SimRNA (c) 2009-2024 Genesilico, ver. 3.33
Replica Exchange Monte Carlo Method is SWITCHED ON
10 replicas were ordered
.reading parameteres
setting random seed = 1
initiating replica nr: 1
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 0.900
successfully initiated
initiating replica nr: 2
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 0.950
successfully initiated
initiating replica nr: 3
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.000
successfully initiated
initiating replica nr: 4
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.050
successfully initiated
initiating replica nr: 5
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.100
successfully initiated
initiating replica nr: 6
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.150
successfully initiated
initiating replica nr: 7
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.200
successfully initiated
initiating replica nr: 8
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.250
successfully initiated
initiating replica nr: 9
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.300
successfully initiated
initiating replica nr: 10
before entireStruct->initialize(input)
file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa first_line: R
number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/I00-c8ccef4a/inputs/seq.fa: 1
curr_seq: _GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG_
chainIds_rna: _A_, chainIds_protein: __
chainId: A, chainSeq: GCAUGACUCCACGUUCGAUCCACUGGCGAGUGCUAGUAGUAGUACUGCUGUUUCGUAGCGGAACACGACGGCCGUGGGACUCCCCCCUUGGUAACAAGGACCCGCGGGGCCAAAAGCCACGUCUCUGACCCGUCGUGUGUGCAAACCCAGCACAGCAGCUUUACUGCGAAAACCACUUUAAGGUGACAUUGAUACUGGUACUCACGCACUGGUG
RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000
RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000
RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000
RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000
RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000
RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000
RNA chains:
chain A contains 214 nucleotides
loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE
loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE
loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE
loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE
loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE
reweighting term eta_theta by 0.400000, default value
scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000
eta-theta term was reweighted by factor 0.400000 provided by the user
reading conformers file: ./data/rna/A_conformers
n_lines: 4766
16 15 69 34 27
46 26 156 83 35
93 127 1269 89 50
187 157 1927 88 75
51 22 67 25 32
DONE
reading conformers file: ./data/rna/C_conformers
n_lines: 5164
7 8 61 17 4
14 12 143 49 12
23 140 2110 21 24
88 101 2101 19 36
25 21 108 8 12
DONE
reading conformers file: ./data/rna/G_conformers
n_lines: 6375
11 7 79 21 50
20 17 175 54 39
42 102 2774 90 34
61 94 2314 71 100
20 22 142 15 21
DONE
reading conformers file: ./data/rna/U_conformers
n_lines: 3617
6 6 43 33 24
20 20 131 50 28
30 58 1412 30 24
64 82 1197 31 32
71 36 132 13 44
DONE
loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE
loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE
loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE
loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE
loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE
loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE
loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE
loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE
loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE
loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE
loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE
loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE
loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE
loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE
loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE
loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE
loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE
scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE
scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE
scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE
scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE
scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE
scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000
loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE
loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE
loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE
loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE
loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE
loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE
loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE
loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE
loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE
scaling: histogram A_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE
scaling: histogram C_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE
scaling: histogram G_3_exvol.hist was multiplied by 0.100000
loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE
scaling: histogram U_3_exvol.hist was multiplied by 0.100000
x_protein_frc: 0.000
x_rna_frc: 1.000
int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 1075
n_atoms_counter: 1075
Fraction Of RNA Moves = 1.000000
Fraction Of Protein Moves = 0.000000
EntireStructure::rnaStruct limitingSphereRadius : 214.000000 DONE
before calcCenterOfMass();
after calcCenterOfMass();
before calcTotalEnergy();
after calcTotalEnergy();
after entireStruct->initialize(input)
leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input)
number of iterations = 100000
trajectory write in every 16000 iterations
after each trajectory write attempt of changing replicas will be done
replica Temperature = 1.350
successfully initiated
.calculating
program compiled for parallel execution of replicas in Replica Exchange MC method
program can utilize maximum as many CPU cores as replicas, in this case: 10
==================================
temp. level: 1, replica: 1
=====================================
Write number: 1
Temperature: 0.900000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 2
=====================================
Write number: 1
Temperature: 0.950000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 1
Temperature: 1.000000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 4
=====================================
Write number: 1
Temperature: 1.050000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 5
=====================================
Write number: 1
Temperature: 1.100000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 6
=====================================
Write number: 1
Temperature: 1.150000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 7
=====================================
Write number: 1
Temperature: 1.200000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 8
=====================================
Write number: 1
Temperature: 1.250000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 9
=====================================
Write number: 1
Temperature: 1.300000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 10
=====================================
Write number: 1
Temperature: 1.350000
Total energy: -850.770319 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -850.770319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -850.770319 (E_RNA)
where:
Base-Base interactions energy: -17.862
where: short stacking energy: -17.862
Base-Backbone interact. energy: -0.000
local terms energy: -832.908039
where:
bonds (distance) C4'-P energy: -207.918
bonds (distance) P-C4' energy: -192.350
flat angles C4'-P-C4' energy: -157.124
flat angles P-C4'-P energy: -179.733
tors. eta vs tors. theta energy: -95.783
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 1
=====================================
Write number: 2
Temperature: 0.900000
Total energy: -1054.039887 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1054.039887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1054.039887 (E_RNA)
where:
Base-Base interactions energy: -447.273
where: short stacking energy: -447.265
Base-Backbone interact. energy: 0.991
local terms energy: -607.757795
where:
bonds (distance) C4'-P energy: -119.011
bonds (distance) P-C4' energy: -140.907
flat angles C4'-P-C4' energy: -147.354
flat angles P-C4'-P energy: -86.977
tors. eta vs tors. theta energy: -113.509
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 2
=====================================
Write number: 2
Temperature: 0.950000
Total energy: -995.554699 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -995.554699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -995.554699 (E_RNA)
where:
Base-Base interactions energy: -401.847
where: short stacking energy: -401.847
Base-Backbone interact. energy: -0.047
local terms energy: -593.660141
where:
bonds (distance) C4'-P energy: -146.235
bonds (distance) P-C4' energy: -140.204
flat angles C4'-P-C4' energy: -122.446
flat angles P-C4'-P energy: -79.499
tors. eta vs tors. theta energy: -105.276
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 2
Temperature: 1.000000
Total energy: -929.829517 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -929.829517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -929.829517 (E_RNA)
where:
Base-Base interactions energy: -368.952
where: short stacking energy: -368.528
Base-Backbone interact. energy: -0.817
local terms energy: -560.059735
where:
bonds (distance) C4'-P energy: -130.571
bonds (distance) P-C4' energy: -148.943
flat angles C4'-P-C4' energy: -118.760
flat angles P-C4'-P energy: -71.083
tors. eta vs tors. theta energy: -90.702
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 4
=====================================
Write number: 2
Temperature: 1.050000
Total energy: -885.828428 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -885.828428 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -885.828428 (E_RNA)
where:
Base-Base interactions energy: -348.273
where: short stacking energy: -346.104
Base-Backbone interact. energy: 0.052
local terms energy: -537.607116
where:
bonds (distance) C4'-P energy: -125.413
bonds (distance) P-C4' energy: -130.007
flat angles C4'-P-C4' energy: -132.888
flat angles P-C4'-P energy: -71.547
tors. eta vs tors. theta energy: -77.752
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 5
=====================================
Write number: 2
Temperature: 1.100000
Total energy: -875.149162 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -875.149162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -875.149162 (E_RNA)
where:
Base-Base interactions energy: -303.648
where: short stacking energy: -303.648
Base-Backbone interact. energy: -0.001
local terms energy: -571.500069
where:
bonds (distance) C4'-P energy: -112.225
bonds (distance) P-C4' energy: -117.073
flat angles C4'-P-C4' energy: -136.015
flat angles P-C4'-P energy: -120.230
tors. eta vs tors. theta energy: -85.957
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 6
=====================================
Write number: 2
Temperature: 1.150000
Total energy: -868.616094 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -868.616094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -868.616094 (E_RNA)
where:
Base-Base interactions energy: -55.772
where: short stacking energy: -55.772
Base-Backbone interact. energy: -0.000
local terms energy: -812.843714
where:
bonds (distance) C4'-P energy: -193.024
bonds (distance) P-C4' energy: -185.373
flat angles C4'-P-C4' energy: -157.187
flat angles P-C4'-P energy: -176.713
tors. eta vs tors. theta energy: -100.547
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 7
=====================================
Write number: 2
Temperature: 1.200000
Total energy: -864.504052 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -864.504052 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -864.504052 (E_RNA)
where:
Base-Base interactions energy: -51.127
where: short stacking energy: -51.127
Base-Backbone interact. energy: -0.000
local terms energy: -813.377202
where:
bonds (distance) C4'-P energy: -195.823
bonds (distance) P-C4' energy: -183.741
flat angles C4'-P-C4' energy: -159.024
flat angles P-C4'-P energy: -176.537
tors. eta vs tors. theta energy: -98.252
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 8
=====================================
Write number: 2
Temperature: 1.250000
Total energy: -872.332810 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -872.332810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -872.332810 (E_RNA)
where:
Base-Base interactions energy: -81.678
where: short stacking energy: -81.678
Base-Backbone interact. energy: -0.000
local terms energy: -790.654929
where:
bonds (distance) C4'-P energy: -186.082
bonds (distance) P-C4' energy: -171.193
flat angles C4'-P-C4' energy: -158.335
flat angles P-C4'-P energy: -172.930
tors. eta vs tors. theta energy: -102.114
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 9
=====================================
Write number: 2
Temperature: 1.300000
Total energy: -855.314490 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -855.314490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -855.314490 (E_RNA)
where:
Base-Base interactions energy: -42.549
where: short stacking energy: -42.549
Base-Backbone interact. energy: -0.000
local terms energy: -812.765524
where:
bonds (distance) C4'-P energy: -194.187
bonds (distance) P-C4' energy: -185.133
flat angles C4'-P-C4' energy: -158.165
flat angles P-C4'-P energy: -177.653
tors. eta vs tors. theta energy: -97.627
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 10
=====================================
Write number: 2
Temperature: 1.350000
Total energy: -858.773731 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -858.773731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -858.773731 (E_RNA)
where:
Base-Base interactions energy: -42.945
where: short stacking energy: -42.945
Base-Backbone interact. energy: -0.000
local terms energy: -815.828295
where:
bonds (distance) C4'-P energy: -196.974
bonds (distance) P-C4' energy: -185.137
flat angles C4'-P-C4' energy: -158.713
flat angles P-C4'-P energy: -177.649
tors. eta vs tors. theta energy: -97.357
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 1
=====================================
Write number: 3
Temperature: 0.900000
Total energy: -1085.390699 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1085.390699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1085.390699 (E_RNA)
where:
Base-Base interactions energy: -473.269
where: short stacking energy: -465.055
Base-Backbone interact. energy: -0.870
local terms energy: -611.251665
where:
bonds (distance) C4'-P energy: -128.659
bonds (distance) P-C4' energy: -142.710
flat angles C4'-P-C4' energy: -137.263
flat angles P-C4'-P energy: -88.881
tors. eta vs tors. theta energy: -113.738
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 2
=====================================
Write number: 3
Temperature: 0.950000
Total energy: -1026.833720 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1026.833720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1026.833720 (E_RNA)
where:
Base-Base interactions energy: -442.124
where: short stacking energy: -426.793
Base-Backbone interact. energy: -0.828
local terms energy: -583.881575
where:
bonds (distance) C4'-P energy: -129.599
bonds (distance) P-C4' energy: -130.115
flat angles C4'-P-C4' energy: -129.840
flat angles P-C4'-P energy: -94.816
tors. eta vs tors. theta energy: -99.512
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 3
Temperature: 1.000000
Total energy: -944.450484 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -944.450484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -944.450484 (E_RNA)
where:
Base-Base interactions energy: -411.323
where: short stacking energy: -392.078
Base-Backbone interact. energy: -0.583
local terms energy: -532.544101
where:
bonds (distance) C4'-P energy: -116.811
bonds (distance) P-C4' energy: -125.300
flat angles C4'-P-C4' energy: -125.345
flat angles P-C4'-P energy: -85.245
tors. eta vs tors. theta energy: -79.842
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 4
=====================================
Write number: 3
Temperature: 1.050000
Total energy: -884.308939 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -884.308939 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -884.308939 (E_RNA)
where:
Base-Base interactions energy: -369.677
where: short stacking energy: -351.764
Base-Backbone interact. energy: -0.429
local terms energy: -514.203168
where:
bonds (distance) C4'-P energy: -122.620
bonds (distance) P-C4' energy: -138.472
flat angles C4'-P-C4' energy: -112.744
flat angles P-C4'-P energy: -71.619
tors. eta vs tors. theta energy: -68.748
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 5
=====================================
Write number: 3
Temperature: 1.100000
Total energy: -835.504480 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -835.504480 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -835.504480 (E_RNA)
where:
Base-Base interactions energy: -329.451
where: short stacking energy: -320.256
Base-Backbone interact. energy: -0.773
local terms energy: -505.280503
where:
bonds (distance) C4'-P energy: -123.509
bonds (distance) P-C4' energy: -131.478
flat angles C4'-P-C4' energy: -121.351
flat angles P-C4'-P energy: -70.967
tors. eta vs tors. theta energy: -57.975
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 6
=====================================
Write number: 3
Temperature: 1.150000
Total energy: -713.155252 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -713.155252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -713.155252 (E_RNA)
where:
Base-Base interactions energy: -286.367
where: short stacking energy: -240.174
Base-Backbone interact. energy: 6.511
local terms energy: -433.299035
where:
bonds (distance) C4'-P energy: -137.133
bonds (distance) P-C4' energy: -111.145
flat angles C4'-P-C4' energy: -109.092
flat angles P-C4'-P energy: -68.305
tors. eta vs tors. theta energy: -7.624
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 7
=====================================
Write number: 3
Temperature: 1.200000
Total energy: -701.311146 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -701.311146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -701.311146 (E_RNA)
where:
Base-Base interactions energy: -282.081
where: short stacking energy: -258.871
Base-Backbone interact. energy: -1.236
local terms energy: -417.993967
where:
bonds (distance) C4'-P energy: -117.520
bonds (distance) P-C4' energy: -108.784
flat angles C4'-P-C4' energy: -111.489
flat angles P-C4'-P energy: -58.118
tors. eta vs tors. theta energy: -22.084
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 9
=====================================
Write number: 3
Temperature: 1.250000
Total energy: -695.111546 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -695.111546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -695.111546 (E_RNA)
where:
Base-Base interactions energy: -283.560
where: short stacking energy: -224.726
Base-Backbone interact. energy: 4.613
local terms energy: -416.164677
where:
bonds (distance) C4'-P energy: -107.891
bonds (distance) P-C4' energy: -118.427
flat angles C4'-P-C4' energy: -111.374
flat angles P-C4'-P energy: -57.165
tors. eta vs tors. theta energy: -21.308
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 8
=====================================
Write number: 3
Temperature: 1.300000
Total energy: -590.298029 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -590.298029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -590.298029 (E_RNA)
where:
Base-Base interactions energy: -209.367
where: short stacking energy: -194.109
Base-Backbone interact. energy: 5.347
local terms energy: -386.278698
where:
bonds (distance) C4'-P energy: -102.228
bonds (distance) P-C4' energy: -117.887
flat angles C4'-P-C4' energy: -96.476
flat angles P-C4'-P energy: -62.700
tors. eta vs tors. theta energy: -6.988
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 10
=====================================
Write number: 3
Temperature: 1.350000
Total energy: -589.919081 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -589.919081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -589.919081 (E_RNA)
where:
Base-Base interactions energy: -242.677
where: short stacking energy: -176.185
Base-Backbone interact. energy: 1.042
local terms energy: -348.283897
where:
bonds (distance) C4'-P energy: -86.671
bonds (distance) P-C4' energy: -113.990
flat angles C4'-P-C4' energy: -87.186
flat angles P-C4'-P energy: -74.046
tors. eta vs tors. theta energy: 13.608
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 1
=====================================
Write number: 4
Temperature: 0.900000
Total energy: -1138.676383 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1138.676383 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1138.676383 (E_RNA)
where:
Base-Base interactions energy: -521.252
where: short stacking energy: -505.524
Base-Backbone interact. energy: 0.176
local terms energy: -617.600008
where:
bonds (distance) C4'-P energy: -129.889
bonds (distance) P-C4' energy: -138.528
flat angles C4'-P-C4' energy: -143.727
flat angles P-C4'-P energy: -74.370
tors. eta vs tors. theta energy: -131.086
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 2
=====================================
Write number: 4
Temperature: 0.950000
Total energy: -1116.294659 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1116.294659 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1116.294659 (E_RNA)
where:
Base-Base interactions energy: -545.327
where: short stacking energy: -410.293
Base-Backbone interact. energy: -0.837
local terms energy: -570.130772
where:
bonds (distance) C4'-P energy: -122.313
bonds (distance) P-C4' energy: -149.653
flat angles C4'-P-C4' energy: -139.500
flat angles P-C4'-P energy: -81.334
tors. eta vs tors. theta energy: -77.330
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 4
Temperature: 1.000000
Total energy: -984.725826 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -984.725826 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -984.725826 (E_RNA)
where:
Base-Base interactions energy: -432.343
where: short stacking energy: -390.157
Base-Backbone interact. energy: 2.922
local terms energy: -555.305401
where:
bonds (distance) C4'-P energy: -133.464
bonds (distance) P-C4' energy: -139.943
flat angles C4'-P-C4' energy: -117.692
flat angles P-C4'-P energy: -85.391
tors. eta vs tors. theta energy: -78.816
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 4
=====================================
Write number: 4
Temperature: 1.050000
Total energy: -889.974333 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -889.974333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -889.974333 (E_RNA)
where:
Base-Base interactions energy: -382.557
where: short stacking energy: -365.631
Base-Backbone interact. energy: 2.342
local terms energy: -509.758967
where:
bonds (distance) C4'-P energy: -118.555
bonds (distance) P-C4' energy: -116.942
flat angles C4'-P-C4' energy: -126.298
flat angles P-C4'-P energy: -86.611
tors. eta vs tors. theta energy: -61.353
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 5
=====================================
Write number: 4
Temperature: 1.100000
Total energy: -805.223704 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -805.223704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -805.223704 (E_RNA)
where:
Base-Base interactions energy: -340.465
where: short stacking energy: -319.131
Base-Backbone interact. energy: -0.985
local terms energy: -463.773557
where:
bonds (distance) C4'-P energy: -110.152
bonds (distance) P-C4' energy: -121.879
flat angles C4'-P-C4' energy: -107.767
flat angles P-C4'-P energy: -82.840
tors. eta vs tors. theta energy: -41.136
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 6
=====================================
Write number: 4
Temperature: 1.150000
Total energy: -774.707219 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -774.707219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -774.707219 (E_RNA)
where:
Base-Base interactions energy: -344.420
where: short stacking energy: -251.403
Base-Backbone interact. energy: 1.478
local terms energy: -431.765540
where:
bonds (distance) C4'-P energy: -107.253
bonds (distance) P-C4' energy: -127.876
flat angles C4'-P-C4' energy: -105.319
flat angles P-C4'-P energy: -70.737
tors. eta vs tors. theta energy: -20.582
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 9
=====================================
Write number: 4
Temperature: 1.200000
Total energy: -808.778632 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -808.778632 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -808.778632 (E_RNA)
where:
Base-Base interactions energy: -412.142
where: short stacking energy: -277.161
Base-Backbone interact. energy: 4.819
local terms energy: -401.455262
where:
bonds (distance) C4'-P energy: -99.014
bonds (distance) P-C4' energy: -133.304
flat angles C4'-P-C4' energy: -102.893
flat angles P-C4'-P energy: -40.079
tors. eta vs tors. theta energy: -26.166
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 7
=====================================
Write number: 4
Temperature: 1.250000
Total energy: -641.626269 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -641.626269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -641.626269 (E_RNA)
where:
Base-Base interactions energy: -243.450
where: short stacking energy: -190.298
Base-Backbone interact. energy: 4.019
local terms energy: -402.195581
where:
bonds (distance) C4'-P energy: -117.694
bonds (distance) P-C4' energy: -124.929
flat angles C4'-P-C4' energy: -82.796
flat angles P-C4'-P energy: -63.281
tors. eta vs tors. theta energy: -13.495
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 8
=====================================
Write number: 4
Temperature: 1.300000
Total energy: -653.804887 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -653.804887 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -653.804887 (E_RNA)
where:
Base-Base interactions energy: -315.148
where: short stacking energy: -206.308
Base-Backbone interact. energy: 1.099
local terms energy: -339.756038
where:
bonds (distance) C4'-P energy: -87.589
bonds (distance) P-C4' energy: -109.237
flat angles C4'-P-C4' energy: -101.625
flat angles P-C4'-P energy: -53.208
tors. eta vs tors. theta energy: 11.904
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 10
=====================================
Write number: 4
Temperature: 1.350000
Total energy: -614.136901 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -614.136901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -614.136901 (E_RNA)
where:
Base-Base interactions energy: -270.746
where: short stacking energy: -186.746
Base-Backbone interact. energy: -0.629
local terms energy: -342.762433
where:
bonds (distance) C4'-P energy: -105.299
bonds (distance) P-C4' energy: -122.449
flat angles C4'-P-C4' energy: -71.338
flat angles P-C4'-P energy: -53.088
tors. eta vs tors. theta energy: 9.411
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 1
=====================================
Write number: 5
Temperature: 0.900000
Total energy: -1118.165954 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1118.165954 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1118.165954 (E_RNA)
where:
Base-Base interactions energy: -527.197
where: short stacking energy: -457.467
Base-Backbone interact. energy: -1.116
local terms energy: -589.853016
where:
bonds (distance) C4'-P energy: -129.032
bonds (distance) P-C4' energy: -136.229
flat angles C4'-P-C4' energy: -135.842
flat angles P-C4'-P energy: -85.632
tors. eta vs tors. theta energy: -103.118
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 2
=====================================
Write number: 5
Temperature: 0.950000
Total energy: -1167.158865 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1167.158865 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1167.158865 (E_RNA)
where:
Base-Base interactions energy: -600.372
where: short stacking energy: -436.358
Base-Backbone interact. energy: -2.905
local terms energy: -563.881361
where:
bonds (distance) C4'-P energy: -127.635
bonds (distance) P-C4' energy: -136.809
flat angles C4'-P-C4' energy: -128.906
flat angles P-C4'-P energy: -67.809
tors. eta vs tors. theta energy: -102.723
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 5
Temperature: 1.000000
Total energy: -1017.373720 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1017.373720 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1017.373720 (E_RNA)
where:
Base-Base interactions energy: -467.135
where: short stacking energy: -379.287
Base-Backbone interact. energy: 0.349
local terms energy: -550.587619
where:
bonds (distance) C4'-P energy: -128.907
bonds (distance) P-C4' energy: -134.471
flat angles C4'-P-C4' energy: -126.815
flat angles P-C4'-P energy: -84.906
tors. eta vs tors. theta energy: -75.489
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 5
=====================================
Write number: 5
Temperature: 1.050000
Total energy: -882.117234 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -882.117234 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -882.117234 (E_RNA)
where:
Base-Base interactions energy: -354.243
where: short stacking energy: -318.085
Base-Backbone interact. energy: -1.808
local terms energy: -526.065499
where:
bonds (distance) C4'-P energy: -116.574
bonds (distance) P-C4' energy: -137.005
flat angles C4'-P-C4' energy: -130.604
flat angles P-C4'-P energy: -81.490
tors. eta vs tors. theta energy: -60.392
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 4
=====================================
Write number: 5
Temperature: 1.100000
Total energy: -863.172216 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -863.172216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -863.172216 (E_RNA)
where:
Base-Base interactions energy: -396.171
where: short stacking energy: -325.061
Base-Backbone interact. energy: -0.365
local terms energy: -466.635433
where:
bonds (distance) C4'-P energy: -121.306
bonds (distance) P-C4' energy: -130.447
flat angles C4'-P-C4' energy: -103.937
flat angles P-C4'-P energy: -61.553
tors. eta vs tors. theta energy: -49.391
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 9
=====================================
Write number: 5
Temperature: 1.150000
Total energy: -913.579614 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -913.579614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -913.579614 (E_RNA)
where:
Base-Base interactions energy: -450.366
where: short stacking energy: -313.474
Base-Backbone interact. energy: 13.310
local terms energy: -476.523796
where:
bonds (distance) C4'-P energy: -106.939
bonds (distance) P-C4' energy: -136.860
flat angles C4'-P-C4' energy: -122.665
flat angles P-C4'-P energy: -77.770
tors. eta vs tors. theta energy: -32.289
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 6
=====================================
Write number: 5
Temperature: 1.200000
Total energy: -714.624443 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -714.624443 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -714.624443 (E_RNA)
where:
Base-Base interactions energy: -292.757
where: short stacking energy: -214.422
Base-Backbone interact. energy: 0.064
local terms energy: -421.932124
where:
bonds (distance) C4'-P energy: -110.105
bonds (distance) P-C4' energy: -115.108
flat angles C4'-P-C4' energy: -108.724
flat angles P-C4'-P energy: -80.040
tors. eta vs tors. theta energy: -7.956
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 8
=====================================
Write number: 5
Temperature: 1.250000
Total energy: -642.907322 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -642.907322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -642.907322 (E_RNA)
where:
Base-Base interactions energy: -268.183
where: short stacking energy: -193.738
Base-Backbone interact. energy: -4.036
local terms energy: -370.688025
where:
bonds (distance) C4'-P energy: -104.698
bonds (distance) P-C4' energy: -115.995
flat angles C4'-P-C4' energy: -102.838
flat angles P-C4'-P energy: -52.580
tors. eta vs tors. theta energy: 5.424
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 7
=====================================
Write number: 5
Temperature: 1.300000
Total energy: -543.672636 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -543.672636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -543.672636 (E_RNA)
where:
Base-Base interactions energy: -223.129
where: short stacking energy: -187.855
Base-Backbone interact. energy: 3.378
local terms energy: -323.921141
where:
bonds (distance) C4'-P energy: -106.576
bonds (distance) P-C4' energy: -106.957
flat angles C4'-P-C4' energy: -76.217
flat angles P-C4'-P energy: -51.893
tors. eta vs tors. theta energy: 17.722
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 10
=====================================
Write number: 5
Temperature: 1.350000
Total energy: -585.583589 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -585.583589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -585.583589 (E_RNA)
where:
Base-Base interactions energy: -247.520
where: short stacking energy: -159.751
Base-Backbone interact. energy: 2.220
local terms energy: -340.283475
where:
bonds (distance) C4'-P energy: -92.695
bonds (distance) P-C4' energy: -120.463
flat angles C4'-P-C4' energy: -84.055
flat angles P-C4'-P energy: -43.494
tors. eta vs tors. theta energy: 0.424
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 2
=====================================
Write number: 6
Temperature: 0.900000
Total energy: -1339.263431 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1339.263431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1339.263431 (E_RNA)
where:
Base-Base interactions energy: -736.155
where: short stacking energy: -479.155
Base-Backbone interact. energy: -4.855
local terms energy: -598.252762
where:
bonds (distance) C4'-P energy: -126.655
bonds (distance) P-C4' energy: -126.523
flat angles C4'-P-C4' energy: -151.823
flat angles P-C4'-P energy: -85.367
tors. eta vs tors. theta energy: -107.883
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 1
=====================================
Write number: 6
Temperature: 0.950000
Total energy: -1158.753212 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1158.753212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1158.753212 (E_RNA)
where:
Base-Base interactions energy: -588.936
where: short stacking energy: -423.077
Base-Backbone interact. energy: 0.072
local terms energy: -569.889098
where:
bonds (distance) C4'-P energy: -122.383
bonds (distance) P-C4' energy: -133.120
flat angles C4'-P-C4' energy: -131.604
flat angles P-C4'-P energy: -95.731
tors. eta vs tors. theta energy: -87.051
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 6
Temperature: 1.000000
Total energy: -1043.290444 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1043.290444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1043.290444 (E_RNA)
where:
Base-Base interactions energy: -507.482
where: short stacking energy: -388.307
Base-Backbone interact. energy: 2.653
local terms energy: -538.462109
where:
bonds (distance) C4'-P energy: -130.591
bonds (distance) P-C4' energy: -122.302
flat angles C4'-P-C4' energy: -132.967
flat angles P-C4'-P energy: -78.492
tors. eta vs tors. theta energy: -74.110
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 5
=====================================
Write number: 6
Temperature: 1.050000
Total energy: -925.637553 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -925.637553 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -925.637553 (E_RNA)
where:
Base-Base interactions energy: -403.291
where: short stacking energy: -339.489
Base-Backbone interact. energy: -1.243
local terms energy: -521.102840
where:
bonds (distance) C4'-P energy: -118.671
bonds (distance) P-C4' energy: -129.118
flat angles C4'-P-C4' energy: -114.636
flat angles P-C4'-P energy: -88.882
tors. eta vs tors. theta energy: -69.797
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 4
=====================================
Write number: 6
Temperature: 1.100000
Total energy: -917.822139 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -917.822139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -917.822139 (E_RNA)
where:
Base-Base interactions energy: -441.646
where: short stacking energy: -309.178
Base-Backbone interact. energy: 0.084
local terms energy: -476.260152
where:
bonds (distance) C4'-P energy: -124.042
bonds (distance) P-C4' energy: -126.850
flat angles C4'-P-C4' energy: -108.138
flat angles P-C4'-P energy: -73.381
tors. eta vs tors. theta energy: -43.849
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 9
=====================================
Write number: 6
Temperature: 1.150000
Total energy: -950.745098 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -950.745098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -950.745098 (E_RNA)
where:
Base-Base interactions energy: -503.340
where: short stacking energy: -303.491
Base-Backbone interact. energy: -0.489
local terms energy: -446.915851
where:
bonds (distance) C4'-P energy: -129.316
bonds (distance) P-C4' energy: -115.074
flat angles C4'-P-C4' energy: -94.964
flat angles P-C4'-P energy: -60.456
tors. eta vs tors. theta energy: -47.106
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 6
=====================================
Write number: 6
Temperature: 1.200000
Total energy: -740.887645 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -740.887645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -740.887645 (E_RNA)
where:
Base-Base interactions energy: -334.777
where: short stacking energy: -223.909
Base-Backbone interact. energy: -2.507
local terms energy: -403.604002
where:
bonds (distance) C4'-P energy: -111.630
bonds (distance) P-C4' energy: -110.410
flat angles C4'-P-C4' energy: -109.429
flat angles P-C4'-P energy: -70.639
tors. eta vs tors. theta energy: -1.496
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 8
=====================================
Write number: 6
Temperature: 1.250000
Total energy: -610.822358 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -610.822358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -610.822358 (E_RNA)
where:
Base-Base interactions energy: -228.632
where: short stacking energy: -164.339
Base-Backbone interact. energy: -0.611
local terms energy: -381.579314
where:
bonds (distance) C4'-P energy: -106.609
bonds (distance) P-C4' energy: -116.185
flat angles C4'-P-C4' energy: -115.612
flat angles P-C4'-P energy: -36.743
tors. eta vs tors. theta energy: -6.431
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 10
=====================================
Write number: 6
Temperature: 1.300000
Total energy: -666.937748 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -666.937748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -666.937748 (E_RNA)
where:
Base-Base interactions energy: -283.533
where: short stacking energy: -198.108
Base-Backbone interact. energy: -0.129
local terms energy: -383.276392
where:
bonds (distance) C4'-P energy: -103.485
bonds (distance) P-C4' energy: -118.967
flat angles C4'-P-C4' energy: -106.010
flat angles P-C4'-P energy: -51.086
tors. eta vs tors. theta energy: -3.729
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 7
=====================================
Write number: 6
Temperature: 1.350000
Total energy: -524.543534 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -524.543534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -524.543534 (E_RNA)
where:
Base-Base interactions energy: -208.287
where: short stacking energy: -165.780
Base-Backbone interact. energy: 10.820
local terms energy: -327.076400
where:
bonds (distance) C4'-P energy: -109.741
bonds (distance) P-C4' energy: -93.186
flat angles C4'-P-C4' energy: -101.533
flat angles P-C4'-P energy: -39.395
tors. eta vs tors. theta energy: 16.779
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 2
=====================================
Write number: 7
Temperature: 0.900000
Total energy: -1364.537002 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1364.537002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1364.537002 (E_RNA)
where:
Base-Base interactions energy: -766.039
where: short stacking energy: -495.980
Base-Backbone interact. energy: -1.569
local terms energy: -596.928260
where:
bonds (distance) C4'-P energy: -126.909
bonds (distance) P-C4' energy: -143.389
flat angles C4'-P-C4' energy: -123.157
flat angles P-C4'-P energy: -86.446
tors. eta vs tors. theta energy: -117.028
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 1
=====================================
Write number: 7
Temperature: 0.950000
Total energy: -1188.760197 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1188.760197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1188.760197 (E_RNA)
where:
Base-Base interactions energy: -614.230
where: short stacking energy: -460.093
Base-Backbone interact. energy: -0.713
local terms energy: -573.817356
where:
bonds (distance) C4'-P energy: -131.306
bonds (distance) P-C4' energy: -134.355
flat angles C4'-P-C4' energy: -141.813
flat angles P-C4'-P energy: -83.696
tors. eta vs tors. theta energy: -82.647
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 7
Temperature: 1.000000
Total energy: -1120.477784 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1120.477784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1120.477784 (E_RNA)
where:
Base-Base interactions energy: -608.431
where: short stacking energy: -368.000
Base-Backbone interact. energy: -0.684
local terms energy: -511.362435
where:
bonds (distance) C4'-P energy: -113.186
bonds (distance) P-C4' energy: -129.108
flat angles C4'-P-C4' energy: -107.721
flat angles P-C4'-P energy: -86.538
tors. eta vs tors. theta energy: -74.809
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 4
=====================================
Write number: 7
Temperature: 1.050000
Total energy: -1047.527562 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1047.527562 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1047.527562 (E_RNA)
where:
Base-Base interactions energy: -510.695
where: short stacking energy: -359.679
Base-Backbone interact. energy: 0.647
local terms energy: -537.478978
where:
bonds (distance) C4'-P energy: -112.640
bonds (distance) P-C4' energy: -130.427
flat angles C4'-P-C4' energy: -130.892
flat angles P-C4'-P energy: -85.655
tors. eta vs tors. theta energy: -77.865
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 5
=====================================
Write number: 7
Temperature: 1.100000
Total energy: -868.509798 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -868.509798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -868.509798 (E_RNA)
where:
Base-Base interactions energy: -390.223
where: short stacking energy: -308.389
Base-Backbone interact. energy: -2.316
local terms energy: -475.970770
where:
bonds (distance) C4'-P energy: -124.409
bonds (distance) P-C4' energy: -134.194
flat angles C4'-P-C4' energy: -115.450
flat angles P-C4'-P energy: -39.506
tors. eta vs tors. theta energy: -62.412
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 9
=====================================
Write number: 7
Temperature: 1.150000
Total energy: -982.609098 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -982.609098 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -982.609098 (E_RNA)
where:
Base-Base interactions energy: -522.226
where: short stacking energy: -313.002
Base-Backbone interact. energy: -0.209
local terms energy: -460.174178
where:
bonds (distance) C4'-P energy: -127.379
bonds (distance) P-C4' energy: -102.063
flat angles C4'-P-C4' energy: -124.843
flat angles P-C4'-P energy: -59.119
tors. eta vs tors. theta energy: -46.770
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 6
=====================================
Write number: 7
Temperature: 1.200000
Total energy: -785.515609 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -785.515609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -785.515609 (E_RNA)
where:
Base-Base interactions energy: -396.326
where: short stacking energy: -233.616
Base-Backbone interact. energy: 1.804
local terms energy: -390.993979
where:
bonds (distance) C4'-P energy: -103.836
bonds (distance) P-C4' energy: -135.414
flat angles C4'-P-C4' energy: -105.019
flat angles P-C4'-P energy: -38.556
tors. eta vs tors. theta energy: -8.169
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 10
=====================================
Write number: 7
Temperature: 1.250000
Total energy: -712.866771 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -712.866771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -712.866771 (E_RNA)
where:
Base-Base interactions energy: -341.267
where: short stacking energy: -249.426
Base-Backbone interact. energy: -1.117
local terms energy: -370.483666
where:
bonds (distance) C4'-P energy: -100.847
bonds (distance) P-C4' energy: -95.789
flat angles C4'-P-C4' energy: -100.091
flat angles P-C4'-P energy: -45.866
tors. eta vs tors. theta energy: -27.890
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 8
=====================================
Write number: 7
Temperature: 1.300000
Total energy: -575.846025 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -575.846025 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -575.846025 (E_RNA)
where:
Base-Base interactions energy: -214.008
where: short stacking energy: -185.589
Base-Backbone interact. energy: -0.517
local terms energy: -361.321529
where:
bonds (distance) C4'-P energy: -105.614
bonds (distance) P-C4' energy: -101.394
flat angles C4'-P-C4' energy: -97.993
flat angles P-C4'-P energy: -56.846
tors. eta vs tors. theta energy: 0.524
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 7
=====================================
Write number: 7
Temperature: 1.350000
Total energy: -481.784899 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -481.784899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -481.784899 (E_RNA)
where:
Base-Base interactions energy: -182.009
where: short stacking energy: -159.543
Base-Backbone interact. energy: -0.274
local terms energy: -299.501672
where:
bonds (distance) C4'-P energy: -84.839
bonds (distance) P-C4' energy: -110.375
flat angles C4'-P-C4' energy: -86.793
flat angles P-C4'-P energy: -48.674
tors. eta vs tors. theta energy: 31.180
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 1, replica: 2
=====================================
Write number: 8
Temperature: 0.900000
Total energy: -1405.522565 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1405.522565 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1405.522565 (E_RNA)
where:
Base-Base interactions energy: -806.586
where: short stacking energy: -506.439
Base-Backbone interact. energy: -1.619
local terms energy: -597.317371
where:
bonds (distance) C4'-P energy: -125.310
bonds (distance) P-C4' energy: -140.118
flat angles C4'-P-C4' energy: -140.728
flat angles P-C4'-P energy: -72.775
tors. eta vs tors. theta energy: -118.387
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 2, replica: 1
=====================================
Write number: 8
Temperature: 0.950000
Total energy: -1227.329747 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1227.329747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1227.329747 (E_RNA)
where:
Base-Base interactions energy: -658.074
where: short stacking energy: -438.531
Base-Backbone interact. energy: 0.874
local terms energy: -570.129227
where:
bonds (distance) C4'-P energy: -119.030
bonds (distance) P-C4' energy: -128.081
flat angles C4'-P-C4' energy: -130.662
flat angles P-C4'-P energy: -83.394
tors. eta vs tors. theta energy: -108.962
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 3, replica: 3
=====================================
Write number: 8
Temperature: 1.000000
Total energy: -1240.440890 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1240.440890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1240.440890 (E_RNA)
where:
Base-Base interactions energy: -691.316
where: short stacking energy: -429.605
Base-Backbone interact. energy: -0.248
local terms energy: -548.876724
where:
bonds (distance) C4'-P energy: -129.050
bonds (distance) P-C4' energy: -130.282
flat angles C4'-P-C4' energy: -125.192
flat angles P-C4'-P energy: -91.882
tors. eta vs tors. theta energy: -72.471
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 4, replica: 4
=====================================
Write number: 8
Temperature: 1.050000
Total energy: -1049.650554 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -1049.650554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -1049.650554 (E_RNA)
where:
Base-Base interactions energy: -538.613
where: short stacking energy: -379.718
Base-Backbone interact. energy: -2.178
local terms energy: -508.858954
where:
bonds (distance) C4'-P energy: -120.151
bonds (distance) P-C4' energy: -116.183
flat angles C4'-P-C4' energy: -121.133
flat angles P-C4'-P energy: -60.899
tors. eta vs tors. theta energy: -90.493
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 5, replica: 9
=====================================
Write number: 8
Temperature: 1.100000
Total energy: -972.774990 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -972.774990 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -972.774990 (E_RNA)
where:
Base-Base interactions energy: -496.023
where: short stacking energy: -322.654
Base-Backbone interact. energy: -1.154
local terms energy: -475.597832
where:
bonds (distance) C4'-P energy: -105.201
bonds (distance) P-C4' energy: -134.083
flat angles C4'-P-C4' energy: -120.318
flat angles P-C4'-P energy: -77.789
tors. eta vs tors. theta energy: -38.207
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 6, replica: 5
=====================================
Write number: 8
Temperature: 1.150000
Total energy: -835.567288 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -835.567288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -835.567288 (E_RNA)
where:
Base-Base interactions energy: -400.448
where: short stacking energy: -279.378
Base-Backbone interact. energy: 0.221
local terms energy: -435.340643
where:
bonds (distance) C4'-P energy: -106.738
bonds (distance) P-C4' energy: -128.008
flat angles C4'-P-C4' energy: -101.465
flat angles P-C4'-P energy: -64.994
tors. eta vs tors. theta energy: -34.136
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 7, replica: 6
=====================================
Write number: 8
Temperature: 1.200000
Total energy: -841.640758 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -841.640758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -841.640758 (E_RNA)
where:
Base-Base interactions energy: -424.252
where: short stacking energy: -269.596
Base-Backbone interact. energy: 4.123
local terms energy: -421.511820
where:
bonds (distance) C4'-P energy: -110.809
bonds (distance) P-C4' energy: -113.781
flat angles C4'-P-C4' energy: -89.373
flat angles P-C4'-P energy: -75.633
tors. eta vs tors. theta energy: -31.916
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 8, replica: 10
=====================================
Write number: 8
Temperature: 1.250000
Total energy: -715.335222 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -715.335222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -715.335222 (E_RNA)
where:
Base-Base interactions energy: -298.402
where: short stacking energy: -207.531
Base-Backbone interact. energy: 1.498
local terms energy: -418.430793
where:
bonds (distance) C4'-P energy: -124.119
bonds (distance) P-C4' energy: -137.184
flat angles C4'-P-C4' energy: -105.718
flat angles P-C4'-P energy: -41.643
tors. eta vs tors. theta energy: -9.767
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 9, replica: 7
=====================================
Write number: 8
Temperature: 1.300000
Total energy: -555.501192 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -555.501192 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -555.501192 (E_RNA)
where:
Base-Base interactions energy: -200.753
where: short stacking energy: -174.345
Base-Backbone interact. energy: 3.391
local terms energy: -358.138848
where:
bonds (distance) C4'-P energy: -116.669
bonds (distance) P-C4' energy: -97.360
flat angles C4'-P-C4' energy: -98.553
flat angles P-C4'-P energy: -38.825
tors. eta vs tors. theta energy: -6.731
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
==================================
temp. level: 10, replica: 8
=====================================
Write number: 8
Temperature: 1.350000
Total energy: -500.179823 (ES_TOTAL = E_TOTAL + S_TOTAL)
where:
RNA energy: -500.179823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA)
where:
Molecular energy: -500.179823 (E_RNA)
where:
Base-Base interactions energy: -188.390
where: short stacking energy: -158.598
Base-Backbone interact. energy: 0.344
local terms energy: -312.133443
where:
bonds (distance) C4'-P energy: -104.722
bonds (distance) P-C4' energy: -120.937
flat angles C4'-P-C4' energy: -76.447
flat angles P-C4'-P energy: -30.380
tors. eta vs tors. theta energy: 20.353
Dist. restrs. and SS energy: 0.000 (S_DIST_RNA)
chem. prob. restrs. energy: 0.000 (S_CHEM_RNA)
Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA)
replica 2 ended at temp. level: 1, temp: 0.900000
for this replica:
moves confirmed at first: 2572783
moves confirmed later: 2910672
all moves confirmed: 5483455
percent of confirmed moves: 54.834550
current total energy: -1317.707419
recalc. total energy: -1317.707419
replica 3 ended at temp. level: 2, temp: 0.950000
for this replica:
moves confirmed at first: 2805938
moves confirmed later: 3250878
all moves confirmed: 6056816
percent of confirmed moves: 60.568160
current total energy: -1140.112415
recalc. total energy: -1140.112415
replica 1 ended at temp. level: 3, temp: 1.000000
for this replica:
moves confirmed at first: 2663115
moves confirmed later: 3009738
all moves confirmed: 5672853
percent of confirmed moves: 56.728530
current total energy: -1075.437811
recalc. total energy: -1075.437811
replica 4 ended at temp. level: 4, temp: 1.050000
for this replica:
moves confirmed at first: 3024767
moves confirmed later: 3573346
all moves confirmed: 6598113
percent of confirmed moves: 65.981130
current total energy: -916.563082
recalc. total energy: -916.563082
replica 9 ended at temp. level: 5, temp: 1.100000
for this replica:
moves confirmed at first: 3185496
moves confirmed later: 3842680
all moves confirmed: 7028176
percent of confirmed moves: 70.281760
current total energy: -840.115841
recalc. total energy: -840.115841
replica 6 ended at temp. level: 6, temp: 1.150000
for this replica:
moves confirmed at first: 3270959
moves confirmed later: 3943870
all moves confirmed: 7214829
percent of confirmed moves: 72.148290
current total energy: -727.537016
recalc. total energy: -727.537016
replica 5 ended at temp. level: 7, temp: 1.200000
for this replica:
moves confirmed at first: 3139523
moves confirmed later: 3731728
all moves confirmed: 6871251
percent of confirmed moves: 68.712510
current total energy: -731.952550
recalc. total energy: -731.952550
replica 10 ended at temp. level: 8, temp: 1.250000
for this replica:
moves confirmed at first: 3519773
moves confirmed later: 4305503
all moves confirmed: 7825276
percent of confirmed moves: 78.252760
current total energy: -529.646245
recalc. total energy: -529.646245
replica 7 ended at temp. level: 9, temp: 1.300000
for this replica:
moves confirmed at first: 3551080
moves confirmed later: 4329515
all moves confirmed: 7880595
percent of confirmed moves: 78.805950
current total energy: -403.011957
recalc. total energy: -403.011957
replica 8 ended at temp. level: 10, temp: 1.350000
for this replica:
moves confirmed at first: 3541148
moves confirmed later: 4327419
all moves confirmed: 7868567
percent of confirmed moves: 78.685670
current total energy: -350.784696
recalc. total energy: -350.784696
out arg RESULTS//1/I00-c8ccef4a_01
Time of doing 100000 iterations: 440.750 seconds