -35.306 tors. eta vs tors. theta energy: -45.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -780.421267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -780.421267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -780.421267 (E_RNA) where: Base-Base interactions energy: -494.845 where: short stacking energy: -229.267 Base-Backbone interact. energy: 1.536 local terms energy: -287.111771 where: bonds (distance) C4'-P energy: -66.983 bonds (distance) P-C4' energy: -70.727 flat angles C4'-P-C4' energy: -76.761 flat angles P-C4'-P energy: -42.481 tors. eta vs tors. theta energy: -30.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -680.210222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -680.210222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -680.210222 (E_RNA) where: Base-Base interactions energy: -398.465 where: short stacking energy: -187.631 Base-Backbone interact. energy: -0.667 local terms energy: -281.078348 where: bonds (distance) C4'-P energy: -67.714 bonds (distance) P-C4' energy: -67.091 flat angles C4'-P-C4' energy: -68.242 flat angles P-C4'-P energy: -49.812 tors. eta vs tors. theta energy: -28.220 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -456.940302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.940302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.940302 (E_RNA) where: Base-Base interactions energy: -227.462 where: short stacking energy: -123.282 Base-Backbone interact. energy: -2.493 local terms energy: -226.985481 where: bonds (distance) C4'-P energy: -59.200 bonds (distance) P-C4' energy: -74.706 flat angles C4'-P-C4' energy: -71.436 flat angles P-C4'-P energy: -28.280 tors. eta vs tors. theta energy: 6.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -1433.878455 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.878455 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.878455 (E_RNA) where: Base-Base interactions energy: -978.431 where: short stacking energy: -426.383 Base-Backbone interact. energy: -2.255 local terms energy: -453.192650 where: bonds (distance) C4'-P energy: -82.996 bonds (distance) P-C4' energy: -99.143 flat angles C4'-P-C4' energy: -90.913 flat angles P-C4'-P energy: -66.624 tors. eta vs tors. theta energy: -113.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -1334.064208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.064208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.064208 (E_RNA) where: Base-Base interactions energy: -910.874 where: short stacking energy: -412.638 Base-Backbone interact. energy: -2.026 local terms energy: -421.163972 where: bonds (distance) C4'-P energy: -78.693 bonds (distance) P-C4' energy: -80.298 flat angles C4'-P-C4' energy: -91.253 flat angles P-C4'-P energy: -55.634 tors. eta vs tors. theta energy: -115.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -1193.877092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.877092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.877092 (E_RNA) where: Base-Base interactions energy: -814.446 where: short stacking energy: -359.981 Base-Backbone interact. energy: -2.194 local terms energy: -377.236170 where: bonds (distance) C4'-P energy: -70.942 bonds (distance) P-C4' energy: -94.482 flat angles C4'-P-C4' energy: -73.761 flat angles P-C4'-P energy: -47.930 tors. eta vs tors. theta energy: -90.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -1188.014302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1188.014302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1188.014302 (E_RNA) where: Base-Base interactions energy: -768.824 where: short stacking energy: -356.247 Base-Backbone interact. energy: -1.242 local terms energy: -417.947915 where: bonds (distance) C4'-P energy: -82.993 bonds (distance) P-C4' energy: -84.919 flat angles C4'-P-C4' energy: -87.731 flat angles P-C4'-P energy: -63.981 tors. eta vs tors. theta energy: -98.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -1018.455927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1018.455927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1018.455927 (E_RNA) where: Base-Base interactions energy: -655.995 where: short stacking energy: -306.739 Base-Backbone interact. energy: -0.943 local terms energy: -361.518445 where: bonds (distance) C4'-P energy: -77.384 bonds (distance) P-C4' energy: -83.906 flat angles C4'-P-C4' energy: -78.811 flat angles P-C4'-P energy: -50.299 tors. eta vs tors. theta energy: -71.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -1088.330653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.330653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.330653 (E_RNA) where: Base-Base interactions energy: -732.955 where: short stacking energy: -333.066 Base-Backbone interact. energy: -0.131 local terms energy: -355.244769 where: bonds (distance) C4'-P energy: -64.438 bonds (distance) P-C4' energy: -77.968 flat angles C4'-P-C4' energy: -80.373 flat angles P-C4'-P energy: -57.328 tors. eta vs tors. theta energy: -75.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -812.067309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.067309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.067309 (E_RNA) where: Base-Base interactions energy: -522.266 where: short stacking energy: -256.086 Base-Backbone interact. energy: 2.205 local terms energy: -292.005959 where: bonds (distance) C4'-P energy: -67.081 bonds (distance) P-C4' energy: -68.987 flat angles C4'-P-C4' energy: -52.991 flat angles P-C4'-P energy: -46.044 tors. eta vs tors. theta energy: -56.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -724.349376 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -724.349376 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -724.349376 (E_RNA) where: Base-Base interactions energy: -454.310 where: short stacking energy: -212.799 Base-Backbone interact. energy: 1.112 local terms energy: -271.151033 where: bonds (distance) C4'-P energy: -60.906 bonds (distance) P-C4' energy: -83.487 flat angles C4'-P-C4' energy: -50.307 flat angles P-C4'-P energy: -44.667 tors. eta vs tors. theta energy: -31.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -685.540887 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -685.540887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -685.540887 (E_RNA) where: Base-Base interactions energy: -404.179 where: short stacking energy: -198.542 Base-Backbone interact. energy: -1.195 local terms energy: -280.167071 where: bonds (distance) C4'-P energy: -64.850 bonds (distance) P-C4' energy: -70.511 flat angles C4'-P-C4' energy: -70.955 flat angles P-C4'-P energy: -48.591 tors. eta vs tors. theta energy: -25.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -434.358589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.358589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.358589 (E_RNA) where: Base-Base interactions energy: -206.321 where: short stacking energy: -119.405 Base-Backbone interact. energy: -1.147 local terms energy: -226.890749 where: bonds (distance) C4'-P energy: -68.339 bonds (distance) P-C4' energy: -81.950 flat angles C4'-P-C4' energy: -66.452 flat angles P-C4'-P energy: -15.362 tors. eta vs tors. theta energy: 5.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -1445.304052 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.304052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.304052 (E_RNA) where: Base-Base interactions energy: -986.429 where: short stacking energy: -408.301 Base-Backbone interact. energy: -1.874 local terms energy: -457.001746 where: bonds (distance) C4'-P energy: -90.220 bonds (distance) P-C4' energy: -90.513 flat angles C4'-P-C4' energy: -96.279 flat angles P-C4'-P energy: -61.359 tors. eta vs tors. theta energy: -118.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -1355.783489 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1355.783489 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1355.783489 (E_RNA) where: Base-Base interactions energy: -935.061 where: short stacking energy: -398.711 Base-Backbone interact. energy: -1.547 local terms energy: -419.176071 where: bonds (distance) C4'-P energy: -75.489 bonds (distance) P-C4' energy: -89.568 flat angles C4'-P-C4' energy: -97.965 flat angles P-C4'-P energy: -49.563 tors. eta vs tors. theta energy: -106.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -1216.759314 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1216.759314 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.759314 (E_RNA) where: Base-Base interactions energy: -834.155 where: short stacking energy: -360.315 Base-Backbone interact. energy: -0.845 local terms energy: -381.759160 where: bonds (distance) C4'-P energy: -76.800 bonds (distance) P-C4' energy: -88.087 flat angles C4'-P-C4' energy: -78.095 flat angles P-C4'-P energy: -53.407 tors. eta vs tors. theta energy: -85.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -1170.646816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1170.646816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.646816 (E_RNA) where: Base-Base interactions energy: -778.041 where: short stacking energy: -365.179 Base-Backbone interact. energy: 0.744 local terms energy: -393.349736 where: bonds (distance) C4'-P energy: -63.734 bonds (distance) P-C4' energy: -82.473 flat angles C4'-P-C4' energy: -87.065 flat angles P-C4'-P energy: -63.995 tors. eta vs tors. theta energy: -96.083 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -1173.622522 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.622522 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.622522 (E_RNA) where: Base-Base interactions energy: -777.976 where: short stacking energy: -351.931 Base-Backbone interact. energy: 3.145 local terms energy: -398.791907 where: bonds (distance) C4'-P energy: -80.991 bonds (distance) P-C4' energy: -78.986 flat angles C4'-P-C4' energy: -86.184 flat angles P-C4'-P energy: -60.147 tors. eta vs tors. theta energy: -92.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -974.275794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -974.275794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -974.275794 (E_RNA) where: Base-Base interactions energy: -645.968 where: short stacking energy: -301.610 Base-Backbone interact. energy: -0.475 local terms energy: -327.832039 where: bonds (distance) C4'-P energy: -76.742 bonds (distance) P-C4' energy: -69.858 flat angles C4'-P-C4' energy: -75.868 flat angles P-C4'-P energy: -39.074 tors. eta vs tors. theta energy: -66.289 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -834.963224 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.963224 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.963224 (E_RNA) where: Base-Base interactions energy: -491.276 where: short stacking energy: -240.676 Base-Backbone interact. energy: -1.014 local terms energy: -342.673892 where: bonds (distance) C4'-P energy: -72.202 bonds (distance) P-C4' energy: -78.839 flat angles C4'-P-C4' energy: -68.381 flat angles P-C4'-P energy: -58.681 tors. eta vs tors. theta energy: -64.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -714.047185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -714.047185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -714.047185 (E_RNA) where: Base-Base interactions energy: -420.342 where: short stacking energy: -230.000 Base-Backbone interact. energy: -0.547 local terms energy: -293.157202 where: bonds (distance) C4'-P energy: -63.907 bonds (distance) P-C4' energy: -70.363 flat angles C4'-P-C4' energy: -73.402 flat angles P-C4'-P energy: -49.593 tors. eta vs tors. theta energy: -35.892 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -851.008828 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.008828 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.008828 (E_RNA) where: Base-Base interactions energy: -565.668 where: short stacking energy: -259.570 Base-Backbone interact. energy: -1.704 local terms energy: -283.636299 where: bonds (distance) C4'-P energy: -53.607 bonds (distance) P-C4' energy: -65.122 flat angles C4'-P-C4' energy: -71.521 flat angles P-C4'-P energy: -33.963 tors. eta vs tors. theta energy: -59.423 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -426.064001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.064001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.064001 (E_RNA) where: Base-Base interactions energy: -215.007 where: short stacking energy: -135.711 Base-Backbone interact. energy: -0.163 local terms energy: -210.893906 where: bonds (distance) C4'-P energy: -74.897 bonds (distance) P-C4' energy: -68.877 flat angles C4'-P-C4' energy: -53.914 flat angles P-C4'-P energy: -19.687 tors. eta vs tors. theta energy: 6.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -1432.224627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.224627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.224627 (E_RNA) where: Base-Base interactions energy: -999.007 where: short stacking energy: -439.730 Base-Backbone interact. energy: -2.806 local terms energy: -430.412048 where: bonds (distance) C4'-P energy: -87.388 bonds (distance) P-C4' energy: -77.771 flat angles C4'-P-C4' energy: -93.501 flat angles P-C4'-P energy: -56.303 tors. eta vs tors. theta energy: -115.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -1328.992769 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.992769 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.992769 (E_RNA) where: Base-Base interactions energy: -906.030 where: short stacking energy: -402.995 Base-Backbone interact. energy: 2.088 local terms energy: -425.051076 where: bonds (distance) C4'-P energy: -79.802 bonds (distance) P-C4' energy: -79.407 flat angles C4'-P-C4' energy: -94.356 flat angles P-C4'-P energy: -61.275 tors. eta vs tors. theta energy: -110.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -1213.433031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.433031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.433031 (E_RNA) where: Base-Base interactions energy: -814.547 where: short stacking energy: -352.127 Base-Backbone interact. energy: -2.865 local terms energy: -396.021581 where: bonds (distance) C4'-P energy: -84.948 bonds (distance) P-C4' energy: -82.550 flat angles C4'-P-C4' energy: -81.259 flat angles P-C4'-P energy: -62.799 tors. eta vs tors. theta energy: -84.466 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -1141.041297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1141.041297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1141.041297 (E_RNA) where: Base-Base interactions energy: -755.221 where: short stacking energy: -351.024 Base-Backbone interact. energy: -3.378 local terms energy: -382.442408 where: bonds (distance) C4'-P energy: -68.311 bonds (distance) P-C4' energy: -77.292 flat angles C4'-P-C4' energy: -83.195 flat angles P-C4'-P energy: -57.326 tors. eta vs tors. theta energy: -96.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -1131.283593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.283593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.283593 (E_RNA) where: Base-Base interactions energy: -770.756 where: short stacking energy: -330.363 Base-Backbone interact. energy: 0.459 local terms energy: -360.987047 where: bonds (distance) C4'-P energy: -81.987 bonds (distance) P-C4' energy: -82.349 flat angles C4'-P-C4' energy: -88.956 flat angles P-C4'-P energy: -40.919 tors. eta vs tors. theta energy: -66.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -965.076753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -965.076753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -965.076753 (E_RNA) where: Base-Base interactions energy: -629.761 where: short stacking energy: -319.594 Base-Backbone interact. energy: -1.247 local terms energy: -334.068294 where: bonds (distance) C4'-P energy: -62.494 bonds (distance) P-C4' energy: -70.164 flat angles C4'-P-C4' energy: -87.454 flat angles P-C4'-P energy: -47.061 tors. eta vs tors. theta energy: -66.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -831.539088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.539088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.539088 (E_RNA) where: Base-Base interactions energy: -501.535 where: short stacking energy: -253.000 Base-Backbone interact. energy: -1.459 local terms energy: -328.544784 where: bonds (distance) C4'-P energy: -72.465 bonds (distance) P-C4' energy: -78.695 flat angles C4'-P-C4' energy: -81.876 flat angles P-C4'-P energy: -41.704 tors. eta vs tors. theta energy: -53.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -887.431456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -887.431456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -887.431456 (E_RNA) where: Base-Base interactions energy: -560.694 where: short stacking energy: -274.013 Base-Backbone interact. energy: -1.195 local terms energy: -325.543110 where: bonds (distance) C4'-P energy: -75.162 bonds (distance) P-C4' energy: -83.521 flat angles C4'-P-C4' energy: -69.387 flat angles P-C4'-P energy: -41.929 tors. eta vs tors. theta energy: -55.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -694.369059 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -694.369059 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -694.369059 (E_RNA) where: Base-Base interactions energy: -419.661 where: short stacking energy: -195.624 Base-Backbone interact. energy: -0.087 local terms energy: -274.620240 where: bonds (distance) C4'-P energy: -51.987 bonds (distance) P-C4' energy: -80.574 flat angles C4'-P-C4' energy: -62.036 flat angles P-C4'-P energy: -50.148 tors. eta vs tors. theta energy: -29.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -409.499829 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.499829 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.499829 (E_RNA) where: Base-Base interactions energy: -202.589 where: short stacking energy: -102.964 Base-Backbone interact. energy: -1.309 local terms energy: -205.601834 where: bonds (distance) C4'-P energy: -55.159 bonds (distance) P-C4' energy: -76.201 flat angles C4'-P-C4' energy: -58.859 flat angles P-C4'-P energy: -35.722 tors. eta vs tors. theta energy: 20.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -1466.352795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.352795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.352795 (E_RNA) where: Base-Base interactions energy: -1032.828 where: short stacking energy: -430.966 Base-Backbone interact. energy: -2.110 local terms energy: -431.415022 where: bonds (distance) C4'-P energy: -84.348 bonds (distance) P-C4' energy: -85.262 flat angles C4'-P-C4' energy: -87.055 flat angles P-C4'-P energy: -63.878 tors. eta vs tors. theta energy: -110.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -1326.533873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.533873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1326.533873 (E_RNA) where: Base-Base interactions energy: -909.105 where: short stacking energy: -404.355 Base-Backbone interact. energy: 0.212 local terms energy: -417.640761 where: bonds (distance) C4'-P energy: -86.726 bonds (distance) P-C4' energy: -87.476 flat angles C4'-P-C4' energy: -81.478 flat angles P-C4'-P energy: -54.343 tors. eta vs tors. theta energy: -107.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -1207.062305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.062305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.062305 (E_RNA) where: Base-Base interactions energy: -825.105 where: short stacking energy: -355.396 Base-Backbone interact. energy: -1.103 local terms energy: -380.854521 where: bonds (distance) C4'-P energy: -72.398 bonds (distance) P-C4' energy: -88.885 flat angles C4'-P-C4' energy: -79.491 flat angles P-C4'-P energy: -57.423 tors. eta vs tors. theta energy: -82.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -1162.500270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.500270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.500270 (E_RNA) where: Base-Base interactions energy: -745.696 where: short stacking energy: -354.398 Base-Backbone interact. energy: -0.698 local terms energy: -416.105687 where: bonds (distance) C4'-P energy: -80.946 bonds (distance) P-C4' energy: -91.343 flat angles C4'-P-C4' energy: -88.850 flat angles P-C4'-P energy: -61.704 tors. eta vs tors. theta energy: -93.263 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -1184.252392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1184.252392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1184.252392 (E_RNA) where: Base-Base interactions energy: -800.596 where: short stacking energy: -350.352 Base-Backbone interact. energy: -3.778 local terms energy: -379.878512 where: bonds (distance) C4'-P energy: -79.973 bonds (distance) P-C4' energy: -72.417 flat angles C4'-P-C4' energy: -87.087 flat angles P-C4'-P energy: -55.130 tors. eta vs tors. theta energy: -85.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -962.023932 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -962.023932 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -962.023932 (E_RNA) where: Base-Base interactions energy: -640.549 where: short stacking energy: -286.632 Base-Backbone interact. energy: -0.674 local terms energy: -320.800410 where: bonds (distance) C4'-P energy: -64.045 bonds (distance) P-C4' energy: -72.486 flat angles C4'-P-C4' energy: -69.501 flat angles P-C4'-P energy: -54.885 tors. eta vs tors. theta energy: -59.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -897.314309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.314309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.314309 (E_RNA) where: Base-Base interactions energy: -553.202 where: short stacking energy: -266.615 Base-Backbone interact. energy: -1.606 local terms energy: -342.506355 where: bonds (distance) C4'-P energy: -69.860 bonds (distance) P-C4' energy: -70.902 flat angles C4'-P-C4' energy: -88.779 flat angles P-C4'-P energy: -58.220 tors. eta vs tors. theta energy: -54.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -813.330642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -813.330642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -813.330642 (E_RNA) where: Base-Base interactions energy: -506.544 where: short stacking energy: -239.595 Base-Backbone interact. energy: 0.685 local terms energy: -307.472019 where: bonds (distance) C4'-P energy: -76.256 bonds (distance) P-C4' energy: -78.108 flat angles C4'-P-C4' energy: -60.825 flat angles P-C4'-P energy: -46.069 tors. eta vs tors. theta energy: -46.214 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -731.522286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -731.522286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -731.522286 (E_RNA) where: Base-Base interactions energy: -444.187 where: short stacking energy: -217.608 Base-Backbone interact. energy: 3.700 local terms energy: -291.034809 where: bonds (distance) C4'-P energy: -72.708 bonds (distance) P-C4' energy: -76.335 flat angles C4'-P-C4' energy: -59.246 flat angles P-C4'-P energy: -42.770 tors. eta vs tors. theta energy: -39.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -467.498988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.498988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.498988 (E_RNA) where: Base-Base interactions energy: -234.319 where: short stacking energy: -147.724 Base-Backbone interact. energy: 0.331 local terms energy: -233.510677 where: bonds (distance) C4'-P energy: -61.917 bonds (distance) P-C4' energy: -66.369 flat angles C4'-P-C4' energy: -65.972 flat angles P-C4'-P energy: -34.128 tors. eta vs tors. theta energy: -5.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -1454.154890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.154890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.154890 (E_RNA) where: Base-Base interactions energy: -1015.236 where: short stacking energy: -442.859 Base-Backbone interact. energy: -2.160 local terms energy: -436.759137 where: bonds (distance) C4'-P energy: -81.996 bonds (distance) P-C4' energy: -82.633 flat angles C4'-P-C4' energy: -92.516 flat angles P-C4'-P energy: -64.600 tors. eta vs tors. theta energy: -115.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -1319.323564 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1319.323564 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1319.323564 (E_RNA) where: Base-Base interactions energy: -904.497 where: short stacking energy: -391.331 Base-Backbone interact. energy: -1.988 local terms energy: -412.837943 where: bonds (distance) C4'-P energy: -71.646 bonds (distance) P-C4' energy: -87.275 flat angles C4'-P-C4' energy: -90.288 flat angles P-C4'-P energy: -57.250 tors. eta vs tors. theta energy: -106.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -1242.286008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.286008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.286008 (E_RNA) where: Base-Base interactions energy: -855.907 where: short stacking energy: -344.016 Base-Backbone interact. energy: 2.506 local terms energy: -388.884887 where: bonds (distance) C4'-P energy: -72.748 bonds (distance) P-C4' energy: -83.995 flat angles C4'-P-C4' energy: -83.840 flat angles P-C4'-P energy: -59.840 tors. eta vs tors. theta energy: -88.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -1236.134280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1236.134280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1236.134280 (E_RNA) where: Base-Base interactions energy: -841.905 where: short stacking energy: -347.755 Base-Backbone interact. energy: -0.284 local terms energy: -393.945867 where: bonds (distance) C4'-P energy: -81.881 bonds (distance) P-C4' energy: -88.945 flat angles C4'-P-C4' energy: -85.878 flat angles P-C4'-P energy: -51.664 tors. eta vs tors. theta energy: -85.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -1139.306386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1139.306386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1139.306386 (E_RNA) where: Base-Base interactions energy: -756.742 where: short stacking energy: -355.689 Base-Backbone interact. energy: -1.825 local terms energy: -380.739712 where: bonds (distance) C4'-P energy: -72.885 bonds (distance) P-C4' energy: -82.587 flat angles C4'-P-C4' energy: -85.294 flat angles P-C4'-P energy: -48.655 tors. eta vs tors. theta energy: -91.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -939.556466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.556466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.556466 (E_RNA) where: Base-Base interactions energy: -615.342 where: short stacking energy: -287.971 Base-Backbone interact. energy: -1.289 local terms energy: -322.925802 where: bonds (distance) C4'-P energy: -72.698 bonds (distance) P-C4' energy: -77.885 flat angles C4'-P-C4' energy: -69.866 flat angles P-C4'-P energy: -51.811 tors. eta vs tors. theta energy: -50.665 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -897.428175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.428175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.428175 (E_RNA) where: Base-Base interactions energy: -581.656 where: short stacking energy: -263.431 Base-Backbone interact. energy: 0.837 local terms energy: -316.608546 where: bonds (distance) C4'-P energy: -62.642 bonds (distance) P-C4' energy: -78.885 flat angles C4'-P-C4' energy: -72.775 flat angles P-C4'-P energy: -53.198 tors. eta vs tors. theta energy: -49.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -783.166797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -783.166797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -783.166797 (E_RNA) where: Base-Base interactions energy: -469.056 where: short stacking energy: -221.396 Base-Backbone interact. energy: -1.849 local terms energy: -312.261766 where: bonds (distance) C4'-P energy: -83.434 bonds (distance) P-C4' energy: -61.508 flat angles C4'-P-C4' energy: -78.617 flat angles P-C4'-P energy: -36.192 tors. eta vs tors. theta energy: -52.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -709.303179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -709.303179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -709.303179 (E_RNA) where: Base-Base interactions energy: -421.156 where: short stacking energy: -199.208 Base-Backbone interact. energy: -3.485 local terms energy: -284.661638 where: bonds (distance) C4'-P energy: -79.639 bonds (distance) P-C4' energy: -64.721 flat angles C4'-P-C4' energy: -63.022 flat angles P-C4'-P energy: -44.654 tors. eta vs tors. theta energy: -32.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -384.083158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.083158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.083158 (E_RNA) where: Base-Base interactions energy: -184.436 where: short stacking energy: -124.591 Base-Backbone interact. energy: 2.154 local terms energy: -201.801387 where: bonds (distance) C4'-P energy: -51.590 bonds (distance) P-C4' energy: -58.031 flat angles C4'-P-C4' energy: -56.146 flat angles P-C4'-P energy: -45.130 tors. eta vs tors. theta energy: 9.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -1449.186630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.186630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.186630 (E_RNA) where: Base-Base interactions energy: -994.514 where: short stacking energy: -426.241 Base-Backbone interact. energy: 0.734 local terms energy: -455.406517 where: bonds (distance) C4'-P energy: -84.806 bonds (distance) P-C4' energy: -89.435 flat angles C4'-P-C4' energy: -96.048 flat angles P-C4'-P energy: -62.553 tors. eta vs tors. theta energy: -122.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -1333.449172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.449172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.449172 (E_RNA) where: Base-Base interactions energy: -920.733 where: short stacking energy: -398.928 Base-Backbone interact. energy: -2.021 local terms energy: -410.694917 where: bonds (distance) C4'-P energy: -81.560 bonds (distance) P-C4' energy: -85.559 flat angles C4'-P-C4' energy: -81.936 flat angles P-C4'-P energy: -46.306 tors. eta vs tors. theta energy: -115.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -1259.826738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.826738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.826738 (E_RNA) where: Base-Base interactions energy: -864.595 where: short stacking energy: -386.356 Base-Backbone interact. energy: -2.704 local terms energy: -392.527591 where: bonds (distance) C4'-P energy: -66.772 bonds (distance) P-C4' energy: -82.480 flat angles C4'-P-C4' energy: -91.692 flat angles P-C4'-P energy: -51.043 tors. eta vs tors. theta energy: -100.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -1215.824689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.824689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.824689 (E_RNA) where: Base-Base interactions energy: -850.197 where: short stacking energy: -344.078 Base-Backbone interact. energy: -0.571 local terms energy: -365.057429 where: bonds (distance) C4'-P energy: -74.701 bonds (distance) P-C4' energy: -88.714 flat angles C4'-P-C4' energy: -84.824 flat angles P-C4'-P energy: -38.411 tors. eta vs tors. theta energy: -78.407 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -1169.885882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.885882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.885882 (E_RNA) where: Base-Base interactions energy: -805.011 where: short stacking energy: -372.904 Base-Backbone interact. energy: -0.840 local terms energy: -364.034269 where: bonds (distance) C4'-P energy: -75.050 bonds (distance) P-C4' energy: -71.976 flat angles C4'-P-C4' energy: -84.139 flat angles P-C4'-P energy: -37.671 tors. eta vs tors. theta energy: -95.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -1043.939545 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.939545 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.939545 (E_RNA) where: Base-Base interactions energy: -694.405 where: short stacking energy: -313.748 Base-Backbone interact. energy: -0.621 local terms energy: -348.913912 where: bonds (distance) C4'-P energy: -72.426 bonds (distance) P-C4' energy: -73.503 flat angles C4'-P-C4' energy: -82.588 flat angles P-C4'-P energy: -51.827 tors. eta vs tors. theta energy: -68.570 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -862.599751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.599751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.599751 (E_RNA) where: Base-Base interactions energy: -553.551 where: short stacking energy: -257.618 Base-Backbone interact. energy: -0.158 local terms energy: -308.891077 where: bonds (distance) C4'-P energy: -61.171 bonds (distance) P-C4' energy: -76.591 flat angles C4'-P-C4' energy: -77.462 flat angles P-C4'-P energy: -38.017 tors. eta vs tors. theta energy: -55.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -848.206194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.206194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.206194 (E_RNA) where: Base-Base interactions energy: -539.723 where: short stacking energy: -254.459 Base-Backbone interact. energy: -1.313 local terms energy: -307.169676 where: bonds (distance) C4'-P energy: -68.974 bonds (distance) P-C4' energy: -70.512 flat angles C4'-P-C4' energy: -74.916 flat angles P-C4'-P energy: -41.274 tors. eta vs tors. theta energy: -51.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -691.938637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -691.938637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -691.938637 (E_RNA) where: Base-Base interactions energy: -426.922 where: short stacking energy: -221.797 Base-Backbone interact. energy: 1.092 local terms energy: -266.109307 where: bonds (distance) C4'-P energy: -47.988 bonds (distance) P-C4' energy: -75.063 flat angles C4'-P-C4' energy: -70.680 flat angles P-C4'-P energy: -35.629 tors. eta vs tors. theta energy: -36.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -360.112385 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.112385 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.112385 (E_RNA) where: Base-Base interactions energy: -116.796 where: short stacking energy: -106.540 Base-Backbone interact. energy: 2.538 local terms energy: -245.854231 where: bonds (distance) C4'-P energy: -73.584 bonds (distance) P-C4' energy: -80.960 flat angles C4'-P-C4' energy: -59.899 flat angles P-C4'-P energy: -41.712 tors. eta vs tors. theta energy: 10.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -1445.188409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1445.188409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1445.188409 (E_RNA) where: Base-Base interactions energy: -1001.035 where: short stacking energy: -447.573 Base-Backbone interact. energy: 1.912 local terms energy: -446.065215 where: bonds (distance) C4'-P energy: -84.300 bonds (distance) P-C4' energy: -88.251 flat angles C4'-P-C4' energy: -94.353 flat angles P-C4'-P energy: -59.425 tors. eta vs tors. theta energy: -119.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -1339.862518 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.862518 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.862518 (E_RNA) where: Base-Base interactions energy: -927.178 where: short stacking energy: -398.103 Base-Backbone interact. energy: 0.426 local terms energy: -413.110623 where: bonds (distance) C4'-P energy: -83.046 bonds (distance) P-C4' energy: -76.462 flat angles C4'-P-C4' energy: -86.650 flat angles P-C4'-P energy: -58.014 tors. eta vs tors. theta energy: -108.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -1249.017780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.017780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1249.017780 (E_RNA) where: Base-Base interactions energy: -828.537 where: short stacking energy: -349.370 Base-Backbone interact. energy: -3.764 local terms energy: -416.716601 where: bonds (distance) C4'-P energy: -78.007 bonds (distance) P-C4' energy: -87.279 flat angles C4'-P-C4' energy: -98.875 flat angles P-C4'-P energy: -57.708 tors. eta vs tors. theta energy: -94.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -1226.665208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1226.665208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1226.665208 (E_RNA) where: Base-Base interactions energy: -844.925 where: short stacking energy: -340.195 Base-Backbone interact. energy: -3.081 local terms energy: -378.658964 where: bonds (distance) C4'-P energy: -67.241 bonds (distance) P-C4' energy: -83.110 flat angles C4'-P-C4' energy: -91.443 flat angles P-C4'-P energy: -50.730 tors. eta vs tors. theta energy: -86.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -1161.835948 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1161.835948 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.835948 (E_RNA) where: Base-Base interactions energy: -768.860 where: short stacking energy: -361.584 Base-Backbone interact. energy: 0.593 local terms energy: -393.569174 where: bonds (distance) C4'-P energy: -75.044 bonds (distance) P-C4' energy: -88.890 flat angles C4'-P-C4' energy: -95.064 flat angles P-C4'-P energy: -35.563 tors. eta vs tors. theta energy: -99.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -1029.270699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1029.270699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1029.270699 (E_RNA) where: Base-Base interactions energy: -687.466 where: short stacking energy: -318.482 Base-Backbone interact. energy: -0.443 local terms energy: -341.361795 where: bonds (distance) C4'-P energy: -64.381 bonds (distance) P-C4' energy: -63.263 flat angles C4'-P-C4' energy: -84.982 flat angles P-C4'-P energy: -62.365 tors. eta vs tors. theta energy: -66.371 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -920.350894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.350894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.350894 (E_RNA) where: Base-Base interactions energy: -588.447 where: short stacking energy: -281.357 Base-Backbone interact. energy: -0.795 local terms energy: -331.109449 where: bonds (distance) C4'-P energy: -60.296 bonds (distance) P-C4' energy: -77.124 flat angles C4'-P-C4' energy: -75.996 flat angles P-C4'-P energy: -55.343 tors. eta vs tors. theta energy: -62.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -790.558958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -790.558958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -790.558958 (E_RNA) where: Base-Base interactions energy: -485.467 where: short stacking energy: -251.647 Base-Backbone interact. energy: -2.017 local terms energy: -303.075460 where: bonds (distance) C4'-P energy: -56.619 bonds (distance) P-C4' energy: -73.051 flat angles C4'-P-C4' energy: -68.854 flat angles P-C4'-P energy: -50.265 tors. eta vs tors. theta energy: -54.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -688.308711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -688.308711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -688.308711 (E_RNA) where: Base-Base interactions energy: -426.378 where: short stacking energy: -206.105 Base-Backbone interact. energy: -2.165 local terms energy: -259.765886 where: bonds (distance) C4'-P energy: -66.191 bonds (distance) P-C4' energy: -68.267 flat angles C4'-P-C4' energy: -66.739 flat angles P-C4'-P energy: -34.943 tors. eta vs tors. theta energy: -23.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -366.132444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.132444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.132444 (E_RNA) where: Base-Base interactions energy: -141.129 where: short stacking energy: -92.097 Base-Backbone interact. energy: -2.343 local terms energy: -222.660274 where: bonds (distance) C4'-P energy: -73.349 bonds (distance) P-C4' energy: -83.529 flat angles C4'-P-C4' energy: -61.324 flat angles P-C4'-P energy: -26.441 tors. eta vs tors. theta energy: 21.983 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -1449.150973 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.150973 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.150973 (E_RNA) where: Base-Base interactions energy: -992.561 where: short stacking energy: -424.669 Base-Backbone interact. energy: -2.707 local terms energy: -453.883166 where: bonds (distance) C4'-P energy: -91.432 bonds (distance) P-C4' energy: -89.188 flat angles C4'-P-C4' energy: -95.241 flat angles P-C4'-P energy: -61.496 tors. eta vs tors. theta energy: -116.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -1328.573629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1328.573629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1328.573629 (E_RNA) where: Base-Base interactions energy: -906.271 where: short stacking energy: -380.143 Base-Backbone interact. energy: -2.259 local terms energy: -420.044191 where: bonds (distance) C4'-P energy: -96.536 bonds (distance) P-C4' energy: -88.571 flat angles C4'-P-C4' energy: -90.399 flat angles P-C4'-P energy: -41.988 tors. eta vs tors. theta energy: -102.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -1259.440252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1259.440252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1259.440252 (E_RNA) where: Base-Base interactions energy: -858.237 where: short stacking energy: -376.735 Base-Backbone interact. energy: -0.965 local terms energy: -400.237999 where: bonds (distance) C4'-P energy: -73.519 bonds (distance) P-C4' energy: -80.530 flat angles C4'-P-C4' energy: -89.517 flat angles P-C4'-P energy: -65.198 tors. eta vs tors. theta energy: -91.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -1217.902378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1217.902378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1217.902378 (E_RNA) where: Base-Base interactions energy: -836.741 where: short stacking energy: -345.186 Base-Backbone interact. energy: -2.857 local terms energy: -378.304913 where: bonds (distance) C4'-P energy: -70.684 bonds (distance) P-C4' energy: -74.737 flat angles C4'-P-C4' energy: -87.636 flat angles P-C4'-P energy: -57.830 tors. eta vs tors. theta energy: -87.418 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -1187.992474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.992474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.992474 (E_RNA) where: Base-Base interactions energy: -795.029 where: short stacking energy: -360.969 Base-Backbone interact. energy: -1.116 local terms energy: -391.847871 where: bonds (distance) C4'-P energy: -77.050 bonds (distance) P-C4' energy: -78.118 flat angles C4'-P-C4' energy: -87.649 flat angles P-C4'-P energy: -53.929 tors. eta vs tors. theta energy: -95.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -1030.545645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.545645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.545645 (E_RNA) where: Base-Base interactions energy: -694.617 where: short stacking energy: -309.846 Base-Backbone interact. energy: -2.571 local terms energy: -333.357324 where: bonds (distance) C4'-P energy: -67.525 bonds (distance) P-C4' energy: -78.716 flat angles C4'-P-C4' energy: -79.628 flat angles P-C4'-P energy: -48.587 tors. eta vs tors. theta energy: -58.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -925.246700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.246700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.246700 (E_RNA) where: Base-Base interactions energy: -588.039 where: short stacking energy: -280.295 Base-Backbone interact. energy: -1.971 local terms energy: -335.236143 where: bonds (distance) C4'-P energy: -76.655 bonds (distance) P-C4' energy: -76.487 flat angles C4'-P-C4' energy: -75.844 flat angles P-C4'-P energy: -37.387 tors. eta vs tors. theta energy: -68.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -832.472935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.472935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.472935 (E_RNA) where: Base-Base interactions energy: -548.399 where: short stacking energy: -240.298 Base-Backbone interact. energy: -1.902 local terms energy: -282.171663 where: bonds (distance) C4'-P energy: -68.608 bonds (distance) P-C4' energy: -63.459 flat angles C4'-P-C4' energy: -71.673 flat angles P-C4'-P energy: -39.633 tors. eta vs tors. theta energy: -38.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -704.344758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -704.344758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -704.344758 (E_RNA) where: Base-Base interactions energy: -423.230 where: short stacking energy: -206.874 Base-Backbone interact. energy: -0.458 local terms energy: -280.656597 where: bonds (distance) C4'-P energy: -74.482 bonds (distance) P-C4' energy: -80.795 flat angles C4'-P-C4' energy: -69.325 flat angles P-C4'-P energy: -29.442 tors. eta vs tors. theta energy: -26.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -370.693329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.693329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.693329 (E_RNA) where: Base-Base interactions energy: -142.242 where: short stacking energy: -104.752 Base-Backbone interact. energy: -0.894 local terms energy: -227.557901 where: bonds (distance) C4'-P energy: -65.002 bonds (distance) P-C4' energy: -73.018 flat angles C4'-P-C4' energy: -66.294 flat angles P-C4'-P energy: -40.037 tors. eta vs tors. theta energy: 16.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -1453.094492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1453.094492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1453.094492 (E_RNA) where: Base-Base interactions energy: -1003.185 where: short stacking energy: -444.470 Base-Backbone interact. energy: -2.708 local terms energy: -447.202249 where: bonds (distance) C4'-P energy: -68.256 bonds (distance) P-C4' energy: -92.138 flat angles C4'-P-C4' energy: -101.849 flat angles P-C4'-P energy: -58.755 tors. eta vs tors. theta energy: -126.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -1352.047188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1352.047188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1352.047188 (E_RNA) where: Base-Base interactions energy: -941.633 where: short stacking energy: -411.596 Base-Backbone interact. energy: -1.197 local terms energy: -409.216677 where: bonds (distance) C4'-P energy: -73.368 bonds (distance) P-C4' energy: -78.367 flat angles C4'-P-C4' energy: -90.977 flat angles P-C4'-P energy: -52.176 tors. eta vs tors. theta energy: -114.329 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -1283.148325 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.148325 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.148325 (E_RNA) where: Base-Base interactions energy: -893.665 where: short stacking energy: -397.489 Base-Backbone interact. energy: -0.294 local terms energy: -389.188839 where: bonds (distance) C4'-P energy: -70.984 bonds (distance) P-C4' energy: -74.586 flat angles C4'-P-C4' energy: -93.152 flat angles P-C4'-P energy: -58.105 tors. eta vs tors. theta energy: -92.361 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -1213.936249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.936249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.936249 (E_RNA) where: Base-Base interactions energy: -825.336 where: short stacking energy: -343.324 Base-Backbone interact. energy: -1.806 local terms energy: -386.794434 where: bonds (distance) C4'-P energy: -81.980 bonds (distance) P-C4' energy: -87.558 flat angles C4'-P-C4' energy: -82.470 flat angles P-C4'-P energy: -54.286 tors. eta vs tors. theta energy: -80.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -1194.003990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.003990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.003990 (E_RNA) where: Base-Base interactions energy: -833.151 where: short stacking energy: -360.345 Base-Backbone interact. energy: 0.721 local terms energy: -361.573624 where: bonds (distance) C4'-P energy: -71.634 bonds (distance) P-C4' energy: -76.124 flat angles C4'-P-C4' energy: -75.194 flat angles P-C4'-P energy: -52.781 tors. eta vs tors. theta energy: -85.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -1063.068253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1063.068253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1063.068253 (E_RNA) where: Base-Base interactions energy: -705.370 where: short stacking energy: -295.723 Base-Backbone interact. energy: -0.392 local terms energy: -357.306660 where: bonds (distance) C4'-P energy: -72.373 bonds (distance) P-C4' energy: -80.729 flat angles C4'-P-C4' energy: -86.007 flat angles P-C4'-P energy: -58.291 tors. eta vs tors. theta energy: -59.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -925.840965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -925.840965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -925.840965 (E_RNA) where: Base-Base interactions energy: -598.498 where: short stacking energy: -278.791 Base-Backbone interact. energy: 0.164 local terms energy: -327.506813 where: bonds (distance) C4'-P energy: -75.547 bonds (distance) P-C4' energy: -69.283 flat angles C4'-P-C4' energy: -68.105 flat angles P-C4'-P energy: -50.675 tors. eta vs tors. theta energy: -63.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -766.993937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.993937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.993937 (E_RNA) where: Base-Base interactions energy: -461.544 where: short stacking energy: -208.592 Base-Backbone interact. energy: 1.690 local terms energy: -307.140100 where: bonds (distance) C4'-P energy: -62.543 bonds (distance) P-C4' energy: -97.005 flat angles C4'-P-C4' energy: -76.189 flat angles P-C4'-P energy: -34.448 tors. eta vs tors. theta energy: -36.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -778.221087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.221087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.221087 (E_RNA) where: Base-Base interactions energy: -495.656 where: short stacking energy: -215.344 Base-Backbone interact. energy: -0.130 local terms energy: -282.434307 where: bonds (distance) C4'-P energy: -59.665 bonds (distance) P-C4' energy: -85.149 flat angles C4'-P-C4' energy: -73.519 flat angles P-C4'-P energy: -32.442 tors. eta vs tors. theta energy: -31.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -350.299063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.299063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.299063 (E_RNA) where: Base-Base interactions energy: -129.992 where: short stacking energy: -114.147 Base-Backbone interact. energy: -0.974 local terms energy: -219.332401 where: bonds (distance) C4'-P energy: -68.205 bonds (distance) P-C4' energy: -76.066 flat angles C4'-P-C4' energy: -59.405 flat angles P-C4'-P energy: -26.232 tors. eta vs tors. theta energy: 10.576 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -1443.061975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1443.061975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1443.061975 (E_RNA) where: Base-Base interactions energy: -979.599 where: short stacking energy: -419.796 Base-Backbone interact. energy: -0.954 local terms energy: -462.509279 where: bonds (distance) C4'-P energy: -89.944 bonds (distance) P-C4' energy: -85.931 flat angles C4'-P-C4' energy: -97.132 flat angles P-C4'-P energy: -67.848 tors. eta vs tors. theta energy: -121.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -1357.123207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.123207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.123207 (E_RNA) where: Base-Base interactions energy: -935.221 where: short stacking energy: -417.444 Base-Backbone interact. energy: -3.016 local terms energy: -418.886345 where: bonds (distance) C4'-P energy: -85.965 bonds (distance) P-C4' energy: -86.502 flat angles C4'-P-C4' energy: -86.898 flat angles P-C4'-P energy: -46.849 tors. eta vs tors. theta energy: -112.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -1266.740731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.740731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.740731 (E_RNA) where: Base-Base interactions energy: -862.860 where: short stacking energy: -383.114 Base-Backbone interact. energy: -1.831 local terms energy: -402.050299 where: bonds (distance) C4'-P energy: -71.045 bonds (distance) P-C4' energy: -93.751 flat angles C4'-P-C4' energy: -83.166 flat angles P-C4'-P energy: -58.226 tors. eta vs tors. theta energy: -95.863 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -1168.800134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.800134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.800134 (E_RNA) where: Base-Base interactions energy: -794.505 where: short stacking energy: -352.986 Base-Backbone interact. energy: -2.534 local terms energy: -371.762079 where: bonds (distance) C4'-P energy: -73.525 bonds (distance) P-C4' energy: -80.763 flat angles C4'-P-C4' energy: -77.466 flat angles P-C4'-P energy: -55.397 tors. eta vs tors. theta energy: -84.611 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -1178.585724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.585724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1178.585724 (E_RNA) where: Base-Base interactions energy: -807.340 where: short stacking energy: -361.275 Base-Backbone interact. energy: -1.192 local terms energy: -370.053673 where: bonds (distance) C4'-P energy: -65.027 bonds (distance) P-C4' energy: -81.694 flat angles C4'-P-C4' energy: -88.226 flat angles P-C4'-P energy: -48.123 tors. eta vs tors. theta energy: -86.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -1046.722047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1046.722047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1046.722047 (E_RNA) where: Base-Base interactions energy: -686.679 where: short stacking energy: -300.857 Base-Backbone interact. energy: 1.401 local terms energy: -361.443481 where: bonds (distance) C4'-P energy: -80.940 bonds (distance) P-C4' energy: -81.618 flat angles C4'-P-C4' energy: -78.648 flat angles P-C4'-P energy: -53.126 tors. eta vs tors. theta energy: -67.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -950.772717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -950.772717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -950.772717 (E_RNA) where: Base-Base interactions energy: -602.959 where: short stacking energy: -271.825 Base-Backbone interact. energy: 0.887 local terms energy: -348.700120 where: bonds (distance) C4'-P energy: -71.619 bonds (distance) P-C4' energy: -79.701 flat angles C4'-P-C4' energy: -88.826 flat angles P-C4'-P energy: -56.709 tors. eta vs tors. theta energy: -51.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -775.066970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -775.066970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -775.066970 (E_RNA) where: Base-Base interactions energy: -470.115 where: short stacking energy: -217.921 Base-Backbone interact. energy: 1.663 local terms energy: -306.614866 where: bonds (distance) C4'-P energy: -64.642 bonds (distance) P-C4' energy: -78.426 flat angles C4'-P-C4' energy: -83.681 flat angles P-C4'-P energy: -39.820 tors. eta vs tors. theta energy: -40.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -802.263821 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -802.263821 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -802.263821 (E_RNA) where: Base-Base interactions energy: -512.183 where: short stacking energy: -234.411 Base-Backbone interact. energy: -2.072 local terms energy: -288.009622 where: bonds (distance) C4'-P energy: -66.905 bonds (distance) P-C4' energy: -74.543 flat angles C4'-P-C4' energy: -70.336 flat angles P-C4'-P energy: -42.264 tors. eta vs tors. theta energy: -33.961 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -339.007027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.007027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.007027 (E_RNA) where: Base-Base interactions energy: -121.011 where: short stacking energy: -104.732 Base-Backbone interact. energy: -3.400 local terms energy: -214.596115 where: bonds (distance) C4'-P energy: -69.442 bonds (distance) P-C4' energy: -75.756 flat angles C4'-P-C4' energy: -38.462 flat angles P-C4'-P energy: -33.686 tors. eta vs tors. theta energy: 2.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -1448.701409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.701409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.701409 (E_RNA) where: Base-Base interactions energy: -1014.538 where: short stacking energy: -428.959 Base-Backbone interact. energy: -4.356 local terms energy: -429.806886 where: bonds (distance) C4'-P energy: -90.508 bonds (distance) P-C4' energy: -79.877 flat angles C4'-P-C4' energy: -94.805 flat angles P-C4'-P energy: -49.672 tors. eta vs tors. theta energy: -114.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -1343.045908 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1343.045908 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1343.045908 (E_RNA) where: Base-Base interactions energy: -912.293 where: short stacking energy: -409.949 Base-Backbone interact. energy: -1.127 local terms energy: -429.625311 where: bonds (distance) C4'-P energy: -87.760 bonds (distance) P-C4' energy: -84.831 flat angles C4'-P-C4' energy: -93.574 flat angles P-C4'-P energy: -51.682 tors. eta vs tors. theta energy: -111.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -1300.082615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.082615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.082615 (E_RNA) where: Base-Base interactions energy: -900.736 where: short stacking energy: -405.532 Base-Backbone interact. energy: -0.222 local terms energy: -399.124122 where: bonds (distance) C4'-P energy: -75.448 bonds (distance) P-C4' energy: -79.838 flat angles C4'-P-C4' energy: -87.487 flat angles P-C4'-P energy: -57.297 tors. eta vs tors. theta energy: -99.054 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -1203.173400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.173400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1203.173400 (E_RNA) where: Base-Base interactions energy: -796.504 where: short stacking energy: -351.417 Base-Backbone interact. energy: -1.558 local terms energy: -405.111264 where: bonds (distance) C4'-P energy: -82.845 bonds (distance) P-C4' energy: -81.115 flat angles C4'-P-C4' energy: -90.806 flat angles P-C4'-P energy: -58.454 tors. eta vs tors. theta energy: -91.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -1165.137546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1165.137546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1165.137546 (E_RNA) where: Base-Base interactions energy: -812.327 where: short stacking energy: -336.481 Base-Backbone interact. energy: -1.069 local terms energy: -351.741754 where: bonds (distance) C4'-P energy: -70.449 bonds (distance) P-C4' energy: -76.325 flat angles C4'-P-C4' energy: -77.929 flat angles P-C4'-P energy: -45.590 tors. eta vs tors. theta energy: -81.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -1040.307490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1040.307490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1040.307490 (E_RNA) where: Base-Base interactions energy: -694.648 where: short stacking energy: -291.571 Base-Backbone interact. energy: -1.066 local terms energy: -344.592845 where: bonds (distance) C4'-P energy: -69.797 bonds (distance) P-C4' energy: -94.188 flat angles C4'-P-C4' energy: -70.664 flat angles P-C4'-P energy: -49.920 tors. eta vs tors. theta energy: -60.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -896.136397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.136397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.136397 (E_RNA) where: Base-Base interactions energy: -585.808 where: short stacking energy: -256.559 Base-Backbone interact. energy: 0.814 local terms energy: -311.141687 where: bonds (distance) C4'-P energy: -73.798 bonds (distance) P-C4' energy: -75.224 flat angles C4'-P-C4' energy: -71.708 flat angles P-C4'-P energy: -52.660 tors. eta vs tors. theta energy: -37.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -879.452952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.452952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.452952 (E_RNA) where: Base-Base interactions energy: -561.098 where: short stacking energy: -279.989 Base-Backbone interact. energy: -2.978 local terms energy: -315.376097 where: bonds (distance) C4'-P energy: -72.817 bonds (distance) P-C4' energy: -79.490 flat angles C4'-P-C4' energy: -63.587 flat angles P-C4'-P energy: -33.958 tors. eta vs tors. theta energy: -65.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -768.646475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -768.646475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -768.646475 (E_RNA) where: Base-Base interactions energy: -476.932 where: short stacking energy: -210.405 Base-Backbone interact. energy: -2.617 local terms energy: -289.097319 where: bonds (distance) C4'-P energy: -70.194 bonds (distance) P-C4' energy: -66.302 flat angles C4'-P-C4' energy: -62.237 flat angles P-C4'-P energy: -44.436 tors. eta vs tors. theta energy: -45.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -358.086959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.086959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.086959 (E_RNA) where: Base-Base interactions energy: -124.134 where: short stacking energy: -114.285 Base-Backbone interact. energy: -1.055 local terms energy: -232.896997 where: bonds (distance) C4'-P energy: -58.969 bonds (distance) P-C4' energy: -74.964 flat angles C4'-P-C4' energy: -55.959 flat angles P-C4'-P energy: -44.198 tors. eta vs tors. theta energy: 1.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -1462.082568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.082568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1462.082568 (E_RNA) where: Base-Base interactions energy: -1010.667 where: short stacking energy: -428.209 Base-Backbone interact. energy: 0.989 local terms energy: -452.404854 where: bonds (distance) C4'-P energy: -87.047 bonds (distance) P-C4' energy: -89.807 flat angles C4'-P-C4' energy: -88.370 flat angles P-C4'-P energy: -64.865 tors. eta vs tors. theta energy: -122.316 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -1339.180893 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.180893 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.180893 (E_RNA) where: Base-Base interactions energy: -909.028 where: short stacking energy: -401.340 Base-Backbone interact. energy: -1.301 local terms energy: -428.851551 where: bonds (distance) C4'-P energy: -92.255 bonds (distance) P-C4' energy: -83.659 flat angles C4'-P-C4' energy: -90.619 flat angles P-C4'-P energy: -58.107 tors. eta vs tors. theta energy: -104.213 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -1314.114040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.114040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.114040 (E_RNA) where: Base-Base interactions energy: -891.161 where: short stacking energy: -386.702 Base-Backbone interact. energy: -3.939 local terms energy: -419.013292 where: bonds (distance) C4'-P energy: -78.577 bonds (distance) P-C4' energy: -72.128 flat angles C4'-P-C4' energy: -92.749 flat angles P-C4'-P energy: -65.092 tors. eta vs tors. theta energy: -110.467 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -1231.995024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1231.995024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1231.995024 (E_RNA) where: Base-Base interactions energy: -835.164 where: short stacking energy: -384.281 Base-Backbone interact. energy: -2.080 local terms energy: -394.751259 where: bonds (distance) C4'-P energy: -65.576 bonds (distance) P-C4' energy: -76.659 flat angles C4'-P-C4' energy: -90.644 flat angles P-C4'-P energy: -59.669 tors. eta vs tors. theta energy: -102.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -1124.750032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1124.750032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1124.750032 (E_RNA) where: Base-Base interactions energy: -752.186 where: short stacking energy: -328.253 Base-Backbone interact. energy: -1.551 local terms energy: -371.012786 where: bonds (distance) C4'-P energy: -76.173 bonds (distance) P-C4' energy: -80.243 flat angles C4'-P-C4' energy: -68.421 flat angles P-C4'-P energy: -65.138 tors. eta vs tors. theta energy: -81.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -1035.191392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1035.191392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1035.191392 (E_RNA) where: Base-Base interactions energy: -701.471 where: short stacking energy: -308.670 Base-Backbone interact. energy: -1.733 local terms energy: -331.987907 where: bonds (distance) C4'-P energy: -78.065 bonds (distance) P-C4' energy: -72.735 flat angles C4'-P-C4' energy: -75.782 flat angles P-C4'-P energy: -39.775 tors. eta vs tors. theta energy: -65.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -964.811863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.811863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.811863 (E_RNA) where: Base-Base interactions energy: -598.181 where: short stacking energy: -274.029 Base-Backbone interact. energy: -1.054 local terms energy: -365.576226 where: bonds (distance) C4'-P energy: -80.572 bonds (distance) P-C4' energy: -80.867 flat angles C4'-P-C4' energy: -86.059 flat angles P-C4'-P energy: -61.235 tors. eta vs tors. theta energy: -56.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -872.526786 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -872.526786 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -872.526786 (E_RNA) where: Base-Base interactions energy: -550.618 where: short stacking energy: -251.748 Base-Backbone interact. energy: -1.658 local terms energy: -320.250718 where: bonds (distance) C4'-P energy: -67.857 bonds (distance) P-C4' energy: -74.889 flat angles C4'-P-C4' energy: -76.940 flat angles P-C4'-P energy: -49.797 tors. eta vs tors. theta energy: -50.768 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -792.439475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -792.439475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.439475 (E_RNA) where: Base-Base interactions energy: -522.746 where: short stacking energy: -248.776 Base-Backbone interact. energy: 0.357 local terms energy: -270.050029 where: bonds (distance) C4'-P energy: -54.046 bonds (distance) P-C4' energy: -71.401 flat angles C4'-P-C4' energy: -63.880 flat angles P-C4'-P energy: -32.855 tors. eta vs tors. theta energy: -47.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -383.767756 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.767756 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.767756 (E_RNA) where: Base-Base interactions energy: -154.082 where: short stacking energy: -128.190 Base-Backbone interact. energy: 1.825 local terms energy: -231.510692 where: bonds (distance) C4'-P energy: -63.751 bonds (distance) P-C4' energy: -66.570 flat angles C4'-P-C4' energy: -51.704 flat angles P-C4'-P energy: -33.802 tors. eta vs tors. theta energy: -15.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -1465.976168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.976168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.976168 (E_RNA) where: Base-Base interactions energy: -1023.959 where: short stacking energy: -428.015 Base-Backbone interact. energy: -2.534 local terms energy: -439.484097 where: bonds (distance) C4'-P energy: -84.429 bonds (distance) P-C4' energy: -84.631 flat angles C4'-P-C4' energy: -92.848 flat angles P-C4'-P energy: -60.445 tors. eta vs tors. theta energy: -117.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -1359.897183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.897183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.897183 (E_RNA) where: Base-Base interactions energy: -940.862 where: short stacking energy: -410.671 Base-Backbone interact. energy: -1.604 local terms energy: -417.431168 where: bonds (distance) C4'-P energy: -75.286 bonds (distance) P-C4' energy: -89.776 flat angles C4'-P-C4' energy: -89.138 flat angles P-C4'-P energy: -50.082 tors. eta vs tors. theta energy: -113.150 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -1322.547924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1322.547924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1322.547924 (E_RNA) where: Base-Base interactions energy: -902.052 where: short stacking energy: -374.329 Base-Backbone interact. energy: -3.134 local terms energy: -417.362090 where: bonds (distance) C4'-P energy: -82.245 bonds (distance) P-C4' energy: -79.991 flat angles C4'-P-C4' energy: -86.679 flat angles P-C4'-P energy: -62.758 tors. eta vs tors. theta energy: -105.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -1191.669585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.669585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.669585 (E_RNA) where: Base-Base interactions energy: -775.514 where: short stacking energy: -366.522 Base-Backbone interact. energy: -2.872 local terms energy: -413.283262 where: bonds (distance) C4'-P energy: -75.269 bonds (distance) P-C4' energy: -87.605 flat angles C4'-P-C4' energy: -91.248 flat angles P-C4'-P energy: -59.045 tors. eta vs tors. theta energy: -100.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -1181.421199 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.421199 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1181.421199 (E_RNA) where: Base-Base interactions energy: -807.898 where: short stacking energy: -349.331 Base-Backbone interact. energy: -0.663 local terms energy: -372.860211 where: bonds (distance) C4'-P energy: -82.843 bonds (distance) P-C4' energy: -73.980 flat angles C4'-P-C4' energy: -77.391 flat angles P-C4'-P energy: -58.313 tors. eta vs tors. theta energy: -80.333 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -1030.105660 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1030.105660 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1030.105660 (E_RNA) where: Base-Base interactions energy: -679.494 where: short stacking energy: -309.753 Base-Backbone interact. energy: 0.299 local terms energy: -350.909907 where: bonds (distance) C4'-P energy: -69.448 bonds (distance) P-C4' energy: -75.556 flat angles C4'-P-C4' energy: -79.936 flat angles P-C4'-P energy: -47.598 tors. eta vs tors. theta energy: -78.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -1017.288553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.288553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.288553 (E_RNA) where: Base-Base interactions energy: -690.178 where: short stacking energy: -297.118 Base-Backbone interact. energy: 3.620 local terms energy: -330.730164 where: bonds (distance) C4'-P energy: -68.349 bonds (distance) P-C4' energy: -66.374 flat angles C4'-P-C4' energy: -72.881 flat angles P-C4'-P energy: -52.576 tors. eta vs tors. theta energy: -70.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -861.456213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.456213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.456213 (E_RNA) where: Base-Base interactions energy: -551.619 where: short stacking energy: -260.101 Base-Backbone interact. energy: -2.610 local terms energy: -307.226677 where: bonds (distance) C4'-P energy: -75.878 bonds (distance) P-C4' energy: -69.552 flat angles C4'-P-C4' energy: -74.913 flat angles P-C4'-P energy: -33.526 tors. eta vs tors. theta energy: -53.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -834.640598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.640598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.640598 (E_RNA) where: Base-Base interactions energy: -520.417 where: short stacking energy: -242.919 Base-Backbone interact. energy: -0.738 local terms energy: -313.486316 where: bonds (distance) C4'-P energy: -66.377 bonds (distance) P-C4' energy: -69.171 flat angles C4'-P-C4' energy: -77.721 flat angles P-C4'-P energy: -39.167 tors. eta vs tors. theta energy: -61.050 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -344.434977 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.434977 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.434977 (E_RNA) where: Base-Base interactions energy: -137.699 where: short stacking energy: -108.749 Base-Backbone interact. energy: -1.492 local terms energy: -205.243911 where: bonds (distance) C4'-P energy: -62.742 bonds (distance) P-C4' energy: -66.920 flat angles C4'-P-C4' energy: -46.125 flat angles P-C4'-P energy: -41.223 tors. eta vs tors. theta energy: 11.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -1454.750080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.750080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.750080 (E_RNA) where: Base-Base interactions energy: -1009.224 where: short stacking energy: -415.348 Base-Backbone interact. energy: -1.117 local terms energy: -444.408458 where: bonds (distance) C4'-P energy: -79.722 bonds (distance) P-C4' energy: -84.708 flat angles C4'-P-C4' energy: -101.325 flat angles P-C4'-P energy: -64.522 tors. eta vs tors. theta energy: -114.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -1357.617698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1357.617698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1357.617698 (E_RNA) where: Base-Base interactions energy: -944.578 where: short stacking energy: -413.858 Base-Backbone interact. energy: -3.111 local terms energy: -409.928281 where: bonds (distance) C4'-P energy: -66.968 bonds (distance) P-C4' energy: -82.226 flat angles C4'-P-C4' energy: -91.416 flat angles P-C4'-P energy: -59.485 tors. eta vs tors. theta energy: -109.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -1309.459383 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.459383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.459383 (E_RNA) where: Base-Base interactions energy: -892.064 where: short stacking energy: -387.703 Base-Backbone interact. energy: -2.753 local terms energy: -414.642451 where: bonds (distance) C4'-P energy: -77.267 bonds (distance) P-C4' energy: -80.519 flat angles C4'-P-C4' energy: -93.083 flat angles P-C4'-P energy: -62.094 tors. eta vs tors. theta energy: -101.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -1199.200033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.200033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.200033 (E_RNA) where: Base-Base interactions energy: -835.426 where: short stacking energy: -385.169 Base-Backbone interact. energy: -0.120 local terms energy: -363.654154 where: bonds (distance) C4'-P energy: -65.009 bonds (distance) P-C4' energy: -71.927 flat angles C4'-P-C4' energy: -83.791 flat angles P-C4'-P energy: -45.235 tors. eta vs tors. theta energy: -97.691 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -1162.201076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.201076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.201076 (E_RNA) where: Base-Base interactions energy: -792.147 where: short stacking energy: -337.900 Base-Backbone interact. energy: -0.500 local terms energy: -369.554846 where: bonds (distance) C4'-P energy: -81.048 bonds (distance) P-C4' energy: -82.083 flat angles C4'-P-C4' energy: -77.852 flat angles P-C4'-P energy: -48.476 tors. eta vs tors. theta energy: -80.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -1088.081667 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1088.081667 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1088.081667 (E_RNA) where: Base-Base interactions energy: -722.365 where: short stacking energy: -337.769 Base-Backbone interact. energy: -2.450 local terms energy: -363.266370 where: bonds (distance) C4'-P energy: -72.583 bonds (distance) P-C4' energy: -70.198 flat angles C4'-P-C4' energy: -75.085 flat angles P-C4'-P energy: -61.338 tors. eta vs tors. theta energy: -84.062 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -1031.432458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1031.432458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1031.432458 (E_RNA) where: Base-Base interactions energy: -686.595 where: short stacking energy: -312.521 Base-Backbone interact. energy: -0.537 local terms energy: -344.300666 where: bonds (distance) C4'-P energy: -74.482 bonds (distance) P-C4' energy: -76.392 flat angles C4'-P-C4' energy: -78.547 flat angles P-C4'-P energy: -47.265 tors. eta vs tors. theta energy: -67.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -876.298044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -876.298044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -876.298044 (E_RNA) where: Base-Base interactions energy: -561.080 where: short stacking energy: -260.525 Base-Backbone interact. energy: -0.832 local terms energy: -314.386596 where: bonds (distance) C4'-P energy: -64.853 bonds (distance) P-C4' energy: -82.072 flat angles C4'-P-C4' energy: -67.379 flat angles P-C4'-P energy: -38.788 tors. eta vs tors. theta energy: -61.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -857.909801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -857.909801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -857.909801 (E_RNA) where: Base-Base interactions energy: -554.440 where: short stacking energy: -252.843 Base-Backbone interact. energy: -0.448 local terms energy: -303.021836 where: bonds (distance) C4'-P energy: -79.077 bonds (distance) P-C4' energy: -86.685 flat angles C4'-P-C4' energy: -48.904 flat angles P-C4'-P energy: -42.378 tors. eta vs tors. theta energy: -45.978 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -394.722158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.722158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.722158 (E_RNA) where: Base-Base interactions energy: -180.417 where: short stacking energy: -111.155 Base-Backbone interact. energy: -0.014 local terms energy: -214.290665 where: bonds (distance) C4'-P energy: -51.277 bonds (distance) P-C4' energy: -70.677 flat angles C4'-P-C4' energy: -69.037 flat angles P-C4'-P energy: -31.726 tors. eta vs tors. theta energy: 8.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -1467.239280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1467.239280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1467.239280 (E_RNA) where: Base-Base interactions energy: -1037.442 where: short stacking energy: -443.570 Base-Backbone interact. energy: -3.273 local terms energy: -426.524988 where: bonds (distance) C4'-P energy: -77.846 bonds (distance) P-C4' energy: -81.387 flat angles C4'-P-C4' energy: -86.664 flat angles P-C4'-P energy: -62.715 tors. eta vs tors. theta energy: -117.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -1359.159795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1359.159795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1359.159795 (E_RNA) where: Base-Base interactions energy: -957.603 where: short stacking energy: -395.124 Base-Backbone interact. energy: -0.855 local terms energy: -400.702522 where: bonds (distance) C4'-P energy: -75.596 bonds (distance) P-C4' energy: -83.084 flat angles C4'-P-C4' energy: -86.720 flat angles P-C4'-P energy: -52.042 tors. eta vs tors. theta energy: -103.261 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -1360.250563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.250563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.250563 (E_RNA) where: Base-Base interactions energy: -942.723 where: short stacking energy: -402.233 Base-Backbone interact. energy: -1.001 local terms energy: -416.525914 where: bonds (distance) C4'-P energy: -86.766 bonds (distance) P-C4' energy: -91.552 flat angles C4'-P-C4' energy: -78.870 flat angles P-C4'-P energy: -50.108 tors. eta vs tors. theta energy: -109.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -1194.840320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1194.840320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1194.840320 (E_RNA) where: Base-Base interactions energy: -790.120 where: short stacking energy: -388.286 Base-Backbone interact. energy: -1.944 local terms energy: -402.776815 where: bonds (distance) C4'-P energy: -75.235 bonds (distance) P-C4' energy: -81.750 flat angles C4'-P-C4' energy: -92.318 flat angles P-C4'-P energy: -49.658 tors. eta vs tors. theta energy: -103.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -1208.957342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.957342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.957342 (E_RNA) where: Base-Base interactions energy: -834.600 where: short stacking energy: -337.988 Base-Backbone interact. energy: 1.289 local terms energy: -375.646549 where: bonds (distance) C4'-P energy: -64.185 bonds (distance) P-C4' energy: -79.611 flat angles C4'-P-C4' energy: -90.637 flat angles P-C4'-P energy: -57.973 tors. eta vs tors. theta energy: -83.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -1062.843933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.843933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1062.843933 (E_RNA) where: Base-Base interactions energy: -697.742 where: short stacking energy: -292.735 Base-Backbone interact. energy: 0.983 local terms energy: -366.085505 where: bonds (distance) C4'-P energy: -70.590 bonds (distance) P-C4' energy: -85.338 flat angles C4'-P-C4' energy: -87.338 flat angles P-C4'-P energy: -57.266 tors. eta vs tors. theta energy: -65.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -998.677926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -998.677926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -998.677926 (E_RNA) where: Base-Base interactions energy: -685.553 where: short stacking energy: -303.983 Base-Backbone interact. energy: -2.500 local terms energy: -310.624592 where: bonds (distance) C4'-P energy: -47.985 bonds (distance) P-C4' energy: -82.486 flat angles C4'-P-C4' energy: -71.792 flat angles P-C4'-P energy: -41.934 tors. eta vs tors. theta energy: -66.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -933.556665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.556665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.556665 (E_RNA) where: Base-Base interactions energy: -599.435 where: short stacking energy: -283.713 Base-Backbone interact. energy: -3.144 local terms energy: -330.978478 where: bonds (distance) C4'-P energy: -71.314 bonds (distance) P-C4' energy: -69.004 flat angles C4'-P-C4' energy: -67.319 flat angles P-C4'-P energy: -50.339 tors. eta vs tors. theta energy: -73.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -847.194046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.194046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.194046 (E_RNA) where: Base-Base interactions energy: -547.976 where: short stacking energy: -250.023 Base-Backbone interact. energy: 3.718 local terms energy: -302.936405 where: bonds (distance) C4'-P energy: -66.647 bonds (distance) P-C4' energy: -74.405 flat angles C4'-P-C4' energy: -71.701 flat angles P-C4'-P energy: -47.652 tors. eta vs tors. theta energy: -42.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -429.039115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.039115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.039115 (E_RNA) where: Base-Base interactions energy: -219.282 where: short stacking energy: -116.785 Base-Backbone interact. energy: 1.382 local terms energy: -211.139041 where: bonds (distance) C4'-P energy: -64.593 bonds (distance) P-C4' energy: -77.046 flat angles C4'-P-C4' energy: -64.192 flat angles P-C4'-P energy: -21.216 tors. eta vs tors. theta energy: 15.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -1446.224311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.224311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.224311 (E_RNA) where: Base-Base interactions energy: -1018.651 where: short stacking energy: -442.490 Base-Backbone interact. energy: -2.487 local terms energy: -425.086309 where: bonds (distance) C4'-P energy: -72.759 bonds (distance) P-C4' energy: -82.240 flat angles C4'-P-C4' energy: -90.050 flat angles P-C4'-P energy: -65.149 tors. eta vs tors. theta energy: -114.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -1379.426603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.426603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.426603 (E_RNA) where: Base-Base interactions energy: -967.554 where: short stacking energy: -398.210 Base-Backbone interact. energy: 0.320 local terms energy: -412.192298 where: bonds (distance) C4'-P energy: -75.881 bonds (distance) P-C4' energy: -86.445 flat angles C4'-P-C4' energy: -90.224 flat angles P-C4'-P energy: -55.113 tors. eta vs tors. theta energy: -104.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -1358.973942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.973942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.973942 (E_RNA) where: Base-Base interactions energy: -926.538 where: short stacking energy: -395.203 Base-Backbone interact. energy: -0.029 local terms energy: -432.406658 where: bonds (distance) C4'-P energy: -81.028 bonds (distance) P-C4' energy: -87.750 flat angles C4'-P-C4' energy: -90.744 flat angles P-C4'-P energy: -60.412 tors. eta vs tors. theta energy: -112.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -1221.578999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.578999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.578999 (E_RNA) where: Base-Base interactions energy: -837.873 where: short stacking energy: -390.996 Base-Backbone interact. energy: 0.222 local terms energy: -383.927803 where: bonds (distance) C4'-P energy: -73.005 bonds (distance) P-C4' energy: -73.847 flat angles C4'-P-C4' energy: -83.585 flat angles P-C4'-P energy: -50.833 tors. eta vs tors. theta energy: -102.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -1207.303085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.303085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.303085 (E_RNA) where: Base-Base interactions energy: -834.528 where: short stacking energy: -349.870 Base-Backbone interact. energy: -2.049 local terms energy: -370.725655 where: bonds (distance) C4'-P energy: -80.560 bonds (distance) P-C4' energy: -66.734 flat angles C4'-P-C4' energy: -83.533 flat angles P-C4'-P energy: -65.735 tors. eta vs tors. theta energy: -74.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -1089.444835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1089.444835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1089.444835 (E_RNA) where: Base-Base interactions energy: -748.069 where: short stacking energy: -310.050 Base-Backbone interact. energy: -0.761 local terms energy: -340.614472 where: bonds (distance) C4'-P energy: -61.369 bonds (distance) P-C4' energy: -68.879 flat angles C4'-P-C4' energy: -85.602 flat angles P-C4'-P energy: -53.851 tors. eta vs tors. theta energy: -70.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -1012.744830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.744830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.744830 (E_RNA) where: Base-Base interactions energy: -685.134 where: short stacking energy: -302.906 Base-Backbone interact. energy: -1.770 local terms energy: -325.840872 where: bonds (distance) C4'-P energy: -71.938 bonds (distance) P-C4' energy: -78.541 flat angles C4'-P-C4' energy: -73.713 flat angles P-C4'-P energy: -37.573 tors. eta vs tors. theta energy: -64.076 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -877.518994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -877.518994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -877.518994 (E_RNA) where: Base-Base interactions energy: -554.730 where: short stacking energy: -263.382 Base-Backbone interact. energy: 0.731 local terms energy: -323.519986 where: bonds (distance) C4'-P energy: -64.642 bonds (distance) P-C4' energy: -75.267 flat angles C4'-P-C4' energy: -81.169 flat angles P-C4'-P energy: -40.687 tors. eta vs tors. theta energy: -61.756 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -766.832264 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -766.832264 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -766.832264 (E_RNA) where: Base-Base interactions energy: -496.474 where: short stacking energy: -221.127 Base-Backbone interact. energy: -1.238 local terms energy: -269.120523 where: bonds (distance) C4'-P energy: -65.374 bonds (distance) P-C4' energy: -58.291 flat angles C4'-P-C4' energy: -73.189 flat angles P-C4'-P energy: -40.481 tors. eta vs tors. theta energy: -31.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -488.368050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -488.368050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -488.368050 (E_RNA) where: Base-Base interactions energy: -254.461 where: short stacking energy: -139.796 Base-Backbone interact. energy: 0.404 local terms energy: -234.311162 where: bonds (distance) C4'-P energy: -74.773 bonds (distance) P-C4' energy: -59.548 flat angles C4'-P-C4' energy: -61.895 flat angles P-C4'-P energy: -39.362 tors. eta vs tors. theta energy: 1.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -1429.582668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.582668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.582668 (E_RNA) where: Base-Base interactions energy: -989.498 where: short stacking energy: -425.278 Base-Backbone interact. energy: -3.310 local terms energy: -436.775110 where: bonds (distance) C4'-P energy: -85.508 bonds (distance) P-C4' energy: -82.868 flat angles C4'-P-C4' energy: -95.331 flat angles P-C4'-P energy: -62.920 tors. eta vs tors. theta energy: -110.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -1371.551628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.551628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.551628 (E_RNA) where: Base-Base interactions energy: -943.093 where: short stacking energy: -404.273 Base-Backbone interact. energy: 0.628 local terms energy: -429.086199 where: bonds (distance) C4'-P energy: -85.608 bonds (distance) P-C4' energy: -87.178 flat angles C4'-P-C4' energy: -94.233 flat angles P-C4'-P energy: -49.492 tors. eta vs tors. theta energy: -112.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -1374.560629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1374.560629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1374.560629 (E_RNA) where: Base-Base interactions energy: -935.511 where: short stacking energy: -414.765 Base-Backbone interact. energy: -2.663 local terms energy: -436.386861 where: bonds (distance) C4'-P energy: -84.167 bonds (distance) P-C4' energy: -88.572 flat angles C4'-P-C4' energy: -89.126 flat angles P-C4'-P energy: -60.980 tors. eta vs tors. theta energy: -113.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -1266.990909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1266.990909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1266.990909 (E_RNA) where: Base-Base interactions energy: -895.494 where: short stacking energy: -369.181 Base-Backbone interact. energy: -2.776 local terms energy: -368.721407 where: bonds (distance) C4'-P energy: -76.627 bonds (distance) P-C4' energy: -72.096 flat angles C4'-P-C4' energy: -81.844 flat angles P-C4'-P energy: -50.530 tors. eta vs tors. theta energy: -87.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -1196.170288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.170288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.170288 (E_RNA) where: Base-Base interactions energy: -800.022 where: short stacking energy: -377.287 Base-Backbone interact. energy: -1.602 local terms energy: -394.547036 where: bonds (distance) C4'-P energy: -71.419 bonds (distance) P-C4' energy: -85.627 flat angles C4'-P-C4' energy: -82.661 flat angles P-C4'-P energy: -53.997 tors. eta vs tors. theta energy: -100.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -1025.917832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.917832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.917832 (E_RNA) where: Base-Base interactions energy: -695.255 where: short stacking energy: -294.195 Base-Backbone interact. energy: 0.067 local terms energy: -330.730118 where: bonds (distance) C4'-P energy: -71.990 bonds (distance) P-C4' energy: -86.149 flat angles C4'-P-C4' energy: -81.788 flat angles P-C4'-P energy: -43.452 tors. eta vs tors. theta energy: -47.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -1039.551096 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.551096 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.551096 (E_RNA) where: Base-Base interactions energy: -695.848 where: short stacking energy: -322.896 Base-Backbone interact. energy: -2.279 local terms energy: -341.423815 where: bonds (distance) C4'-P energy: -68.008 bonds (distance) P-C4' energy: -64.553 flat angles C4'-P-C4' energy: -81.932 flat angles P-C4'-P energy: -51.978 tors. eta vs tors. theta energy: -74.952 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -868.318409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -868.318409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -868.318409 (E_RNA) where: Base-Base interactions energy: -556.557 where: short stacking energy: -268.697 Base-Backbone interact. energy: -1.359 local terms energy: -310.402668 where: bonds (distance) C4'-P energy: -68.112 bonds (distance) P-C4' energy: -62.862 flat angles C4'-P-C4' energy: -83.779 flat angles P-C4'-P energy: -33.742 tors. eta vs tors. theta energy: -61.908 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -866.833029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.833029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.833029 (E_RNA) where: Base-Base interactions energy: -534.711 where: short stacking energy: -246.939 Base-Backbone interact. energy: -3.606 local terms energy: -328.516063 where: bonds (distance) C4'-P energy: -69.462 bonds (distance) P-C4' energy: -78.922 flat angles C4'-P-C4' energy: -83.116 flat angles P-C4'-P energy: -44.812 tors. eta vs tors. theta energy: -52.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -470.775572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.775572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.775572 (E_RNA) where: Base-Base interactions energy: -216.847 where: short stacking energy: -133.393 Base-Backbone interact. energy: -0.194 local terms energy: -253.734324 where: bonds (distance) C4'-P energy: -62.326 bonds (distance) P-C4' energy: -73.773 flat angles C4'-P-C4' energy: -80.358 flat angles P-C4'-P energy: -32.704 tors. eta vs tors. theta energy: -4.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -1448.407338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1448.407338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1448.407338 (E_RNA) where: Base-Base interactions energy: -1006.062 where: short stacking energy: -421.050 Base-Backbone interact. energy: -1.263 local terms energy: -441.082051 where: bonds (distance) C4'-P energy: -80.243 bonds (distance) P-C4' energy: -93.153 flat angles C4'-P-C4' energy: -88.345 flat angles P-C4'-P energy: -62.368 tors. eta vs tors. theta energy: -116.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -1351.459710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1351.459710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1351.459710 (E_RNA) where: Base-Base interactions energy: -913.725 where: short stacking energy: -395.573 Base-Backbone interact. energy: -2.682 local terms energy: -435.052857 where: bonds (distance) C4'-P energy: -92.578 bonds (distance) P-C4' energy: -78.498 flat angles C4'-P-C4' energy: -95.126 flat angles P-C4'-P energy: -55.463 tors. eta vs tors. theta energy: -113.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -1376.821075 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1376.821075 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1376.821075 (E_RNA) where: Base-Base interactions energy: -965.553 where: short stacking energy: -430.669 Base-Backbone interact. energy: -2.257 local terms energy: -409.011282 where: bonds (distance) C4'-P energy: -76.107 bonds (distance) P-C4' energy: -67.436 flat angles C4'-P-C4' energy: -88.980 flat angles P-C4'-P energy: -57.662 tors. eta vs tors. theta energy: -118.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -1276.154471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.154471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.154471 (E_RNA) where: Base-Base interactions energy: -879.882 where: short stacking energy: -371.713 Base-Backbone interact. energy: -0.166 local terms energy: -396.106894 where: bonds (distance) C4'-P energy: -70.199 bonds (distance) P-C4' energy: -80.204 flat angles C4'-P-C4' energy: -100.225 flat angles P-C4'-P energy: -56.578 tors. eta vs tors. theta energy: -88.901 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -1203.176174 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.176174 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1203.176174 (E_RNA) where: Base-Base interactions energy: -832.630 where: short stacking energy: -379.711 Base-Backbone interact. energy: -1.376 local terms energy: -369.170814 where: bonds (distance) C4'-P energy: -84.899 bonds (distance) P-C4' energy: -56.441 flat angles C4'-P-C4' energy: -76.961 flat angles P-C4'-P energy: -52.583 tors. eta vs tors. theta energy: -98.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -1012.850959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.850959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1012.850959 (E_RNA) where: Base-Base interactions energy: -642.779 where: short stacking energy: -294.619 Base-Backbone interact. energy: -2.285 local terms energy: -367.786477 where: bonds (distance) C4'-P energy: -80.071 bonds (distance) P-C4' energy: -79.641 flat angles C4'-P-C4' energy: -71.988 flat angles P-C4'-P energy: -69.859 tors. eta vs tors. theta energy: -66.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -1064.494665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.494665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1064.494665 (E_RNA) where: Base-Base interactions energy: -722.479 where: short stacking energy: -318.809 Base-Backbone interact. energy: -0.264 local terms energy: -341.751765 where: bonds (distance) C4'-P energy: -76.844 bonds (distance) P-C4' energy: -80.480 flat angles C4'-P-C4' energy: -77.582 flat angles P-C4'-P energy: -39.700 tors. eta vs tors. theta energy: -67.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -859.119986 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.119986 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.119986 (E_RNA) where: Base-Base interactions energy: -569.134 where: short stacking energy: -268.853 Base-Backbone interact. energy: 4.761 local terms energy: -294.746545 where: bonds (distance) C4'-P energy: -65.981 bonds (distance) P-C4' energy: -67.877 flat angles C4'-P-C4' energy: -82.421 flat angles P-C4'-P energy: -30.498 tors. eta vs tors. theta energy: -47.970 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -814.956447 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -814.956447 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -814.956447 (E_RNA) where: Base-Base interactions energy: -539.758 where: short stacking energy: -236.392 Base-Backbone interact. energy: -2.803 local terms energy: -272.395830 where: bonds (distance) C4'-P energy: -66.509 bonds (distance) P-C4' energy: -74.762 flat angles C4'-P-C4' energy: -67.829 flat angles P-C4'-P energy: -26.538 tors. eta vs tors. theta energy: -36.758 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -438.883758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.883758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.883758 (E_RNA) where: Base-Base interactions energy: -230.864 where: short stacking energy: -114.488 Base-Backbone interact. energy: 1.187 local terms energy: -209.206081 where: bonds (distance) C4'-P energy: -61.007 bonds (distance) P-C4' energy: -71.922 flat angles C4'-P-C4' energy: -52.479 flat angles P-C4'-P energy: -36.303 tors. eta vs tors. theta energy: 12.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -1454.397581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.397581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.397581 (E_RNA) where: Base-Base interactions energy: -1009.621 where: short stacking energy: -436.740 Base-Backbone interact. energy: -2.477 local terms energy: -442.299166 where: bonds (distance) C4'-P energy: -77.955 bonds (distance) P-C4' energy: -88.482 flat angles C4'-P-C4' energy: -93.473 flat angles P-C4'-P energy: -70.415 tors. eta vs tors. theta energy: -111.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -1418.516436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1418.516436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1418.516436 (E_RNA) where: Base-Base interactions energy: -967.777 where: short stacking energy: -416.634 Base-Backbone interact. energy: -1.518 local terms energy: -449.221082 where: bonds (distance) C4'-P energy: -80.898 bonds (distance) P-C4' energy: -88.453 flat angles C4'-P-C4' energy: -94.535 flat angles P-C4'-P energy: -62.132 tors. eta vs tors. theta energy: -123.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -1332.687429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.687429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.687429 (E_RNA) where: Base-Base interactions energy: -908.723 where: short stacking energy: -407.095 Base-Backbone interact. energy: -4.195 local terms energy: -419.769746 where: bonds (distance) C4'-P energy: -79.525 bonds (distance) P-C4' energy: -83.529 flat angles C4'-P-C4' energy: -89.101 flat angles P-C4'-P energy: -59.246 tors. eta vs tors. theta energy: -108.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -1238.962826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.962826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.962826 (E_RNA) where: Base-Base interactions energy: -852.180 where: short stacking energy: -329.943 Base-Backbone interact. energy: -1.518 local terms energy: -385.264633 where: bonds (distance) C4'-P energy: -78.750 bonds (distance) P-C4' energy: -74.211 flat angles C4'-P-C4' energy: -84.870 flat angles P-C4'-P energy: -59.620 tors. eta vs tors. theta energy: -87.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -1175.897761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1175.897761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1175.897761 (E_RNA) where: Base-Base interactions energy: -794.765 where: short stacking energy: -340.242 Base-Backbone interact. energy: -2.448 local terms energy: -378.685264 where: bonds (distance) C4'-P energy: -69.594 bonds (distance) P-C4' energy: -76.409 flat angles C4'-P-C4' energy: -80.958 flat angles P-C4'-P energy: -57.307 tors. eta vs tors. theta energy: -94.417 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -1069.754800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.754800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.754800 (E_RNA) where: Base-Base interactions energy: -719.016 where: short stacking energy: -315.576 Base-Backbone interact. energy: -1.671 local terms energy: -349.067383 where: bonds (distance) C4'-P energy: -59.710 bonds (distance) P-C4' energy: -70.798 flat angles C4'-P-C4' energy: -90.045 flat angles P-C4'-P energy: -51.497 tors. eta vs tors. theta energy: -77.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -985.363861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -985.363861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -985.363861 (E_RNA) where: Base-Base interactions energy: -661.108 where: short stacking energy: -302.787 Base-Backbone interact. energy: 6.108 local terms energy: -330.363899 where: bonds (distance) C4'-P energy: -69.837 bonds (distance) P-C4' energy: -81.183 flat angles C4'-P-C4' energy: -73.904 flat angles P-C4'-P energy: -41.619 tors. eta vs tors. theta energy: -63.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -850.622326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -850.622326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -850.622326 (E_RNA) where: Base-Base interactions energy: -544.994 where: short stacking energy: -262.854 Base-Backbone interact. energy: 7.377 local terms energy: -313.005138 where: bonds (distance) C4'-P energy: -66.753 bonds (distance) P-C4' energy: -70.440 flat angles C4'-P-C4' energy: -74.010 flat angles P-C4'-P energy: -46.023 tors. eta vs tors. theta energy: -55.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -858.042523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -858.042523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -858.042523 (E_RNA) where: Base-Base interactions energy: -563.751 where: short stacking energy: -233.981 Base-Backbone interact. energy: -0.103 local terms energy: -294.188210 where: bonds (distance) C4'-P energy: -60.344 bonds (distance) P-C4' energy: -72.295 flat angles C4'-P-C4' energy: -78.257 flat angles P-C4'-P energy: -43.796 tors. eta vs tors. theta energy: -39.496 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -459.418790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.418790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.418790 (E_RNA) where: Base-Base interactions energy: -212.214 where: short stacking energy: -131.185 Base-Backbone interact. energy: -0.059 local terms energy: -247.145370 where: bonds (distance) C4'-P energy: -81.597 bonds (distance) P-C4' energy: -61.971 flat angles C4'-P-C4' energy: -60.068 flat angles P-C4'-P energy: -36.311 tors. eta vs tors. theta energy: -7.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -1451.958771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.958771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.958771 (E_RNA) where: Base-Base interactions energy: -984.960 where: short stacking energy: -428.044 Base-Backbone interact. energy: -1.731 local terms energy: -465.267506 where: bonds (distance) C4'-P energy: -95.540 bonds (distance) P-C4' energy: -82.116 flat angles C4'-P-C4' energy: -100.747 flat angles P-C4'-P energy: -67.448 tors. eta vs tors. theta energy: -119.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -1401.112031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.112031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.112031 (E_RNA) where: Base-Base interactions energy: -956.397 where: short stacking energy: -415.425 Base-Backbone interact. energy: 2.589 local terms energy: -447.304258 where: bonds (distance) C4'-P energy: -74.622 bonds (distance) P-C4' energy: -91.364 flat angles C4'-P-C4' energy: -93.856 flat angles P-C4'-P energy: -72.708 tors. eta vs tors. theta energy: -114.755 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -1295.059775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.059775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.059775 (E_RNA) where: Base-Base interactions energy: -899.707 where: short stacking energy: -403.431 Base-Backbone interact. energy: -1.114 local terms energy: -394.238320 where: bonds (distance) C4'-P energy: -72.517 bonds (distance) P-C4' energy: -74.064 flat angles C4'-P-C4' energy: -81.913 flat angles P-C4'-P energy: -56.329 tors. eta vs tors. theta energy: -109.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -1285.573235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1285.573235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1285.573235 (E_RNA) where: Base-Base interactions energy: -896.656 where: short stacking energy: -370.549 Base-Backbone interact. energy: -0.639 local terms energy: -388.277428 where: bonds (distance) C4'-P energy: -72.850 bonds (distance) P-C4' energy: -71.253 flat angles C4'-P-C4' energy: -89.618 flat angles P-C4'-P energy: -61.855 tors. eta vs tors. theta energy: -92.701 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -1168.970397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.970397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.970397 (E_RNA) where: Base-Base interactions energy: -801.237 where: short stacking energy: -374.951 Base-Backbone interact. energy: -1.636 local terms energy: -366.096725 where: bonds (distance) C4'-P energy: -64.012 bonds (distance) P-C4' energy: -59.744 flat angles C4'-P-C4' energy: -91.991 flat angles P-C4'-P energy: -57.808 tors. eta vs tors. theta energy: -92.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -1083.506101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1083.506101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1083.506101 (E_RNA) where: Base-Base interactions energy: -743.614 where: short stacking energy: -319.569 Base-Backbone interact. energy: -0.111 local terms energy: -339.781498 where: bonds (distance) C4'-P energy: -74.420 bonds (distance) P-C4' energy: -71.226 flat angles C4'-P-C4' energy: -71.309 flat angles P-C4'-P energy: -53.115 tors. eta vs tors. theta energy: -69.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -1007.766540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.766540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.766540 (E_RNA) where: Base-Base interactions energy: -694.947 where: short stacking energy: -317.583 Base-Backbone interact. energy: -1.257 local terms energy: -311.562557 where: bonds (distance) C4'-P energy: -66.651 bonds (distance) P-C4' energy: -57.380 flat angles C4'-P-C4' energy: -78.595 flat angles P-C4'-P energy: -46.533 tors. eta vs tors. theta energy: -62.404 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -841.217863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -841.217863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -841.217863 (E_RNA) where: Base-Base interactions energy: -524.836 where: short stacking energy: -239.602 Base-Backbone interact. energy: 0.848 local terms energy: -317.230206 where: bonds (distance) C4'-P energy: -64.211 bonds (distance) P-C4' energy: -70.903 flat angles C4'-P-C4' energy: -85.963 flat angles P-C4'-P energy: -36.887 tors. eta vs tors. theta energy: -59.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -871.489274 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.489274 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.489274 (E_RNA) where: Base-Base interactions energy: -593.425 where: short stacking energy: -264.851 Base-Backbone interact. energy: -1.061 local terms energy: -277.002546 where: bonds (distance) C4'-P energy: -39.508 bonds (distance) P-C4' energy: -60.550 flat angles C4'-P-C4' energy: -71.506 flat angles P-C4'-P energy: -42.572 tors. eta vs tors. theta energy: -62.866 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -456.655648 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.655648 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.655648 (E_RNA) where: Base-Base interactions energy: -220.265 where: short stacking energy: -135.424 Base-Backbone interact. energy: 3.516 local terms energy: -239.905911 where: bonds (distance) C4'-P energy: -62.358 bonds (distance) P-C4' energy: -67.946 flat angles C4'-P-C4' energy: -52.385 flat angles P-C4'-P energy: -45.137 tors. eta vs tors. theta energy: -12.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -1458.531034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.531034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.531034 (E_RNA) where: Base-Base interactions energy: -1005.871 where: short stacking energy: -433.949 Base-Backbone interact. energy: -2.420 local terms energy: -450.239732 where: bonds (distance) C4'-P energy: -81.742 bonds (distance) P-C4' energy: -83.382 flat angles C4'-P-C4' energy: -100.925 flat angles P-C4'-P energy: -66.184 tors. eta vs tors. theta energy: -118.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -1408.940964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.940964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.940964 (E_RNA) where: Base-Base interactions energy: -961.016 where: short stacking energy: -402.773 Base-Backbone interact. energy: -5.752 local terms energy: -442.172272 where: bonds (distance) C4'-P energy: -90.694 bonds (distance) P-C4' energy: -87.088 flat angles C4'-P-C4' energy: -92.782 flat angles P-C4'-P energy: -63.211 tors. eta vs tors. theta energy: -108.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -1300.679307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.679307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.679307 (E_RNA) where: Base-Base interactions energy: -888.275 where: short stacking energy: -387.122 Base-Backbone interact. energy: -2.980 local terms energy: -409.424516 where: bonds (distance) C4'-P energy: -83.410 bonds (distance) P-C4' energy: -75.600 flat angles C4'-P-C4' energy: -87.873 flat angles P-C4'-P energy: -63.803 tors. eta vs tors. theta energy: -98.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -1276.843815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1276.843815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1276.843815 (E_RNA) where: Base-Base interactions energy: -901.221 where: short stacking energy: -360.836 Base-Backbone interact. energy: -1.997 local terms energy: -373.625209 where: bonds (distance) C4'-P energy: -67.256 bonds (distance) P-C4' energy: -73.172 flat angles C4'-P-C4' energy: -89.708 flat angles P-C4'-P energy: -55.920 tors. eta vs tors. theta energy: -87.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -1199.634615 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.634615 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.634615 (E_RNA) where: Base-Base interactions energy: -801.399 where: short stacking energy: -352.347 Base-Backbone interact. energy: -1.518 local terms energy: -396.718223 where: bonds (distance) C4'-P energy: -77.957 bonds (distance) P-C4' energy: -83.801 flat angles C4'-P-C4' energy: -95.549 flat angles P-C4'-P energy: -46.610 tors. eta vs tors. theta energy: -92.801 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -1101.149537 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1101.149537 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1101.149537 (E_RNA) where: Base-Base interactions energy: -739.995 where: short stacking energy: -317.711 Base-Backbone interact. energy: 3.026 local terms energy: -364.180743 where: bonds (distance) C4'-P energy: -81.377 bonds (distance) P-C4' energy: -71.118 flat angles C4'-P-C4' energy: -86.442 flat angles P-C4'-P energy: -49.567 tors. eta vs tors. theta energy: -75.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -954.240057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -954.240057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -954.240057 (E_RNA) where: Base-Base interactions energy: -623.100 where: short stacking energy: -265.938 Base-Backbone interact. energy: -1.810 local terms energy: -329.329768 where: bonds (distance) C4'-P energy: -73.460 bonds (distance) P-C4' energy: -75.592 flat angles C4'-P-C4' energy: -68.063 flat angles P-C4'-P energy: -51.691 tors. eta vs tors. theta energy: -60.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -944.218796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.218796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -944.218796 (E_RNA) where: Base-Base interactions energy: -605.136 where: short stacking energy: -283.617 Base-Backbone interact. energy: -2.553 local terms energy: -336.530280 where: bonds (distance) C4'-P energy: -69.007 bonds (distance) P-C4' energy: -70.966 flat angles C4'-P-C4' energy: -80.754 flat angles P-C4'-P energy: -59.197 tors. eta vs tors. theta energy: -56.607 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -795.170951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -795.170951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -795.170951 (E_RNA) where: Base-Base interactions energy: -510.594 where: short stacking energy: -221.939 Base-Backbone interact. energy: -0.193 local terms energy: -284.383860 where: bonds (distance) C4'-P energy: -79.488 bonds (distance) P-C4' energy: -55.267 flat angles C4'-P-C4' energy: -64.966 flat angles P-C4'-P energy: -42.733 tors. eta vs tors. theta energy: -41.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -470.878580 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.878580 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.878580 (E_RNA) where: Base-Base interactions energy: -221.725 where: short stacking energy: -138.418 Base-Backbone interact. energy: -1.559 local terms energy: -247.594542 where: bonds (distance) C4'-P energy: -68.715 bonds (distance) P-C4' energy: -72.176 flat angles C4'-P-C4' energy: -65.117 flat angles P-C4'-P energy: -36.381 tors. eta vs tors. theta energy: -5.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -1415.171593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.171593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.171593 (E_RNA) where: Base-Base interactions energy: -974.983 where: short stacking energy: -416.635 Base-Backbone interact. energy: -2.921 local terms energy: -437.268013 where: bonds (distance) C4'-P energy: -71.509 bonds (distance) P-C4' energy: -86.939 flat angles C4'-P-C4' energy: -98.196 flat angles P-C4'-P energy: -69.172 tors. eta vs tors. theta energy: -111.452 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -1406.261546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.261546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.261546 (E_RNA) where: Base-Base interactions energy: -980.736 where: short stacking energy: -422.695 Base-Backbone interact. energy: 0.218 local terms energy: -425.743414 where: bonds (distance) C4'-P energy: -83.041 bonds (distance) P-C4' energy: -73.637 flat angles C4'-P-C4' energy: -96.272 flat angles P-C4'-P energy: -55.146 tors. eta vs tors. theta energy: -117.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -1310.929472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.929472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.929472 (E_RNA) where: Base-Base interactions energy: -910.847 where: short stacking energy: -383.750 Base-Backbone interact. energy: -2.200 local terms energy: -397.881887 where: bonds (distance) C4'-P energy: -97.002 bonds (distance) P-C4' energy: -69.013 flat angles C4'-P-C4' energy: -82.674 flat angles P-C4'-P energy: -44.128 tors. eta vs tors. theta energy: -105.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -1257.704740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.704740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.704740 (E_RNA) where: Base-Base interactions energy: -865.714 where: short stacking energy: -338.751 Base-Backbone interact. energy: -2.369 local terms energy: -389.622300 where: bonds (distance) C4'-P energy: -82.561 bonds (distance) P-C4' energy: -81.181 flat angles C4'-P-C4' energy: -78.360 flat angles P-C4'-P energy: -60.812 tors. eta vs tors. theta energy: -86.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -1207.295638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1207.295638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1207.295638 (E_RNA) where: Base-Base interactions energy: -836.292 where: short stacking energy: -369.521 Base-Backbone interact. energy: -3.209 local terms energy: -367.795129 where: bonds (distance) C4'-P energy: -55.187 bonds (distance) P-C4' energy: -78.416 flat angles C4'-P-C4' energy: -82.294 flat angles P-C4'-P energy: -57.832 tors. eta vs tors. theta energy: -94.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -1098.009436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1098.009436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.009436 (E_RNA) where: Base-Base interactions energy: -745.876 where: short stacking energy: -315.077 Base-Backbone interact. energy: -2.894 local terms energy: -349.238628 where: bonds (distance) C4'-P energy: -75.148 bonds (distance) P-C4' energy: -60.022 flat angles C4'-P-C4' energy: -89.997 flat angles P-C4'-P energy: -56.294 tors. eta vs tors. theta energy: -67.778 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -928.022220 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.022220 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.022220 (E_RNA) where: Base-Base interactions energy: -578.955 where: short stacking energy: -263.154 Base-Backbone interact. energy: -0.714 local terms energy: -348.354051 where: bonds (distance) C4'-P energy: -71.508 bonds (distance) P-C4' energy: -87.901 flat angles C4'-P-C4' energy: -69.557 flat angles P-C4'-P energy: -54.494 tors. eta vs tors. theta energy: -64.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -980.354870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.354870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.354870 (E_RNA) where: Base-Base interactions energy: -635.613 where: short stacking energy: -285.598 Base-Backbone interact. energy: -0.578 local terms energy: -344.163657 where: bonds (distance) C4'-P energy: -73.269 bonds (distance) P-C4' energy: -80.448 flat angles C4'-P-C4' energy: -74.731 flat angles P-C4'-P energy: -47.887 tors. eta vs tors. theta energy: -67.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 3 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -819.774223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.774223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.774223 (E_RNA) where: Base-Base interactions energy: -525.281 where: short stacking energy: -252.957 Base-Backbone interact. energy: 0.073 local terms energy: -294.566662 where: bonds (distance) C4'-P energy: -62.446 bonds (distance) P-C4' energy: -69.271 flat angles C4'-P-C4' energy: -77.734 flat angles P-C4'-P energy: -40.328 tors. eta vs tors. theta energy: -44.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -455.483811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.483811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.483811 (E_RNA) where: Base-Base interactions energy: -221.722 where: short stacking energy: -126.477 Base-Backbone interact. energy: -1.736 local terms energy: -232.025505 where: bonds (distance) C4'-P energy: -72.955 bonds (distance) P-C4' energy: -63.834 flat angles C4'-P-C4' energy: -55.910 flat angles P-C4'-P energy: -46.924 tors. eta vs tors. theta energy: 7.597 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -1429.481427 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.481427 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.481427 (E_RNA) where: Base-Base interactions energy: -990.888 where: short stacking energy: -398.552 Base-Backbone interact. energy: -1.557 local terms energy: -437.036826 where: bonds (distance) C4'-P energy: -74.534 bonds (distance) P-C4' energy: -88.532 flat angles C4'-P-C4' energy: -99.916 flat angles P-C4'-P energy: -62.151 tors. eta vs tors. theta energy: -111.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -1417.234237 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1417.234237 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.234237 (E_RNA) where: Base-Base interactions energy: -980.040 where: short stacking energy: -409.268 Base-Backbone interact. energy: -0.901 local terms energy: -436.293400 where: bonds (distance) C4'-P energy: -80.589 bonds (distance) P-C4' energy: -85.575 flat angles C4'-P-C4' energy: -89.248 flat angles P-C4'-P energy: -65.017 tors. eta vs tors. theta energy: -115.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -1340.088576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1340.088576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1340.088576 (E_RNA) where: Base-Base interactions energy: -904.225 where: short stacking energy: -410.086 Base-Backbone interact. energy: -0.034 local terms energy: -435.829797 where: bonds (distance) C4'-P energy: -87.985 bonds (distance) P-C4' energy: -87.190 flat angles C4'-P-C4' energy: -90.356 flat angles P-C4'-P energy: -53.809 tors. eta vs tors. theta energy: -116.490 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -1257.546865 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.546865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.546865 (E_RNA) where: Base-Base interactions energy: -830.280 where: short stacking energy: -357.860 Base-Backbone interact. energy: -2.842 local terms energy: -424.425682 where: bonds (distance) C4'-P energy: -79.198 bonds (distance) P-C4' energy: -93.245 flat angles C4'-P-C4' energy: -89.528 flat angles P-C4'-P energy: -64.849 tors. eta vs tors. theta energy: -97.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -1213.333831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1213.333831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1213.333831 (E_RNA) where: Base-Base interactions energy: -840.240 where: short stacking energy: -371.874 Base-Backbone interact. energy: -1.332 local terms energy: -371.761514 where: bonds (distance) C4'-P energy: -52.363 bonds (distance) P-C4' energy: -65.867 flat angles C4'-P-C4' energy: -90.608 flat angles P-C4'-P energy: -59.898 tors. eta vs tors. theta energy: -103.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -1060.912727 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.912727 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.912727 (E_RNA) where: Base-Base interactions energy: -711.778 where: short stacking energy: -333.337 Base-Backbone interact. energy: -0.391 local terms energy: -348.743782 where: bonds (distance) C4'-P energy: -66.678 bonds (distance) P-C4' energy: -74.900 flat angles C4'-P-C4' energy: -81.429 flat angles P-C4'-P energy: -51.311 tors. eta vs tors. theta energy: -74.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -859.975121 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -859.975121 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -859.975121 (E_RNA) where: Base-Base interactions energy: -526.192 where: short stacking energy: -263.947 Base-Backbone interact. energy: 0.966 local terms energy: -334.748275 where: bonds (distance) C4'-P energy: -61.478 bonds (distance) P-C4' energy: -80.263 flat angles C4'-P-C4' energy: -83.247 flat angles P-C4'-P energy: -53.869 tors. eta vs tors. theta energy: -55.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -851.246599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -851.246599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -851.246599 (E_RNA) where: Base-Base interactions energy: -544.051 where: short stacking energy: -265.081 Base-Backbone interact. energy: -1.302 local terms energy: -305.893392 where: bonds (distance) C4'-P energy: -68.140 bonds (distance) P-C4' energy: -67.182 flat angles C4'-P-C4' energy: -80.027 flat angles P-C4'-P energy: -42.766 tors. eta vs tors. theta energy: -47.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -980.385031 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -980.385031 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -980.385031 (E_RNA) where: Base-Base interactions energy: -666.547 where: short stacking energy: -294.522 Base-Backbone interact. energy: -1.333 local terms energy: -312.504091 where: bonds (distance) C4'-P energy: -62.496 bonds (distance) P-C4' energy: -68.223 flat angles C4'-P-C4' energy: -65.174 flat angles P-C4'-P energy: -54.674 tors. eta vs tors. theta energy: -61.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -452.394229 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.394229 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.394229 (E_RNA) where: Base-Base interactions energy: -201.963 where: short stacking energy: -142.316 Base-Backbone interact. energy: 1.172 local terms energy: -251.602809 where: bonds (distance) C4'-P energy: -74.592 bonds (distance) P-C4' energy: -80.429 flat angles C4'-P-C4' energy: -62.363 flat angles P-C4'-P energy: -35.775 tors. eta vs tors. theta energy: 1.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -1438.911342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.911342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.911342 (E_RNA) where: Base-Base interactions energy: -996.705 where: short stacking energy: -438.084 Base-Backbone interact. energy: -1.720 local terms energy: -440.486710 where: bonds (distance) C4'-P energy: -78.895 bonds (distance) P-C4' energy: -82.484 flat angles C4'-P-C4' energy: -102.092 flat angles P-C4'-P energy: -62.365 tors. eta vs tors. theta energy: -114.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -1416.936604 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.936604 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.936604 (E_RNA) where: Base-Base interactions energy: -972.592 where: short stacking energy: -419.233 Base-Backbone interact. energy: -1.023 local terms energy: -443.321176 where: bonds (distance) C4'-P energy: -80.700 bonds (distance) P-C4' energy: -80.897 flat angles C4'-P-C4' energy: -99.669 flat angles P-C4'-P energy: -68.757 tors. eta vs tors. theta energy: -113.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -1330.087424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.087424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.087424 (E_RNA) where: Base-Base interactions energy: -906.033 where: short stacking energy: -413.261 Base-Backbone interact. energy: -0.308 local terms energy: -423.746517 where: bonds (distance) C4'-P energy: -77.162 bonds (distance) P-C4' energy: -78.298 flat angles C4'-P-C4' energy: -93.486 flat angles P-C4'-P energy: -58.214 tors. eta vs tors. theta energy: -116.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -1262.515138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.515138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.515138 (E_RNA) where: Base-Base interactions energy: -883.050 where: short stacking energy: -373.871 Base-Backbone interact. energy: 0.570 local terms energy: -380.035451 where: bonds (distance) C4'-P energy: -73.663 bonds (distance) P-C4' energy: -72.072 flat angles C4'-P-C4' energy: -82.447 flat angles P-C4'-P energy: -56.182 tors. eta vs tors. theta energy: -95.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -1221.168023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1221.168023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1221.168023 (E_RNA) where: Base-Base interactions energy: -831.676 where: short stacking energy: -372.470 Base-Backbone interact. energy: -1.967 local terms energy: -387.525018 where: bonds (distance) C4'-P energy: -77.777 bonds (distance) P-C4' energy: -80.831 flat angles C4'-P-C4' energy: -76.612 flat angles P-C4'-P energy: -47.891 tors. eta vs tors. theta energy: -104.414 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -1072.639796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1072.639796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1072.639796 (E_RNA) where: Base-Base interactions energy: -719.537 where: short stacking energy: -335.344 Base-Backbone interact. energy: -0.602 local terms energy: -352.500857 where: bonds (distance) C4'-P energy: -73.588 bonds (distance) P-C4' energy: -67.380 flat angles C4'-P-C4' energy: -78.535 flat angles P-C4'-P energy: -44.644 tors. eta vs tors. theta energy: -88.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -896.972597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.972597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.972597 (E_RNA) where: Base-Base interactions energy: -599.774 where: short stacking energy: -263.044 Base-Backbone interact. energy: -3.108 local terms energy: -294.090643 where: bonds (distance) C4'-P energy: -65.648 bonds (distance) P-C4' energy: -71.561 flat angles C4'-P-C4' energy: -71.822 flat angles P-C4'-P energy: -34.134 tors. eta vs tors. theta energy: -50.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -853.847879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -853.847879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -853.847879 (E_RNA) where: Base-Base interactions energy: -546.443 where: short stacking energy: -254.117 Base-Backbone interact. energy: 0.554 local terms energy: -307.959141 where: bonds (distance) C4'-P energy: -61.705 bonds (distance) P-C4' energy: -72.270 flat angles C4'-P-C4' energy: -77.656 flat angles P-C4'-P energy: -49.239 tors. eta vs tors. theta energy: -47.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -941.268563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -941.268563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -941.268563 (E_RNA) where: Base-Base interactions energy: -627.950 where: short stacking energy: -263.067 Base-Backbone interact. energy: 3.874 local terms energy: -317.191946 where: bonds (distance) C4'-P energy: -75.395 bonds (distance) P-C4' energy: -73.602 flat angles C4'-P-C4' energy: -71.131 flat angles P-C4'-P energy: -37.325 tors. eta vs tors. theta energy: -59.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -490.414995 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -490.414995 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -490.414995 (E_RNA) where: Base-Base interactions energy: -229.905 where: short stacking energy: -143.245 Base-Backbone interact. energy: -1.384 local terms energy: -259.126510 where: bonds (distance) C4'-P energy: -66.522 bonds (distance) P-C4' energy: -80.731 flat angles C4'-P-C4' energy: -66.054 flat angles P-C4'-P energy: -35.363 tors. eta vs tors. theta energy: -10.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -1438.595765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1438.595765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1438.595765 (E_RNA) where: Base-Base interactions energy: -987.094 where: short stacking energy: -428.367 Base-Backbone interact. energy: -0.652 local terms energy: -450.849644 where: bonds (distance) C4'-P energy: -80.707 bonds (distance) P-C4' energy: -82.665 flat angles C4'-P-C4' energy: -98.267 flat angles P-C4'-P energy: -69.602 tors. eta vs tors. theta energy: -119.609 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -1408.308433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.308433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.308433 (E_RNA) where: Base-Base interactions energy: -972.540 where: short stacking energy: -409.229 Base-Backbone interact. energy: -3.005 local terms energy: -432.764025 where: bonds (distance) C4'-P energy: -84.111 bonds (distance) P-C4' energy: -86.573 flat angles C4'-P-C4' energy: -96.707 flat angles P-C4'-P energy: -53.335 tors. eta vs tors. theta energy: -112.039 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -1298.159384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.159384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.159384 (E_RNA) where: Base-Base interactions energy: -888.986 where: short stacking energy: -400.382 Base-Backbone interact. energy: -1.660 local terms energy: -407.513623 where: bonds (distance) C4'-P energy: -79.426 bonds (distance) P-C4' energy: -79.106 flat angles C4'-P-C4' energy: -83.728 flat angles P-C4'-P energy: -63.109 tors. eta vs tors. theta energy: -102.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -1272.035198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.035198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.035198 (E_RNA) where: Base-Base interactions energy: -874.400 where: short stacking energy: -344.403 Base-Backbone interact. energy: 2.469 local terms energy: -400.104570 where: bonds (distance) C4'-P energy: -79.653 bonds (distance) P-C4' energy: -79.001 flat angles C4'-P-C4' energy: -88.124 flat angles P-C4'-P energy: -58.132 tors. eta vs tors. theta energy: -95.195 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -1215.800557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.800557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.800557 (E_RNA) where: Base-Base interactions energy: -834.756 where: short stacking energy: -377.671 Base-Backbone interact. energy: 4.858 local terms energy: -385.902266 where: bonds (distance) C4'-P energy: -67.076 bonds (distance) P-C4' energy: -81.747 flat angles C4'-P-C4' energy: -89.489 flat angles P-C4'-P energy: -43.125 tors. eta vs tors. theta energy: -104.465 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -1038.178511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.178511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.178511 (E_RNA) where: Base-Base interactions energy: -693.335 where: short stacking energy: -311.762 Base-Backbone interact. energy: -1.006 local terms energy: -343.838097 where: bonds (distance) C4'-P energy: -74.008 bonds (distance) P-C4' energy: -78.497 flat angles C4'-P-C4' energy: -79.506 flat angles P-C4'-P energy: -43.992 tors. eta vs tors. theta energy: -67.835 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -939.175637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -939.175637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -939.175637 (E_RNA) where: Base-Base interactions energy: -614.490 where: short stacking energy: -284.579 Base-Backbone interact. energy: -1.152 local terms energy: -323.534382 where: bonds (distance) C4'-P energy: -70.346 bonds (distance) P-C4' energy: -75.477 flat angles C4'-P-C4' energy: -74.483 flat angles P-C4'-P energy: -42.026 tors. eta vs tors. theta energy: -61.203 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -994.809062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -994.809062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -994.809062 (E_RNA) where: Base-Base interactions energy: -684.296 where: short stacking energy: -281.077 Base-Backbone interact. energy: 2.118 local terms energy: -312.630858 where: bonds (distance) C4'-P energy: -61.497 bonds (distance) P-C4' energy: -75.875 flat angles C4'-P-C4' energy: -80.861 flat angles P-C4'-P energy: -42.050 tors. eta vs tors. theta energy: -52.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -847.095347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -847.095347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -847.095347 (E_RNA) where: Base-Base interactions energy: -534.190 where: short stacking energy: -245.774 Base-Backbone interact. energy: -2.190 local terms energy: -310.715555 where: bonds (distance) C4'-P energy: -63.142 bonds (distance) P-C4' energy: -89.527 flat angles C4'-P-C4' energy: -60.447 flat angles P-C4'-P energy: -53.839 tors. eta vs tors. theta energy: -43.760 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -486.659047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -486.659047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -486.659047 (E_RNA) where: Base-Base interactions energy: -238.980 where: short stacking energy: -159.235 Base-Backbone interact. energy: -0.919 local terms energy: -246.760064 where: bonds (distance) C4'-P energy: -67.178 bonds (distance) P-C4' energy: -59.596 flat angles C4'-P-C4' energy: -63.642 flat angles P-C4'-P energy: -38.950 tors. eta vs tors. theta energy: -17.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -1451.252130 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1451.252130 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1451.252130 (E_RNA) where: Base-Base interactions energy: -1020.807 where: short stacking energy: -426.028 Base-Backbone interact. energy: -2.398 local terms energy: -428.046906 where: bonds (distance) C4'-P energy: -77.992 bonds (distance) P-C4' energy: -73.222 flat angles C4'-P-C4' energy: -99.794 flat angles P-C4'-P energy: -62.447 tors. eta vs tors. theta energy: -114.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -1420.097508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.097508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.097508 (E_RNA) where: Base-Base interactions energy: -993.382 where: short stacking energy: -420.604 Base-Backbone interact. energy: -3.273 local terms energy: -423.441813 where: bonds (distance) C4'-P energy: -76.779 bonds (distance) P-C4' energy: -78.384 flat angles C4'-P-C4' energy: -89.785 flat angles P-C4'-P energy: -60.918 tors. eta vs tors. theta energy: -117.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -1314.882917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.882917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.882917 (E_RNA) where: Base-Base interactions energy: -901.790 where: short stacking energy: -387.765 Base-Backbone interact. energy: 0.297 local terms energy: -413.389543 where: bonds (distance) C4'-P energy: -84.088 bonds (distance) P-C4' energy: -82.256 flat angles C4'-P-C4' energy: -92.257 flat angles P-C4'-P energy: -59.541 tors. eta vs tors. theta energy: -95.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -1271.829083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.829083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.829083 (E_RNA) where: Base-Base interactions energy: -853.589 where: short stacking energy: -383.806 Base-Backbone interact. energy: -2.196 local terms energy: -416.043553 where: bonds (distance) C4'-P energy: -78.774 bonds (distance) P-C4' energy: -84.196 flat angles C4'-P-C4' energy: -94.402 flat angles P-C4'-P energy: -49.488 tors. eta vs tors. theta energy: -109.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -1189.632601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1189.632601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1189.632601 (E_RNA) where: Base-Base interactions energy: -808.559 where: short stacking energy: -372.904 Base-Backbone interact. energy: 1.528 local terms energy: -382.601260 where: bonds (distance) C4'-P energy: -61.267 bonds (distance) P-C4' energy: -82.082 flat angles C4'-P-C4' energy: -75.284 flat angles P-C4'-P energy: -50.160 tors. eta vs tors. theta energy: -113.807 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -1047.373226 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1047.373226 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1047.373226 (E_RNA) where: Base-Base interactions energy: -705.279 where: short stacking energy: -306.247 Base-Backbone interact. energy: 2.994 local terms energy: -345.088489 where: bonds (distance) C4'-P energy: -71.027 bonds (distance) P-C4' energy: -69.618 flat angles C4'-P-C4' energy: -81.586 flat angles P-C4'-P energy: -52.815 tors. eta vs tors. theta energy: -70.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -945.439996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.439996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.439996 (E_RNA) where: Base-Base interactions energy: -622.708 where: short stacking energy: -284.207 Base-Backbone interact. energy: -2.011 local terms energy: -320.720674 where: bonds (distance) C4'-P energy: -50.207 bonds (distance) P-C4' energy: -73.353 flat angles C4'-P-C4' energy: -85.717 flat angles P-C4'-P energy: -53.880 tors. eta vs tors. theta energy: -57.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -963.656747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.656747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.656747 (E_RNA) where: Base-Base interactions energy: -650.720 where: short stacking energy: -281.994 Base-Backbone interact. energy: 0.684 local terms energy: -313.621192 where: bonds (distance) C4'-P energy: -74.438 bonds (distance) P-C4' energy: -57.160 flat angles C4'-P-C4' energy: -83.006 flat angles P-C4'-P energy: -38.347 tors. eta vs tors. theta energy: -60.671 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -740.614832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -740.614832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -740.614832 (E_RNA) where: Base-Base interactions energy: -456.665 where: short stacking energy: -208.588 Base-Backbone interact. energy: -1.148 local terms energy: -282.801400 where: bonds (distance) C4'-P energy: -70.719 bonds (distance) P-C4' energy: -75.916 flat angles C4'-P-C4' energy: -74.727 flat angles P-C4'-P energy: -28.547 tors. eta vs tors. theta energy: -32.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -438.601576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.601576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.601576 (E_RNA) where: Base-Base interactions energy: -222.284 where: short stacking energy: -136.675 Base-Backbone interact. energy: 1.692 local terms energy: -218.009554 where: bonds (distance) C4'-P energy: -63.804 bonds (distance) P-C4' energy: -69.997 flat angles C4'-P-C4' energy: -50.549 flat angles P-C4'-P energy: -39.395 tors. eta vs tors. theta energy: 5.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -1463.507678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.507678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.507678 (E_RNA) where: Base-Base interactions energy: -1036.624 where: short stacking energy: -447.692 Base-Backbone interact. energy: -3.689 local terms energy: -423.194607 where: bonds (distance) C4'-P energy: -78.924 bonds (distance) P-C4' energy: -74.822 flat angles C4'-P-C4' energy: -97.717 flat angles P-C4'-P energy: -62.672 tors. eta vs tors. theta energy: -109.060 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -1433.570664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1433.570664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1433.570664 (E_RNA) where: Base-Base interactions energy: -975.471 where: short stacking energy: -417.189 Base-Backbone interact. energy: -2.043 local terms energy: -456.056453 where: bonds (distance) C4'-P energy: -84.163 bonds (distance) P-C4' energy: -88.999 flat angles C4'-P-C4' energy: -97.441 flat angles P-C4'-P energy: -67.244 tors. eta vs tors. theta energy: -118.210 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -1273.179020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.179020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.179020 (E_RNA) where: Base-Base interactions energy: -887.520 where: short stacking energy: -382.886 Base-Backbone interact. energy: -1.318 local terms energy: -384.341430 where: bonds (distance) C4'-P energy: -70.890 bonds (distance) P-C4' energy: -78.914 flat angles C4'-P-C4' energy: -90.958 flat angles P-C4'-P energy: -45.988 tors. eta vs tors. theta energy: -97.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -1277.241955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1277.241955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.241955 (E_RNA) where: Base-Base interactions energy: -846.838 where: short stacking energy: -392.917 Base-Backbone interact. energy: -4.042 local terms energy: -426.361540 where: bonds (distance) C4'-P energy: -77.535 bonds (distance) P-C4' energy: -73.830 flat angles C4'-P-C4' energy: -94.594 flat angles P-C4'-P energy: -64.249 tors. eta vs tors. theta energy: -116.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -1230.356451 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1230.356451 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1230.356451 (E_RNA) where: Base-Base interactions energy: -852.228 where: short stacking energy: -365.051 Base-Backbone interact. energy: -4.171 local terms energy: -373.957401 where: bonds (distance) C4'-P energy: -64.515 bonds (distance) P-C4' energy: -72.859 flat angles C4'-P-C4' energy: -89.923 flat angles P-C4'-P energy: -48.385 tors. eta vs tors. theta energy: -98.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -1059.050891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.050891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.050891 (E_RNA) where: Base-Base interactions energy: -719.860 where: short stacking energy: -319.563 Base-Backbone interact. energy: -1.257 local terms energy: -337.934127 where: bonds (distance) C4'-P energy: -60.787 bonds (distance) P-C4' energy: -73.318 flat angles C4'-P-C4' energy: -90.400 flat angles P-C4'-P energy: -38.436 tors. eta vs tors. theta energy: -74.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -1039.438350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1039.438350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1039.438350 (E_RNA) where: Base-Base interactions energy: -686.872 where: short stacking energy: -312.367 Base-Backbone interact. energy: 4.446 local terms energy: -357.012379 where: bonds (distance) C4'-P energy: -65.116 bonds (distance) P-C4' energy: -74.410 flat angles C4'-P-C4' energy: -85.439 flat angles P-C4'-P energy: -57.597 tors. eta vs tors. theta energy: -74.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -969.110685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -969.110685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -969.110685 (E_RNA) where: Base-Base interactions energy: -658.949 where: short stacking energy: -299.404 Base-Backbone interact. energy: -0.886 local terms energy: -309.276438 where: bonds (distance) C4'-P energy: -63.736 bonds (distance) P-C4' energy: -68.904 flat angles C4'-P-C4' energy: -75.630 flat angles P-C4'-P energy: -42.261 tors. eta vs tors. theta energy: -58.746 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -769.909516 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -769.909516 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -769.909516 (E_RNA) where: Base-Base interactions energy: -475.204 where: short stacking energy: -202.818 Base-Backbone interact. energy: 1.568 local terms energy: -296.273337 where: bonds (distance) C4'-P energy: -69.104 bonds (distance) P-C4' energy: -72.096 flat angles C4'-P-C4' energy: -80.966 flat angles P-C4'-P energy: -39.287 tors. eta vs tors. theta energy: -34.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -432.480592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.480592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.480592 (E_RNA) where: Base-Base interactions energy: -193.419 where: short stacking energy: -104.325 Base-Backbone interact. energy: 1.150 local terms energy: -240.211970 where: bonds (distance) C4'-P energy: -69.501 bonds (distance) P-C4' energy: -77.078 flat angles C4'-P-C4' energy: -65.149 flat angles P-C4'-P energy: -32.918 tors. eta vs tors. theta energy: 4.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -1469.508990 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.508990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.508990 (E_RNA) where: Base-Base interactions energy: -1014.456 where: short stacking energy: -435.938 Base-Backbone interact. energy: -1.937 local terms energy: -453.116041 where: bonds (distance) C4'-P energy: -88.938 bonds (distance) P-C4' energy: -82.010 flat angles C4'-P-C4' energy: -98.566 flat angles P-C4'-P energy: -69.197 tors. eta vs tors. theta energy: -114.405 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -1420.119969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.119969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.119969 (E_RNA) where: Base-Base interactions energy: -982.149 where: short stacking energy: -425.522 Base-Backbone interact. energy: -0.931 local terms energy: -437.040257 where: bonds (distance) C4'-P energy: -76.745 bonds (distance) P-C4' energy: -81.689 flat angles C4'-P-C4' energy: -96.228 flat angles P-C4'-P energy: -68.829 tors. eta vs tors. theta energy: -113.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -1261.955795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1261.955795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1261.955795 (E_RNA) where: Base-Base interactions energy: -839.754 where: short stacking energy: -394.112 Base-Backbone interact. energy: -2.268 local terms energy: -419.934426 where: bonds (distance) C4'-P energy: -73.271 bonds (distance) P-C4' energy: -79.537 flat angles C4'-P-C4' energy: -91.550 flat angles P-C4'-P energy: -60.847 tors. eta vs tors. theta energy: -114.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -1262.340733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.340733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.340733 (E_RNA) where: Base-Base interactions energy: -854.609 where: short stacking energy: -378.521 Base-Backbone interact. energy: -1.180 local terms energy: -406.551761 where: bonds (distance) C4'-P energy: -82.662 bonds (distance) P-C4' energy: -76.494 flat angles C4'-P-C4' energy: -87.679 flat angles P-C4'-P energy: -53.016 tors. eta vs tors. theta energy: -106.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -1238.898845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1238.898845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1238.898845 (E_RNA) where: Base-Base interactions energy: -855.457 where: short stacking energy: -375.389 Base-Backbone interact. energy: 0.949 local terms energy: -384.390489 where: bonds (distance) C4'-P energy: -71.741 bonds (distance) P-C4' energy: -69.667 flat angles C4'-P-C4' energy: -88.574 flat angles P-C4'-P energy: -58.011 tors. eta vs tors. theta energy: -96.398 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -1049.282326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1049.282326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1049.282326 (E_RNA) where: Base-Base interactions energy: -707.496 where: short stacking energy: -308.255 Base-Backbone interact. energy: 0.346 local terms energy: -342.131907 where: bonds (distance) C4'-P energy: -56.439 bonds (distance) P-C4' energy: -78.577 flat angles C4'-P-C4' energy: -80.471 flat angles P-C4'-P energy: -52.521 tors. eta vs tors. theta energy: -74.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -1009.136984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1009.136984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1009.136984 (E_RNA) where: Base-Base interactions energy: -661.214 where: short stacking energy: -290.438 Base-Backbone interact. energy: -0.618 local terms energy: -347.305281 where: bonds (distance) C4'-P energy: -59.328 bonds (distance) P-C4' energy: -74.613 flat angles C4'-P-C4' energy: -83.953 flat angles P-C4'-P energy: -62.486 tors. eta vs tors. theta energy: -66.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -912.632024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.632024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.632024 (E_RNA) where: Base-Base interactions energy: -591.615 where: short stacking energy: -275.036 Base-Backbone interact. energy: -2.300 local terms energy: -318.717331 where: bonds (distance) C4'-P energy: -60.120 bonds (distance) P-C4' energy: -78.401 flat angles C4'-P-C4' energy: -82.587 flat angles P-C4'-P energy: -47.045 tors. eta vs tors. theta energy: -50.564 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -705.432020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -705.432020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -705.432020 (E_RNA) where: Base-Base interactions energy: -436.002 where: short stacking energy: -210.596 Base-Backbone interact. energy: -0.133 local terms energy: -269.297071 where: bonds (distance) C4'-P energy: -53.171 bonds (distance) P-C4' energy: -78.102 flat angles C4'-P-C4' energy: -69.720 flat angles P-C4'-P energy: -41.727 tors. eta vs tors. theta energy: -26.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -449.730553 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.730553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.730553 (E_RNA) where: Base-Base interactions energy: -203.948 where: short stacking energy: -134.102 Base-Backbone interact. energy: 1.574 local terms energy: -247.356773 where: bonds (distance) C4'-P energy: -52.928 bonds (distance) P-C4' energy: -80.315 flat angles C4'-P-C4' energy: -68.346 flat angles P-C4'-P energy: -42.482 tors. eta vs tors. theta energy: -3.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -1465.957138 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.957138 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.957138 (E_RNA) where: Base-Base interactions energy: -1027.347 where: short stacking energy: -448.266 Base-Backbone interact. energy: -1.101 local terms energy: -437.508779 where: bonds (distance) C4'-P energy: -76.178 bonds (distance) P-C4' energy: -72.696 flat angles C4'-P-C4' energy: -102.856 flat angles P-C4'-P energy: -62.777 tors. eta vs tors. theta energy: -123.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -1415.699583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.699583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.699583 (E_RNA) where: Base-Base interactions energy: -1004.621 where: short stacking energy: -418.284 Base-Backbone interact. energy: 0.965 local terms energy: -412.042930 where: bonds (distance) C4'-P energy: -80.149 bonds (distance) P-C4' energy: -87.503 flat angles C4'-P-C4' energy: -90.251 flat angles P-C4'-P energy: -49.887 tors. eta vs tors. theta energy: -104.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -1261.766478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1261.766478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1261.766478 (E_RNA) where: Base-Base interactions energy: -859.688 where: short stacking energy: -387.365 Base-Backbone interact. energy: 0.433 local terms energy: -402.510894 where: bonds (distance) C4'-P energy: -85.978 bonds (distance) P-C4' energy: -76.525 flat angles C4'-P-C4' energy: -95.607 flat angles P-C4'-P energy: -46.006 tors. eta vs tors. theta energy: -98.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -1248.003367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1248.003367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1248.003367 (E_RNA) where: Base-Base interactions energy: -851.822 where: short stacking energy: -367.723 Base-Backbone interact. energy: -0.476 local terms energy: -395.705680 where: bonds (distance) C4'-P energy: -76.519 bonds (distance) P-C4' energy: -86.721 flat angles C4'-P-C4' energy: -86.143 flat angles P-C4'-P energy: -52.023 tors. eta vs tors. theta energy: -94.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -1202.020812 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1202.020812 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1202.020812 (E_RNA) where: Base-Base interactions energy: -827.183 where: short stacking energy: -366.583 Base-Backbone interact. energy: -3.358 local terms energy: -371.479729 where: bonds (distance) C4'-P energy: -72.066 bonds (distance) P-C4' energy: -77.124 flat angles C4'-P-C4' energy: -78.855 flat angles P-C4'-P energy: -46.218 tors. eta vs tors. theta energy: -97.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -1068.485412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.485412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.485412 (E_RNA) where: Base-Base interactions energy: -737.989 where: short stacking energy: -324.411 Base-Backbone interact. energy: 3.298 local terms energy: -333.793700 where: bonds (distance) C4'-P energy: -58.747 bonds (distance) P-C4' energy: -68.863 flat angles C4'-P-C4' energy: -77.787 flat angles P-C4'-P energy: -53.015 tors. eta vs tors. theta energy: -75.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -1052.150873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.150873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1052.150873 (E_RNA) where: Base-Base interactions energy: -737.068 where: short stacking energy: -306.571 Base-Backbone interact. energy: 0.400 local terms energy: -315.482193 where: bonds (distance) C4'-P energy: -64.745 bonds (distance) P-C4' energy: -65.142 flat angles C4'-P-C4' energy: -76.531 flat angles P-C4'-P energy: -42.555 tors. eta vs tors. theta energy: -66.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -866.053938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -866.053938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -866.053938 (E_RNA) where: Base-Base interactions energy: -562.062 where: short stacking energy: -252.585 Base-Backbone interact. energy: -0.507 local terms energy: -303.484905 where: bonds (distance) C4'-P energy: -74.186 bonds (distance) P-C4' energy: -73.823 flat angles C4'-P-C4' energy: -68.198 flat angles P-C4'-P energy: -37.276 tors. eta vs tors. theta energy: -50.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -754.641010 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -754.641010 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -754.641010 (E_RNA) where: Base-Base interactions energy: -489.386 where: short stacking energy: -231.616 Base-Backbone interact. energy: 8.582 local terms energy: -273.836493 where: bonds (distance) C4'-P energy: -70.773 bonds (distance) P-C4' energy: -66.715 flat angles C4'-P-C4' energy: -65.016 flat angles P-C4'-P energy: -35.101 tors. eta vs tors. theta energy: -36.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -432.266049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.266049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.266049 (E_RNA) where: Base-Base interactions energy: -195.473 where: short stacking energy: -117.346 Base-Backbone interact. energy: 0.249 local terms energy: -237.041730 where: bonds (distance) C4'-P energy: -73.483 bonds (distance) P-C4' energy: -67.189 flat angles C4'-P-C4' energy: -58.316 flat angles P-C4'-P energy: -46.143 tors. eta vs tors. theta energy: 8.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -1484.166750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1484.166750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1484.166750 (E_RNA) where: Base-Base interactions energy: -1031.375 where: short stacking energy: -448.667 Base-Backbone interact. energy: -0.250 local terms energy: -452.541058 where: bonds (distance) C4'-P energy: -71.461 bonds (distance) P-C4' energy: -92.116 flat angles C4'-P-C4' energy: -97.948 flat angles P-C4'-P energy: -66.585 tors. eta vs tors. theta energy: -124.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -1406.761371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1406.761371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1406.761371 (E_RNA) where: Base-Base interactions energy: -984.601 where: short stacking energy: -434.690 Base-Backbone interact. energy: -2.050 local terms energy: -420.110423 where: bonds (distance) C4'-P energy: -80.427 bonds (distance) P-C4' energy: -77.981 flat angles C4'-P-C4' energy: -90.186 flat angles P-C4'-P energy: -58.479 tors. eta vs tors. theta energy: -113.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -1344.860594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1344.860594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1344.860594 (E_RNA) where: Base-Base interactions energy: -929.538 where: short stacking energy: -397.416 Base-Backbone interact. energy: -0.878 local terms energy: -414.443826 where: bonds (distance) C4'-P energy: -87.007 bonds (distance) P-C4' energy: -83.319 flat angles C4'-P-C4' energy: -78.335 flat angles P-C4'-P energy: -57.413 tors. eta vs tors. theta energy: -108.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -1256.072245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1256.072245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1256.072245 (E_RNA) where: Base-Base interactions energy: -839.576 where: short stacking energy: -379.981 Base-Backbone interact. energy: -4.156 local terms energy: -412.340337 where: bonds (distance) C4'-P energy: -88.084 bonds (distance) P-C4' energy: -71.397 flat angles C4'-P-C4' energy: -90.312 flat angles P-C4'-P energy: -54.076 tors. eta vs tors. theta energy: -108.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -1145.104573 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1145.104573 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1145.104573 (E_RNA) where: Base-Base interactions energy: -759.186 where: short stacking energy: -348.562 Base-Backbone interact. energy: 1.839 local terms energy: -387.756939 where: bonds (distance) C4'-P energy: -81.886 bonds (distance) P-C4' energy: -82.436 flat angles C4'-P-C4' energy: -87.149 flat angles P-C4'-P energy: -51.214 tors. eta vs tors. theta energy: -85.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -1060.576685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1060.576685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1060.576685 (E_RNA) where: Base-Base interactions energy: -718.528 where: short stacking energy: -313.482 Base-Backbone interact. energy: -0.193 local terms energy: -341.856131 where: bonds (distance) C4'-P energy: -63.813 bonds (distance) P-C4' energy: -77.748 flat angles C4'-P-C4' energy: -70.866 flat angles P-C4'-P energy: -57.597 tors. eta vs tors. theta energy: -71.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -1070.294301 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1070.294301 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1070.294301 (E_RNA) where: Base-Base interactions energy: -730.313 where: short stacking energy: -306.657 Base-Backbone interact. energy: 3.728 local terms energy: -343.709861 where: bonds (distance) C4'-P energy: -76.209 bonds (distance) P-C4' energy: -58.953 flat angles C4'-P-C4' energy: -80.267 flat angles P-C4'-P energy: -56.253 tors. eta vs tors. theta energy: -72.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -889.820287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -889.820287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -889.820287 (E_RNA) where: Base-Base interactions energy: -586.451 where: short stacking energy: -268.058 Base-Backbone interact. energy: 0.093 local terms energy: -303.462015 where: bonds (distance) C4'-P energy: -64.804 bonds (distance) P-C4' energy: -75.711 flat angles C4'-P-C4' energy: -69.806 flat angles P-C4'-P energy: -40.482 tors. eta vs tors. theta energy: -52.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -750.762944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.762944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.762944 (E_RNA) where: Base-Base interactions energy: -469.687 where: short stacking energy: -226.923 Base-Backbone interact. energy: 0.998 local terms energy: -282.074301 where: bonds (distance) C4'-P energy: -52.910 bonds (distance) P-C4' energy: -77.675 flat angles C4'-P-C4' energy: -72.860 flat angles P-C4'-P energy: -43.734 tors. eta vs tors. theta energy: -34.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -454.946166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.946166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.946166 (E_RNA) where: Base-Base interactions energy: -232.863 where: short stacking energy: -140.132 Base-Backbone interact. energy: -1.128 local terms energy: -220.955333 where: bonds (distance) C4'-P energy: -66.910 bonds (distance) P-C4' energy: -59.587 flat angles C4'-P-C4' energy: -58.339 flat angles P-C4'-P energy: -36.421 tors. eta vs tors. theta energy: 0.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -1471.660568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.660568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.660568 (E_RNA) where: Base-Base interactions energy: -1009.258 where: short stacking energy: -438.481 Base-Backbone interact. energy: -3.016 local terms energy: -459.386886 where: bonds (distance) C4'-P energy: -85.376 bonds (distance) P-C4' energy: -85.129 flat angles C4'-P-C4' energy: -93.400 flat angles P-C4'-P energy: -71.164 tors. eta vs tors. theta energy: -124.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -1414.034533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1414.034533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1414.034533 (E_RNA) where: Base-Base interactions energy: -985.429 where: short stacking energy: -431.771 Base-Backbone interact. energy: -2.017 local terms energy: -426.588428 where: bonds (distance) C4'-P energy: -87.786 bonds (distance) P-C4' energy: -74.095 flat angles C4'-P-C4' energy: -95.729 flat angles P-C4'-P energy: -57.997 tors. eta vs tors. theta energy: -110.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -1341.040182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.040182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1341.040182 (E_RNA) where: Base-Base interactions energy: -938.266 where: short stacking energy: -387.990 Base-Backbone interact. energy: -4.052 local terms energy: -398.722565 where: bonds (distance) C4'-P energy: -75.453 bonds (distance) P-C4' energy: -82.746 flat angles C4'-P-C4' energy: -94.837 flat angles P-C4'-P energy: -47.450 tors. eta vs tors. theta energy: -98.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -1218.781234 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.781234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.781234 (E_RNA) where: Base-Base interactions energy: -826.385 where: short stacking energy: -369.011 Base-Backbone interact. energy: -0.744 local terms energy: -391.652149 where: bonds (distance) C4'-P energy: -77.261 bonds (distance) P-C4' energy: -70.156 flat angles C4'-P-C4' energy: -90.724 flat angles P-C4'-P energy: -44.373 tors. eta vs tors. theta energy: -109.138 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -1197.478167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1197.478167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1197.478167 (E_RNA) where: Base-Base interactions energy: -798.699 where: short stacking energy: -380.472 Base-Backbone interact. energy: 5.324 local terms energy: -404.103361 where: bonds (distance) C4'-P energy: -73.423 bonds (distance) P-C4' energy: -77.168 flat angles C4'-P-C4' energy: -92.896 flat angles P-C4'-P energy: -59.628 tors. eta vs tors. theta energy: -100.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -1136.180137 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1136.180137 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1136.180137 (E_RNA) where: Base-Base interactions energy: -771.937 where: short stacking energy: -343.537 Base-Backbone interact. energy: -1.217 local terms energy: -363.025952 where: bonds (distance) C4'-P energy: -69.250 bonds (distance) P-C4' energy: -81.846 flat angles C4'-P-C4' energy: -78.704 flat angles P-C4'-P energy: -53.682 tors. eta vs tors. theta energy: -79.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -993.853430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.853430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.853430 (E_RNA) where: Base-Base interactions energy: -680.315 where: short stacking energy: -275.427 Base-Backbone interact. energy: -3.708 local terms energy: -309.830513 where: bonds (distance) C4'-P energy: -69.749 bonds (distance) P-C4' energy: -73.743 flat angles C4'-P-C4' energy: -78.441 flat angles P-C4'-P energy: -33.505 tors. eta vs tors. theta energy: -54.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -879.724983 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.724983 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.724983 (E_RNA) where: Base-Base interactions energy: -597.909 where: short stacking energy: -251.292 Base-Backbone interact. energy: -2.202 local terms energy: -279.613966 where: bonds (distance) C4'-P energy: -47.084 bonds (distance) P-C4' energy: -72.139 flat angles C4'-P-C4' energy: -70.946 flat angles P-C4'-P energy: -47.173 tors. eta vs tors. theta energy: -42.273 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -743.144599 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -743.144599 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -743.144599 (E_RNA) where: Base-Base interactions energy: -478.841 where: short stacking energy: -233.368 Base-Backbone interact. energy: -1.269 local terms energy: -263.034832 where: bonds (distance) C4'-P energy: -54.332 bonds (distance) P-C4' energy: -67.509 flat angles C4'-P-C4' energy: -74.377 flat angles P-C4'-P energy: -43.644 tors. eta vs tors. theta energy: -23.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -444.455766 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.455766 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.455766 (E_RNA) where: Base-Base interactions energy: -204.854 where: short stacking energy: -134.019 Base-Backbone interact. energy: 0.078 local terms energy: -239.679595 where: bonds (distance) C4'-P energy: -69.781 bonds (distance) P-C4' energy: -63.145 flat angles C4'-P-C4' energy: -73.459 flat angles P-C4'-P energy: -27.026 tors. eta vs tors. theta energy: -6.269 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -1464.195377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.195377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.195377 (E_RNA) where: Base-Base interactions energy: -996.970 where: short stacking energy: -447.089 Base-Backbone interact. energy: -3.936 local terms energy: -463.289478 where: bonds (distance) C4'-P energy: -77.640 bonds (distance) P-C4' energy: -91.606 flat angles C4'-P-C4' energy: -99.502 flat angles P-C4'-P energy: -66.837 tors. eta vs tors. theta energy: -127.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -1401.542676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1401.542676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1401.542676 (E_RNA) where: Base-Base interactions energy: -970.840 where: short stacking energy: -409.911 Base-Backbone interact. energy: -1.943 local terms energy: -428.759303 where: bonds (distance) C4'-P energy: -83.657 bonds (distance) P-C4' energy: -77.944 flat angles C4'-P-C4' energy: -96.197 flat angles P-C4'-P energy: -57.749 tors. eta vs tors. theta energy: -113.212 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -1339.456827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1339.456827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1339.456827 (E_RNA) where: Base-Base interactions energy: -932.208 where: short stacking energy: -379.641 Base-Backbone interact. energy: -2.736 local terms energy: -404.512050 where: bonds (distance) C4'-P energy: -68.569 bonds (distance) P-C4' energy: -85.876 flat angles C4'-P-C4' energy: -92.369 flat angles P-C4'-P energy: -57.209 tors. eta vs tors. theta energy: -100.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -1262.979483 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1262.979483 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1262.979483 (E_RNA) where: Base-Base interactions energy: -876.108 where: short stacking energy: -365.555 Base-Backbone interact. energy: -0.986 local terms energy: -385.885523 where: bonds (distance) C4'-P energy: -74.004 bonds (distance) P-C4' energy: -68.479 flat angles C4'-P-C4' energy: -83.966 flat angles P-C4'-P energy: -57.883 tors. eta vs tors. theta energy: -101.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -1182.934192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.934192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.934192 (E_RNA) where: Base-Base interactions energy: -771.125 where: short stacking energy: -343.510 Base-Backbone interact. energy: -3.043 local terms energy: -408.766324 where: bonds (distance) C4'-P energy: -86.706 bonds (distance) P-C4' energy: -84.721 flat angles C4'-P-C4' energy: -76.582 flat angles P-C4'-P energy: -65.079 tors. eta vs tors. theta energy: -95.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -1180.134036 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.134036 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.134036 (E_RNA) where: Base-Base interactions energy: -785.259 where: short stacking energy: -359.681 Base-Backbone interact. energy: -1.239 local terms energy: -393.635306 where: bonds (distance) C4'-P energy: -67.698 bonds (distance) P-C4' energy: -80.629 flat angles C4'-P-C4' energy: -86.938 flat angles P-C4'-P energy: -49.315 tors. eta vs tors. theta energy: -109.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -928.682707 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -928.682707 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -928.682707 (E_RNA) where: Base-Base interactions energy: -608.296 where: short stacking energy: -266.877 Base-Backbone interact. energy: 0.216 local terms energy: -320.602281 where: bonds (distance) C4'-P energy: -71.847 bonds (distance) P-C4' energy: -91.507 flat angles C4'-P-C4' energy: -73.480 flat angles P-C4'-P energy: -38.856 tors. eta vs tors. theta energy: -44.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -1017.199030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1017.199030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1017.199030 (E_RNA) where: Base-Base interactions energy: -691.109 where: short stacking energy: -303.747 Base-Backbone interact. energy: -0.041 local terms energy: -326.048341 where: bonds (distance) C4'-P energy: -61.541 bonds (distance) P-C4' energy: -60.314 flat angles C4'-P-C4' energy: -76.549 flat angles P-C4'-P energy: -49.927 tors. eta vs tors. theta energy: -77.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -734.761345 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -734.761345 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -734.761345 (E_RNA) where: Base-Base interactions energy: -465.565 where: short stacking energy: -238.841 Base-Backbone interact. energy: -2.090 local terms energy: -267.106159 where: bonds (distance) C4'-P energy: -64.240 bonds (distance) P-C4' energy: -74.807 flat angles C4'-P-C4' energy: -60.707 flat angles P-C4'-P energy: -38.939 tors. eta vs tors. theta energy: -28.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -449.923976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.923976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.923976 (E_RNA) where: Base-Base interactions energy: -216.668 where: short stacking energy: -142.250 Base-Backbone interact. energy: 0.252 local terms energy: -233.508271 where: bonds (distance) C4'-P energy: -75.554 bonds (distance) P-C4' energy: -60.995 flat angles C4'-P-C4' energy: -54.165 flat angles P-C4'-P energy: -31.221 tors. eta vs tors. theta energy: -11.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -1470.299637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.299637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.299637 (E_RNA) where: Base-Base interactions energy: -1017.695 where: short stacking energy: -442.869 Base-Backbone interact. energy: -1.840 local terms energy: -450.764810 where: bonds (distance) C4'-P energy: -79.701 bonds (distance) P-C4' energy: -81.946 flat angles C4'-P-C4' energy: -101.698 flat angles P-C4'-P energy: -62.086 tors. eta vs tors. theta energy: -125.334 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -1409.646297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.646297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1409.646297 (E_RNA) where: Base-Base interactions energy: -957.554 where: short stacking energy: -397.128 Base-Backbone interact. energy: -2.706 local terms energy: -449.386323 where: bonds (distance) C4'-P energy: -90.933 bonds (distance) P-C4' energy: -90.643 flat angles C4'-P-C4' energy: -102.527 flat angles P-C4'-P energy: -58.755 tors. eta vs tors. theta energy: -106.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -1311.500759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1311.500759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1311.500759 (E_RNA) where: Base-Base interactions energy: -899.882 where: short stacking energy: -376.928 Base-Backbone interact. energy: -2.752 local terms energy: -408.867005 where: bonds (distance) C4'-P energy: -65.806 bonds (distance) P-C4' energy: -85.971 flat angles C4'-P-C4' energy: -99.879 flat angles P-C4'-P energy: -60.867 tors. eta vs tors. theta energy: -96.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -1257.422176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1257.422176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1257.422176 (E_RNA) where: Base-Base interactions energy: -866.752 where: short stacking energy: -395.642 Base-Backbone interact. energy: -0.367 local terms energy: -390.303385 where: bonds (distance) C4'-P energy: -64.758 bonds (distance) P-C4' energy: -70.603 flat angles C4'-P-C4' energy: -80.317 flat angles P-C4'-P energy: -59.585 tors. eta vs tors. theta energy: -115.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -1144.485586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1144.485586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1144.485586 (E_RNA) where: Base-Base interactions energy: -772.612 where: short stacking energy: -352.562 Base-Backbone interact. energy: -0.359 local terms energy: -371.514759 where: bonds (distance) C4'-P energy: -73.080 bonds (distance) P-C4' energy: -75.659 flat angles C4'-P-C4' energy: -79.331 flat angles P-C4'-P energy: -49.256 tors. eta vs tors. theta energy: -94.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -1169.017068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1169.017068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1169.017068 (E_RNA) where: Base-Base interactions energy: -785.064 where: short stacking energy: -367.453 Base-Backbone interact. energy: -0.255 local terms energy: -383.698115 where: bonds (distance) C4'-P energy: -69.034 bonds (distance) P-C4' energy: -73.814 flat angles C4'-P-C4' energy: -87.413 flat angles P-C4'-P energy: -57.935 tors. eta vs tors. theta energy: -95.501 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -963.507342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.507342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.507342 (E_RNA) where: Base-Base interactions energy: -649.455 where: short stacking energy: -250.251 Base-Backbone interact. energy: -1.318 local terms energy: -312.734735 where: bonds (distance) C4'-P energy: -74.154 bonds (distance) P-C4' energy: -66.410 flat angles C4'-P-C4' energy: -70.241 flat angles P-C4'-P energy: -50.841 tors. eta vs tors. theta energy: -51.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -943.686034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -943.686034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -943.686034 (E_RNA) where: Base-Base interactions energy: -625.795 where: short stacking energy: -252.158 Base-Backbone interact. energy: -0.357 local terms energy: -317.534132 where: bonds (distance) C4'-P energy: -67.427 bonds (distance) P-C4' energy: -66.721 flat angles C4'-P-C4' energy: -74.825 flat angles P-C4'-P energy: -55.760 tors. eta vs tors. theta energy: -52.802 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -752.551005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -752.551005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -752.551005 (E_RNA) where: Base-Base interactions energy: -462.226 where: short stacking energy: -213.945 Base-Backbone interact. energy: 0.412 local terms energy: -290.737304 where: bonds (distance) C4'-P energy: -73.884 bonds (distance) P-C4' energy: -72.484 flat angles C4'-P-C4' energy: -62.942 flat angles P-C4'-P energy: -42.506 tors. eta vs tors. theta energy: -38.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -461.618394 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.618394 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.618394 (E_RNA) where: Base-Base interactions energy: -238.367 where: short stacking energy: -129.735 Base-Backbone interact. energy: -0.174 local terms energy: -223.078035 where: bonds (distance) C4'-P energy: -70.796 bonds (distance) P-C4' energy: -65.798 flat angles C4'-P-C4' energy: -44.219 flat angles P-C4'-P energy: -33.550 tors. eta vs tors. theta energy: -8.715 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -1481.545058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1481.545058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1481.545058 (E_RNA) where: Base-Base interactions energy: -1021.669 where: short stacking energy: -462.500 Base-Backbone interact. energy: -1.917 local terms energy: -457.958473 where: bonds (distance) C4'-P energy: -83.382 bonds (distance) P-C4' energy: -88.431 flat angles C4'-P-C4' energy: -90.784 flat angles P-C4'-P energy: -65.912 tors. eta vs tors. theta energy: -129.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -1404.715146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.715146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.715146 (E_RNA) where: Base-Base interactions energy: -979.116 where: short stacking energy: -419.386 Base-Backbone interact. energy: -0.715 local terms energy: -424.884130 where: bonds (distance) C4'-P energy: -77.647 bonds (distance) P-C4' energy: -75.401 flat angles C4'-P-C4' energy: -100.404 flat angles P-C4'-P energy: -62.783 tors. eta vs tors. theta energy: -108.650 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -1314.236145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.236145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.236145 (E_RNA) where: Base-Base interactions energy: -904.333 where: short stacking energy: -408.433 Base-Backbone interact. energy: -1.759 local terms energy: -408.144659 where: bonds (distance) C4'-P energy: -80.147 bonds (distance) P-C4' energy: -82.507 flat angles C4'-P-C4' energy: -86.007 flat angles P-C4'-P energy: -43.979 tors. eta vs tors. theta energy: -115.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -1253.006200 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1253.006200 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1253.006200 (E_RNA) where: Base-Base interactions energy: -856.934 where: short stacking energy: -386.702 Base-Backbone interact. energy: -0.725 local terms energy: -395.347393 where: bonds (distance) C4'-P energy: -83.659 bonds (distance) P-C4' energy: -77.410 flat angles C4'-P-C4' energy: -84.370 flat angles P-C4'-P energy: -48.170 tors. eta vs tors. theta energy: -101.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -1212.867846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1212.867846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1212.867846 (E_RNA) where: Base-Base interactions energy: -816.390 where: short stacking energy: -349.577 Base-Backbone interact. energy: -1.570 local terms energy: -394.907597 where: bonds (distance) C4'-P energy: -90.850 bonds (distance) P-C4' energy: -77.024 flat angles C4'-P-C4' energy: -76.649 flat angles P-C4'-P energy: -53.306 tors. eta vs tors. theta energy: -97.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -1164.879836 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1164.879836 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1164.879836 (E_RNA) where: Base-Base interactions energy: -794.186 where: short stacking energy: -338.921 Base-Backbone interact. energy: -1.364 local terms energy: -369.329102 where: bonds (distance) C4'-P energy: -75.326 bonds (distance) P-C4' energy: -72.037 flat angles C4'-P-C4' energy: -82.997 flat angles P-C4'-P energy: -52.945 tors. eta vs tors. theta energy: -86.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -1026.085574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1026.085574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1026.085574 (E_RNA) where: Base-Base interactions energy: -688.309 where: short stacking energy: -306.787 Base-Backbone interact. energy: 0.987 local terms energy: -338.763167 where: bonds (distance) C4'-P energy: -64.764 bonds (distance) P-C4' energy: -73.695 flat angles C4'-P-C4' energy: -82.179 flat angles P-C4'-P energy: -49.454 tors. eta vs tors. theta energy: -68.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -947.141005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.141005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.141005 (E_RNA) where: Base-Base interactions energy: -637.876 where: short stacking energy: -261.749 Base-Backbone interact. energy: -1.920 local terms energy: -307.344912 where: bonds (distance) C4'-P energy: -69.347 bonds (distance) P-C4' energy: -70.384 flat angles C4'-P-C4' energy: -71.632 flat angles P-C4'-P energy: -39.042 tors. eta vs tors. theta energy: -56.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -732.555341 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -732.555341 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -732.555341 (E_RNA) where: Base-Base interactions energy: -435.553 where: short stacking energy: -205.927 Base-Backbone interact. energy: -1.509 local terms energy: -295.493523 where: bonds (distance) C4'-P energy: -81.595 bonds (distance) P-C4' energy: -74.319 flat angles C4'-P-C4' energy: -62.617 flat angles P-C4'-P energy: -40.859 tors. eta vs tors. theta energy: -36.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -470.060403 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.060403 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.060403 (E_RNA) where: Base-Base interactions energy: -228.658 where: short stacking energy: -158.134 Base-Backbone interact. energy: 2.354 local terms energy: -243.755808 where: bonds (distance) C4'-P energy: -56.339 bonds (distance) P-C4' energy: -70.343 flat angles C4'-P-C4' energy: -70.682 flat angles P-C4'-P energy: -38.446 tors. eta vs tors. theta energy: -7.946 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -1477.965798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1477.965798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1477.965798 (E_RNA) where: Base-Base interactions energy: -1011.859 where: short stacking energy: -442.838 Base-Backbone interact. energy: -4.435 local terms energy: -461.672038 where: bonds (distance) C4'-P energy: -85.426 bonds (distance) P-C4' energy: -89.240 flat angles C4'-P-C4' energy: -99.904 flat angles P-C4'-P energy: -63.598 tors. eta vs tors. theta energy: -123.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -1404.840136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.840136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.840136 (E_RNA) where: Base-Base interactions energy: -970.453 where: short stacking energy: -433.519 Base-Backbone interact. energy: -0.574 local terms energy: -433.813070 where: bonds (distance) C4'-P energy: -83.133 bonds (distance) P-C4' energy: -91.003 flat angles C4'-P-C4' energy: -90.521 flat angles P-C4'-P energy: -56.262 tors. eta vs tors. theta energy: -112.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -1302.978574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1302.978574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1302.978574 (E_RNA) where: Base-Base interactions energy: -908.647 where: short stacking energy: -403.982 Base-Backbone interact. energy: 0.001 local terms energy: -394.332499 where: bonds (distance) C4'-P energy: -78.744 bonds (distance) P-C4' energy: -64.286 flat angles C4'-P-C4' energy: -99.530 flat angles P-C4'-P energy: -46.273 tors. eta vs tors. theta energy: -105.499 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -1310.893825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1310.893825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1310.893825 (E_RNA) where: Base-Base interactions energy: -912.854 where: short stacking energy: -405.121 Base-Backbone interact. energy: 2.402 local terms energy: -400.441839 where: bonds (distance) C4'-P energy: -70.373 bonds (distance) P-C4' energy: -77.797 flat angles C4'-P-C4' energy: -91.888 flat angles P-C4'-P energy: -49.897 tors. eta vs tors. theta energy: -110.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -1233.484261 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1233.484261 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1233.484261 (E_RNA) where: Base-Base interactions energy: -829.091 where: short stacking energy: -355.801 Base-Backbone interact. energy: -1.004 local terms energy: -403.389616 where: bonds (distance) C4'-P energy: -73.623 bonds (distance) P-C4' energy: -75.185 flat angles C4'-P-C4' energy: -97.656 flat angles P-C4'-P energy: -56.115 tors. eta vs tors. theta energy: -100.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -1162.716201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.716201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.716201 (E_RNA) where: Base-Base interactions energy: -791.174 where: short stacking energy: -351.958 Base-Backbone interact. energy: 1.015 local terms energy: -372.556994 where: bonds (distance) C4'-P energy: -67.419 bonds (distance) P-C4' energy: -83.092 flat angles C4'-P-C4' energy: -81.541 flat angles P-C4'-P energy: -48.374 tors. eta vs tors. theta energy: -92.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -1081.958194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1081.958194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1081.958194 (E_RNA) where: Base-Base interactions energy: -730.211 where: short stacking energy: -313.337 Base-Backbone interact. energy: -2.386 local terms energy: -349.361198 where: bonds (distance) C4'-P energy: -61.207 bonds (distance) P-C4' energy: -79.635 flat angles C4'-P-C4' energy: -83.714 flat angles P-C4'-P energy: -49.633 tors. eta vs tors. theta energy: -75.173 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -920.772378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.772378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.772378 (E_RNA) where: Base-Base interactions energy: -628.137 where: short stacking energy: -265.656 Base-Backbone interact. energy: -2.214 local terms energy: -290.421104 where: bonds (distance) C4'-P energy: -59.379 bonds (distance) P-C4' energy: -64.539 flat angles C4'-P-C4' energy: -73.863 flat angles P-C4'-P energy: -42.053 tors. eta vs tors. theta energy: -50.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -777.496217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -777.496217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -777.496217 (E_RNA) where: Base-Base interactions energy: -504.633 where: short stacking energy: -254.868 Base-Backbone interact. energy: -0.126 local terms energy: -272.737069 where: bonds (distance) C4'-P energy: -69.970 bonds (distance) P-C4' energy: -73.091 flat angles C4'-P-C4' energy: -46.957 flat angles P-C4'-P energy: -34.545 tors. eta vs tors. theta energy: -48.174 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -495.189965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -495.189965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -495.189965 (E_RNA) where: Base-Base interactions energy: -263.071 where: short stacking energy: -138.051 Base-Backbone interact. energy: -1.518 local terms energy: -230.600618 where: bonds (distance) C4'-P energy: -69.178 bonds (distance) P-C4' energy: -62.382 flat angles C4'-P-C4' energy: -66.750 flat angles P-C4'-P energy: -44.523 tors. eta vs tors. theta energy: 12.233 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -1457.981115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1457.981115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1457.981115 (E_RNA) where: Base-Base interactions energy: -1008.362 where: short stacking energy: -441.485 Base-Backbone interact. energy: -2.157 local terms energy: -447.462042 where: bonds (distance) C4'-P energy: -78.786 bonds (distance) P-C4' energy: -88.851 flat angles C4'-P-C4' energy: -92.841 flat angles P-C4'-P energy: -66.731 tors. eta vs tors. theta energy: -120.252 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -1412.583584 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.583584 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.583584 (E_RNA) where: Base-Base interactions energy: -986.697 where: short stacking energy: -416.843 Base-Backbone interact. energy: -0.847 local terms energy: -425.040322 where: bonds (distance) C4'-P energy: -68.033 bonds (distance) P-C4' energy: -81.173 flat angles C4'-P-C4' energy: -93.422 flat angles P-C4'-P energy: -67.761 tors. eta vs tors. theta energy: -114.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -1313.678179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1313.678179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1313.678179 (E_RNA) where: Base-Base interactions energy: -885.080 where: short stacking energy: -409.061 Base-Backbone interact. energy: -2.706 local terms energy: -425.892031 where: bonds (distance) C4'-P energy: -80.162 bonds (distance) P-C4' energy: -73.551 flat angles C4'-P-C4' energy: -94.313 flat angles P-C4'-P energy: -58.235 tors. eta vs tors. theta energy: -119.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -1291.992718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.992718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1291.992718 (E_RNA) where: Base-Base interactions energy: -892.521 where: short stacking energy: -392.274 Base-Backbone interact. energy: -0.838 local terms energy: -398.634489 where: bonds (distance) C4'-P energy: -80.263 bonds (distance) P-C4' energy: -79.924 flat angles C4'-P-C4' energy: -85.047 flat angles P-C4'-P energy: -45.885 tors. eta vs tors. theta energy: -107.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -1222.320000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1222.320000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1222.320000 (E_RNA) where: Base-Base interactions energy: -850.656 where: short stacking energy: -386.777 Base-Backbone interact. energy: 1.357 local terms energy: -373.020864 where: bonds (distance) C4'-P energy: -75.982 bonds (distance) P-C4' energy: -68.239 flat angles C4'-P-C4' energy: -90.492 flat angles P-C4'-P energy: -51.033 tors. eta vs tors. theta energy: -87.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -1104.136101 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1104.136101 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1104.136101 (E_RNA) where: Base-Base interactions energy: -732.229 where: short stacking energy: -339.885 Base-Backbone interact. energy: 2.641 local terms energy: -374.548065 where: bonds (distance) C4'-P energy: -73.170 bonds (distance) P-C4' energy: -75.742 flat angles C4'-P-C4' energy: -78.624 flat angles P-C4'-P energy: -60.738 tors. eta vs tors. theta energy: -86.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -1082.627815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.627815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1082.627815 (E_RNA) where: Base-Base interactions energy: -731.487 where: short stacking energy: -316.523 Base-Backbone interact. energy: -1.536 local terms energy: -349.604573 where: bonds (distance) C4'-P energy: -79.082 bonds (distance) P-C4' energy: -74.505 flat angles C4'-P-C4' energy: -71.195 flat angles P-C4'-P energy: -50.381 tors. eta vs tors. theta energy: -74.443 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -963.985322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.985322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.985322 (E_RNA) where: Base-Base interactions energy: -637.223 where: short stacking energy: -261.563 Base-Backbone interact. energy: -1.489 local terms energy: -325.272889 where: bonds (distance) C4'-P energy: -67.401 bonds (distance) P-C4' energy: -69.104 flat angles C4'-P-C4' energy: -79.010 flat angles P-C4'-P energy: -50.740 tors. eta vs tors. theta energy: -59.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -770.269775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -770.269775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -770.269775 (E_RNA) where: Base-Base interactions energy: -489.977 where: short stacking energy: -242.757 Base-Backbone interact. energy: -0.995 local terms energy: -279.298266 where: bonds (distance) C4'-P energy: -59.298 bonds (distance) P-C4' energy: -69.111 flat angles C4'-P-C4' energy: -58.732 flat angles P-C4'-P energy: -44.386 tors. eta vs tors. theta energy: -47.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -452.988023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.988023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.988023 (E_RNA) where: Base-Base interactions energy: -209.481 where: short stacking energy: -127.103 Base-Backbone interact. energy: -1.429 local terms energy: -242.077177 where: bonds (distance) C4'-P energy: -59.442 bonds (distance) P-C4' energy: -80.897 flat angles C4'-P-C4' energy: -59.597 flat angles P-C4'-P energy: -40.612 tors. eta vs tors. theta energy: -1.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -1459.488574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1459.488574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1459.488574 (E_RNA) where: Base-Base interactions energy: -999.165 where: short stacking energy: -438.959 Base-Backbone interact. energy: -2.526 local terms energy: -457.797336 where: bonds (distance) C4'-P energy: -80.488 bonds (distance) P-C4' energy: -83.309 flat angles C4'-P-C4' energy: -97.842 flat angles P-C4'-P energy: -69.325 tors. eta vs tors. theta energy: -126.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -1426.904223 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.904223 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.904223 (E_RNA) where: Base-Base interactions energy: -989.679 where: short stacking energy: -450.935 Base-Backbone interact. energy: -0.816 local terms energy: -436.408938 where: bonds (distance) C4'-P energy: -69.748 bonds (distance) P-C4' energy: -90.343 flat angles C4'-P-C4' energy: -95.148 flat angles P-C4'-P energy: -58.605 tors. eta vs tors. theta energy: -122.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -1334.300881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.300881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.300881 (E_RNA) where: Base-Base interactions energy: -915.978 where: short stacking energy: -413.242 Base-Backbone interact. energy: 0.462 local terms energy: -418.784922 where: bonds (distance) C4'-P energy: -67.746 bonds (distance) P-C4' energy: -83.303 flat angles C4'-P-C4' energy: -94.533 flat angles P-C4'-P energy: -52.647 tors. eta vs tors. theta energy: -120.556 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -1258.418652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1258.418652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.418652 (E_RNA) where: Base-Base interactions energy: -859.640 where: short stacking energy: -345.226 Base-Backbone interact. energy: 1.813 local terms energy: -400.592285 where: bonds (distance) C4'-P energy: -84.122 bonds (distance) P-C4' energy: -76.384 flat angles C4'-P-C4' energy: -79.763 flat angles P-C4'-P energy: -56.744 tors. eta vs tors. theta energy: -103.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -1208.685285 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.685285 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.685285 (E_RNA) where: Base-Base interactions energy: -838.135 where: short stacking energy: -359.096 Base-Backbone interact. energy: -2.999 local terms energy: -367.551527 where: bonds (distance) C4'-P energy: -68.480 bonds (distance) P-C4' energy: -70.657 flat angles C4'-P-C4' energy: -87.190 flat angles P-C4'-P energy: -53.289 tors. eta vs tors. theta energy: -87.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -1067.677192 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1067.677192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1067.677192 (E_RNA) where: Base-Base interactions energy: -701.875 where: short stacking energy: -330.558 Base-Backbone interact. energy: 0.776 local terms energy: -366.577863 where: bonds (distance) C4'-P energy: -69.045 bonds (distance) P-C4' energy: -73.046 flat angles C4'-P-C4' energy: -84.384 flat angles P-C4'-P energy: -51.918 tors. eta vs tors. theta energy: -88.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -1108.903927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1108.903927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1108.903927 (E_RNA) where: Base-Base interactions energy: -754.167 where: short stacking energy: -331.958 Base-Backbone interact. energy: -1.223 local terms energy: -353.513893 where: bonds (distance) C4'-P energy: -79.664 bonds (distance) P-C4' energy: -62.386 flat angles C4'-P-C4' energy: -81.114 flat angles P-C4'-P energy: -44.328 tors. eta vs tors. theta energy: -86.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -922.046762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.046762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.046762 (E_RNA) where: Base-Base interactions energy: -625.417 where: short stacking energy: -266.273 Base-Backbone interact. energy: -1.974 local terms energy: -294.655783 where: bonds (distance) C4'-P energy: -56.529 bonds (distance) P-C4' energy: -71.313 flat angles C4'-P-C4' energy: -76.617 flat angles P-C4'-P energy: -45.488 tors. eta vs tors. theta energy: -44.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -828.150047 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -828.150047 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -828.150047 (E_RNA) where: Base-Base interactions energy: -526.880 where: short stacking energy: -264.146 Base-Backbone interact. energy: 1.132 local terms energy: -302.401353 where: bonds (distance) C4'-P energy: -77.587 bonds (distance) P-C4' energy: -51.358 flat angles C4'-P-C4' energy: -78.986 flat angles P-C4'-P energy: -46.717 tors. eta vs tors. theta energy: -47.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -460.498107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.498107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.498107 (E_RNA) where: Base-Base interactions energy: -216.499 where: short stacking energy: -145.296 Base-Backbone interact. energy: -0.498 local terms energy: -243.500720 where: bonds (distance) C4'-P energy: -70.358 bonds (distance) P-C4' energy: -83.461 flat angles C4'-P-C4' energy: -53.418 flat angles P-C4'-P energy: -39.560 tors. eta vs tors. theta energy: 3.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -1456.041976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.041976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.041976 (E_RNA) where: Base-Base interactions energy: -1026.833 where: short stacking energy: -451.875 Base-Backbone interact. energy: 0.191 local terms energy: -429.400352 where: bonds (distance) C4'-P energy: -75.613 bonds (distance) P-C4' energy: -79.846 flat angles C4'-P-C4' energy: -92.161 flat angles P-C4'-P energy: -64.412 tors. eta vs tors. theta energy: -117.369 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -1449.944015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.944015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.944015 (E_RNA) where: Base-Base interactions energy: -1010.695 where: short stacking energy: -436.336 Base-Backbone interact. energy: -3.487 local terms energy: -435.761493 where: bonds (distance) C4'-P energy: -90.054 bonds (distance) P-C4' energy: -81.513 flat angles C4'-P-C4' energy: -96.619 flat angles P-C4'-P energy: -50.248 tors. eta vs tors. theta energy: -117.328 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -1345.682270 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.682270 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.682270 (E_RNA) where: Base-Base interactions energy: -897.347 where: short stacking energy: -420.365 Base-Backbone interact. energy: -0.866 local terms energy: -447.468934 where: bonds (distance) C4'-P energy: -76.518 bonds (distance) P-C4' energy: -82.382 flat angles C4'-P-C4' energy: -96.264 flat angles P-C4'-P energy: -70.972 tors. eta vs tors. theta energy: -121.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -1291.617572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1291.617572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1291.617572 (E_RNA) where: Base-Base interactions energy: -886.628 where: short stacking energy: -391.929 Base-Backbone interact. energy: 0.423 local terms energy: -405.411771 where: bonds (distance) C4'-P energy: -75.726 bonds (distance) P-C4' energy: -80.990 flat angles C4'-P-C4' energy: -87.493 flat angles P-C4'-P energy: -51.138 tors. eta vs tors. theta energy: -110.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -1209.783159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1209.783159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1209.783159 (E_RNA) where: Base-Base interactions energy: -828.670 where: short stacking energy: -345.007 Base-Backbone interact. energy: -3.249 local terms energy: -377.863983 where: bonds (distance) C4'-P energy: -74.584 bonds (distance) P-C4' energy: -74.076 flat angles C4'-P-C4' energy: -86.314 flat angles P-C4'-P energy: -55.551 tors. eta vs tors. theta energy: -87.339 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -1043.090025 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.090025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.090025 (E_RNA) where: Base-Base interactions energy: -674.552 where: short stacking energy: -307.856 Base-Backbone interact. energy: -2.419 local terms energy: -366.119064 where: bonds (distance) C4'-P energy: -73.178 bonds (distance) P-C4' energy: -70.103 flat angles C4'-P-C4' energy: -84.800 flat angles P-C4'-P energy: -58.291 tors. eta vs tors. theta energy: -79.747 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -1032.605586 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1032.605586 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1032.605586 (E_RNA) where: Base-Base interactions energy: -715.405 where: short stacking energy: -292.822 Base-Backbone interact. energy: -0.316 local terms energy: -316.883712 where: bonds (distance) C4'-P energy: -56.731 bonds (distance) P-C4' energy: -62.133 flat angles C4'-P-C4' energy: -76.788 flat angles P-C4'-P energy: -56.563 tors. eta vs tors. theta energy: -64.669 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -970.841350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -970.841350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -970.841350 (E_RNA) where: Base-Base interactions energy: -626.595 where: short stacking energy: -266.964 Base-Backbone interact. energy: 0.052 local terms energy: -344.297719 where: bonds (distance) C4'-P energy: -72.762 bonds (distance) P-C4' energy: -80.531 flat angles C4'-P-C4' energy: -79.716 flat angles P-C4'-P energy: -47.631 tors. eta vs tors. theta energy: -63.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -822.160815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -822.160815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -822.160815 (E_RNA) where: Base-Base interactions energy: -511.825 where: short stacking energy: -233.655 Base-Backbone interact. energy: -2.662 local terms energy: -307.673777 where: bonds (distance) C4'-P energy: -68.970 bonds (distance) P-C4' energy: -76.060 flat angles C4'-P-C4' energy: -80.510 flat angles P-C4'-P energy: -39.363 tors. eta vs tors. theta energy: -42.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -466.784695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.784695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.784695 (E_RNA) where: Base-Base interactions energy: -225.295 where: short stacking energy: -135.969 Base-Backbone interact. energy: -1.698 local terms energy: -239.791568 where: bonds (distance) C4'-P energy: -73.771 bonds (distance) P-C4' energy: -84.113 flat angles C4'-P-C4' energy: -49.034 flat angles P-C4'-P energy: -41.942 tors. eta vs tors. theta energy: 9.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -1442.251172 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.251172 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.251172 (E_RNA) where: Base-Base interactions energy: -993.145 where: short stacking energy: -414.343 Base-Backbone interact. energy: 2.829 local terms energy: -451.935055 where: bonds (distance) C4'-P energy: -84.708 bonds (distance) P-C4' energy: -95.867 flat angles C4'-P-C4' energy: -91.187 flat angles P-C4'-P energy: -69.952 tors. eta vs tors. theta energy: -110.222 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -1411.478652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1411.478652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1411.478652 (E_RNA) where: Base-Base interactions energy: -982.802 where: short stacking energy: -398.523 Base-Backbone interact. energy: -2.293 local terms energy: -426.383313 where: bonds (distance) C4'-P energy: -77.289 bonds (distance) P-C4' energy: -88.262 flat angles C4'-P-C4' energy: -88.148 flat angles P-C4'-P energy: -49.954 tors. eta vs tors. theta energy: -122.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -1300.246623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1300.246623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1300.246623 (E_RNA) where: Base-Base interactions energy: -873.985 where: short stacking energy: -413.920 Base-Backbone interact. energy: -2.135 local terms energy: -424.126797 where: bonds (distance) C4'-P energy: -75.546 bonds (distance) P-C4' energy: -79.731 flat angles C4'-P-C4' energy: -87.075 flat angles P-C4'-P energy: -59.505 tors. eta vs tors. theta energy: -122.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -1296.169303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1296.169303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1296.169303 (E_RNA) where: Base-Base interactions energy: -890.636 where: short stacking energy: -385.835 Base-Backbone interact. energy: -1.245 local terms energy: -404.287562 where: bonds (distance) C4'-P energy: -70.653 bonds (distance) P-C4' energy: -80.067 flat angles C4'-P-C4' energy: -95.745 flat angles P-C4'-P energy: -51.584 tors. eta vs tors. theta energy: -106.239 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -1252.178346 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1252.178346 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1252.178346 (E_RNA) where: Base-Base interactions energy: -851.597 where: short stacking energy: -366.240 Base-Backbone interact. energy: -4.351 local terms energy: -396.230487 where: bonds (distance) C4'-P energy: -79.779 bonds (distance) P-C4' energy: -75.940 flat angles C4'-P-C4' energy: -84.531 flat angles P-C4'-P energy: -56.154 tors. eta vs tors. theta energy: -99.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -1045.587399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1045.587399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1045.587399 (E_RNA) where: Base-Base interactions energy: -686.017 where: short stacking energy: -309.277 Base-Backbone interact. energy: -1.337 local terms energy: -358.233052 where: bonds (distance) C4'-P energy: -77.919 bonds (distance) P-C4' energy: -78.103 flat angles C4'-P-C4' energy: -85.487 flat angles P-C4'-P energy: -58.477 tors. eta vs tors. theta energy: -58.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -1053.646582 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.646582 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.646582 (E_RNA) where: Base-Base interactions energy: -704.707 where: short stacking energy: -295.009 Base-Backbone interact. energy: 1.284 local terms energy: -350.223233 where: bonds (distance) C4'-P energy: -67.412 bonds (distance) P-C4' energy: -81.522 flat angles C4'-P-C4' energy: -80.169 flat angles P-C4'-P energy: -52.204 tors. eta vs tors. theta energy: -68.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -920.328891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -920.328891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -920.328891 (E_RNA) where: Base-Base interactions energy: -583.191 where: short stacking energy: -266.334 Base-Backbone interact. energy: -0.813 local terms energy: -336.324340 where: bonds (distance) C4'-P energy: -59.317 bonds (distance) P-C4' energy: -82.810 flat angles C4'-P-C4' energy: -78.570 flat angles P-C4'-P energy: -52.096 tors. eta vs tors. theta energy: -63.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -823.733907 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -823.733907 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -823.733907 (E_RNA) where: Base-Base interactions energy: -527.605 where: short stacking energy: -256.513 Base-Backbone interact. energy: -1.031 local terms energy: -295.097848 where: bonds (distance) C4'-P energy: -58.060 bonds (distance) P-C4' energy: -69.903 flat angles C4'-P-C4' energy: -64.917 flat angles P-C4'-P energy: -44.136 tors. eta vs tors. theta energy: -58.082 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -435.322674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.322674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.322674 (E_RNA) where: Base-Base interactions energy: -197.308 where: short stacking energy: -109.606 Base-Backbone interact. energy: 0.370 local terms energy: -238.385132 where: bonds (distance) C4'-P energy: -67.001 bonds (distance) P-C4' energy: -74.322 flat angles C4'-P-C4' energy: -66.142 flat angles P-C4'-P energy: -31.156 tors. eta vs tors. theta energy: 0.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -1444.002725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.002725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.002725 (E_RNA) where: Base-Base interactions energy: -988.908 where: short stacking energy: -410.025 Base-Backbone interact. energy: -1.799 local terms energy: -453.296055 where: bonds (distance) C4'-P energy: -82.928 bonds (distance) P-C4' energy: -90.239 flat angles C4'-P-C4' energy: -98.933 flat angles P-C4'-P energy: -72.167 tors. eta vs tors. theta energy: -109.031 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -1420.586043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.586043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.586043 (E_RNA) where: Base-Base interactions energy: -993.155 where: short stacking energy: -417.631 Base-Backbone interact. energy: 0.975 local terms energy: -428.405872 where: bonds (distance) C4'-P energy: -84.027 bonds (distance) P-C4' energy: -83.576 flat angles C4'-P-C4' energy: -87.621 flat angles P-C4'-P energy: -58.655 tors. eta vs tors. theta energy: -114.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -1295.614557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.614557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1295.614557 (E_RNA) where: Base-Base interactions energy: -879.432 where: short stacking energy: -389.286 Base-Backbone interact. energy: -1.664 local terms energy: -414.519002 where: bonds (distance) C4'-P energy: -84.137 bonds (distance) P-C4' energy: -78.662 flat angles C4'-P-C4' energy: -90.920 flat angles P-C4'-P energy: -50.613 tors. eta vs tors. theta energy: -110.187 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -1280.430502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.430502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.430502 (E_RNA) where: Base-Base interactions energy: -888.268 where: short stacking energy: -387.133 Base-Backbone interact. energy: -0.097 local terms energy: -392.065299 where: bonds (distance) C4'-P energy: -76.883 bonds (distance) P-C4' energy: -73.217 flat angles C4'-P-C4' energy: -88.127 flat angles P-C4'-P energy: -52.667 tors. eta vs tors. theta energy: -101.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -1247.666863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.666863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.666863 (E_RNA) where: Base-Base interactions energy: -857.918 where: short stacking energy: -359.869 Base-Backbone interact. energy: -1.290 local terms energy: -388.458180 where: bonds (distance) C4'-P energy: -75.173 bonds (distance) P-C4' energy: -79.348 flat angles C4'-P-C4' energy: -84.161 flat angles P-C4'-P energy: -56.409 tors. eta vs tors. theta energy: -93.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -1082.330299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1082.330299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1082.330299 (E_RNA) where: Base-Base interactions energy: -742.128 where: short stacking energy: -319.850 Base-Backbone interact. energy: 1.284 local terms energy: -341.486152 where: bonds (distance) C4'-P energy: -68.610 bonds (distance) P-C4' energy: -75.813 flat angles C4'-P-C4' energy: -80.863 flat angles P-C4'-P energy: -46.558 tors. eta vs tors. theta energy: -69.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -1004.152428 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1004.152428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1004.152428 (E_RNA) where: Base-Base interactions energy: -670.725 where: short stacking energy: -285.977 Base-Backbone interact. energy: 0.136 local terms energy: -333.563284 where: bonds (distance) C4'-P energy: -67.327 bonds (distance) P-C4' energy: -85.367 flat angles C4'-P-C4' energy: -70.842 flat angles P-C4'-P energy: -40.636 tors. eta vs tors. theta energy: -69.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -888.211263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -888.211263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -888.211263 (E_RNA) where: Base-Base interactions energy: -579.357 where: short stacking energy: -272.804 Base-Backbone interact. energy: 3.393 local terms energy: -312.246956 where: bonds (distance) C4'-P energy: -72.281 bonds (distance) P-C4' energy: -65.809 flat angles C4'-P-C4' energy: -81.824 flat angles P-C4'-P energy: -32.739 tors. eta vs tors. theta energy: -59.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -718.275311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -718.275311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -718.275311 (E_RNA) where: Base-Base interactions energy: -441.439 where: short stacking energy: -211.317 Base-Backbone interact. energy: -2.480 local terms energy: -274.356549 where: bonds (distance) C4'-P energy: -58.972 bonds (distance) P-C4' energy: -74.674 flat angles C4'-P-C4' energy: -70.286 flat angles P-C4'-P energy: -41.887 tors. eta vs tors. theta energy: -28.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -439.145879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.145879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.145879 (E_RNA) where: Base-Base interactions energy: -203.664 where: short stacking energy: -122.735 Base-Backbone interact. energy: 5.861 local terms energy: -241.343007 where: bonds (distance) C4'-P energy: -59.884 bonds (distance) P-C4' energy: -86.945 flat angles C4'-P-C4' energy: -61.849 flat angles P-C4'-P energy: -43.912 tors. eta vs tors. theta energy: 11.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -1439.141967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.141967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.141967 (E_RNA) where: Base-Base interactions energy: -998.953 where: short stacking energy: -413.256 Base-Backbone interact. energy: -1.561 local terms energy: -438.628647 where: bonds (distance) C4'-P energy: -80.603 bonds (distance) P-C4' energy: -79.586 flat angles C4'-P-C4' energy: -97.523 flat angles P-C4'-P energy: -67.282 tors. eta vs tors. theta energy: -113.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -1379.139307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1379.139307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1379.139307 (E_RNA) where: Base-Base interactions energy: -956.880 where: short stacking energy: -405.737 Base-Backbone interact. energy: -3.525 local terms energy: -418.734295 where: bonds (distance) C4'-P energy: -78.674 bonds (distance) P-C4' energy: -77.863 flat angles C4'-P-C4' energy: -86.046 flat angles P-C4'-P energy: -59.357 tors. eta vs tors. theta energy: -116.794 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -1345.473412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1345.473412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.473412 (E_RNA) where: Base-Base interactions energy: -901.189 where: short stacking energy: -398.474 Base-Backbone interact. energy: -1.162 local terms energy: -443.122220 where: bonds (distance) C4'-P energy: -79.961 bonds (distance) P-C4' energy: -96.927 flat angles C4'-P-C4' energy: -93.113 flat angles P-C4'-P energy: -66.550 tors. eta vs tors. theta energy: -106.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -1270.298358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.298358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.298358 (E_RNA) where: Base-Base interactions energy: -883.953 where: short stacking energy: -382.712 Base-Backbone interact. energy: -0.228 local terms energy: -386.116853 where: bonds (distance) C4'-P energy: -70.443 bonds (distance) P-C4' energy: -89.612 flat angles C4'-P-C4' energy: -87.483 flat angles P-C4'-P energy: -45.263 tors. eta vs tors. theta energy: -93.315 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -1289.501930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.501930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.501930 (E_RNA) where: Base-Base interactions energy: -881.272 where: short stacking energy: -367.228 Base-Backbone interact. energy: -3.085 local terms energy: -405.144377 where: bonds (distance) C4'-P energy: -81.206 bonds (distance) P-C4' energy: -71.032 flat angles C4'-P-C4' energy: -87.877 flat angles P-C4'-P energy: -63.338 tors. eta vs tors. theta energy: -101.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -1117.344351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1117.344351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1117.344351 (E_RNA) where: Base-Base interactions energy: -764.666 where: short stacking energy: -336.088 Base-Backbone interact. energy: -1.999 local terms energy: -350.679446 where: bonds (distance) C4'-P energy: -68.726 bonds (distance) P-C4' energy: -78.724 flat angles C4'-P-C4' energy: -72.493 flat angles P-C4'-P energy: -51.888 tors. eta vs tors. theta energy: -78.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -1023.180295 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.180295 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1023.180295 (E_RNA) where: Base-Base interactions energy: -680.077 where: short stacking energy: -324.209 Base-Backbone interact. energy: -1.255 local terms energy: -341.848184 where: bonds (distance) C4'-P energy: -71.439 bonds (distance) P-C4' energy: -61.631 flat angles C4'-P-C4' energy: -80.034 flat angles P-C4'-P energy: -54.054 tors. eta vs tors. theta energy: -74.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -862.061849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -862.061849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -862.061849 (E_RNA) where: Base-Base interactions energy: -578.642 where: short stacking energy: -271.070 Base-Backbone interact. energy: 0.804 local terms energy: -284.223807 where: bonds (distance) C4'-P energy: -73.051 bonds (distance) P-C4' energy: -62.843 flat angles C4'-P-C4' energy: -67.823 flat angles P-C4'-P energy: -33.222 tors. eta vs tors. theta energy: -47.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -746.260408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -746.260408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -746.260408 (E_RNA) where: Base-Base interactions energy: -480.681 where: short stacking energy: -223.752 Base-Backbone interact. energy: -1.736 local terms energy: -263.843930 where: bonds (distance) C4'-P energy: -54.161 bonds (distance) P-C4' energy: -69.414 flat angles C4'-P-C4' energy: -61.687 flat angles P-C4'-P energy: -38.297 tors. eta vs tors. theta energy: -40.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -427.849539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.849539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.849539 (E_RNA) where: Base-Base interactions energy: -213.711 where: short stacking energy: -131.656 Base-Backbone interact. energy: -3.440 local terms energy: -210.698442 where: bonds (distance) C4'-P energy: -56.151 bonds (distance) P-C4' energy: -74.457 flat angles C4'-P-C4' energy: -63.544 flat angles P-C4'-P energy: -27.118 tors. eta vs tors. theta energy: 10.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -1489.415472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1489.415472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1489.415472 (E_RNA) where: Base-Base interactions energy: -1021.075 where: short stacking energy: -443.073 Base-Backbone interact. energy: -2.759 local terms energy: -465.581565 where: bonds (distance) C4'-P energy: -81.149 bonds (distance) P-C4' energy: -81.592 flat angles C4'-P-C4' energy: -103.536 flat angles P-C4'-P energy: -76.358 tors. eta vs tors. theta energy: -122.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -1437.265702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.265702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.265702 (E_RNA) where: Base-Base interactions energy: -998.721 where: short stacking energy: -432.622 Base-Backbone interact. energy: 0.277 local terms energy: -438.821071 where: bonds (distance) C4'-P energy: -84.337 bonds (distance) P-C4' energy: -87.248 flat angles C4'-P-C4' energy: -91.355 flat angles P-C4'-P energy: -61.638 tors. eta vs tors. theta energy: -114.244 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -1308.885678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1308.885678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1308.885678 (E_RNA) where: Base-Base interactions energy: -889.000 where: short stacking energy: -388.388 Base-Backbone interact. energy: -1.379 local terms energy: -418.506614 where: bonds (distance) C4'-P energy: -83.708 bonds (distance) P-C4' energy: -87.588 flat angles C4'-P-C4' energy: -84.644 flat angles P-C4'-P energy: -60.016 tors. eta vs tors. theta energy: -102.550 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -1286.432177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1286.432177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1286.432177 (E_RNA) where: Base-Base interactions energy: -865.476 where: short stacking energy: -374.543 Base-Backbone interact. energy: -3.893 local terms energy: -417.063008 where: bonds (distance) C4'-P energy: -82.176 bonds (distance) P-C4' energy: -72.321 flat angles C4'-P-C4' energy: -89.583 flat angles P-C4'-P energy: -73.540 tors. eta vs tors. theta energy: -99.442 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -1294.537844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.537844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.537844 (E_RNA) where: Base-Base interactions energy: -881.729 where: short stacking energy: -385.752 Base-Backbone interact. energy: -0.827 local terms energy: -411.981851 where: bonds (distance) C4'-P energy: -82.099 bonds (distance) P-C4' energy: -85.769 flat angles C4'-P-C4' energy: -81.747 flat angles P-C4'-P energy: -55.166 tors. eta vs tors. theta energy: -107.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -1106.774814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1106.774814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1106.774814 (E_RNA) where: Base-Base interactions energy: -762.705 where: short stacking energy: -333.181 Base-Backbone interact. energy: -1.767 local terms energy: -342.302275 where: bonds (distance) C4'-P energy: -54.701 bonds (distance) P-C4' energy: -79.682 flat angles C4'-P-C4' energy: -80.778 flat angles P-C4'-P energy: -57.357 tors. eta vs tors. theta energy: -69.785 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -988.937745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -988.937745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -988.937745 (E_RNA) where: Base-Base interactions energy: -654.587 where: short stacking energy: -285.976 Base-Backbone interact. energy: 0.508 local terms energy: -334.858242 where: bonds (distance) C4'-P energy: -76.039 bonds (distance) P-C4' energy: -68.567 flat angles C4'-P-C4' energy: -73.516 flat angles P-C4'-P energy: -50.171 tors. eta vs tors. theta energy: -66.566 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -933.224874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -933.224874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -933.224874 (E_RNA) where: Base-Base interactions energy: -610.737 where: short stacking energy: -288.946 Base-Backbone interact. energy: -2.343 local terms energy: -320.144317 where: bonds (distance) C4'-P energy: -62.299 bonds (distance) P-C4' energy: -75.975 flat angles C4'-P-C4' energy: -74.580 flat angles P-C4'-P energy: -46.509 tors. eta vs tors. theta energy: -60.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -836.815657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -836.815657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -836.815657 (E_RNA) where: Base-Base interactions energy: -532.285 where: short stacking energy: -247.620 Base-Backbone interact. energy: -0.796 local terms energy: -303.734704 where: bonds (distance) C4'-P energy: -69.457 bonds (distance) P-C4' energy: -56.822 flat angles C4'-P-C4' energy: -69.778 flat angles P-C4'-P energy: -51.488 tors. eta vs tors. theta energy: -56.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -463.386899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.386899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.386899 (E_RNA) where: Base-Base interactions energy: -212.283 where: short stacking energy: -145.754 Base-Backbone interact. energy: 0.635 local terms energy: -251.739060 where: bonds (distance) C4'-P energy: -61.759 bonds (distance) P-C4' energy: -77.768 flat angles C4'-P-C4' energy: -67.851 flat angles P-C4'-P energy: -39.653 tors. eta vs tors. theta energy: -4.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -1471.660258 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1471.660258 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1471.660258 (E_RNA) where: Base-Base interactions energy: -1022.509 where: short stacking energy: -443.958 Base-Backbone interact. energy: -2.090 local terms energy: -447.061013 where: bonds (distance) C4'-P energy: -73.898 bonds (distance) P-C4' energy: -86.188 flat angles C4'-P-C4' energy: -99.592 flat angles P-C4'-P energy: -60.031 tors. eta vs tors. theta energy: -127.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -1423.722529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1423.722529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1423.722529 (E_RNA) where: Base-Base interactions energy: -1004.316 where: short stacking energy: -409.777 Base-Backbone interact. energy: -1.636 local terms energy: -417.770928 where: bonds (distance) C4'-P energy: -77.212 bonds (distance) P-C4' energy: -77.613 flat angles C4'-P-C4' energy: -100.247 flat angles P-C4'-P energy: -51.139 tors. eta vs tors. theta energy: -111.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -1334.862215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1334.862215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.862215 (E_RNA) where: Base-Base interactions energy: -936.281 where: short stacking energy: -397.843 Base-Backbone interact. energy: -2.512 local terms energy: -396.069281 where: bonds (distance) C4'-P energy: -75.575 bonds (distance) P-C4' energy: -76.910 flat angles C4'-P-C4' energy: -90.287 flat angles P-C4'-P energy: -50.263 tors. eta vs tors. theta energy: -103.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -1318.390790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1318.390790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1318.390790 (E_RNA) where: Base-Base interactions energy: -920.608 where: short stacking energy: -400.205 Base-Backbone interact. energy: -0.271 local terms energy: -397.511739 where: bonds (distance) C4'-P energy: -77.231 bonds (distance) P-C4' energy: -86.331 flat angles C4'-P-C4' energy: -82.378 flat angles P-C4'-P energy: -44.996 tors. eta vs tors. theta energy: -106.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -1289.649832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1289.649832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1289.649832 (E_RNA) where: Base-Base interactions energy: -890.988 where: short stacking energy: -377.475 Base-Backbone interact. energy: 1.601 local terms energy: -400.262304 where: bonds (distance) C4'-P energy: -64.961 bonds (distance) P-C4' energy: -75.318 flat angles C4'-P-C4' energy: -93.014 flat angles P-C4'-P energy: -61.617 tors. eta vs tors. theta energy: -105.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -1159.004533 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1159.004533 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1159.004533 (E_RNA) where: Base-Base interactions energy: -803.247 where: short stacking energy: -346.336 Base-Backbone interact. energy: -0.403 local terms energy: -355.354137 where: bonds (distance) C4'-P energy: -72.164 bonds (distance) P-C4' energy: -80.793 flat angles C4'-P-C4' energy: -69.261 flat angles P-C4'-P energy: -52.318 tors. eta vs tors. theta energy: -80.819 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -966.934316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -966.934316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -966.934316 (E_RNA) where: Base-Base interactions energy: -617.053 where: short stacking energy: -297.728 Base-Backbone interact. energy: 0.944 local terms energy: -350.825551 where: bonds (distance) C4'-P energy: -72.188 bonds (distance) P-C4' energy: -87.848 flat angles C4'-P-C4' energy: -63.041 flat angles P-C4'-P energy: -53.482 tors. eta vs tors. theta energy: -74.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 3 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -957.574149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -957.574149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -957.574149 (E_RNA) where: Base-Base interactions energy: -620.544 where: short stacking energy: -281.612 Base-Backbone interact. energy: -0.790 local terms energy: -336.240084 where: bonds (distance) C4'-P energy: -69.699 bonds (distance) P-C4' energy: -67.977 flat angles C4'-P-C4' energy: -88.685 flat angles P-C4'-P energy: -39.866 tors. eta vs tors. theta energy: -70.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -832.932985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -832.932985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -832.932985 (E_RNA) where: Base-Base interactions energy: -535.832 where: short stacking energy: -246.082 Base-Backbone interact. energy: 2.598 local terms energy: -299.698776 where: bonds (distance) C4'-P energy: -56.566 bonds (distance) P-C4' energy: -73.160 flat angles C4'-P-C4' energy: -73.254 flat angles P-C4'-P energy: -43.048 tors. eta vs tors. theta energy: -53.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -462.312245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.312245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.312245 (E_RNA) where: Base-Base interactions energy: -238.360 where: short stacking energy: -129.956 Base-Backbone interact. energy: 3.057 local terms energy: -227.009186 where: bonds (distance) C4'-P energy: -65.525 bonds (distance) P-C4' energy: -74.813 flat angles C4'-P-C4' energy: -56.181 flat angles P-C4'-P energy: -35.728 tors. eta vs tors. theta energy: 5.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -1449.742526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.742526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.742526 (E_RNA) where: Base-Base interactions energy: -1006.917 where: short stacking energy: -447.137 Base-Backbone interact. energy: -0.694 local terms energy: -442.132019 where: bonds (distance) C4'-P energy: -83.284 bonds (distance) P-C4' energy: -78.811 flat angles C4'-P-C4' energy: -100.239 flat angles P-C4'-P energy: -66.235 tors. eta vs tors. theta energy: -113.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -1393.352894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1393.352894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1393.352894 (E_RNA) where: Base-Base interactions energy: -968.686 where: short stacking energy: -405.795 Base-Backbone interact. energy: 1.161 local terms energy: -425.828296 where: bonds (distance) C4'-P energy: -87.759 bonds (distance) P-C4' energy: -86.146 flat angles C4'-P-C4' energy: -94.050 flat angles P-C4'-P energy: -58.402 tors. eta vs tors. theta energy: -99.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -1305.776477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.776477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.776477 (E_RNA) where: Base-Base interactions energy: -907.712 where: short stacking energy: -388.689 Base-Backbone interact. energy: -1.171 local terms energy: -396.892799 where: bonds (distance) C4'-P energy: -72.048 bonds (distance) P-C4' energy: -79.076 flat angles C4'-P-C4' energy: -92.642 flat angles P-C4'-P energy: -48.282 tors. eta vs tors. theta energy: -104.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -1325.961409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.961409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.961409 (E_RNA) where: Base-Base interactions energy: -908.314 where: short stacking energy: -397.717 Base-Backbone interact. energy: 3.805 local terms energy: -421.452681 where: bonds (distance) C4'-P energy: -75.291 bonds (distance) P-C4' energy: -74.388 flat angles C4'-P-C4' energy: -104.616 flat angles P-C4'-P energy: -53.093 tors. eta vs tors. theta energy: -114.065 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -1367.368881 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.368881 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.368881 (E_RNA) where: Base-Base interactions energy: -970.263 where: short stacking energy: -424.167 Base-Backbone interact. energy: -1.564 local terms energy: -395.541713 where: bonds (distance) C4'-P energy: -66.705 bonds (distance) P-C4' energy: -80.699 flat angles C4'-P-C4' energy: -88.675 flat angles P-C4'-P energy: -48.677 tors. eta vs tors. theta energy: -110.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -1155.683794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1155.683794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1155.683794 (E_RNA) where: Base-Base interactions energy: -780.856 where: short stacking energy: -338.610 Base-Backbone interact. energy: 2.049 local terms energy: -376.877543 where: bonds (distance) C4'-P energy: -66.125 bonds (distance) P-C4' energy: -82.531 flat angles C4'-P-C4' energy: -89.083 flat angles P-C4'-P energy: -56.867 tors. eta vs tors. theta energy: -82.271 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -1016.536561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.536561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.536561 (E_RNA) where: Base-Base interactions energy: -667.795 where: short stacking energy: -311.997 Base-Backbone interact. energy: 0.806 local terms energy: -349.547653 where: bonds (distance) C4'-P energy: -71.924 bonds (distance) P-C4' energy: -80.636 flat angles C4'-P-C4' energy: -78.141 flat angles P-C4'-P energy: -48.217 tors. eta vs tors. theta energy: -70.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -912.486291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.486291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.486291 (E_RNA) where: Base-Base interactions energy: -586.391 where: short stacking energy: -280.359 Base-Backbone interact. energy: -1.366 local terms energy: -324.729617 where: bonds (distance) C4'-P energy: -71.084 bonds (distance) P-C4' energy: -69.788 flat angles C4'-P-C4' energy: -83.509 flat angles P-C4'-P energy: -43.757 tors. eta vs tors. theta energy: -56.592 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -869.976789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -869.976789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -869.976789 (E_RNA) where: Base-Base interactions energy: -547.845 where: short stacking energy: -258.298 Base-Backbone interact. energy: -1.282 local terms energy: -320.849194 where: bonds (distance) C4'-P energy: -64.536 bonds (distance) P-C4' energy: -84.617 flat angles C4'-P-C4' energy: -72.429 flat angles P-C4'-P energy: -56.713 tors. eta vs tors. theta energy: -42.553 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -466.345215 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.345215 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.345215 (E_RNA) where: Base-Base interactions energy: -222.038 where: short stacking energy: -152.350 Base-Backbone interact. energy: 1.747 local terms energy: -246.053350 where: bonds (distance) C4'-P energy: -54.430 bonds (distance) P-C4' energy: -69.902 flat angles C4'-P-C4' energy: -74.210 flat angles P-C4'-P energy: -36.508 tors. eta vs tors. theta energy: -11.003 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -1476.393030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.393030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.393030 (E_RNA) where: Base-Base interactions energy: -1028.481 where: short stacking energy: -443.263 Base-Backbone interact. energy: 0.314 local terms energy: -448.225992 where: bonds (distance) C4'-P energy: -85.582 bonds (distance) P-C4' energy: -82.885 flat angles C4'-P-C4' energy: -103.467 flat angles P-C4'-P energy: -58.568 tors. eta vs tors. theta energy: -117.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -1426.719572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1426.719572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1426.719572 (E_RNA) where: Base-Base interactions energy: -983.031 where: short stacking energy: -428.711 Base-Backbone interact. energy: -1.985 local terms energy: -441.703284 where: bonds (distance) C4'-P energy: -96.752 bonds (distance) P-C4' energy: -82.318 flat angles C4'-P-C4' energy: -95.331 flat angles P-C4'-P energy: -60.437 tors. eta vs tors. theta energy: -106.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -1315.865247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1315.865247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1315.865247 (E_RNA) where: Base-Base interactions energy: -897.811 where: short stacking energy: -380.129 Base-Backbone interact. energy: 0.581 local terms energy: -418.636173 where: bonds (distance) C4'-P energy: -89.211 bonds (distance) P-C4' energy: -75.068 flat angles C4'-P-C4' energy: -97.438 flat angles P-C4'-P energy: -58.578 tors. eta vs tors. theta energy: -98.341 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -1389.308026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.308026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.308026 (E_RNA) where: Base-Base interactions energy: -957.837 where: short stacking energy: -391.409 Base-Backbone interact. energy: -2.871 local terms energy: -428.599723 where: bonds (distance) C4'-P energy: -81.072 bonds (distance) P-C4' energy: -79.549 flat angles C4'-P-C4' energy: -95.664 flat angles P-C4'-P energy: -56.469 tors. eta vs tors. theta energy: -115.845 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -1268.160575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1268.160575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1268.160575 (E_RNA) where: Base-Base interactions energy: -879.480 where: short stacking energy: -368.785 Base-Backbone interact. energy: -3.959 local terms energy: -384.720989 where: bonds (distance) C4'-P energy: -69.010 bonds (distance) P-C4' energy: -71.025 flat angles C4'-P-C4' energy: -86.284 flat angles P-C4'-P energy: -48.859 tors. eta vs tors. theta energy: -109.543 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -1131.345808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1131.345808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1131.345808 (E_RNA) where: Base-Base interactions energy: -775.105 where: short stacking energy: -335.020 Base-Backbone interact. energy: 2.359 local terms energy: -358.600227 where: bonds (distance) C4'-P energy: -69.611 bonds (distance) P-C4' energy: -72.867 flat angles C4'-P-C4' energy: -84.520 flat angles P-C4'-P energy: -47.698 tors. eta vs tors. theta energy: -83.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -1069.649976 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.649976 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1069.649976 (E_RNA) where: Base-Base interactions energy: -719.300 where: short stacking energy: -321.522 Base-Backbone interact. energy: -1.495 local terms energy: -348.854830 where: bonds (distance) C4'-P energy: -67.065 bonds (distance) P-C4' energy: -68.895 flat angles C4'-P-C4' energy: -82.275 flat angles P-C4'-P energy: -45.698 tors. eta vs tors. theta energy: -84.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -923.876027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -923.876027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -923.876027 (E_RNA) where: Base-Base interactions energy: -629.712 where: short stacking energy: -275.457 Base-Backbone interact. energy: 0.705 local terms energy: -294.869238 where: bonds (distance) C4'-P energy: -64.520 bonds (distance) P-C4' energy: -65.512 flat angles C4'-P-C4' energy: -69.970 flat angles P-C4'-P energy: -37.101 tors. eta vs tors. theta energy: -57.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -879.188785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -879.188785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -879.188785 (E_RNA) where: Base-Base interactions energy: -575.584 where: short stacking energy: -256.619 Base-Backbone interact. energy: -2.777 local terms energy: -300.827350 where: bonds (distance) C4'-P energy: -75.651 bonds (distance) P-C4' energy: -62.637 flat angles C4'-P-C4' energy: -58.425 flat angles P-C4'-P energy: -58.777 tors. eta vs tors. theta energy: -45.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -424.662634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.662634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.662634 (E_RNA) where: Base-Base interactions energy: -188.079 where: short stacking energy: -108.336 Base-Backbone interact. energy: -0.718 local terms energy: -235.866034 where: bonds (distance) C4'-P energy: -60.113 bonds (distance) P-C4' energy: -78.604 flat angles C4'-P-C4' energy: -64.086 flat angles P-C4'-P energy: -41.475 tors. eta vs tors. theta energy: 8.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -1478.346649 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1478.346649 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1478.346649 (E_RNA) where: Base-Base interactions energy: -1037.192 where: short stacking energy: -444.080 Base-Backbone interact. energy: -2.186 local terms energy: -438.968469 where: bonds (distance) C4'-P energy: -82.711 bonds (distance) P-C4' energy: -84.685 flat angles C4'-P-C4' energy: -94.153 flat angles P-C4'-P energy: -64.973 tors. eta vs tors. theta energy: -112.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -1415.085810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1415.085810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1415.085810 (E_RNA) where: Base-Base interactions energy: -984.103 where: short stacking energy: -439.286 Base-Backbone interact. energy: 0.828 local terms energy: -431.810338 where: bonds (distance) C4'-P energy: -76.422 bonds (distance) P-C4' energy: -91.080 flat angles C4'-P-C4' energy: -92.821 flat angles P-C4'-P energy: -64.002 tors. eta vs tors. theta energy: -107.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -1399.615348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.615348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.615348 (E_RNA) where: Base-Base interactions energy: -967.760 where: short stacking energy: -413.294 Base-Backbone interact. energy: -1.644 local terms energy: -430.211362 where: bonds (distance) C4'-P energy: -80.184 bonds (distance) P-C4' energy: -76.947 flat angles C4'-P-C4' energy: -98.453 flat angles P-C4'-P energy: -58.764 tors. eta vs tors. theta energy: -115.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -1317.061475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1317.061475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.061475 (E_RNA) where: Base-Base interactions energy: -923.505 where: short stacking energy: -392.031 Base-Backbone interact. energy: -1.468 local terms energy: -392.089292 where: bonds (distance) C4'-P energy: -65.914 bonds (distance) P-C4' energy: -81.888 flat angles C4'-P-C4' energy: -89.370 flat angles P-C4'-P energy: -56.553 tors. eta vs tors. theta energy: -98.365 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -1271.413430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.413430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.413430 (E_RNA) where: Base-Base interactions energy: -877.176 where: short stacking energy: -374.567 Base-Backbone interact. energy: -1.804 local terms energy: -392.434183 where: bonds (distance) C4'-P energy: -73.666 bonds (distance) P-C4' energy: -76.854 flat angles C4'-P-C4' energy: -92.727 flat angles P-C4'-P energy: -50.298 tors. eta vs tors. theta energy: -98.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -1143.013222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1143.013222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1143.013222 (E_RNA) where: Base-Base interactions energy: -770.195 where: short stacking energy: -327.141 Base-Backbone interact. energy: -3.928 local terms energy: -368.889681 where: bonds (distance) C4'-P energy: -64.673 bonds (distance) P-C4' energy: -73.016 flat angles C4'-P-C4' energy: -86.813 flat angles P-C4'-P energy: -59.756 tors. eta vs tors. theta energy: -84.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -1038.640057 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.640057 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1038.640057 (E_RNA) where: Base-Base interactions energy: -701.928 where: short stacking energy: -318.992 Base-Backbone interact. energy: 2.819 local terms energy: -339.531427 where: bonds (distance) C4'-P energy: -71.881 bonds (distance) P-C4' energy: -62.313 flat angles C4'-P-C4' energy: -75.005 flat angles P-C4'-P energy: -53.216 tors. eta vs tors. theta energy: -77.117 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -963.793655 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -963.793655 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -963.793655 (E_RNA) where: Base-Base interactions energy: -628.640 where: short stacking energy: -289.090 Base-Backbone interact. energy: -1.836 local terms energy: -333.318068 where: bonds (distance) C4'-P energy: -66.534 bonds (distance) P-C4' energy: -75.816 flat angles C4'-P-C4' energy: -70.594 flat angles P-C4'-P energy: -50.325 tors. eta vs tors. theta energy: -70.048 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -883.505180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -883.505180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -883.505180 (E_RNA) where: Base-Base interactions energy: -578.776 where: short stacking energy: -266.010 Base-Backbone interact. energy: -0.659 local terms energy: -304.070852 where: bonds (distance) C4'-P energy: -66.145 bonds (distance) P-C4' energy: -69.251 flat angles C4'-P-C4' energy: -65.658 flat angles P-C4'-P energy: -49.276 tors. eta vs tors. theta energy: -53.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -442.674637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.674637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.674637 (E_RNA) where: Base-Base interactions energy: -228.788 where: short stacking energy: -134.523 Base-Backbone interact. energy: 2.486 local terms energy: -216.372324 where: bonds (distance) C4'-P energy: -57.518 bonds (distance) P-C4' energy: -66.546 flat angles C4'-P-C4' energy: -44.126 flat angles P-C4'-P energy: -45.754 tors. eta vs tors. theta energy: -2.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -1466.602167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1466.602167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.602167 (E_RNA) where: Base-Base interactions energy: -1033.722 where: short stacking energy: -418.679 Base-Backbone interact. energy: -3.475 local terms energy: -429.404410 where: bonds (distance) C4'-P energy: -94.643 bonds (distance) P-C4' energy: -75.970 flat angles C4'-P-C4' energy: -86.447 flat angles P-C4'-P energy: -58.135 tors. eta vs tors. theta energy: -114.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -1421.877758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1421.877758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1421.877758 (E_RNA) where: Base-Base interactions energy: -995.357 where: short stacking energy: -424.930 Base-Backbone interact. energy: -1.558 local terms energy: -424.963353 where: bonds (distance) C4'-P energy: -76.707 bonds (distance) P-C4' energy: -84.538 flat angles C4'-P-C4' energy: -93.819 flat angles P-C4'-P energy: -61.292 tors. eta vs tors. theta energy: -108.606 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -1405.954050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.954050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.954050 (E_RNA) where: Base-Base interactions energy: -959.858 where: short stacking energy: -408.222 Base-Backbone interact. energy: -0.707 local terms energy: -445.389507 where: bonds (distance) C4'-P energy: -81.355 bonds (distance) P-C4' energy: -85.869 flat angles C4'-P-C4' energy: -89.193 flat angles P-C4'-P energy: -68.657 tors. eta vs tors. theta energy: -120.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -1292.212728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1292.212728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1292.212728 (E_RNA) where: Base-Base interactions energy: -899.437 where: short stacking energy: -394.234 Base-Backbone interact. energy: -1.848 local terms energy: -390.927714 where: bonds (distance) C4'-P energy: -77.809 bonds (distance) P-C4' energy: -72.961 flat angles C4'-P-C4' energy: -93.087 flat angles P-C4'-P energy: -50.432 tors. eta vs tors. theta energy: -96.638 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -1254.322429 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1254.322429 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1254.322429 (E_RNA) where: Base-Base interactions energy: -862.021 where: short stacking energy: -381.750 Base-Backbone interact. energy: 0.789 local terms energy: -393.090578 where: bonds (distance) C4'-P energy: -71.500 bonds (distance) P-C4' energy: -74.140 flat angles C4'-P-C4' energy: -92.521 flat angles P-C4'-P energy: -54.904 tors. eta vs tors. theta energy: -100.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -1178.851280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1178.851280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1178.851280 (E_RNA) where: Base-Base interactions energy: -803.585 where: short stacking energy: -335.853 Base-Backbone interact. energy: -3.352 local terms energy: -371.914317 where: bonds (distance) C4'-P energy: -74.082 bonds (distance) P-C4' energy: -73.633 flat angles C4'-P-C4' energy: -82.955 flat angles P-C4'-P energy: -45.151 tors. eta vs tors. theta energy: -96.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -1025.692347 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.692347 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.692347 (E_RNA) where: Base-Base interactions energy: -654.170 where: short stacking energy: -279.124 Base-Backbone interact. energy: -2.215 local terms energy: -369.307395 where: bonds (distance) C4'-P energy: -85.854 bonds (distance) P-C4' energy: -81.555 flat angles C4'-P-C4' energy: -77.319 flat angles P-C4'-P energy: -48.045 tors. eta vs tors. theta energy: -76.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -897.487939 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.487939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.487939 (E_RNA) where: Base-Base interactions energy: -560.998 where: short stacking energy: -263.236 Base-Backbone interact. energy: -3.010 local terms energy: -333.479811 where: bonds (distance) C4'-P energy: -70.828 bonds (distance) P-C4' energy: -80.410 flat angles C4'-P-C4' energy: -78.681 flat angles P-C4'-P energy: -49.581 tors. eta vs tors. theta energy: -53.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -894.815381 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -894.815381 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -894.815381 (E_RNA) where: Base-Base interactions energy: -577.336 where: short stacking energy: -260.312 Base-Backbone interact. energy: 0.314 local terms energy: -317.792890 where: bonds (distance) C4'-P energy: -60.324 bonds (distance) P-C4' energy: -67.522 flat angles C4'-P-C4' energy: -82.230 flat angles P-C4'-P energy: -48.989 tors. eta vs tors. theta energy: -58.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -491.211668 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -491.211668 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -491.211668 (E_RNA) where: Base-Base interactions energy: -291.752 where: short stacking energy: -156.597 Base-Backbone interact. energy: 0.943 local terms energy: -200.402666 where: bonds (distance) C4'-P energy: -49.215 bonds (distance) P-C4' energy: -59.850 flat angles C4'-P-C4' energy: -58.205 flat angles P-C4'-P energy: -37.290 tors. eta vs tors. theta energy: 4.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -1461.147679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1461.147679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1461.147679 (E_RNA) where: Base-Base interactions energy: -1027.258 where: short stacking energy: -425.220 Base-Backbone interact. energy: -2.487 local terms energy: -431.403014 where: bonds (distance) C4'-P energy: -85.694 bonds (distance) P-C4' energy: -87.360 flat angles C4'-P-C4' energy: -92.418 flat angles P-C4'-P energy: -52.119 tors. eta vs tors. theta energy: -113.813 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -1402.967008 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1402.967008 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1402.967008 (E_RNA) where: Base-Base interactions energy: -974.802 where: short stacking energy: -412.212 Base-Backbone interact. energy: -1.091 local terms energy: -427.074126 where: bonds (distance) C4'-P energy: -80.296 bonds (distance) P-C4' energy: -89.401 flat angles C4'-P-C4' energy: -85.502 flat angles P-C4'-P energy: -73.229 tors. eta vs tors. theta energy: -98.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -1408.339803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1408.339803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1408.339803 (E_RNA) where: Base-Base interactions energy: -985.924 where: short stacking energy: -420.041 Base-Backbone interact. energy: -1.754 local terms energy: -420.662582 where: bonds (distance) C4'-P energy: -78.117 bonds (distance) P-C4' energy: -82.744 flat angles C4'-P-C4' energy: -97.649 flat angles P-C4'-P energy: -49.720 tors. eta vs tors. theta energy: -112.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -1284.607351 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.607351 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.607351 (E_RNA) where: Base-Base interactions energy: -872.264 where: short stacking energy: -381.231 Base-Backbone interact. energy: -1.739 local terms energy: -410.604448 where: bonds (distance) C4'-P energy: -61.055 bonds (distance) P-C4' energy: -79.875 flat angles C4'-P-C4' energy: -92.611 flat angles P-C4'-P energy: -68.472 tors. eta vs tors. theta energy: -108.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -1246.480996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.480996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.480996 (E_RNA) where: Base-Base interactions energy: -865.132 where: short stacking energy: -354.107 Base-Backbone interact. energy: -0.381 local terms energy: -380.967691 where: bonds (distance) C4'-P energy: -84.152 bonds (distance) P-C4' energy: -79.332 flat angles C4'-P-C4' energy: -74.498 flat angles P-C4'-P energy: -58.260 tors. eta vs tors. theta energy: -84.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -1157.369964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1157.369964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1157.369964 (E_RNA) where: Base-Base interactions energy: -804.105 where: short stacking energy: -352.706 Base-Backbone interact. energy: -2.311 local terms energy: -350.954722 where: bonds (distance) C4'-P energy: -54.972 bonds (distance) P-C4' energy: -64.490 flat angles C4'-P-C4' energy: -92.759 flat angles P-C4'-P energy: -53.206 tors. eta vs tors. theta energy: -85.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -983.867802 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -983.867802 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -983.867802 (E_RNA) where: Base-Base interactions energy: -641.198 where: short stacking energy: -283.853 Base-Backbone interact. energy: -0.574 local terms energy: -342.095743 where: bonds (distance) C4'-P energy: -73.244 bonds (distance) P-C4' energy: -86.127 flat angles C4'-P-C4' energy: -69.142 flat angles P-C4'-P energy: -57.289 tors. eta vs tors. theta energy: -56.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -914.465366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -914.465366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -914.465366 (E_RNA) where: Base-Base interactions energy: -573.591 where: short stacking energy: -283.330 Base-Backbone interact. energy: -1.826 local terms energy: -339.048346 where: bonds (distance) C4'-P energy: -69.854 bonds (distance) P-C4' energy: -73.513 flat angles C4'-P-C4' energy: -80.396 flat angles P-C4'-P energy: -47.264 tors. eta vs tors. theta energy: -68.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -819.166357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -819.166357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -819.166357 (E_RNA) where: Base-Base interactions energy: -543.881 where: short stacking energy: -247.927 Base-Backbone interact. energy: 0.187 local terms energy: -275.473346 where: bonds (distance) C4'-P energy: -59.151 bonds (distance) P-C4' energy: -64.012 flat angles C4'-P-C4' energy: -68.370 flat angles P-C4'-P energy: -41.191 tors. eta vs tors. theta energy: -42.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -496.543734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -496.543734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -496.543734 (E_RNA) where: Base-Base interactions energy: -251.634 where: short stacking energy: -147.305 Base-Backbone interact. energy: -1.629 local terms energy: -243.280232 where: bonds (distance) C4'-P energy: -71.522 bonds (distance) P-C4' energy: -66.539 flat angles C4'-P-C4' energy: -55.109 flat angles P-C4'-P energy: -47.956 tors. eta vs tors. theta energy: -2.154 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -1470.370785 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.370785 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.370785 (E_RNA) where: Base-Base interactions energy: -1024.521 where: short stacking energy: -430.959 Base-Backbone interact. energy: -1.550 local terms energy: -444.299815 where: bonds (distance) C4'-P energy: -88.026 bonds (distance) P-C4' energy: -82.559 flat angles C4'-P-C4' energy: -93.382 flat angles P-C4'-P energy: -55.828 tors. eta vs tors. theta energy: -124.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -1436.051750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.051750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.051750 (E_RNA) where: Base-Base interactions energy: -1000.120 where: short stacking energy: -441.985 Base-Backbone interact. energy: -1.805 local terms energy: -434.126829 where: bonds (distance) C4'-P energy: -77.386 bonds (distance) P-C4' energy: -88.789 flat angles C4'-P-C4' energy: -89.616 flat angles P-C4'-P energy: -58.753 tors. eta vs tors. theta energy: -119.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -1370.400818 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1370.400818 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1370.400818 (E_RNA) where: Base-Base interactions energy: -971.880 where: short stacking energy: -423.130 Base-Backbone interact. energy: -1.200 local terms energy: -397.320281 where: bonds (distance) C4'-P energy: -70.141 bonds (distance) P-C4' energy: -73.766 flat angles C4'-P-C4' energy: -95.596 flat angles P-C4'-P energy: -49.713 tors. eta vs tors. theta energy: -108.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -1283.084214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.084214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.084214 (E_RNA) where: Base-Base interactions energy: -863.194 where: short stacking energy: -361.116 Base-Backbone interact. energy: -2.415 local terms energy: -417.475296 where: bonds (distance) C4'-P energy: -75.264 bonds (distance) P-C4' energy: -85.410 flat angles C4'-P-C4' energy: -92.374 flat angles P-C4'-P energy: -62.239 tors. eta vs tors. theta energy: -102.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -1219.972485 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1219.972485 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1219.972485 (E_RNA) where: Base-Base interactions energy: -834.614 where: short stacking energy: -369.051 Base-Backbone interact. energy: 0.430 local terms energy: -385.787952 where: bonds (distance) C4'-P energy: -67.311 bonds (distance) P-C4' energy: -79.234 flat angles C4'-P-C4' energy: -89.958 flat angles P-C4'-P energy: -64.457 tors. eta vs tors. theta energy: -84.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -1162.002163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1162.002163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1162.002163 (E_RNA) where: Base-Base interactions energy: -789.695 where: short stacking energy: -345.686 Base-Backbone interact. energy: 0.598 local terms energy: -372.905284 where: bonds (distance) C4'-P energy: -79.378 bonds (distance) P-C4' energy: -73.102 flat angles C4'-P-C4' energy: -78.566 flat angles P-C4'-P energy: -44.576 tors. eta vs tors. theta energy: -97.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -1016.005079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.005079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.005079 (E_RNA) where: Base-Base interactions energy: -682.676 where: short stacking energy: -301.724 Base-Backbone interact. energy: -2.670 local terms energy: -330.659257 where: bonds (distance) C4'-P energy: -61.940 bonds (distance) P-C4' energy: -70.934 flat angles C4'-P-C4' energy: -68.721 flat angles P-C4'-P energy: -52.817 tors. eta vs tors. theta energy: -76.248 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -926.400945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -926.400945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -926.400945 (E_RNA) where: Base-Base interactions energy: -606.708 where: short stacking energy: -300.197 Base-Backbone interact. energy: -0.577 local terms energy: -319.115561 where: bonds (distance) C4'-P energy: -66.244 bonds (distance) P-C4' energy: -57.899 flat angles C4'-P-C4' energy: -76.852 flat angles P-C4'-P energy: -55.259 tors. eta vs tors. theta energy: -62.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -837.118484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -837.118484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -837.118484 (E_RNA) where: Base-Base interactions energy: -549.780 where: short stacking energy: -248.320 Base-Backbone interact. energy: -2.493 local terms energy: -284.845936 where: bonds (distance) C4'-P energy: -61.402 bonds (distance) P-C4' energy: -68.553 flat angles C4'-P-C4' energy: -69.205 flat angles P-C4'-P energy: -40.597 tors. eta vs tors. theta energy: -45.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -468.788964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.788964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.788964 (E_RNA) where: Base-Base interactions energy: -229.380 where: short stacking energy: -127.421 Base-Backbone interact. energy: 1.857 local terms energy: -241.266262 where: bonds (distance) C4'-P energy: -68.774 bonds (distance) P-C4' energy: -81.251 flat angles C4'-P-C4' energy: -54.889 flat angles P-C4'-P energy: -38.035 tors. eta vs tors. theta energy: 1.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -1479.543414 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1479.543414 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1479.543414 (E_RNA) where: Base-Base interactions energy: -1030.618 where: short stacking energy: -432.211 Base-Backbone interact. energy: -2.298 local terms energy: -446.626751 where: bonds (distance) C4'-P energy: -87.920 bonds (distance) P-C4' energy: -77.539 flat angles C4'-P-C4' energy: -93.141 flat angles P-C4'-P energy: -62.841 tors. eta vs tors. theta energy: -125.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -1422.707272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1422.707272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1422.707272 (E_RNA) where: Base-Base interactions energy: -967.302 where: short stacking energy: -398.907 Base-Backbone interact. energy: -3.272 local terms energy: -452.132687 where: bonds (distance) C4'-P energy: -88.006 bonds (distance) P-C4' energy: -93.367 flat angles C4'-P-C4' energy: -92.952 flat angles P-C4'-P energy: -68.234 tors. eta vs tors. theta energy: -109.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -1384.132861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1384.132861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1384.132861 (E_RNA) where: Base-Base interactions energy: -972.972 where: short stacking energy: -427.467 Base-Backbone interact. energy: -0.182 local terms energy: -410.979141 where: bonds (distance) C4'-P energy: -81.111 bonds (distance) P-C4' energy: -64.903 flat angles C4'-P-C4' energy: -94.255 flat angles P-C4'-P energy: -56.710 tors. eta vs tors. theta energy: -114.000 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -1303.051600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1303.051600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1303.051600 (E_RNA) where: Base-Base interactions energy: -901.971 where: short stacking energy: -365.197 Base-Backbone interact. energy: -0.934 local terms energy: -400.146586 where: bonds (distance) C4'-P energy: -76.744 bonds (distance) P-C4' energy: -81.358 flat angles C4'-P-C4' energy: -95.527 flat angles P-C4'-P energy: -50.567 tors. eta vs tors. theta energy: -95.950 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -1258.518127 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1258.518127 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1258.518127 (E_RNA) where: Base-Base interactions energy: -864.983 where: short stacking energy: -377.171 Base-Backbone interact. energy: -1.420 local terms energy: -392.114508 where: bonds (distance) C4'-P energy: -66.722 bonds (distance) P-C4' energy: -80.041 flat angles C4'-P-C4' energy: -88.878 flat angles P-C4'-P energy: -58.572 tors. eta vs tors. theta energy: -97.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -1158.294034 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.294034 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1158.294034 (E_RNA) where: Base-Base interactions energy: -789.418 where: short stacking energy: -345.445 Base-Backbone interact. energy: -2.346 local terms energy: -366.529651 where: bonds (distance) C4'-P energy: -73.779 bonds (distance) P-C4' energy: -80.714 flat angles C4'-P-C4' energy: -76.300 flat angles P-C4'-P energy: -47.490 tors. eta vs tors. theta energy: -88.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -1011.122650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1011.122650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1011.122650 (E_RNA) where: Base-Base interactions energy: -671.289 where: short stacking energy: -312.933 Base-Backbone interact. energy: 0.456 local terms energy: -340.289710 where: bonds (distance) C4'-P energy: -64.464 bonds (distance) P-C4' energy: -73.633 flat angles C4'-P-C4' energy: -71.021 flat angles P-C4'-P energy: -48.708 tors. eta vs tors. theta energy: -82.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -919.843443 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -919.843443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -919.843443 (E_RNA) where: Base-Base interactions energy: -590.774 where: short stacking energy: -265.908 Base-Backbone interact. energy: 0.030 local terms energy: -329.098728 where: bonds (distance) C4'-P energy: -64.659 bonds (distance) P-C4' energy: -64.276 flat angles C4'-P-C4' energy: -79.226 flat angles P-C4'-P energy: -50.757 tors. eta vs tors. theta energy: -70.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -840.927529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -840.927529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -840.927529 (E_RNA) where: Base-Base interactions energy: -540.276 where: short stacking energy: -262.971 Base-Backbone interact. energy: -0.686 local terms energy: -299.965563 where: bonds (distance) C4'-P energy: -72.299 bonds (distance) P-C4' energy: -59.701 flat angles C4'-P-C4' energy: -69.152 flat angles P-C4'-P energy: -47.895 tors. eta vs tors. theta energy: -50.918 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -502.449460 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -502.449460 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -502.449460 (E_RNA) where: Base-Base interactions energy: -277.512 where: short stacking energy: -135.430 Base-Backbone interact. energy: 5.418 local terms energy: -230.355307 where: bonds (distance) C4'-P energy: -67.772 bonds (distance) P-C4' energy: -73.683 flat angles C4'-P-C4' energy: -51.777 flat angles P-C4'-P energy: -43.043 tors. eta vs tors. theta energy: 5.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -1446.803538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.803538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1446.803538 (E_RNA) where: Base-Base interactions energy: -990.128 where: short stacking energy: -416.270 Base-Backbone interact. energy: -5.065 local terms energy: -451.610501 where: bonds (distance) C4'-P energy: -92.459 bonds (distance) P-C4' energy: -78.257 flat angles C4'-P-C4' energy: -96.805 flat angles P-C4'-P energy: -66.752 tors. eta vs tors. theta energy: -117.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -1442.199035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.199035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.199035 (E_RNA) where: Base-Base interactions energy: -1003.123 where: short stacking energy: -438.104 Base-Backbone interact. energy: -0.287 local terms energy: -438.789049 where: bonds (distance) C4'-P energy: -75.331 bonds (distance) P-C4' energy: -80.548 flat angles C4'-P-C4' energy: -89.126 flat angles P-C4'-P energy: -66.498 tors. eta vs tors. theta energy: -127.285 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -1398.249281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.249281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.249281 (E_RNA) where: Base-Base interactions energy: -960.841 where: short stacking energy: -402.956 Base-Backbone interact. energy: -0.501 local terms energy: -436.906633 where: bonds (distance) C4'-P energy: -68.568 bonds (distance) P-C4' energy: -91.931 flat angles C4'-P-C4' energy: -99.700 flat angles P-C4'-P energy: -65.010 tors. eta vs tors. theta energy: -111.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -1282.961082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1282.961082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1282.961082 (E_RNA) where: Base-Base interactions energy: -899.761 where: short stacking energy: -390.857 Base-Backbone interact. energy: -0.161 local terms energy: -383.039353 where: bonds (distance) C4'-P energy: -78.471 bonds (distance) P-C4' energy: -77.833 flat angles C4'-P-C4' energy: -79.903 flat angles P-C4'-P energy: -49.049 tors. eta vs tors. theta energy: -97.784 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -1251.355446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1251.355446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1251.355446 (E_RNA) where: Base-Base interactions energy: -859.834 where: short stacking energy: -393.979 Base-Backbone interact. energy: 2.301 local terms energy: -393.821860 where: bonds (distance) C4'-P energy: -61.664 bonds (distance) P-C4' energy: -73.786 flat angles C4'-P-C4' energy: -88.820 flat angles P-C4'-P energy: -63.718 tors. eta vs tors. theta energy: -105.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -1199.748594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1199.748594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1199.748594 (E_RNA) where: Base-Base interactions energy: -818.413 where: short stacking energy: -371.051 Base-Backbone interact. energy: -1.931 local terms energy: -379.404173 where: bonds (distance) C4'-P energy: -74.680 bonds (distance) P-C4' energy: -70.005 flat angles C4'-P-C4' energy: -90.420 flat angles P-C4'-P energy: -55.101 tors. eta vs tors. theta energy: -89.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -1068.807117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1068.807117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1068.807117 (E_RNA) where: Base-Base interactions energy: -716.807 where: short stacking energy: -318.305 Base-Backbone interact. energy: -3.451 local terms energy: -348.549388 where: bonds (distance) C4'-P energy: -75.617 bonds (distance) P-C4' energy: -83.914 flat angles C4'-P-C4' energy: -64.794 flat angles P-C4'-P energy: -43.770 tors. eta vs tors. theta energy: -80.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -865.188310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -865.188310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -865.188310 (E_RNA) where: Base-Base interactions energy: -549.031 where: short stacking energy: -264.518 Base-Backbone interact. energy: -2.024 local terms energy: -314.134126 where: bonds (distance) C4'-P energy: -72.670 bonds (distance) P-C4' energy: -68.284 flat angles C4'-P-C4' energy: -81.033 flat angles P-C4'-P energy: -38.203 tors. eta vs tors. theta energy: -53.944 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -860.023729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -860.023729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -860.023729 (E_RNA) where: Base-Base interactions energy: -553.459 where: short stacking energy: -251.390 Base-Backbone interact. energy: -1.771 local terms energy: -304.793506 where: bonds (distance) C4'-P energy: -74.332 bonds (distance) P-C4' energy: -69.301 flat angles C4'-P-C4' energy: -61.953 flat angles P-C4'-P energy: -50.942 tors. eta vs tors. theta energy: -48.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -474.088288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.088288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.088288 (E_RNA) where: Base-Base interactions energy: -264.162 where: short stacking energy: -140.408 Base-Backbone interact. energy: 0.782 local terms energy: -210.707943 where: bonds (distance) C4'-P energy: -53.265 bonds (distance) P-C4' energy: -63.305 flat angles C4'-P-C4' energy: -66.470 flat angles P-C4'-P energy: -28.529 tors. eta vs tors. theta energy: 0.862 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -1436.065276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.065276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.065276 (E_RNA) where: Base-Base interactions energy: -989.015 where: short stacking energy: -419.710 Base-Backbone interact. energy: -0.807 local terms energy: -446.242783 where: bonds (distance) C4'-P energy: -85.301 bonds (distance) P-C4' energy: -85.992 flat angles C4'-P-C4' energy: -92.931 flat angles P-C4'-P energy: -65.045 tors. eta vs tors. theta energy: -116.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -1404.250490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1404.250490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1404.250490 (E_RNA) where: Base-Base interactions energy: -994.767 where: short stacking energy: -412.171 Base-Backbone interact. energy: -1.401 local terms energy: -408.082088 where: bonds (distance) C4'-P energy: -70.909 bonds (distance) P-C4' energy: -74.084 flat angles C4'-P-C4' energy: -91.918 flat angles P-C4'-P energy: -61.761 tors. eta vs tors. theta energy: -109.411 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -1398.515396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1398.515396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1398.515396 (E_RNA) where: Base-Base interactions energy: -971.524 where: short stacking energy: -421.998 Base-Backbone interact. energy: -1.044 local terms energy: -425.947044 where: bonds (distance) C4'-P energy: -76.456 bonds (distance) P-C4' energy: -88.872 flat angles C4'-P-C4' energy: -85.525 flat angles P-C4'-P energy: -64.557 tors. eta vs tors. theta energy: -110.538 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -1293.363811 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1293.363811 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1293.363811 (E_RNA) where: Base-Base interactions energy: -878.534 where: short stacking energy: -395.282 Base-Backbone interact. energy: -2.475 local terms energy: -412.354780 where: bonds (distance) C4'-P energy: -84.743 bonds (distance) P-C4' energy: -77.507 flat angles C4'-P-C4' energy: -92.019 flat angles P-C4'-P energy: -60.810 tors. eta vs tors. theta energy: -97.276 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -1183.117839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1183.117839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1183.117839 (E_RNA) where: Base-Base interactions energy: -787.469 where: short stacking energy: -350.844 Base-Backbone interact. energy: -1.032 local terms energy: -394.616907 where: bonds (distance) C4'-P energy: -75.581 bonds (distance) P-C4' energy: -84.275 flat angles C4'-P-C4' energy: -81.084 flat angles P-C4'-P energy: -58.695 tors. eta vs tors. theta energy: -94.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -1186.521077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1186.521077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1186.521077 (E_RNA) where: Base-Base interactions energy: -793.183 where: short stacking energy: -335.196 Base-Backbone interact. energy: 0.089 local terms energy: -393.427194 where: bonds (distance) C4'-P energy: -80.263 bonds (distance) P-C4' energy: -80.875 flat angles C4'-P-C4' energy: -83.127 flat angles P-C4'-P energy: -58.542 tors. eta vs tors. theta energy: -90.620 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -1059.297053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1059.297053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1059.297053 (E_RNA) where: Base-Base interactions energy: -712.247 where: short stacking energy: -328.483 Base-Backbone interact. energy: 2.817 local terms energy: -349.867045 where: bonds (distance) C4'-P energy: -68.881 bonds (distance) P-C4' energy: -61.441 flat angles C4'-P-C4' energy: -84.694 flat angles P-C4'-P energy: -50.543 tors. eta vs tors. theta energy: -84.309 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -901.396111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -901.396111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -901.396111 (E_RNA) where: Base-Base interactions energy: -585.482 where: short stacking energy: -270.487 Base-Backbone interact. energy: -3.826 local terms energy: -312.088259 where: bonds (distance) C4'-P energy: -71.561 bonds (distance) P-C4' energy: -62.373 flat angles C4'-P-C4' energy: -73.100 flat angles P-C4'-P energy: -44.621 tors. eta vs tors. theta energy: -60.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -831.079953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.079953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.079953 (E_RNA) where: Base-Base interactions energy: -527.909 where: short stacking energy: -237.562 Base-Backbone interact. energy: -0.269 local terms energy: -302.901455 where: bonds (distance) C4'-P energy: -67.243 bonds (distance) P-C4' energy: -73.372 flat angles C4'-P-C4' energy: -68.171 flat angles P-C4'-P energy: -43.265 tors. eta vs tors. theta energy: -50.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -448.116141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.116141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.116141 (E_RNA) where: Base-Base interactions energy: -215.075 where: short stacking energy: -145.753 Base-Backbone interact. energy: -0.619 local terms energy: -232.422111 where: bonds (distance) C4'-P energy: -57.302 bonds (distance) P-C4' energy: -66.023 flat angles C4'-P-C4' energy: -60.326 flat angles P-C4'-P energy: -38.678 tors. eta vs tors. theta energy: -10.094 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -1456.936993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1456.936993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1456.936993 (E_RNA) where: Base-Base interactions energy: -1017.948 where: short stacking energy: -434.268 Base-Backbone interact. energy: -0.374 local terms energy: -438.614904 where: bonds (distance) C4'-P energy: -88.031 bonds (distance) P-C4' energy: -84.957 flat angles C4'-P-C4' energy: -92.319 flat angles P-C4'-P energy: -48.140 tors. eta vs tors. theta energy: -125.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -1413.019014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1413.019014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1413.019014 (E_RNA) where: Base-Base interactions energy: -988.864 where: short stacking energy: -431.337 Base-Backbone interact. energy: -2.041 local terms energy: -422.114083 where: bonds (distance) C4'-P energy: -70.136 bonds (distance) P-C4' energy: -79.309 flat angles C4'-P-C4' energy: -93.171 flat angles P-C4'-P energy: -61.444 tors. eta vs tors. theta energy: -118.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -1363.311257 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1363.311257 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1363.311257 (E_RNA) where: Base-Base interactions energy: -934.072 where: short stacking energy: -385.565 Base-Backbone interact. energy: -1.974 local terms energy: -427.265267 where: bonds (distance) C4'-P energy: -80.460 bonds (distance) P-C4' energy: -77.669 flat angles C4'-P-C4' energy: -100.918 flat angles P-C4'-P energy: -54.924 tors. eta vs tors. theta energy: -113.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -1242.656926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.656926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.656926 (E_RNA) where: Base-Base interactions energy: -860.534 where: short stacking energy: -362.812 Base-Backbone interact. energy: -0.825 local terms energy: -381.298188 where: bonds (distance) C4'-P energy: -69.876 bonds (distance) P-C4' energy: -90.854 flat angles C4'-P-C4' energy: -84.804 flat angles P-C4'-P energy: -46.997 tors. eta vs tors. theta energy: -88.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -1182.509087 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1182.509087 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1182.509087 (E_RNA) where: Base-Base interactions energy: -801.092 where: short stacking energy: -361.576 Base-Backbone interact. energy: -1.338 local terms energy: -380.079342 where: bonds (distance) C4'-P energy: -77.518 bonds (distance) P-C4' energy: -69.158 flat angles C4'-P-C4' energy: -77.949 flat angles P-C4'-P energy: -61.080 tors. eta vs tors. theta energy: -94.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -1190.164723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1190.164723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1190.164723 (E_RNA) where: Base-Base interactions energy: -842.604 where: short stacking energy: -359.861 Base-Backbone interact. energy: -1.841 local terms energy: -345.719705 where: bonds (distance) C4'-P energy: -67.434 bonds (distance) P-C4' energy: -68.511 flat angles C4'-P-C4' energy: -82.810 flat angles P-C4'-P energy: -36.417 tors. eta vs tors. theta energy: -90.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -1099.396614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1099.396614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1099.396614 (E_RNA) where: Base-Base interactions energy: -736.857 where: short stacking energy: -348.972 Base-Backbone interact. energy: 2.165 local terms energy: -364.704408 where: bonds (distance) C4'-P energy: -71.772 bonds (distance) P-C4' energy: -84.450 flat angles C4'-P-C4' energy: -76.986 flat angles P-C4'-P energy: -52.303 tors. eta vs tors. theta energy: -79.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -864.259077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -864.259077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -864.259077 (E_RNA) where: Base-Base interactions energy: -553.204 where: short stacking energy: -274.258 Base-Backbone interact. energy: 1.167 local terms energy: -312.221394 where: bonds (distance) C4'-P energy: -64.904 bonds (distance) P-C4' energy: -74.943 flat angles C4'-P-C4' energy: -73.648 flat angles P-C4'-P energy: -49.671 tors. eta vs tors. theta energy: -49.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -831.939030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -831.939030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -831.939030 (E_RNA) where: Base-Base interactions energy: -535.645 where: short stacking energy: -226.418 Base-Backbone interact. energy: 2.190 local terms energy: -298.483163 where: bonds (distance) C4'-P energy: -73.374 bonds (distance) P-C4' energy: -82.198 flat angles C4'-P-C4' energy: -57.338 flat angles P-C4'-P energy: -42.559 tors. eta vs tors. theta energy: -43.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -460.660912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.660912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.660912 (E_RNA) where: Base-Base interactions energy: -225.270 where: short stacking energy: -145.017 Base-Backbone interact. energy: -0.226 local terms energy: -235.165021 where: bonds (distance) C4'-P energy: -70.555 bonds (distance) P-C4' energy: -78.345 flat angles C4'-P-C4' energy: -52.725 flat angles P-C4'-P energy: -39.368 tors. eta vs tors. theta energy: 5.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -1432.301065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.301065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.301065 (E_RNA) where: Base-Base interactions energy: -991.395 where: short stacking energy: -427.131 Base-Backbone interact. energy: -1.196 local terms energy: -439.709734 where: bonds (distance) C4'-P energy: -78.853 bonds (distance) P-C4' energy: -88.100 flat angles C4'-P-C4' energy: -97.396 flat angles P-C4'-P energy: -64.624 tors. eta vs tors. theta energy: -110.737 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -1442.778053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1442.778053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1442.778053 (E_RNA) where: Base-Base interactions energy: -1004.967 where: short stacking energy: -434.827 Base-Backbone interact. energy: -2.518 local terms energy: -435.293270 where: bonds (distance) C4'-P energy: -88.392 bonds (distance) P-C4' energy: -79.330 flat angles C4'-P-C4' energy: -96.651 flat angles P-C4'-P energy: -46.918 tors. eta vs tors. theta energy: -124.002 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -1358.114232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.114232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.114232 (E_RNA) where: Base-Base interactions energy: -933.255 where: short stacking energy: -397.128 Base-Backbone interact. energy: -1.465 local terms energy: -423.394725 where: bonds (distance) C4'-P energy: -89.043 bonds (distance) P-C4' energy: -77.956 flat angles C4'-P-C4' energy: -81.300 flat angles P-C4'-P energy: -63.536 tors. eta vs tors. theta energy: -111.559 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -1272.568168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.568168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.568168 (E_RNA) where: Base-Base interactions energy: -887.098 where: short stacking energy: -360.154 Base-Backbone interact. energy: 0.679 local terms energy: -386.149605 where: bonds (distance) C4'-P energy: -77.298 bonds (distance) P-C4' energy: -70.801 flat angles C4'-P-C4' energy: -90.787 flat angles P-C4'-P energy: -50.800 tors. eta vs tors. theta energy: -96.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -1243.291488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1243.291488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1243.291488 (E_RNA) where: Base-Base interactions energy: -854.074 where: short stacking energy: -373.978 Base-Backbone interact. energy: -2.291 local terms energy: -386.927057 where: bonds (distance) C4'-P energy: -69.769 bonds (distance) P-C4' energy: -74.279 flat angles C4'-P-C4' energy: -92.399 flat angles P-C4'-P energy: -47.565 tors. eta vs tors. theta energy: -102.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -1149.151471 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1149.151471 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1149.151471 (E_RNA) where: Base-Base interactions energy: -780.001 where: short stacking energy: -351.404 Base-Backbone interact. energy: -0.588 local terms energy: -368.562043 where: bonds (distance) C4'-P energy: -80.147 bonds (distance) P-C4' energy: -86.584 flat angles C4'-P-C4' energy: -77.796 flat angles P-C4'-P energy: -53.430 tors. eta vs tors. theta energy: -70.605 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -1062.746151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1062.746151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1062.746151 (E_RNA) where: Base-Base interactions energy: -706.281 where: short stacking energy: -319.383 Base-Backbone interact. energy: 0.741 local terms energy: -357.205902 where: bonds (distance) C4'-P energy: -83.317 bonds (distance) P-C4' energy: -76.735 flat angles C4'-P-C4' energy: -74.724 flat angles P-C4'-P energy: -50.857 tors. eta vs tors. theta energy: -71.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -898.693440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -898.693440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -898.693440 (E_RNA) where: Base-Base interactions energy: -609.633 where: short stacking energy: -257.799 Base-Backbone interact. energy: 0.500 local terms energy: -289.560406 where: bonds (distance) C4'-P energy: -66.727 bonds (distance) P-C4' energy: -53.352 flat angles C4'-P-C4' energy: -65.140 flat angles P-C4'-P energy: -46.424 tors. eta vs tors. theta energy: -57.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -821.679737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -821.679737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -821.679737 (E_RNA) where: Base-Base interactions energy: -517.066 where: short stacking energy: -249.406 Base-Backbone interact. energy: 4.244 local terms energy: -308.858164 where: bonds (distance) C4'-P energy: -76.436 bonds (distance) P-C4' energy: -72.944 flat angles C4'-P-C4' energy: -74.049 flat angles P-C4'-P energy: -38.040 tors. eta vs tors. theta energy: -47.390 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -453.406359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.406359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.406359 (E_RNA) where: Base-Base interactions energy: -220.447 where: short stacking energy: -126.435 Base-Backbone interact. energy: -1.103 local terms energy: -231.856411 where: bonds (distance) C4'-P energy: -60.630 bonds (distance) P-C4' energy: -64.416 flat angles C4'-P-C4' energy: -78.210 flat angles P-C4'-P energy: -32.294 tors. eta vs tors. theta energy: 3.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -1464.454971 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.454971 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.454971 (E_RNA) where: Base-Base interactions energy: -1016.647 where: short stacking energy: -430.243 Base-Backbone interact. energy: 0.379 local terms energy: -448.187472 where: bonds (distance) C4'-P energy: -85.318 bonds (distance) P-C4' energy: -86.180 flat angles C4'-P-C4' energy: -94.115 flat angles P-C4'-P energy: -63.549 tors. eta vs tors. theta energy: -119.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -1434.357482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1434.357482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1434.357482 (E_RNA) where: Base-Base interactions energy: -985.637 where: short stacking energy: -425.756 Base-Backbone interact. energy: -2.899 local terms energy: -445.821879 where: bonds (distance) C4'-P energy: -88.507 bonds (distance) P-C4' energy: -82.452 flat angles C4'-P-C4' energy: -96.490 flat angles P-C4'-P energy: -59.601 tors. eta vs tors. theta energy: -118.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -1375.704945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1375.704945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1375.704945 (E_RNA) where: Base-Base interactions energy: -928.907 where: short stacking energy: -402.020 Base-Backbone interact. energy: -2.199 local terms energy: -444.599398 where: bonds (distance) C4'-P energy: -85.849 bonds (distance) P-C4' energy: -80.797 flat angles C4'-P-C4' energy: -95.143 flat angles P-C4'-P energy: -62.452 tors. eta vs tors. theta energy: -120.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -1294.303335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1294.303335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.303335 (E_RNA) where: Base-Base interactions energy: -887.668 where: short stacking energy: -391.468 Base-Backbone interact. energy: -1.464 local terms energy: -405.172185 where: bonds (distance) C4'-P energy: -67.558 bonds (distance) P-C4' energy: -82.649 flat angles C4'-P-C4' energy: -91.482 flat angles P-C4'-P energy: -60.209 tors. eta vs tors. theta energy: -103.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -1247.681606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1247.681606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.681606 (E_RNA) where: Base-Base interactions energy: -853.606 where: short stacking energy: -370.371 Base-Backbone interact. energy: -1.475 local terms energy: -392.601059 where: bonds (distance) C4'-P energy: -71.934 bonds (distance) P-C4' energy: -72.529 flat angles C4'-P-C4' energy: -88.108 flat angles P-C4'-P energy: -55.602 tors. eta vs tors. theta energy: -104.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -1156.577622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1156.577622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1156.577622 (E_RNA) where: Base-Base interactions energy: -788.345 where: short stacking energy: -324.989 Base-Backbone interact. energy: -2.849 local terms energy: -365.383725 where: bonds (distance) C4'-P energy: -81.403 bonds (distance) P-C4' energy: -77.802 flat angles C4'-P-C4' energy: -75.126 flat angles P-C4'-P energy: -56.177 tors. eta vs tors. theta energy: -74.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -1102.782487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1102.782487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1102.782487 (E_RNA) where: Base-Base interactions energy: -735.292 where: short stacking energy: -333.524 Base-Backbone interact. energy: 2.292 local terms energy: -369.782213 where: bonds (distance) C4'-P energy: -80.824 bonds (distance) P-C4' energy: -66.377 flat angles C4'-P-C4' energy: -77.824 flat angles P-C4'-P energy: -57.440 tors. eta vs tors. theta energy: -87.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -881.199097 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -881.199097 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -881.199097 (E_RNA) where: Base-Base interactions energy: -585.986 where: short stacking energy: -247.499 Base-Backbone interact. energy: -0.378 local terms energy: -294.835028 where: bonds (distance) C4'-P energy: -78.641 bonds (distance) P-C4' energy: -71.165 flat angles C4'-P-C4' energy: -77.477 flat angles P-C4'-P energy: -33.063 tors. eta vs tors. theta energy: -34.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -855.027359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.027359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.027359 (E_RNA) where: Base-Base interactions energy: -560.188 where: short stacking energy: -230.106 Base-Backbone interact. energy: -1.530 local terms energy: -293.308768 where: bonds (distance) C4'-P energy: -63.507 bonds (distance) P-C4' energy: -80.034 flat angles C4'-P-C4' energy: -65.813 flat angles P-C4'-P energy: -42.968 tors. eta vs tors. theta energy: -40.987 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -453.388841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.388841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.388841 (E_RNA) where: Base-Base interactions energy: -215.461 where: short stacking energy: -110.745 Base-Backbone interact. energy: 3.761 local terms energy: -241.688144 where: bonds (distance) C4'-P energy: -64.934 bonds (distance) P-C4' energy: -73.277 flat angles C4'-P-C4' energy: -62.066 flat angles P-C4'-P energy: -42.236 tors. eta vs tors. theta energy: 0.825 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -1450.049072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1450.049072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1450.049072 (E_RNA) where: Base-Base interactions energy: -1000.841 where: short stacking energy: -431.775 Base-Backbone interact. energy: -1.550 local terms energy: -447.657678 where: bonds (distance) C4'-P energy: -79.704 bonds (distance) P-C4' energy: -90.454 flat angles C4'-P-C4' energy: -98.544 flat angles P-C4'-P energy: -64.778 tors. eta vs tors. theta energy: -114.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -1437.389558 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.389558 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.389558 (E_RNA) where: Base-Base interactions energy: -999.924 where: short stacking energy: -420.488 Base-Backbone interact. energy: -0.820 local terms energy: -436.644939 where: bonds (distance) C4'-P energy: -93.088 bonds (distance) P-C4' energy: -70.541 flat angles C4'-P-C4' energy: -92.444 flat angles P-C4'-P energy: -59.564 tors. eta vs tors. theta energy: -121.008 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -1389.181917 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.181917 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.181917 (E_RNA) where: Base-Base interactions energy: -968.991 where: short stacking energy: -411.369 Base-Backbone interact. energy: -2.178 local terms energy: -418.012427 where: bonds (distance) C4'-P energy: -72.035 bonds (distance) P-C4' energy: -87.662 flat angles C4'-P-C4' energy: -90.984 flat angles P-C4'-P energy: -64.072 tors. eta vs tors. theta energy: -103.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -1284.295379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1284.295379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1284.295379 (E_RNA) where: Base-Base interactions energy: -875.684 where: short stacking energy: -375.914 Base-Backbone interact. energy: -2.995 local terms energy: -405.616694 where: bonds (distance) C4'-P energy: -83.889 bonds (distance) P-C4' energy: -80.256 flat angles C4'-P-C4' energy: -85.009 flat angles P-C4'-P energy: -56.634 tors. eta vs tors. theta energy: -99.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -1324.428704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.428704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1324.428704 (E_RNA) where: Base-Base interactions energy: -929.762 where: short stacking energy: -391.197 Base-Backbone interact. energy: -2.343 local terms energy: -392.323797 where: bonds (distance) C4'-P energy: -66.765 bonds (distance) P-C4' energy: -77.325 flat angles C4'-P-C4' energy: -85.570 flat angles P-C4'-P energy: -51.625 tors. eta vs tors. theta energy: -111.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -1147.049626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1147.049626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1147.049626 (E_RNA) where: Base-Base interactions energy: -804.274 where: short stacking energy: -359.325 Base-Backbone interact. energy: -1.133 local terms energy: -341.642843 where: bonds (distance) C4'-P energy: -63.455 bonds (distance) P-C4' energy: -61.048 flat angles C4'-P-C4' energy: -76.511 flat angles P-C4'-P energy: -54.610 tors. eta vs tors. theta energy: -86.019 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -1025.890026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1025.890026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1025.890026 (E_RNA) where: Base-Base interactions energy: -710.643 where: short stacking energy: -309.277 Base-Backbone interact. energy: 0.621 local terms energy: -315.868591 where: bonds (distance) C4'-P energy: -55.824 bonds (distance) P-C4' energy: -59.390 flat angles C4'-P-C4' energy: -74.049 flat angles P-C4'-P energy: -45.521 tors. eta vs tors. theta energy: -81.084 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -896.170364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -896.170364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -896.170364 (E_RNA) where: Base-Base interactions energy: -588.005 where: short stacking energy: -242.794 Base-Backbone interact. energy: -1.770 local terms energy: -306.395984 where: bonds (distance) C4'-P energy: -68.464 bonds (distance) P-C4' energy: -76.236 flat angles C4'-P-C4' energy: -73.968 flat angles P-C4'-P energy: -38.748 tors. eta vs tors. theta energy: -48.980 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -930.679239 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -930.679239 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -930.679239 (E_RNA) where: Base-Base interactions energy: -594.227 where: short stacking energy: -271.631 Base-Backbone interact. energy: -0.808 local terms energy: -335.644878 where: bonds (distance) C4'-P energy: -66.710 bonds (distance) P-C4' energy: -77.499 flat angles C4'-P-C4' energy: -73.935 flat angles P-C4'-P energy: -54.798 tors. eta vs tors. theta energy: -62.704 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -474.290497 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.290497 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.290497 (E_RNA) where: Base-Base interactions energy: -245.582 where: short stacking energy: -116.017 Base-Backbone interact. energy: 3.084 local terms energy: -231.792985 where: bonds (distance) C4'-P energy: -45.408 bonds (distance) P-C4' energy: -68.320 flat angles C4'-P-C4' energy: -72.944 flat angles P-C4'-P energy: -55.168 tors. eta vs tors. theta energy: 10.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -1444.381859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.381859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.381859 (E_RNA) where: Base-Base interactions energy: -1015.954 where: short stacking energy: -439.768 Base-Backbone interact. energy: -1.456 local terms energy: -426.971387 where: bonds (distance) C4'-P energy: -65.186 bonds (distance) P-C4' energy: -85.132 flat angles C4'-P-C4' energy: -88.263 flat angles P-C4'-P energy: -68.761 tors. eta vs tors. theta energy: -119.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -1439.793705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.793705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.793705 (E_RNA) where: Base-Base interactions energy: -1007.826 where: short stacking energy: -422.806 Base-Backbone interact. energy: -2.654 local terms energy: -429.313150 where: bonds (distance) C4'-P energy: -76.125 bonds (distance) P-C4' energy: -86.406 flat angles C4'-P-C4' energy: -85.622 flat angles P-C4'-P energy: -71.114 tors. eta vs tors. theta energy: -110.046 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -1412.545583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1412.545583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1412.545583 (E_RNA) where: Base-Base interactions energy: -973.825 where: short stacking energy: -432.723 Base-Backbone interact. energy: -1.181 local terms energy: -437.540224 where: bonds (distance) C4'-P energy: -78.347 bonds (distance) P-C4' energy: -91.916 flat angles C4'-P-C4' energy: -93.403 flat angles P-C4'-P energy: -55.331 tors. eta vs tors. theta energy: -118.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -1332.228780 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1332.228780 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1332.228780 (E_RNA) where: Base-Base interactions energy: -921.138 where: short stacking energy: -381.723 Base-Backbone interact. energy: 1.541 local terms energy: -412.631716 where: bonds (distance) C4'-P energy: -77.371 bonds (distance) P-C4' energy: -81.890 flat angles C4'-P-C4' energy: -94.297 flat angles P-C4'-P energy: -64.168 tors. eta vs tors. theta energy: -94.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -1278.117534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1278.117534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1278.117534 (E_RNA) where: Base-Base interactions energy: -878.537 where: short stacking energy: -388.098 Base-Backbone interact. energy: 0.027 local terms energy: -399.608420 where: bonds (distance) C4'-P energy: -76.171 bonds (distance) P-C4' energy: -69.768 flat angles C4'-P-C4' energy: -83.296 flat angles P-C4'-P energy: -62.565 tors. eta vs tors. theta energy: -107.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -1170.734587 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1170.734587 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1170.734587 (E_RNA) where: Base-Base interactions energy: -784.230 where: short stacking energy: -337.781 Base-Backbone interact. energy: -2.010 local terms energy: -384.494408 where: bonds (distance) C4'-P energy: -70.739 bonds (distance) P-C4' energy: -74.172 flat angles C4'-P-C4' energy: -91.340 flat angles P-C4'-P energy: -65.565 tors. eta vs tors. theta energy: -82.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -1053.988975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1053.988975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1053.988975 (E_RNA) where: Base-Base interactions energy: -700.229 where: short stacking energy: -313.040 Base-Backbone interact. energy: 2.332 local terms energy: -356.091557 where: bonds (distance) C4'-P energy: -70.732 bonds (distance) P-C4' energy: -57.596 flat angles C4'-P-C4' energy: -87.349 flat angles P-C4'-P energy: -54.805 tors. eta vs tors. theta energy: -85.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -964.201978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -964.201978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -964.201978 (E_RNA) where: Base-Base interactions energy: -638.848 where: short stacking energy: -268.332 Base-Backbone interact. energy: -0.606 local terms energy: -324.748179 where: bonds (distance) C4'-P energy: -74.630 bonds (distance) P-C4' energy: -77.838 flat angles C4'-P-C4' energy: -69.749 flat angles P-C4'-P energy: -48.160 tors. eta vs tors. theta energy: -54.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -897.764310 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -897.764310 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -897.764310 (E_RNA) where: Base-Base interactions energy: -602.554 where: short stacking energy: -262.648 Base-Backbone interact. energy: -1.670 local terms energy: -293.539774 where: bonds (distance) C4'-P energy: -63.721 bonds (distance) P-C4' energy: -82.282 flat angles C4'-P-C4' energy: -69.191 flat angles P-C4'-P energy: -42.701 tors. eta vs tors. theta energy: -35.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -467.666022 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.666022 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.666022 (E_RNA) where: Base-Base interactions energy: -236.789 where: short stacking energy: -128.911 Base-Backbone interact. energy: -0.750 local terms energy: -230.127158 where: bonds (distance) C4'-P energy: -68.670 bonds (distance) P-C4' energy: -67.816 flat angles C4'-P-C4' energy: -66.885 flat angles P-C4'-P energy: -31.304 tors. eta vs tors. theta energy: 4.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -1454.536661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1454.536661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.536661 (E_RNA) where: Base-Base interactions energy: -1002.139 where: short stacking energy: -436.426 Base-Backbone interact. energy: -3.266 local terms energy: -449.131668 where: bonds (distance) C4'-P energy: -82.647 bonds (distance) P-C4' energy: -91.543 flat angles C4'-P-C4' energy: -91.817 flat angles P-C4'-P energy: -66.499 tors. eta vs tors. theta energy: -116.625 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -1429.252822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.252822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1429.252822 (E_RNA) where: Base-Base interactions energy: -984.845 where: short stacking energy: -429.715 Base-Backbone interact. energy: -1.461 local terms energy: -442.947244 where: bonds (distance) C4'-P energy: -90.222 bonds (distance) P-C4' energy: -94.222 flat angles C4'-P-C4' energy: -91.952 flat angles P-C4'-P energy: -59.653 tors. eta vs tors. theta energy: -106.899 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -1388.457433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1388.457433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1388.457433 (E_RNA) where: Base-Base interactions energy: -978.501 where: short stacking energy: -430.990 Base-Backbone interact. energy: -1.225 local terms energy: -408.730799 where: bonds (distance) C4'-P energy: -70.485 bonds (distance) P-C4' energy: -70.113 flat angles C4'-P-C4' energy: -93.067 flat angles P-C4'-P energy: -54.945 tors. eta vs tors. theta energy: -120.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -1338.088577 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1338.088577 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1338.088577 (E_RNA) where: Base-Base interactions energy: -926.668 where: short stacking energy: -392.079 Base-Backbone interact. energy: -2.497 local terms energy: -408.923352 where: bonds (distance) C4'-P energy: -77.871 bonds (distance) P-C4' energy: -77.306 flat angles C4'-P-C4' energy: -91.750 flat angles P-C4'-P energy: -62.482 tors. eta vs tors. theta energy: -99.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -1280.821079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1280.821079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1280.821079 (E_RNA) where: Base-Base interactions energy: -883.245 where: short stacking energy: -379.209 Base-Backbone interact. energy: -0.949 local terms energy: -396.626909 where: bonds (distance) C4'-P energy: -65.072 bonds (distance) P-C4' energy: -65.616 flat angles C4'-P-C4' energy: -92.562 flat angles P-C4'-P energy: -62.206 tors. eta vs tors. theta energy: -111.171 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -1150.593666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1150.593666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1150.593666 (E_RNA) where: Base-Base interactions energy: -784.888 where: short stacking energy: -345.888 Base-Backbone interact. energy: 0.082 local terms energy: -365.787129 where: bonds (distance) C4'-P energy: -75.385 bonds (distance) P-C4' energy: -94.741 flat angles C4'-P-C4' energy: -68.194 flat angles P-C4'-P energy: -42.464 tors. eta vs tors. theta energy: -85.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -1043.023762 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1043.023762 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1043.023762 (E_RNA) where: Base-Base interactions energy: -704.324 where: short stacking energy: -292.965 Base-Backbone interact. energy: -3.102 local terms energy: -335.597736 where: bonds (distance) C4'-P energy: -65.436 bonds (distance) P-C4' energy: -71.979 flat angles C4'-P-C4' energy: -69.405 flat angles P-C4'-P energy: -57.292 tors. eta vs tors. theta energy: -71.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -947.899146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -947.899146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -947.899146 (E_RNA) where: Base-Base interactions energy: -626.727 where: short stacking energy: -284.468 Base-Backbone interact. energy: -2.323 local terms energy: -318.848466 where: bonds (distance) C4'-P energy: -60.653 bonds (distance) P-C4' energy: -76.678 flat angles C4'-P-C4' energy: -73.398 flat angles P-C4'-P energy: -45.944 tors. eta vs tors. theta energy: -62.177 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -812.260749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -812.260749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -812.260749 (E_RNA) where: Base-Base interactions energy: -522.826 where: short stacking energy: -230.729 Base-Backbone interact. energy: -2.062 local terms energy: -287.372000 where: bonds (distance) C4'-P energy: -69.138 bonds (distance) P-C4' energy: -71.954 flat angles C4'-P-C4' energy: -68.166 flat angles P-C4'-P energy: -28.741 tors. eta vs tors. theta energy: -49.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -437.229291 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.229291 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.229291 (E_RNA) where: Base-Base interactions energy: -209.763 where: short stacking energy: -139.864 Base-Backbone interact. energy: 1.506 local terms energy: -228.972208 where: bonds (distance) C4'-P energy: -67.151 bonds (distance) P-C4' energy: -66.450 flat angles C4'-P-C4' energy: -62.801 flat angles P-C4'-P energy: -24.896 tors. eta vs tors. theta energy: -7.674 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -1439.538167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1439.538167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1439.538167 (E_RNA) where: Base-Base interactions energy: -987.817 where: short stacking energy: -431.436 Base-Backbone interact. energy: -2.399 local terms energy: -449.321976 where: bonds (distance) C4'-P energy: -81.640 bonds (distance) P-C4' energy: -88.762 flat angles C4'-P-C4' energy: -91.530 flat angles P-C4'-P energy: -65.031 tors. eta vs tors. theta energy: -122.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -1436.432065 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1436.432065 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1436.432065 (E_RNA) where: Base-Base interactions energy: -1003.434 where: short stacking energy: -432.614 Base-Backbone interact. energy: -0.654 local terms energy: -432.344581 where: bonds (distance) C4'-P energy: -82.431 bonds (distance) P-C4' energy: -80.144 flat angles C4'-P-C4' energy: -97.357 flat angles P-C4'-P energy: -51.026 tors. eta vs tors. theta energy: -121.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -1405.639663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1405.639663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1405.639663 (E_RNA) where: Base-Base interactions energy: -986.920 where: short stacking energy: -426.005 Base-Backbone interact. energy: -1.335 local terms energy: -417.384412 where: bonds (distance) C4'-P energy: -75.615 bonds (distance) P-C4' energy: -83.112 flat angles C4'-P-C4' energy: -84.368 flat angles P-C4'-P energy: -57.894 tors. eta vs tors. theta energy: -116.395 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -1331.338207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.338207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.338207 (E_RNA) where: Base-Base interactions energy: -909.618 where: short stacking energy: -408.180 Base-Backbone interact. energy: -1.347 local terms energy: -420.372733 where: bonds (distance) C4'-P energy: -75.381 bonds (distance) P-C4' energy: -77.930 flat angles C4'-P-C4' energy: -87.651 flat angles P-C4'-P energy: -60.831 tors. eta vs tors. theta energy: -118.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -1273.404951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1273.404951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1273.404951 (E_RNA) where: Base-Base interactions energy: -883.752 where: short stacking energy: -393.550 Base-Backbone interact. energy: 0.183 local terms energy: -389.835425 where: bonds (distance) C4'-P energy: -69.465 bonds (distance) P-C4' energy: -80.391 flat angles C4'-P-C4' energy: -85.522 flat angles P-C4'-P energy: -46.647 tors. eta vs tors. theta energy: -107.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -1168.362085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1168.362085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1168.362085 (E_RNA) where: Base-Base interactions energy: -773.699 where: short stacking energy: -352.932 Base-Backbone interact. energy: 0.360 local terms energy: -395.023223 where: bonds (distance) C4'-P energy: -78.105 bonds (distance) P-C4' energy: -78.112 flat angles C4'-P-C4' energy: -97.552 flat angles P-C4'-P energy: -50.516 tors. eta vs tors. theta energy: -90.739 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -1015.839176 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.839176 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1015.839176 (E_RNA) where: Base-Base interactions energy: -676.400 where: short stacking energy: -303.551 Base-Backbone interact. energy: -1.878 local terms energy: -337.561116 where: bonds (distance) C4'-P energy: -61.806 bonds (distance) P-C4' energy: -74.707 flat angles C4'-P-C4' energy: -78.880 flat angles P-C4'-P energy: -48.775 tors. eta vs tors. theta energy: -73.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -848.599122 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -848.599122 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -848.599122 (E_RNA) where: Base-Base interactions energy: -554.935 where: short stacking energy: -276.618 Base-Backbone interact. energy: -1.136 local terms energy: -292.528200 where: bonds (distance) C4'-P energy: -49.575 bonds (distance) P-C4' energy: -70.909 flat angles C4'-P-C4' energy: -73.245 flat angles P-C4'-P energy: -54.825 tors. eta vs tors. theta energy: -43.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -907.398162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -907.398162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -907.398162 (E_RNA) where: Base-Base interactions energy: -586.045 where: short stacking energy: -250.476 Base-Backbone interact. energy: -1.354 local terms energy: -319.999618 where: bonds (distance) C4'-P energy: -70.152 bonds (distance) P-C4' energy: -84.256 flat angles C4'-P-C4' energy: -78.221 flat angles P-C4'-P energy: -30.600 tors. eta vs tors. theta energy: -56.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -424.336529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.336529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.336529 (E_RNA) where: Base-Base interactions energy: -195.576 where: short stacking energy: -130.027 Base-Backbone interact. energy: -1.543 local terms energy: -227.217944 where: bonds (distance) C4'-P energy: -64.743 bonds (distance) P-C4' energy: -71.354 flat angles C4'-P-C4' energy: -52.591 flat angles P-C4'-P energy: -35.990 tors. eta vs tors. theta energy: -2.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -1464.123629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.123629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.123629 (E_RNA) where: Base-Base interactions energy: -1002.074 where: short stacking energy: -434.794 Base-Backbone interact. energy: -2.109 local terms energy: -459.941223 where: bonds (distance) C4'-P energy: -82.811 bonds (distance) P-C4' energy: -88.734 flat angles C4'-P-C4' energy: -91.773 flat angles P-C4'-P energy: -71.451 tors. eta vs tors. theta energy: -125.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -1452.397690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.397690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.397690 (E_RNA) where: Base-Base interactions energy: -1024.747 where: short stacking energy: -434.897 Base-Backbone interact. energy: -1.656 local terms energy: -425.995329 where: bonds (distance) C4'-P energy: -79.520 bonds (distance) P-C4' energy: -63.662 flat angles C4'-P-C4' energy: -104.834 flat angles P-C4'-P energy: -56.317 tors. eta vs tors. theta energy: -121.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -1354.090300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1354.090300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1354.090300 (E_RNA) where: Base-Base interactions energy: -929.950 where: short stacking energy: -411.833 Base-Backbone interact. energy: -1.021 local terms energy: -423.119058 where: bonds (distance) C4'-P energy: -79.776 bonds (distance) P-C4' energy: -74.727 flat angles C4'-P-C4' energy: -91.117 flat angles P-C4'-P energy: -63.827 tors. eta vs tors. theta energy: -113.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -1341.004430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1341.004430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1341.004430 (E_RNA) where: Base-Base interactions energy: -926.089 where: short stacking energy: -407.263 Base-Backbone interact. energy: -1.925 local terms energy: -412.990889 where: bonds (distance) C4'-P energy: -77.983 bonds (distance) P-C4' energy: -79.481 flat angles C4'-P-C4' energy: -93.465 flat angles P-C4'-P energy: -53.560 tors. eta vs tors. theta energy: -108.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -1272.007150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1272.007150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1272.007150 (E_RNA) where: Base-Base interactions energy: -870.968 where: short stacking energy: -386.205 Base-Backbone interact. energy: -1.886 local terms energy: -399.153383 where: bonds (distance) C4'-P energy: -74.854 bonds (distance) P-C4' energy: -83.544 flat angles C4'-P-C4' energy: -81.193 flat angles P-C4'-P energy: -56.344 tors. eta vs tors. theta energy: -103.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -1196.095230 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1196.095230 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1196.095230 (E_RNA) where: Base-Base interactions energy: -833.448 where: short stacking energy: -364.818 Base-Backbone interact. energy: 0.746 local terms energy: -363.393705 where: bonds (distance) C4'-P energy: -70.402 bonds (distance) P-C4' energy: -79.426 flat angles C4'-P-C4' energy: -70.744 flat angles P-C4'-P energy: -59.095 tors. eta vs tors. theta energy: -83.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -1019.420290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.420290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.420290 (E_RNA) where: Base-Base interactions energy: -686.379 where: short stacking energy: -295.843 Base-Backbone interact. energy: 3.071 local terms energy: -336.113085 where: bonds (distance) C4'-P energy: -72.109 bonds (distance) P-C4' energy: -61.846 flat angles C4'-P-C4' energy: -81.308 flat angles P-C4'-P energy: -38.133 tors. eta vs tors. theta energy: -82.717 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -849.104142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.104142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.104142 (E_RNA) where: Base-Base interactions energy: -559.418 where: short stacking energy: -256.222 Base-Backbone interact. energy: 2.602 local terms energy: -292.288114 where: bonds (distance) C4'-P energy: -63.478 bonds (distance) P-C4' energy: -68.318 flat angles C4'-P-C4' energy: -82.816 flat angles P-C4'-P energy: -34.765 tors. eta vs tors. theta energy: -42.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -871.883300 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -871.883300 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -871.883300 (E_RNA) where: Base-Base interactions energy: -575.493 where: short stacking energy: -266.376 Base-Backbone interact. energy: 3.406 local terms energy: -299.796589 where: bonds (distance) C4'-P energy: -62.255 bonds (distance) P-C4' energy: -69.709 flat angles C4'-P-C4' energy: -58.615 flat angles P-C4'-P energy: -58.387 tors. eta vs tors. theta energy: -50.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -454.795868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.795868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.795868 (E_RNA) where: Base-Base interactions energy: -210.873 where: short stacking energy: -141.949 Base-Backbone interact. energy: 3.226 local terms energy: -247.149474 where: bonds (distance) C4'-P energy: -65.958 bonds (distance) P-C4' energy: -70.941 flat angles C4'-P-C4' energy: -76.854 flat angles P-C4'-P energy: -39.147 tors. eta vs tors. theta energy: 5.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 9 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -1464.839299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1464.839299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1464.839299 (E_RNA) where: Base-Base interactions energy: -1021.979 where: short stacking energy: -449.523 Base-Backbone interact. energy: 0.018 local terms energy: -442.878529 where: bonds (distance) C4'-P energy: -75.102 bonds (distance) P-C4' energy: -83.354 flat angles C4'-P-C4' energy: -93.547 flat angles P-C4'-P energy: -60.150 tors. eta vs tors. theta energy: -130.726 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -1449.048520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1449.048520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1449.048520 (E_RNA) where: Base-Base interactions energy: -1008.065 where: short stacking energy: -440.981 Base-Backbone interact. energy: -0.692 local terms energy: -440.292297 where: bonds (distance) C4'-P energy: -82.884 bonds (distance) P-C4' energy: -89.022 flat angles C4'-P-C4' energy: -97.438 flat angles P-C4'-P energy: -51.361 tors. eta vs tors. theta energy: -119.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -1350.812728 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.812728 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.812728 (E_RNA) where: Base-Base interactions energy: -927.688 where: short stacking energy: -405.500 Base-Backbone interact. energy: 0.760 local terms energy: -423.884397 where: bonds (distance) C4'-P energy: -73.162 bonds (distance) P-C4' energy: -73.524 flat angles C4'-P-C4' energy: -89.810 flat angles P-C4'-P energy: -63.892 tors. eta vs tors. theta energy: -123.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -1358.893822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1358.893822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1358.893822 (E_RNA) where: Base-Base interactions energy: -930.524 where: short stacking energy: -377.237 Base-Backbone interact. energy: -1.550 local terms energy: -426.819766 where: bonds (distance) C4'-P energy: -86.418 bonds (distance) P-C4' energy: -83.630 flat angles C4'-P-C4' energy: -91.337 flat angles P-C4'-P energy: -61.472 tors. eta vs tors. theta energy: -103.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -1283.525788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1283.525788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1283.525788 (E_RNA) where: Base-Base interactions energy: -867.822 where: short stacking energy: -388.195 Base-Backbone interact. energy: -1.569 local terms energy: -414.134668 where: bonds (distance) C4'-P energy: -81.610 bonds (distance) P-C4' energy: -77.846 flat angles C4'-P-C4' energy: -85.563 flat angles P-C4'-P energy: -55.736 tors. eta vs tors. theta energy: -113.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -1200.565979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1200.565979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1200.565979 (E_RNA) where: Base-Base interactions energy: -845.618 where: short stacking energy: -350.022 Base-Backbone interact. energy: -2.379 local terms energy: -352.569166 where: bonds (distance) C4'-P energy: -54.978 bonds (distance) P-C4' energy: -75.697 flat angles C4'-P-C4' energy: -83.428 flat angles P-C4'-P energy: -48.637 tors. eta vs tors. theta energy: -89.829 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -1058.778739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1058.778739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.778739 (E_RNA) where: Base-Base interactions energy: -703.860 where: short stacking energy: -321.360 Base-Backbone interact. energy: -1.421 local terms energy: -353.497921 where: bonds (distance) C4'-P energy: -70.307 bonds (distance) P-C4' energy: -72.116 flat angles C4'-P-C4' energy: -74.335 flat angles P-C4'-P energy: -48.738 tors. eta vs tors. theta energy: -88.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -861.318826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -861.318826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -861.318826 (E_RNA) where: Base-Base interactions energy: -580.106 where: short stacking energy: -249.236 Base-Backbone interact. energy: 3.324 local terms energy: -284.536777 where: bonds (distance) C4'-P energy: -63.832 bonds (distance) P-C4' energy: -66.035 flat angles C4'-P-C4' energy: -72.400 flat angles P-C4'-P energy: -44.176 tors. eta vs tors. theta energy: -38.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -834.584965 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -834.584965 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -834.584965 (E_RNA) where: Base-Base interactions energy: -543.792 where: short stacking energy: -253.388 Base-Backbone interact. energy: 1.381 local terms energy: -292.173332 where: bonds (distance) C4'-P energy: -71.902 bonds (distance) P-C4' energy: -73.254 flat angles C4'-P-C4' energy: -61.970 flat angles P-C4'-P energy: -46.024 tors. eta vs tors. theta energy: -39.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -461.894484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.894484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.894484 (E_RNA) where: Base-Base interactions energy: -237.148 where: short stacking energy: -129.575 Base-Backbone interact. energy: -0.152 local terms energy: -224.594196 where: bonds (distance) C4'-P energy: -60.739 bonds (distance) P-C4' energy: -63.393 flat angles C4'-P-C4' energy: -72.895 flat angles P-C4'-P energy: -36.251 tors. eta vs tors. theta energy: 8.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -1470.819975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.819975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1470.819975 (E_RNA) where: Base-Base interactions energy: -1020.685 where: short stacking energy: -442.945 Base-Backbone interact. energy: -0.889 local terms energy: -449.245976 where: bonds (distance) C4'-P energy: -82.191 bonds (distance) P-C4' energy: -82.150 flat angles C4'-P-C4' energy: -99.038 flat angles P-C4'-P energy: -64.326 tors. eta vs tors. theta energy: -121.541 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -1427.569063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1427.569063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1427.569063 (E_RNA) where: Base-Base interactions energy: -1012.232 where: short stacking energy: -427.667 Base-Backbone interact. energy: -0.188 local terms energy: -415.149403 where: bonds (distance) C4'-P energy: -81.088 bonds (distance) P-C4' energy: -75.636 flat angles C4'-P-C4' energy: -81.571 flat angles P-C4'-P energy: -59.914 tors. eta vs tors. theta energy: -116.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -1389.723627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1389.723627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1389.723627 (E_RNA) where: Base-Base interactions energy: -969.737 where: short stacking energy: -412.194 Base-Backbone interact. energy: -5.339 local terms energy: -414.647041 where: bonds (distance) C4'-P energy: -87.933 bonds (distance) P-C4' energy: -71.049 flat angles C4'-P-C4' energy: -95.088 flat angles P-C4'-P energy: -54.805 tors. eta vs tors. theta energy: -105.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -1325.555543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1325.555543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1325.555543 (E_RNA) where: Base-Base interactions energy: -895.825 where: short stacking energy: -399.894 Base-Backbone interact. energy: 1.818 local terms energy: -431.549425 where: bonds (distance) C4'-P energy: -71.422 bonds (distance) P-C4' energy: -91.587 flat angles C4'-P-C4' energy: -94.629 flat angles P-C4'-P energy: -59.523 tors. eta vs tors. theta energy: -114.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -1187.247268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1187.247268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1187.247268 (E_RNA) where: Base-Base interactions energy: -808.560 where: short stacking energy: -343.561 Base-Backbone interact. energy: 1.597 local terms energy: -380.283720 where: bonds (distance) C4'-P energy: -70.784 bonds (distance) P-C4' energy: -80.320 flat angles C4'-P-C4' energy: -81.823 flat angles P-C4'-P energy: -60.851 tors. eta vs tors. theta energy: -86.506 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -1173.397195 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1173.397195 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1173.397195 (E_RNA) where: Base-Base interactions energy: -809.495 where: short stacking energy: -332.273 Base-Backbone interact. energy: -1.456 local terms energy: -362.447075 where: bonds (distance) C4'-P energy: -74.643 bonds (distance) P-C4' energy: -63.048 flat angles C4'-P-C4' energy: -83.837 flat angles P-C4'-P energy: -55.968 tors. eta vs tors. theta energy: -84.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -1010.150275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1010.150275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1010.150275 (E_RNA) where: Base-Base interactions energy: -676.847 where: short stacking energy: -309.449 Base-Backbone interact. energy: -0.304 local terms energy: -332.999286 where: bonds (distance) C4'-P energy: -61.955 bonds (distance) P-C4' energy: -68.459 flat angles C4'-P-C4' energy: -75.283 flat angles P-C4'-P energy: -55.193 tors. eta vs tors. theta energy: -72.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -755.915609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -755.915609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -755.915609 (E_RNA) where: Base-Base interactions energy: -477.482 where: short stacking energy: -223.314 Base-Backbone interact. energy: 0.211 local terms energy: -278.645140 where: bonds (distance) C4'-P energy: -66.367 bonds (distance) P-C4' energy: -78.168 flat angles C4'-P-C4' energy: -59.752 flat angles P-C4'-P energy: -46.389 tors. eta vs tors. theta energy: -27.969 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -849.369250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -849.369250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -849.369250 (E_RNA) where: Base-Base interactions energy: -560.395 where: short stacking energy: -274.196 Base-Backbone interact. energy: -0.678 local terms energy: -288.295600 where: bonds (distance) C4'-P energy: -63.116 bonds (distance) P-C4' energy: -68.493 flat angles C4'-P-C4' energy: -72.592 flat angles P-C4'-P energy: -41.975 tors. eta vs tors. theta energy: -42.119 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -464.140438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.140438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.140438 (E_RNA) where: Base-Base interactions energy: -220.968 where: short stacking energy: -147.778 Base-Backbone interact. energy: -1.869 local terms energy: -241.302866 where: bonds (distance) C4'-P energy: -50.468 bonds (distance) P-C4' energy: -78.905 flat angles C4'-P-C4' energy: -72.163 flat angles P-C4'-P energy: -38.392 tors. eta vs tors. theta energy: -1.376 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -1469.869750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.869750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1469.869750 (E_RNA) where: Base-Base interactions energy: -1021.378 where: short stacking energy: -447.098 Base-Backbone interact. energy: -3.333 local terms energy: -445.158520 where: bonds (distance) C4'-P energy: -80.331 bonds (distance) P-C4' energy: -92.459 flat angles C4'-P-C4' energy: -97.159 flat angles P-C4'-P energy: -62.508 tors. eta vs tors. theta energy: -112.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -1399.343359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1399.343359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1399.343359 (E_RNA) where: Base-Base interactions energy: -958.239 where: short stacking energy: -438.272 Base-Backbone interact. energy: -1.452 local terms energy: -439.652906 where: bonds (distance) C4'-P energy: -82.388 bonds (distance) P-C4' energy: -78.462 flat angles C4'-P-C4' energy: -93.892 flat angles P-C4'-P energy: -66.601 tors. eta vs tors. theta energy: -118.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -1432.672938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.672938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.672938 (E_RNA) where: Base-Base interactions energy: -996.972 where: short stacking energy: -422.557 Base-Backbone interact. energy: -2.673 local terms energy: -433.027843 where: bonds (distance) C4'-P energy: -69.943 bonds (distance) P-C4' energy: -84.994 flat angles C4'-P-C4' energy: -94.252 flat angles P-C4'-P energy: -62.765 tors. eta vs tors. theta energy: -121.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -1307.043890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1307.043890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1307.043890 (E_RNA) where: Base-Base interactions energy: -909.234 where: short stacking energy: -390.371 Base-Backbone interact. energy: -1.519 local terms energy: -396.290772 where: bonds (distance) C4'-P energy: -80.244 bonds (distance) P-C4' energy: -84.018 flat angles C4'-P-C4' energy: -91.592 flat angles P-C4'-P energy: -43.157 tors. eta vs tors. theta energy: -97.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -1244.511885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1244.511885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1244.511885 (E_RNA) where: Base-Base interactions energy: -847.543 where: short stacking energy: -375.604 Base-Backbone interact. energy: -1.260 local terms energy: -395.709022 where: bonds (distance) C4'-P energy: -78.451 bonds (distance) P-C4' energy: -69.108 flat angles C4'-P-C4' energy: -90.329 flat angles P-C4'-P energy: -61.960 tors. eta vs tors. theta energy: -95.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -1193.408552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1193.408552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1193.408552 (E_RNA) where: Base-Base interactions energy: -822.834 where: short stacking energy: -344.263 Base-Backbone interact. energy: 0.485 local terms energy: -371.059648 where: bonds (distance) C4'-P energy: -74.103 bonds (distance) P-C4' energy: -81.995 flat angles C4'-P-C4' energy: -79.297 flat angles P-C4'-P energy: -47.405 tors. eta vs tors. theta energy: -88.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -984.759379 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -984.759379 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.759379 (E_RNA) where: Base-Base interactions energy: -653.235 where: short stacking energy: -291.099 Base-Backbone interact. energy: -2.044 local terms energy: -329.480474 where: bonds (distance) C4'-P energy: -64.954 bonds (distance) P-C4' energy: -75.219 flat angles C4'-P-C4' energy: -82.713 flat angles P-C4'-P energy: -35.488 tors. eta vs tors. theta energy: -71.106 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -863.710621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -863.710621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -863.710621 (E_RNA) where: Base-Base interactions energy: -576.174 where: short stacking energy: -253.679 Base-Backbone interact. energy: 1.231 local terms energy: -288.767550 where: bonds (distance) C4'-P energy: -71.424 bonds (distance) P-C4' energy: -58.826 flat angles C4'-P-C4' energy: -64.194 flat angles P-C4'-P energy: -45.443 tors. eta vs tors. theta energy: -48.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -779.672826 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.672826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.672826 (E_RNA) where: Base-Base interactions energy: -485.683 where: short stacking energy: -243.092 Base-Backbone interact. energy: 5.156 local terms energy: -299.145781 where: bonds (distance) C4'-P energy: -73.523 bonds (distance) P-C4' energy: -76.412 flat angles C4'-P-C4' energy: -70.969 flat angles P-C4'-P energy: -38.444 tors. eta vs tors. theta energy: -39.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -484.623197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -484.623197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -484.623197 (E_RNA) where: Base-Base interactions energy: -249.853 where: short stacking energy: -150.549 Base-Backbone interact. energy: -0.938 local terms energy: -233.832305 where: bonds (distance) C4'-P energy: -73.579 bonds (distance) P-C4' energy: -69.643 flat angles C4'-P-C4' energy: -65.798 flat angles P-C4'-P energy: -27.960 tors. eta vs tors. theta energy: 3.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -1472.518203 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1472.518203 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1472.518203 (E_RNA) where: Base-Base interactions energy: -1025.626 where: short stacking energy: -438.786 Base-Backbone interact. energy: 0.746 local terms energy: -447.638060 where: bonds (distance) C4'-P energy: -83.517 bonds (distance) P-C4' energy: -95.226 flat angles C4'-P-C4' energy: -100.169 flat angles P-C4'-P energy: -57.341 tors. eta vs tors. theta energy: -111.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 9 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -1407.193702 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1407.193702 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.193702 (E_RNA) where: Base-Base interactions energy: -963.846 where: short stacking energy: -429.906 Base-Backbone interact. energy: -0.388 local terms energy: -442.959328 where: bonds (distance) C4'-P energy: -84.168 bonds (distance) P-C4' energy: -82.963 flat angles C4'-P-C4' energy: -95.221 flat angles P-C4'-P energy: -67.401 tors. eta vs tors. theta energy: -113.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -1416.932338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1416.932338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1416.932338 (E_RNA) where: Base-Base interactions energy: -987.946 where: short stacking energy: -421.279 Base-Backbone interact. energy: -2.515 local terms energy: -426.472089 where: bonds (distance) C4'-P energy: -79.034 bonds (distance) P-C4' energy: -84.760 flat angles C4'-P-C4' energy: -88.833 flat angles P-C4'-P energy: -56.776 tors. eta vs tors. theta energy: -117.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -1305.171531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1305.171531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1305.171531 (E_RNA) where: Base-Base interactions energy: -888.602 where: short stacking energy: -391.965 Base-Backbone interact. energy: -0.899 local terms energy: -415.670889 where: bonds (distance) C4'-P energy: -82.454 bonds (distance) P-C4' energy: -82.026 flat angles C4'-P-C4' energy: -88.513 flat angles P-C4'-P energy: -57.127 tors. eta vs tors. theta energy: -105.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -1263.092552 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1263.092552 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1263.092552 (E_RNA) where: Base-Base interactions energy: -878.649 where: short stacking energy: -375.939 Base-Backbone interact. energy: -0.186 local terms energy: -384.257036 where: bonds (distance) C4'-P energy: -67.541 bonds (distance) P-C4' energy: -64.770 flat angles C4'-P-C4' energy: -89.712 flat angles P-C4'-P energy: -56.529 tors. eta vs tors. theta energy: -105.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -1174.815474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.815474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1174.815474 (E_RNA) where: Base-Base interactions energy: -830.830 where: short stacking energy: -363.035 Base-Backbone interact. energy: -0.964 local terms energy: -343.021015 where: bonds (distance) C4'-P energy: -57.478 bonds (distance) P-C4' energy: -57.735 flat angles C4'-P-C4' energy: -79.322 flat angles P-C4'-P energy: -57.099 tors. eta vs tors. theta energy: -91.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -987.554834 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -987.554834 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -987.554834 (E_RNA) where: Base-Base interactions energy: -646.627 where: short stacking energy: -292.668 Base-Backbone interact. energy: -1.557 local terms energy: -339.370839 where: bonds (distance) C4'-P energy: -69.942 bonds (distance) P-C4' energy: -72.208 flat angles C4'-P-C4' energy: -73.845 flat angles P-C4'-P energy: -46.420 tors. eta vs tors. theta energy: -76.955 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -935.294106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -935.294106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -935.294106 (E_RNA) where: Base-Base interactions energy: -609.009 where: short stacking energy: -272.900 Base-Backbone interact. energy: -1.158 local terms energy: -325.127343 where: bonds (distance) C4'-P energy: -72.298 bonds (distance) P-C4' energy: -64.384 flat angles C4'-P-C4' energy: -82.225 flat angles P-C4'-P energy: -49.906 tors. eta vs tors. theta energy: -56.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -778.718253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -778.718253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -778.718253 (E_RNA) where: Base-Base interactions energy: -514.043 where: short stacking energy: -227.492 Base-Backbone interact. energy: 1.717 local terms energy: -266.391663 where: bonds (distance) C4'-P energy: -61.934 bonds (distance) P-C4' energy: -63.760 flat angles C4'-P-C4' energy: -69.135 flat angles P-C4'-P energy: -44.354 tors. eta vs tors. theta energy: -27.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -538.592721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -538.592721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -538.592721 (E_RNA) where: Base-Base interactions energy: -319.538 where: short stacking energy: -160.384 Base-Backbone interact. energy: -0.442 local terms energy: -218.612654 where: bonds (distance) C4'-P energy: -64.869 bonds (distance) P-C4' energy: -54.070 flat angles C4'-P-C4' energy: -56.722 flat angles P-C4'-P energy: -46.065 tors. eta vs tors. theta energy: 3.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -1458.114129 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.114129 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.114129 (E_RNA) where: Base-Base interactions energy: -997.499 where: short stacking energy: -431.416 Base-Backbone interact. energy: -3.702 local terms energy: -456.912644 where: bonds (distance) C4'-P energy: -80.439 bonds (distance) P-C4' energy: -87.554 flat angles C4'-P-C4' energy: -106.003 flat angles P-C4'-P energy: -61.454 tors. eta vs tors. theta energy: -121.462 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -1432.463430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1432.463430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1432.463430 (E_RNA) where: Base-Base interactions energy: -985.984 where: short stacking energy: -399.828 Base-Backbone interact. energy: -2.409 local terms energy: -444.069893 where: bonds (distance) C4'-P energy: -90.745 bonds (distance) P-C4' energy: -84.742 flat angles C4'-P-C4' energy: -88.726 flat angles P-C4'-P energy: -55.061 tors. eta vs tors. theta energy: -124.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 9 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -1371.281753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.281753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.281753 (E_RNA) where: Base-Base interactions energy: -940.034 where: short stacking energy: -405.262 Base-Backbone interact. energy: -2.595 local terms energy: -428.652510 where: bonds (distance) C4'-P energy: -84.666 bonds (distance) P-C4' energy: -75.651 flat angles C4'-P-C4' energy: -93.191 flat angles P-C4'-P energy: -65.107 tors. eta vs tors. theta energy: -110.037 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -1314.252375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1314.252375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1314.252375 (E_RNA) where: Base-Base interactions energy: -906.165 where: short stacking energy: -385.512 Base-Backbone interact. energy: -1.925 local terms energy: -406.162087 where: bonds (distance) C4'-P energy: -66.355 bonds (distance) P-C4' energy: -83.976 flat angles C4'-P-C4' energy: -91.809 flat angles P-C4'-P energy: -64.719 tors. eta vs tors. theta energy: -99.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -1246.949352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1246.949352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1246.949352 (E_RNA) where: Base-Base interactions energy: -842.389 where: short stacking energy: -366.511 Base-Backbone interact. energy: -0.534 local terms energy: -404.027185 where: bonds (distance) C4'-P energy: -77.987 bonds (distance) P-C4' energy: -72.938 flat angles C4'-P-C4' energy: -93.146 flat angles P-C4'-P energy: -59.140 tors. eta vs tors. theta energy: -100.816 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -1215.465672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1215.465672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1215.465672 (E_RNA) where: Base-Base interactions energy: -831.188 where: short stacking energy: -367.743 Base-Backbone interact. energy: -0.966 local terms energy: -383.311587 where: bonds (distance) C4'-P energy: -71.283 bonds (distance) P-C4' energy: -73.272 flat angles C4'-P-C4' energy: -91.579 flat angles P-C4'-P energy: -52.668 tors. eta vs tors. theta energy: -94.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -1055.800311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1055.800311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.800311 (E_RNA) where: Base-Base interactions energy: -710.031 where: short stacking energy: -303.928 Base-Backbone interact. energy: -1.550 local terms energy: -344.219506 where: bonds (distance) C4'-P energy: -73.818 bonds (distance) P-C4' energy: -80.334 flat angles C4'-P-C4' energy: -79.339 flat angles P-C4'-P energy: -42.341 tors. eta vs tors. theta energy: -68.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -945.501942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -945.501942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -945.501942 (E_RNA) where: Base-Base interactions energy: -640.114 where: short stacking energy: -296.840 Base-Backbone interact. energy: 4.829 local terms energy: -310.216655 where: bonds (distance) C4'-P energy: -62.819 bonds (distance) P-C4' energy: -58.926 flat angles C4'-P-C4' energy: -83.956 flat angles P-C4'-P energy: -48.045 tors. eta vs tors. theta energy: -56.471 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -767.100805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -767.100805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -767.100805 (E_RNA) where: Base-Base interactions energy: -461.471 where: short stacking energy: -208.306 Base-Backbone interact. energy: -0.948 local terms energy: -304.681915 where: bonds (distance) C4'-P energy: -83.578 bonds (distance) P-C4' energy: -69.448 flat angles C4'-P-C4' energy: -70.450 flat angles P-C4'-P energy: -45.427 tors. eta vs tors. theta energy: -35.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -499.511675 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -499.511675 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -499.511675 (E_RNA) where: Base-Base interactions energy: -257.246 where: short stacking energy: -153.121 Base-Backbone interact. energy: -1.583 local terms energy: -240.683437 where: bonds (distance) C4'-P energy: -74.776 bonds (distance) P-C4' energy: -67.953 flat angles C4'-P-C4' energy: -57.427 flat angles P-C4'-P energy: -41.808 tors. eta vs tors. theta energy: 1.280 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -1476.629816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1476.629816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1476.629816 (E_RNA) where: Base-Base interactions energy: -1023.829 where: short stacking energy: -417.915 Base-Backbone interact. energy: -2.111 local terms energy: -450.689218 where: bonds (distance) C4'-P energy: -88.109 bonds (distance) P-C4' energy: -78.991 flat angles C4'-P-C4' energy: -98.239 flat angles P-C4'-P energy: -63.958 tors. eta vs tors. theta energy: -121.392 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -1420.941761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1420.941761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1420.941761 (E_RNA) where: Base-Base interactions energy: -969.995 where: short stacking energy: -418.450 Base-Backbone interact. energy: 1.852 local terms energy: -452.798442 where: bonds (distance) C4'-P energy: -88.006 bonds (distance) P-C4' energy: -91.798 flat angles C4'-P-C4' energy: -91.197 flat angles P-C4'-P energy: -59.538 tors. eta vs tors. theta energy: -122.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -1331.353078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1331.353078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1331.353078 (E_RNA) where: Base-Base interactions energy: -920.388 where: short stacking energy: -370.884 Base-Backbone interact. energy: 3.630 local terms energy: -414.594969 where: bonds (distance) C4'-P energy: -71.483 bonds (distance) P-C4' energy: -94.964 flat angles C4'-P-C4' energy: -98.265 flat angles P-C4'-P energy: -44.802 tors. eta vs tors. theta energy: -105.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -1304.579214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.579214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1304.579214 (E_RNA) where: Base-Base interactions energy: -896.427 where: short stacking energy: -397.200 Base-Backbone interact. energy: -3.315 local terms energy: -404.837347 where: bonds (distance) C4'-P energy: -80.352 bonds (distance) P-C4' energy: -71.720 flat angles C4'-P-C4' energy: -87.817 flat angles P-C4'-P energy: -62.419 tors. eta vs tors. theta energy: -102.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -1270.942088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1270.942088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1270.942088 (E_RNA) where: Base-Base interactions energy: -891.661 where: short stacking energy: -381.312 Base-Backbone interact. energy: -2.483 local terms energy: -376.797923 where: bonds (distance) C4'-P energy: -68.010 bonds (distance) P-C4' energy: -67.338 flat angles C4'-P-C4' energy: -90.929 flat angles P-C4'-P energy: -60.923 tors. eta vs tors. theta energy: -89.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -1218.924228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1218.924228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1218.924228 (E_RNA) where: Base-Base interactions energy: -832.548 where: short stacking energy: -349.599 Base-Backbone interact. energy: -2.954 local terms energy: -383.422335 where: bonds (distance) C4'-P energy: -80.579 bonds (distance) P-C4' energy: -75.310 flat angles C4'-P-C4' energy: -86.726 flat angles P-C4'-P energy: -57.825 tors. eta vs tors. theta energy: -82.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -1042.736273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1042.736273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1042.736273 (E_RNA) where: Base-Base interactions energy: -699.368 where: short stacking energy: -322.323 Base-Backbone interact. energy: -2.030 local terms energy: -341.338941 where: bonds (distance) C4'-P energy: -68.484 bonds (distance) P-C4' energy: -78.276 flat angles C4'-P-C4' energy: -74.749 flat angles P-C4'-P energy: -46.321 tors. eta vs tors. theta energy: -73.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -912.520897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -912.520897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -912.520897 (E_RNA) where: Base-Base interactions energy: -596.303 where: short stacking energy: -257.487 Base-Backbone interact. energy: 1.907 local terms energy: -318.125236 where: bonds (distance) C4'-P energy: -70.545 bonds (distance) P-C4' energy: -57.564 flat angles C4'-P-C4' energy: -88.350 flat angles P-C4'-P energy: -37.468 tors. eta vs tors. theta energy: -64.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -772.230470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -772.230470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -772.230470 (E_RNA) where: Base-Base interactions energy: -479.121 where: short stacking energy: -227.513 Base-Backbone interact. energy: 1.054 local terms energy: -294.163063 where: bonds (distance) C4'-P energy: -67.982 bonds (distance) P-C4' energy: -72.518 flat angles C4'-P-C4' energy: -69.400 flat angles P-C4'-P energy: -39.959 tors. eta vs tors. theta energy: -44.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -438.386218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.386218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.386218 (E_RNA) where: Base-Base interactions energy: -196.054 where: short stacking energy: -132.494 Base-Backbone interact. energy: -3.457 local terms energy: -238.875761 where: bonds (distance) C4'-P energy: -65.553 bonds (distance) P-C4' energy: -83.087 flat angles C4'-P-C4' energy: -51.665 flat angles P-C4'-P energy: -38.680 tors. eta vs tors. theta energy: 0.110 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 8 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -1486.898007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1486.898007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1486.898007 (E_RNA) where: Base-Base interactions energy: -1031.848 where: short stacking energy: -432.786 Base-Backbone interact. energy: -0.664 local terms energy: -454.385903 where: bonds (distance) C4'-P energy: -81.488 bonds (distance) P-C4' energy: -88.686 flat angles C4'-P-C4' energy: -99.864 flat angles P-C4'-P energy: -63.628 tors. eta vs tors. theta energy: -120.720 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -1437.300631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.300631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1437.300631 (E_RNA) where: Base-Base interactions energy: -995.977 where: short stacking energy: -415.895 Base-Backbone interact. energy: -1.075 local terms energy: -440.248874 where: bonds (distance) C4'-P energy: -82.826 bonds (distance) P-C4' energy: -86.749 flat angles C4'-P-C4' energy: -98.758 flat angles P-C4'-P energy: -59.744 tors. eta vs tors. theta energy: -112.172 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -1350.503175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1350.503175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1350.503175 (E_RNA) where: Base-Base interactions energy: -917.714 where: short stacking energy: -405.491 Base-Backbone interact. energy: 0.559 local terms energy: -433.347951 where: bonds (distance) C4'-P energy: -73.053 bonds (distance) P-C4' energy: -90.675 flat angles C4'-P-C4' energy: -88.283 flat angles P-C4'-P energy: -67.000 tors. eta vs tors. theta energy: -114.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -1330.773024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1330.773024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1330.773024 (E_RNA) where: Base-Base interactions energy: -925.758 where: short stacking energy: -412.140 Base-Backbone interact. energy: 0.413 local terms energy: -405.428473 where: bonds (distance) C4'-P energy: -65.158 bonds (distance) P-C4' energy: -77.832 flat angles C4'-P-C4' energy: -85.961 flat angles P-C4'-P energy: -66.321 tors. eta vs tors. theta energy: -110.156 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -1225.175721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1225.175721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1225.175721 (E_RNA) where: Base-Base interactions energy: -861.448 where: short stacking energy: -359.416 Base-Backbone interact. energy: 3.144 local terms energy: -366.871608 where: bonds (distance) C4'-P energy: -64.324 bonds (distance) P-C4' energy: -82.221 flat angles C4'-P-C4' energy: -86.553 flat angles P-C4'-P energy: -51.123 tors. eta vs tors. theta energy: -82.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -1208.862077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1208.862077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1208.862077 (E_RNA) where: Base-Base interactions energy: -835.112 where: short stacking energy: -350.119 Base-Backbone interact. energy: -1.807 local terms energy: -371.943130 where: bonds (distance) C4'-P energy: -71.472 bonds (distance) P-C4' energy: -65.916 flat angles C4'-P-C4' energy: -90.750 flat angles P-C4'-P energy: -45.178 tors. eta vs tors. theta energy: -98.627 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -1005.656914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1005.656914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1005.656914 (E_RNA) where: Base-Base interactions energy: -660.488 where: short stacking energy: -308.839 Base-Backbone interact. energy: -1.188 local terms energy: -343.980545 where: bonds (distance) C4'-P energy: -62.487 bonds (distance) P-C4' energy: -77.532 flat angles C4'-P-C4' energy: -84.878 flat angles P-C4'-P energy: -44.505 tors. eta vs tors. theta energy: -74.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -915.332521 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -915.332521 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -915.332521 (E_RNA) where: Base-Base interactions energy: -617.919 where: short stacking energy: -278.011 Base-Backbone interact. energy: 0.115 local terms energy: -297.527856 where: bonds (distance) C4'-P energy: -74.451 bonds (distance) P-C4' energy: -53.366 flat angles C4'-P-C4' energy: -79.728 flat angles P-C4'-P energy: -40.497 tors. eta vs tors. theta energy: -49.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -774.792674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.792674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.792674 (E_RNA) where: Base-Base interactions energy: -483.841 where: short stacking energy: -222.317 Base-Backbone interact. energy: -0.427 local terms energy: -290.524600 where: bonds (distance) C4'-P energy: -62.821 bonds (distance) P-C4' energy: -68.363 flat angles C4'-P-C4' energy: -62.685 flat angles P-C4'-P energy: -48.763 tors. eta vs tors. theta energy: -47.893 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -463.966568 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.966568 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.966568 (E_RNA) where: Base-Base interactions energy: -236.291 where: short stacking energy: -158.023 Base-Backbone interact. energy: 0.229 local terms energy: -227.905041 where: bonds (distance) C4'-P energy: -82.684 bonds (distance) P-C4' energy: -60.357 flat angles C4'-P-C4' energy: -46.381 flat angles P-C4'-P energy: -32.282 tors. eta vs tors. theta energy: -6.201 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -1452.044080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1452.044080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1452.044080 (E_RNA) where: Base-Base interactions energy: -997.091 where: short stacking energy: -422.917 Base-Backbone interact. energy: -0.352 local terms energy: -454.601185 where: bonds (distance) C4'-P energy: -84.232 bonds (distance) P-C4' energy: -92.810 flat angles C4'-P-C4' energy: -97.520 flat angles P-C4'-P energy: -61.330 tors. eta vs tors. theta energy: -118.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -1458.773021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1458.773021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1458.773021 (E_RNA) where: Base-Base interactions energy: -1030.915 where: short stacking energy: -433.571 Base-Backbone interact. energy: -2.825 local terms energy: -425.033722 where: bonds (distance) C4'-P energy: -73.204 bonds (distance) P-C4' energy: -85.611 flat angles C4'-P-C4' energy: -90.828 flat angles P-C4'-P energy: -64.814 tors. eta vs tors. theta energy: -110.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -1361.595944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1361.595944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1361.595944 (E_RNA) where: Base-Base interactions energy: -934.692 where: short stacking energy: -414.747 Base-Backbone interact. energy: -2.242 local terms energy: -424.661641 where: bonds (distance) C4'-P energy: -77.138 bonds (distance) P-C4' energy: -83.716 flat angles C4'-P-C4' energy: -90.007 flat angles P-C4'-P energy: -55.763 tors. eta vs tors. theta energy: -118.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -1298.595432 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1298.595432 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1298.595432 (E_RNA) where: Base-Base interactions energy: -889.243 where: short stacking energy: -392.591 Base-Backbone interact. energy: -3.414 local terms energy: -405.938767 where: bonds (distance) C4'-P energy: -77.054 bonds (distance) P-C4' energy: -72.998 flat angles C4'-P-C4' energy: -82.030 flat angles P-C4'-P energy: -55.911 tors. eta vs tors. theta energy: -117.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -1267.800268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1267.800268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1267.800268 (E_RNA) where: Base-Base interactions energy: -866.999 where: short stacking energy: -378.573 Base-Backbone interact. energy: -1.123 local terms energy: -399.677573 where: bonds (distance) C4'-P energy: -70.010 bonds (distance) P-C4' energy: -72.300 flat angles C4'-P-C4' energy: -92.173 flat angles P-C4'-P energy: -61.867 tors. eta vs tors. theta energy: -103.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -1185.031739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.031739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1185.031739 (E_RNA) where: Base-Base interactions energy: -824.324 where: short stacking energy: -366.114 Base-Backbone interact. energy: -1.985 local terms energy: -358.722531 where: bonds (distance) C4'-P energy: -52.356 bonds (distance) P-C4' energy: -78.337 flat angles C4'-P-C4' energy: -86.056 flat angles P-C4'-P energy: -52.831 tors. eta vs tors. theta energy: -89.143 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -1019.988847 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.988847 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1019.988847 (E_RNA) where: Base-Base interactions energy: -679.027 where: short stacking energy: -299.056 Base-Backbone interact. energy: -1.158 local terms energy: -339.803379 where: bonds (distance) C4'-P energy: -72.237 bonds (distance) P-C4' energy: -77.952 flat angles C4'-P-C4' energy: -73.969 flat angles P-C4'-P energy: -50.288 tors. eta vs tors. theta energy: -65.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -922.110124 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -922.110124 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -922.110124 (E_RNA) where: Base-Base interactions energy: -616.617 where: short stacking energy: -275.229 Base-Backbone interact. energy: 2.470 local terms energy: -307.962872 where: bonds (distance) C4'-P energy: -68.963 bonds (distance) P-C4' energy: -62.610 flat angles C4'-P-C4' energy: -64.710 flat angles P-C4'-P energy: -46.566 tors. eta vs tors. theta energy: -65.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -753.594738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -753.594738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -753.594738 (E_RNA) where: Base-Base interactions energy: -454.226 where: short stacking energy: -227.125 Base-Backbone interact. energy: 1.210 local terms energy: -300.579650 where: bonds (distance) C4'-P energy: -88.640 bonds (distance) P-C4' energy: -62.376 flat angles C4'-P-C4' energy: -68.824 flat angles P-C4'-P energy: -49.619 tors. eta vs tors. theta energy: -31.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -500.966608 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -500.966608 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -500.966608 (E_RNA) where: Base-Base interactions energy: -252.984 where: short stacking energy: -161.858 Base-Backbone interact. energy: -0.073 local terms energy: -247.909710 where: bonds (distance) C4'-P energy: -60.827 bonds (distance) P-C4' energy: -69.680 flat angles C4'-P-C4' energy: -66.279 flat angles P-C4'-P energy: -41.793 tors. eta vs tors. theta energy: -9.330 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -1465.071636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.071636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.071636 (E_RNA) where: Base-Base interactions energy: -1025.687 where: short stacking energy: -445.045 Base-Backbone interact. energy: -3.729 local terms energy: -435.655732 where: bonds (distance) C4'-P energy: -74.155 bonds (distance) P-C4' energy: -82.995 flat angles C4'-P-C4' energy: -95.947 flat angles P-C4'-P energy: -59.055 tors. eta vs tors. theta energy: -123.504 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -1444.224188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1444.224188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1444.224188 (E_RNA) where: Base-Base interactions energy: -1007.542 where: short stacking energy: -431.272 Base-Backbone interact. energy: 1.333 local terms energy: -438.014332 where: bonds (distance) C4'-P energy: -87.834 bonds (distance) P-C4' energy: -87.324 flat angles C4'-P-C4' energy: -93.639 flat angles P-C4'-P energy: -60.557 tors. eta vs tors. theta energy: -108.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -1362.425996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1362.425996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1362.425996 (E_RNA) where: Base-Base interactions energy: -930.344 where: short stacking energy: -395.997 Base-Backbone interact. energy: -2.435 local terms energy: -429.647425 where: bonds (distance) C4'-P energy: -76.136 bonds (distance) P-C4' energy: -85.829 flat angles C4'-P-C4' energy: -91.982 flat angles P-C4'-P energy: -69.063 tors. eta vs tors. theta energy: -106.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -1309.992275 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.992275 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1309.992275 (E_RNA) where: Base-Base interactions energy: -901.394 where: short stacking energy: -395.015 Base-Backbone interact. energy: -2.640 local terms energy: -405.958727 where: bonds (distance) C4'-P energy: -78.200 bonds (distance) P-C4' energy: -74.939 flat angles C4'-P-C4' energy: -86.928 flat angles P-C4'-P energy: -50.877 tors. eta vs tors. theta energy: -115.015 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -1274.471452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1274.471452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1274.471452 (E_RNA) where: Base-Base interactions energy: -875.363 where: short stacking energy: -365.239 Base-Backbone interact. energy: -0.957 local terms energy: -398.150865 where: bonds (distance) C4'-P energy: -70.692 bonds (distance) P-C4' energy: -84.562 flat angles C4'-P-C4' energy: -81.587 flat angles P-C4'-P energy: -56.378 tors. eta vs tors. theta energy: -104.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -1181.820895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1181.820895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1181.820895 (E_RNA) where: Base-Base interactions energy: -814.400 where: short stacking energy: -357.512 Base-Backbone interact. energy: -0.079 local terms energy: -367.341514 where: bonds (distance) C4'-P energy: -66.955 bonds (distance) P-C4' energy: -73.785 flat angles C4'-P-C4' energy: -80.783 flat angles P-C4'-P energy: -48.987 tors. eta vs tors. theta energy: -96.832 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -993.016322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -993.016322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -993.016322 (E_RNA) where: Base-Base interactions energy: -666.577 where: short stacking energy: -302.573 Base-Backbone interact. energy: 2.544 local terms energy: -328.983838 where: bonds (distance) C4'-P energy: -61.080 bonds (distance) P-C4' energy: -83.235 flat angles C4'-P-C4' energy: -68.959 flat angles P-C4'-P energy: -39.492 tors. eta vs tors. theta energy: -76.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -855.620026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -855.620026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -855.620026 (E_RNA) where: Base-Base interactions energy: -531.401 where: short stacking energy: -247.544 Base-Backbone interact. energy: -1.675 local terms energy: -322.544245 where: bonds (distance) C4'-P energy: -74.739 bonds (distance) P-C4' energy: -81.724 flat angles C4'-P-C4' energy: -71.221 flat angles P-C4'-P energy: -48.132 tors. eta vs tors. theta energy: -46.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -774.421038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -774.421038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -774.421038 (E_RNA) where: Base-Base interactions energy: -492.152 where: short stacking energy: -224.317 Base-Backbone interact. energy: -0.647 local terms energy: -281.621850 where: bonds (distance) C4'-P energy: -65.725 bonds (distance) P-C4' energy: -75.168 flat angles C4'-P-C4' energy: -72.034 flat angles P-C4'-P energy: -42.856 tors. eta vs tors. theta energy: -25.839 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -544.162482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -544.162482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -544.162482 (E_RNA) where: Base-Base interactions energy: -299.782 where: short stacking energy: -154.734 Base-Backbone interact. energy: -2.805 local terms energy: -241.576231 where: bonds (distance) C4'-P energy: -58.178 bonds (distance) P-C4' energy: -76.682 flat angles C4'-P-C4' energy: -61.099 flat angles P-C4'-P energy: -40.527 tors. eta vs tors. theta energy: -5.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -1465.796856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.796856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.796856 (E_RNA) where: Base-Base interactions energy: -1014.049 where: short stacking energy: -432.849 Base-Backbone interact. energy: -1.835 local terms energy: -449.912842 where: bonds (distance) C4'-P energy: -94.965 bonds (distance) P-C4' energy: -73.962 flat angles C4'-P-C4' energy: -93.529 flat angles P-C4'-P energy: -61.684 tors. eta vs tors. theta energy: -125.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -1465.945418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1465.945418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1465.945418 (E_RNA) where: Base-Base interactions energy: -1035.844 where: short stacking energy: -437.399 Base-Backbone interact. energy: -4.016 local terms energy: -426.085110 where: bonds (distance) C4'-P energy: -79.789 bonds (distance) P-C4' energy: -83.605 flat angles C4'-P-C4' energy: -93.203 flat angles P-C4'-P energy: -54.411 tors. eta vs tors. theta energy: -115.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -1371.474313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1371.474313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1371.474313 (E_RNA) where: Base-Base interactions energy: -948.476 where: short stacking energy: -390.686 Base-Backbone interact. energy: -0.563 local terms energy: -422.435403 where: bonds (distance) C4'-P energy: -81.467 bonds (distance) P-C4' energy: -84.340 flat angles C4'-P-C4' energy: -81.651 flat angles P-C4'-P energy: -57.818 tors. eta vs tors. theta energy: -117.160 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -1333.031153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1333.031153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1333.031153 (E_RNA) where: Base-Base interactions energy: -895.184 where: short stacking energy: -393.367 Base-Backbone interact. energy: -2.357 local terms energy: -435.490036 where: bonds (distance) C4'-P energy: -83.536 bonds (distance) P-C4' energy: -82.856 flat angles C4'-P-C4' energy: -91.867 flat angles P-C4'-P energy: -63.250 tors. eta vs tors. theta energy: -113.982 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -1242.960532 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.960532 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.960532 (E_RNA) where: Base-Base interactions energy: -854.172 where: short stacking energy: -362.140 Base-Backbone interact. energy: -0.729 local terms energy: -388.059972 where: bonds (distance) C4'-P energy: -72.704 bonds (distance) P-C4' energy: -77.732 flat angles C4'-P-C4' energy: -84.787 flat angles P-C4'-P energy: -56.591 tors. eta vs tors. theta energy: -96.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -1180.713281 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1180.713281 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1180.713281 (E_RNA) where: Base-Base interactions energy: -815.426 where: short stacking energy: -323.896 Base-Backbone interact. energy: -3.721 local terms energy: -361.566250 where: bonds (distance) C4'-P energy: -57.397 bonds (distance) P-C4' energy: -84.594 flat angles C4'-P-C4' energy: -84.288 flat angles P-C4'-P energy: -45.757 tors. eta vs tors. theta energy: -89.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -1016.192369 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1016.192369 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1016.192369 (E_RNA) where: Base-Base interactions energy: -669.921 where: short stacking energy: -301.219 Base-Backbone interact. energy: 2.231 local terms energy: -348.502274 where: bonds (distance) C4'-P energy: -57.204 bonds (distance) P-C4' energy: -72.187 flat angles C4'-P-C4' energy: -80.360 flat angles P-C4'-P energy: -62.305 tors. eta vs tors. theta energy: -76.446 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -878.302158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -878.302158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -878.302158 (E_RNA) where: Base-Base interactions energy: -573.746 where: short stacking energy: -255.376 Base-Backbone interact. energy: -2.163 local terms energy: -302.393119 where: bonds (distance) C4'-P energy: -58.929 bonds (distance) P-C4' energy: -87.252 flat angles C4'-P-C4' energy: -64.444 flat angles P-C4'-P energy: -45.313 tors. eta vs tors. theta energy: -46.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -784.262249 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -784.262249 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -784.262249 (E_RNA) where: Base-Base interactions energy: -499.322 where: short stacking energy: -207.009 Base-Backbone interact. energy: 0.614 local terms energy: -285.554655 where: bonds (distance) C4'-P energy: -67.311 bonds (distance) P-C4' energy: -68.414 flat angles C4'-P-C4' energy: -72.644 flat angles P-C4'-P energy: -33.862 tors. eta vs tors. theta energy: -43.324 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -576.456714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -576.456714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -576.456714 (E_RNA) where: Base-Base interactions energy: -337.004 where: short stacking energy: -162.858 Base-Backbone interact. energy: -0.497 local terms energy: -238.955497 where: bonds (distance) C4'-P energy: -65.217 bonds (distance) P-C4' energy: -65.203 flat angles C4'-P-C4' energy: -72.986 flat angles P-C4'-P energy: -36.230 tors. eta vs tors. theta energy: 0.679 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1463.170449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1463.170449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1463.170449 (E_RNA) where: Base-Base interactions energy: -1012.839 where: short stacking energy: -438.566 Base-Backbone interact. energy: -2.773 local terms energy: -447.558178 where: bonds (distance) C4'-P energy: -87.185 bonds (distance) P-C4' energy: -95.104 flat angles C4'-P-C4' energy: -85.420 flat angles P-C4'-P energy: -56.048 tors. eta vs tors. theta energy: -123.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 8 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -1468.208168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1468.208168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1468.208168 (E_RNA) where: Base-Base interactions energy: -1061.729 where: short stacking energy: -423.027 Base-Backbone interact. energy: -1.817 local terms energy: -404.662537 where: bonds (distance) C4'-P energy: -67.430 bonds (distance) P-C4' energy: -80.492 flat angles C4'-P-C4' energy: -92.143 flat angles P-C4'-P energy: -52.217 tors. eta vs tors. theta energy: -112.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -1360.160090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1360.160090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1360.160090 (E_RNA) where: Base-Base interactions energy: -941.501 where: short stacking energy: -420.948 Base-Backbone interact. energy: -0.455 local terms energy: -418.204008 where: bonds (distance) C4'-P energy: -77.304 bonds (distance) P-C4' energy: -79.118 flat angles C4'-P-C4' energy: -79.926 flat angles P-C4'-P energy: -62.870 tors. eta vs tors. theta energy: -118.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -1271.641699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1271.641699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1271.641699 (E_RNA) where: Base-Base interactions energy: -890.193 where: short stacking energy: -378.072 Base-Backbone interact. energy: 2.722 local terms energy: -384.170226 where: bonds (distance) C4'-P energy: -67.452 bonds (distance) P-C4' energy: -70.954 flat angles C4'-P-C4' energy: -85.236 flat angles P-C4'-P energy: -59.617 tors. eta vs tors. theta energy: -100.912 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -1242.668868 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1242.668868 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1242.668868 (E_RNA) where: Base-Base interactions energy: -860.827 where: short stacking energy: -375.492 Base-Backbone interact. energy: -3.286 local terms energy: -378.556028 where: bonds (distance) C4'-P energy: -63.956 bonds (distance) P-C4' energy: -75.016 flat angles C4'-P-C4' energy: -85.860 flat angles P-C4'-P energy: -55.260 tors. eta vs tors. theta energy: -98.463 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -1191.185040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1191.185040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1191.185040 (E_RNA) where: Base-Base interactions energy: -826.482 where: short stacking energy: -350.638 Base-Backbone interact. energy: -0.031 local terms energy: -364.672376 where: bonds (distance) C4'-P energy: -72.206 bonds (distance) P-C4' energy: -70.330 flat angles C4'-P-C4' energy: -86.450 flat angles P-C4'-P energy: -52.643 tors. eta vs tors. theta energy: -83.043 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -1007.494072 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1007.494072 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1007.494072 (E_RNA) where: Base-Base interactions energy: -674.790 where: short stacking energy: -305.464 Base-Backbone interact. energy: -1.526 local terms energy: -331.177763 where: bonds (distance) C4'-P energy: -75.477 bonds (distance) P-C4' energy: -55.861 flat angles C4'-P-C4' energy: -73.515 flat angles P-C4'-P energy: -57.183 tors. eta vs tors. theta energy: -69.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -904.153819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -904.153819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -904.153819 (E_RNA) where: Base-Base interactions energy: -571.645 where: short stacking energy: -259.837 Base-Backbone interact. energy: 0.706 local terms energy: -333.214760 where: bonds (distance) C4'-P energy: -73.934 bonds (distance) P-C4' energy: -70.983 flat angles C4'-P-C4' energy: -77.405 flat angles P-C4'-P energy: -50.657 tors. eta vs tors. theta energy: -60.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -779.094837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -779.094837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -779.094837 (E_RNA) where: Base-Base interactions energy: -467.600 where: short stacking energy: -214.472 Base-Backbone interact. energy: -1.522 local terms energy: -309.972841 where: bonds (distance) C4'-P energy: -72.634 bonds (distance) P-C4' energy: -73.520 flat angles C4'-P-C4' energy: -80.928 flat angles P-C4'-P energy: -40.452 tors. eta vs tors. theta energy: -42.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -558.866423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -558.866423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -558.866423 (E_RNA) where: Base-Base interactions energy: -314.597 where: short stacking energy: -166.891 Base-Backbone interact. energy: -0.754 local terms energy: -243.515825 where: bonds (distance) C4'-P energy: -67.375 bonds (distance) P-C4' energy: -80.030 flat angles C4'-P-C4' energy: -55.143 flat angles P-C4'-P energy: -34.392 tors. eta vs tors. theta energy: -6.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 8 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 13393198 moves confirmed later: 14759073 all moves confirmed: 28152271 percent of confirmed moves: 17.595169 current total energy: -1376.556893 recalc. total energy: -1376.556893 replica 1 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 14273831 moves confirmed later: 15727618 all moves confirmed: 30001449 percent of confirmed moves: 18.750906 current total energy: -1404.290842 recalc. total energy: -1404.290842 replica 7 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 15247024 moves confirmed later: 16996935 all moves confirmed: 32243959 percent of confirmed moves: 20.152474 current total energy: -1254.717933 recalc. total energy: -1254.717933 replica 2 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 16238059 moves confirmed later: 18176162 all moves confirmed: 34414221 percent of confirmed moves: 21.508888 current total energy: -1150.394083 recalc. total energy: -1150.394083 replica 6 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 18763843 moves confirmed later: 21662472 all moves confirmed: 40426315 percent of confirmed moves: 25.266447 current total energy: -1165.937999 recalc. total energy: -1165.937999 replica 9 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 16871872 moves confirmed later: 19036923 all moves confirmed: 35908795 percent of confirmed moves: 22.442997 current total energy: -1056.718483 recalc. total energy: -1056.718483 replica 3 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 22190725 moves confirmed later: 25991329 all moves confirmed: 48182054 percent of confirmed moves: 30.113784 current total energy: -888.251808 recalc. total energy: -888.251808 replica 4 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 21333879 moves confirmed later: 24880193 all moves confirmed: 46214072 percent of confirmed moves: 28.883795 current total energy: -792.094669 recalc. total energy: -792.094669 replica 5 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 24534788 moves confirmed later: 29092297 all moves confirmed: 53627085 percent of confirmed moves: 33.516928 current total energy: -685.215332 recalc. total energy: -685.215332 replica 10 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 30809515 moves confirmed later: 37228096 all moves confirmed: 68037611 percent of confirmed moves: 42.523507 current total energy: -418.341578 recalc. total energy: -418.341578 out arg RESULTS//1/ID1203-3c86ce96_01 Time of doing 1600000 iterations: 3348.865 seconds