SimRNA (c) 2009-2024 Genesilico, ver. 3.33 .reading parameteres before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex_test_B2-054554c2/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex_test_B2-054554c2/inputs/seq.fa: 1 curr_seq: _UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: UAUGGUAUGCUGUGUGGUAUGGGGUGGCGUGCUCU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 35 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 180 n_atoms_counter: 180 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 chain: 1: _....(((((((..............)))))))..._ chain: 1: _...............((..(()).))........._ nucl1: 10, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 10, chainIndex_2: 0, nuclIndex_2: 25 nucl1: 9, chain1: 0, <---> nucl2: 26, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 9, chainIndex_2: 0, nuclIndex_2: 26 nucl1: 8, chain1: 0, <---> nucl2: 27, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 8, chainIndex_2: 0, nuclIndex_2: 27 nucl1: 7, chain1: 0, <---> nucl2: 28, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2: 28 nucl1: 6, chain1: 0, <---> nucl2: 29, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2: 29 nucl1: 5, chain1: 0, <---> nucl2: 30, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 5, chainIndex_2: 0, nuclIndex_2: 30 nucl1: 4, chain1: 0, <---> nucl2: 31, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2: 31 nucl1: 20, chain1: 0, <---> nucl2: 21, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 20, chainIndex_2: 0, nuclIndex_2: 21 nucl1: 19, chain1: 0, <---> nucl2: 22, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 19, chainIndex_2: 0, nuclIndex_2: 22 nucl1: 16, chain1: 0, <---> nucl2: 24, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 16, chainIndex_2: 0, nuclIndex_2: 24 nucl1: 15, chain1: 0, <---> nucl2: 25, chain2: 0 secondary structure restraint added: chainIndex_1: 0, nuclIndex_1: 15, chainIndex_2: 0, nuclIndex_2: 25 RNAStructure::tertiaryStrcWeight = 1.000000 EntireStructure::rnaStruct limitingSphereRadius : 35.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) random seed = 1 number of iterations = 1600000 trajectory write in every 16000 iterations initTemp = 1.350 finalTemp = 0.900 tempStep = -2.812500e-07 DONE .calculating ===================================== Write number: 1 Temperature: 1.350000 Total energy: -131.331510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -131.331510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -131.331510 (E_RNA) where: Base-Base interactions energy: -1.456 where: short stacking energy: -1.456 Base-Backbone interact. energy: -0.000 local terms energy: -129.875656 where: bonds (distance) C4'-P energy: -34.005 bonds (distance) P-C4' energy: -32.207 flat angles C4'-P-C4' energy: -25.698 flat angles P-C4'-P energy: -29.396 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 2 Temperature: 1.345500 Total energy: -133.029247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.029247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -113.229247 (E_RNA) where: Base-Base interactions energy: -53.987 where: short stacking energy: -24.917 Base-Backbone interact. energy: -0.222 local terms energy: -59.021024 where: bonds (distance) C4'-P energy: -20.203 bonds (distance) P-C4' energy: -24.137 flat angles C4'-P-C4' energy: -13.664 flat angles P-C4'-P energy: -9.383 tors. eta vs tors. theta energy: 8.366 Dist. restrs. and SS energy: -19.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 3 Temperature: 1.341000 Total energy: -151.136511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.136511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -125.936511 (E_RNA) where: Base-Base interactions energy: -57.004 where: short stacking energy: -28.939 Base-Backbone interact. energy: -2.158 local terms energy: -66.774108 where: bonds (distance) C4'-P energy: -17.384 bonds (distance) P-C4' energy: -24.418 flat angles C4'-P-C4' energy: -13.214 flat angles P-C4'-P energy: -10.701 tors. eta vs tors. theta energy: -1.058 Dist. restrs. and SS energy: -25.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 4 Temperature: 1.336500 Total energy: -197.289837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -197.289837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.089837 (E_RNA) where: Base-Base interactions energy: -84.470 where: short stacking energy: -46.952 Base-Backbone interact. energy: -0.135 local terms energy: -78.485162 where: bonds (distance) C4'-P energy: -17.325 bonds (distance) P-C4' energy: -25.054 flat angles C4'-P-C4' energy: -19.263 flat angles P-C4'-P energy: -14.442 tors. eta vs tors. theta energy: -2.401 Dist. restrs. and SS energy: -34.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 5 Temperature: 1.332000 Total energy: -281.353729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.353729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.553729 (E_RNA) where: Base-Base interactions energy: -142.941 where: short stacking energy: -61.848 Base-Backbone interact. energy: -0.342 local terms energy: -82.270654 where: bonds (distance) C4'-P energy: -20.507 bonds (distance) P-C4' energy: -22.741 flat angles C4'-P-C4' energy: -20.539 flat angles P-C4'-P energy: -5.247 tors. eta vs tors. theta energy: -13.237 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 6 Temperature: 1.327500 Total energy: -285.798020 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.798020 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.798020 (E_RNA) where: Base-Base interactions energy: -159.398 where: short stacking energy: -72.946 Base-Backbone interact. energy: -0.295 local terms energy: -72.104643 where: bonds (distance) C4'-P energy: -18.697 bonds (distance) P-C4' energy: -22.555 flat angles C4'-P-C4' energy: -16.667 flat angles P-C4'-P energy: -10.281 tors. eta vs tors. theta energy: -3.904 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 7 Temperature: 1.323000 Total energy: -342.889722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.889722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.889722 (E_RNA) where: Base-Base interactions energy: -189.846 where: short stacking energy: -93.753 Base-Backbone interact. energy: -0.119 local terms energy: -98.924689 where: bonds (distance) C4'-P energy: -14.050 bonds (distance) P-C4' energy: -21.477 flat angles C4'-P-C4' energy: -25.706 flat angles P-C4'-P energy: -16.967 tors. eta vs tors. theta energy: -20.724 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 8 Temperature: 1.318500 Total energy: -328.098478 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.098478 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.698478 (E_RNA) where: Base-Base interactions energy: -162.913 where: short stacking energy: -75.726 Base-Backbone interact. energy: -0.336 local terms energy: -105.449780 where: bonds (distance) C4'-P energy: -26.062 bonds (distance) P-C4' energy: -22.029 flat angles C4'-P-C4' energy: -24.528 flat angles P-C4'-P energy: -17.377 tors. eta vs tors. theta energy: -15.454 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 9 Temperature: 1.314000 Total energy: -336.238043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.238043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.038043 (E_RNA) where: Base-Base interactions energy: -191.707 where: short stacking energy: -92.891 Base-Backbone interact. energy: 1.602 local terms energy: -93.933338 where: bonds (distance) C4'-P energy: -15.910 bonds (distance) P-C4' energy: -21.923 flat angles C4'-P-C4' energy: -24.339 flat angles P-C4'-P energy: -10.456 tors. eta vs tors. theta energy: -21.306 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 10 Temperature: 1.309500 Total energy: -330.854315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.854315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.454315 (E_RNA) where: Base-Base interactions energy: -183.036 where: short stacking energy: -83.572 Base-Backbone interact. energy: -0.499 local terms energy: -87.919980 where: bonds (distance) C4'-P energy: -11.529 bonds (distance) P-C4' energy: -17.301 flat angles C4'-P-C4' energy: -22.803 flat angles P-C4'-P energy: -16.019 tors. eta vs tors. theta energy: -20.268 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 11 Temperature: 1.305000 Total energy: -327.704813 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.704813 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -270.104813 (E_RNA) where: Base-Base interactions energy: -184.732 where: short stacking energy: -81.664 Base-Backbone interact. energy: -0.314 local terms energy: -85.058873 where: bonds (distance) C4'-P energy: -11.232 bonds (distance) P-C4' energy: -19.494 flat angles C4'-P-C4' energy: -26.015 flat angles P-C4'-P energy: -13.926 tors. eta vs tors. theta energy: -14.392 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 12 Temperature: 1.300500 Total energy: -345.353923 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.353923 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.153923 (E_RNA) where: Base-Base interactions energy: -189.561 where: short stacking energy: -97.756 Base-Backbone interact. energy: -0.680 local terms energy: -102.912686 where: bonds (distance) C4'-P energy: -22.877 bonds (distance) P-C4' energy: -21.414 flat angles C4'-P-C4' energy: -19.697 flat angles P-C4'-P energy: -10.651 tors. eta vs tors. theta energy: -28.273 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 13 Temperature: 1.296000 Total energy: -360.813117 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.813117 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.213117 (E_RNA) where: Base-Base interactions energy: -206.548 where: short stacking energy: -98.565 Base-Backbone interact. energy: -1.835 local terms energy: -103.829805 where: bonds (distance) C4'-P energy: -19.430 bonds (distance) P-C4' energy: -25.683 flat angles C4'-P-C4' energy: -21.287 flat angles P-C4'-P energy: -11.146 tors. eta vs tors. theta energy: -26.284 Dist. restrs. and SS energy: -48.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 14 Temperature: 1.291500 Total energy: -355.936526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.936526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.136526 (E_RNA) where: Base-Base interactions energy: -204.093 where: short stacking energy: -90.435 Base-Backbone interact. energy: -0.296 local terms energy: -95.747717 where: bonds (distance) C4'-P energy: -18.936 bonds (distance) P-C4' energy: -27.275 flat angles C4'-P-C4' energy: -23.576 flat angles P-C4'-P energy: -7.628 tors. eta vs tors. theta energy: -18.332 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 15 Temperature: 1.287000 Total energy: -332.532890 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.532890 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.332890 (E_RNA) where: Base-Base interactions energy: -168.539 where: short stacking energy: -78.151 Base-Backbone interact. energy: 0.615 local terms energy: -103.408727 where: bonds (distance) C4'-P energy: -20.816 bonds (distance) P-C4' energy: -24.000 flat angles C4'-P-C4' energy: -21.191 flat angles P-C4'-P energy: -15.409 tors. eta vs tors. theta energy: -21.993 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 16 Temperature: 1.282500 Total energy: -327.519883 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.519883 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.919883 (E_RNA) where: Base-Base interactions energy: -166.556 where: short stacking energy: -84.904 Base-Backbone interact. energy: -0.064 local terms energy: -103.300219 where: bonds (distance) C4'-P energy: -21.920 bonds (distance) P-C4' energy: -23.220 flat angles C4'-P-C4' energy: -16.962 flat angles P-C4'-P energy: -21.574 tors. eta vs tors. theta energy: -19.625 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 17 Temperature: 1.278000 Total energy: -338.247269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.247269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.047269 (E_RNA) where: Base-Base interactions energy: -182.947 where: short stacking energy: -85.297 Base-Backbone interact. energy: -0.165 local terms energy: -93.935588 where: bonds (distance) C4'-P energy: -16.429 bonds (distance) P-C4' energy: -25.173 flat angles C4'-P-C4' energy: -19.159 flat angles P-C4'-P energy: -15.622 tors. eta vs tors. theta energy: -17.552 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 18 Temperature: 1.273500 Total energy: -341.274242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.274242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.074242 (E_RNA) where: Base-Base interactions energy: -190.284 where: short stacking energy: -93.368 Base-Backbone interact. energy: -0.998 local terms energy: -97.791594 where: bonds (distance) C4'-P energy: -14.706 bonds (distance) P-C4' energy: -22.480 flat angles C4'-P-C4' energy: -24.326 flat angles P-C4'-P energy: -12.709 tors. eta vs tors. theta energy: -23.570 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 19 Temperature: 1.269000 Total energy: -319.427408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.427408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.627408 (E_RNA) where: Base-Base interactions energy: -166.411 where: short stacking energy: -75.271 Base-Backbone interact. energy: -0.393 local terms energy: -96.823183 where: bonds (distance) C4'-P energy: -14.175 bonds (distance) P-C4' energy: -24.995 flat angles C4'-P-C4' energy: -21.231 flat angles P-C4'-P energy: -18.180 tors. eta vs tors. theta energy: -18.242 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 20 Temperature: 1.264500 Total energy: -318.609058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.609058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.409058 (E_RNA) where: Base-Base interactions energy: -175.260 where: short stacking energy: -88.568 Base-Backbone interact. energy: -0.293 local terms energy: -90.856630 where: bonds (distance) C4'-P energy: -21.191 bonds (distance) P-C4' energy: -17.637 flat angles C4'-P-C4' energy: -19.546 flat angles P-C4'-P energy: -17.085 tors. eta vs tors. theta energy: -15.398 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 21 Temperature: 1.260000 Total energy: -336.475781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.475781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.075781 (E_RNA) where: Base-Base interactions energy: -184.860 where: short stacking energy: -89.752 Base-Backbone interact. energy: -0.304 local terms energy: -100.911550 where: bonds (distance) C4'-P energy: -21.883 bonds (distance) P-C4' energy: -19.102 flat angles C4'-P-C4' energy: -22.277 flat angles P-C4'-P energy: -16.760 tors. eta vs tors. theta energy: -20.890 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 22 Temperature: 1.255500 Total energy: -344.514892 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.514892 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.314892 (E_RNA) where: Base-Base interactions energy: -184.295 where: short stacking energy: -93.610 Base-Backbone interact. energy: -1.236 local terms energy: -106.783700 where: bonds (distance) C4'-P energy: -12.819 bonds (distance) P-C4' energy: -22.187 flat angles C4'-P-C4' energy: -26.574 flat angles P-C4'-P energy: -16.384 tors. eta vs tors. theta energy: -28.819 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 23 Temperature: 1.251000 Total energy: -326.657491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -326.657491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.457491 (E_RNA) where: Base-Base interactions energy: -181.934 where: short stacking energy: -88.641 Base-Backbone interact. energy: -0.153 local terms energy: -92.370637 where: bonds (distance) C4'-P energy: -22.537 bonds (distance) P-C4' energy: -18.578 flat angles C4'-P-C4' energy: -24.545 flat angles P-C4'-P energy: -10.288 tors. eta vs tors. theta energy: -16.423 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 24 Temperature: 1.246500 Total energy: -369.109507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.109507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -313.309507 (E_RNA) where: Base-Base interactions energy: -213.440 where: short stacking energy: -101.213 Base-Backbone interact. energy: -0.230 local terms energy: -99.639797 where: bonds (distance) C4'-P energy: -17.915 bonds (distance) P-C4' energy: -15.041 flat angles C4'-P-C4' energy: -26.749 flat angles P-C4'-P energy: -17.719 tors. eta vs tors. theta energy: -22.216 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 25 Temperature: 1.242000 Total energy: -369.583132 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.583132 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.583132 (E_RNA) where: Base-Base interactions energy: -204.461 where: short stacking energy: -89.227 Base-Backbone interact. energy: -0.793 local terms energy: -110.329940 where: bonds (distance) C4'-P energy: -19.972 bonds (distance) P-C4' energy: -26.095 flat angles C4'-P-C4' energy: -27.097 flat angles P-C4'-P energy: -14.329 tors. eta vs tors. theta energy: -22.837 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 26 Temperature: 1.237500 Total energy: -348.712373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.712373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.912373 (E_RNA) where: Base-Base interactions energy: -193.332 where: short stacking energy: -86.358 Base-Backbone interact. energy: 2.068 local terms energy: -101.648218 where: bonds (distance) C4'-P energy: -22.084 bonds (distance) P-C4' energy: -23.148 flat angles C4'-P-C4' energy: -25.595 flat angles P-C4'-P energy: -11.141 tors. eta vs tors. theta energy: -19.679 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 27 Temperature: 1.233000 Total energy: -343.320714 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.320714 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.320714 (E_RNA) where: Base-Base interactions energy: -190.199 where: short stacking energy: -91.229 Base-Backbone interact. energy: -0.674 local terms energy: -98.447517 where: bonds (distance) C4'-P energy: -20.332 bonds (distance) P-C4' energy: -14.054 flat angles C4'-P-C4' energy: -26.556 flat angles P-C4'-P energy: -12.159 tors. eta vs tors. theta energy: -25.347 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 28 Temperature: 1.228500 Total energy: -336.088183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.088183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.088183 (E_RNA) where: Base-Base interactions energy: -180.007 where: short stacking energy: -89.718 Base-Backbone interact. energy: -1.489 local terms energy: -100.592043 where: bonds (distance) C4'-P energy: -20.240 bonds (distance) P-C4' energy: -21.067 flat angles C4'-P-C4' energy: -20.662 flat angles P-C4'-P energy: -13.768 tors. eta vs tors. theta energy: -24.855 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 29 Temperature: 1.224000 Total energy: -367.349343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -367.349343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.949343 (E_RNA) where: Base-Base interactions energy: -205.997 where: short stacking energy: -92.104 Base-Backbone interact. energy: 1.397 local terms energy: -94.349362 where: bonds (distance) C4'-P energy: -21.058 bonds (distance) P-C4' energy: -13.365 flat angles C4'-P-C4' energy: -22.546 flat angles P-C4'-P energy: -20.341 tors. eta vs tors. theta energy: -17.040 Dist. restrs. and SS energy: -68.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 30 Temperature: 1.219500 Total energy: -371.275063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.275063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.475063 (E_RNA) where: Base-Base interactions energy: -209.112 where: short stacking energy: -102.455 Base-Backbone interact. energy: -0.099 local terms energy: -97.263936 where: bonds (distance) C4'-P energy: -17.749 bonds (distance) P-C4' energy: -19.637 flat angles C4'-P-C4' energy: -25.966 flat angles P-C4'-P energy: -16.594 tors. eta vs tors. theta energy: -17.318 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 31 Temperature: 1.215000 Total energy: -377.384716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.384716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.784716 (E_RNA) where: Base-Base interactions energy: -211.767 where: short stacking energy: -103.347 Base-Backbone interact. energy: -0.303 local terms energy: -107.715223 where: bonds (distance) C4'-P energy: -21.777 bonds (distance) P-C4' energy: -24.377 flat angles C4'-P-C4' energy: -22.157 flat angles P-C4'-P energy: -12.131 tors. eta vs tors. theta energy: -27.273 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 32 Temperature: 1.210500 Total energy: -377.636745 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.636745 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -323.636745 (E_RNA) where: Base-Base interactions energy: -215.677 where: short stacking energy: -99.620 Base-Backbone interact. energy: 0.415 local terms energy: -108.374373 where: bonds (distance) C4'-P energy: -18.181 bonds (distance) P-C4' energy: -24.973 flat angles C4'-P-C4' energy: -21.372 flat angles P-C4'-P energy: -17.270 tors. eta vs tors. theta energy: -26.579 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 33 Temperature: 1.206000 Total energy: -385.126046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.126046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.126046 (E_RNA) where: Base-Base interactions energy: -225.150 where: short stacking energy: -106.940 Base-Backbone interact. energy: 0.262 local terms energy: -106.238542 where: bonds (distance) C4'-P energy: -15.036 bonds (distance) P-C4' energy: -21.303 flat angles C4'-P-C4' energy: -23.149 flat angles P-C4'-P energy: -17.475 tors. eta vs tors. theta energy: -29.276 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 34 Temperature: 1.201500 Total energy: -375.258335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.258335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.858335 (E_RNA) where: Base-Base interactions energy: -212.163 where: short stacking energy: -101.127 Base-Backbone interact. energy: -0.144 local terms energy: -103.551408 where: bonds (distance) C4'-P energy: -16.488 bonds (distance) P-C4' energy: -20.965 flat angles C4'-P-C4' energy: -24.181 flat angles P-C4'-P energy: -15.503 tors. eta vs tors. theta energy: -26.415 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 35 Temperature: 1.197000 Total energy: -379.756302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.756302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.356302 (E_RNA) where: Base-Base interactions energy: -221.964 where: short stacking energy: -102.888 Base-Backbone interact. energy: -1.926 local terms energy: -105.466648 where: bonds (distance) C4'-P energy: -18.468 bonds (distance) P-C4' energy: -18.181 flat angles C4'-P-C4' energy: -24.256 flat angles P-C4'-P energy: -16.028 tors. eta vs tors. theta energy: -28.534 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 36 Temperature: 1.192500 Total energy: -382.535507 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.535507 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -326.735507 (E_RNA) where: Base-Base interactions energy: -228.887 where: short stacking energy: -106.663 Base-Backbone interact. energy: -0.925 local terms energy: -96.923715 where: bonds (distance) C4'-P energy: -17.340 bonds (distance) P-C4' energy: -19.409 flat angles C4'-P-C4' energy: -23.161 flat angles P-C4'-P energy: -4.173 tors. eta vs tors. theta energy: -32.841 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 37 Temperature: 1.188000 Total energy: -410.101142 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.101142 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.301142 (E_RNA) where: Base-Base interactions energy: -252.375 where: short stacking energy: -110.554 Base-Backbone interact. energy: -0.883 local terms energy: -101.042936 where: bonds (distance) C4'-P energy: -15.285 bonds (distance) P-C4' energy: -20.517 flat angles C4'-P-C4' energy: -19.544 flat angles P-C4'-P energy: -18.036 tors. eta vs tors. theta energy: -27.662 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 38 Temperature: 1.183500 Total energy: -397.479937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.479937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.079937 (E_RNA) where: Base-Base interactions energy: -230.077 where: short stacking energy: -103.749 Base-Backbone interact. energy: -0.032 local terms energy: -116.971146 where: bonds (distance) C4'-P energy: -21.062 bonds (distance) P-C4' energy: -19.238 flat angles C4'-P-C4' energy: -25.162 flat angles P-C4'-P energy: -19.945 tors. eta vs tors. theta energy: -31.565 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 39 Temperature: 1.179000 Total energy: -379.494619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.494619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.294619 (E_RNA) where: Base-Base interactions energy: -219.062 where: short stacking energy: -102.480 Base-Backbone interact. energy: 0.283 local terms energy: -99.515236 where: bonds (distance) C4'-P energy: -20.635 bonds (distance) P-C4' energy: -12.753 flat angles C4'-P-C4' energy: -24.379 flat angles P-C4'-P energy: -16.994 tors. eta vs tors. theta energy: -24.754 Dist. restrs. and SS energy: -61.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 40 Temperature: 1.174500 Total energy: -375.797492 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.797492 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.997492 (E_RNA) where: Base-Base interactions energy: -214.390 where: short stacking energy: -102.946 Base-Backbone interact. energy: -2.319 local terms energy: -103.288180 where: bonds (distance) C4'-P energy: -18.295 bonds (distance) P-C4' energy: -23.860 flat angles C4'-P-C4' energy: -19.517 flat angles P-C4'-P energy: -16.947 tors. eta vs tors. theta energy: -24.669 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 41 Temperature: 1.170000 Total energy: -370.281966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.281966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.881966 (E_RNA) where: Base-Base interactions energy: -215.477 where: short stacking energy: -108.250 Base-Backbone interact. energy: 1.185 local terms energy: -96.589878 where: bonds (distance) C4'-P energy: -17.273 bonds (distance) P-C4' energy: -17.605 flat angles C4'-P-C4' energy: -20.031 flat angles P-C4'-P energy: -18.479 tors. eta vs tors. theta energy: -23.201 Dist. restrs. and SS energy: -59.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 42 Temperature: 1.165500 Total energy: -401.978787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.978787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.178787 (E_RNA) where: Base-Base interactions energy: -228.862 where: short stacking energy: -102.465 Base-Backbone interact. energy: 0.158 local terms energy: -108.474577 where: bonds (distance) C4'-P energy: -22.568 bonds (distance) P-C4' energy: -20.261 flat angles C4'-P-C4' energy: -23.040 flat angles P-C4'-P energy: -14.775 tors. eta vs tors. theta energy: -27.831 Dist. restrs. and SS energy: -64.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 43 Temperature: 1.161000 Total energy: -423.017897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.017897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.017897 (E_RNA) where: Base-Base interactions energy: -236.993 where: short stacking energy: -117.481 Base-Backbone interact. energy: -0.020 local terms energy: -123.005112 where: bonds (distance) C4'-P energy: -25.196 bonds (distance) P-C4' energy: -24.535 flat angles C4'-P-C4' energy: -23.943 flat angles P-C4'-P energy: -15.834 tors. eta vs tors. theta energy: -33.496 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 44 Temperature: 1.156500 Total energy: -382.285088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.285088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.285088 (E_RNA) where: Base-Base interactions energy: -203.897 where: short stacking energy: -84.432 Base-Backbone interact. energy: -1.303 local terms energy: -114.084728 where: bonds (distance) C4'-P energy: -24.290 bonds (distance) P-C4' energy: -24.838 flat angles C4'-P-C4' energy: -25.476 flat angles P-C4'-P energy: -16.155 tors. eta vs tors. theta energy: -23.326 Dist. restrs. and SS energy: -63.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 45 Temperature: 1.152000 Total energy: -399.380303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.380303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.780303 (E_RNA) where: Base-Base interactions energy: -230.626 where: short stacking energy: -106.294 Base-Backbone interact. energy: -0.075 local terms energy: -111.079743 where: bonds (distance) C4'-P energy: -23.349 bonds (distance) P-C4' energy: -23.613 flat angles C4'-P-C4' energy: -24.085 flat angles P-C4'-P energy: -16.532 tors. eta vs tors. theta energy: -23.500 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 46 Temperature: 1.147500 Total energy: -384.704748 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.704748 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.104748 (E_RNA) where: Base-Base interactions energy: -222.841 where: short stacking energy: -96.617 Base-Backbone interact. energy: 0.222 local terms energy: -104.486016 where: bonds (distance) C4'-P energy: -16.358 bonds (distance) P-C4' energy: -22.117 flat angles C4'-P-C4' energy: -23.030 flat angles P-C4'-P energy: -14.563 tors. eta vs tors. theta energy: -28.418 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 47 Temperature: 1.143000 Total energy: -391.355005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.355005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.355005 (E_RNA) where: Base-Base interactions energy: -229.389 where: short stacking energy: -107.174 Base-Backbone interact. energy: -0.884 local terms energy: -107.081983 where: bonds (distance) C4'-P energy: -19.388 bonds (distance) P-C4' energy: -23.789 flat angles C4'-P-C4' energy: -18.798 flat angles P-C4'-P energy: -17.088 tors. eta vs tors. theta energy: -28.020 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 48 Temperature: 1.138500 Total energy: -407.464945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.464945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.664945 (E_RNA) where: Base-Base interactions energy: -235.212 where: short stacking energy: -114.868 Base-Backbone interact. energy: 0.420 local terms energy: -116.873102 where: bonds (distance) C4'-P energy: -18.592 bonds (distance) P-C4' energy: -23.296 flat angles C4'-P-C4' energy: -24.389 flat angles P-C4'-P energy: -14.104 tors. eta vs tors. theta energy: -36.492 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 49 Temperature: 1.134000 Total energy: -393.198583 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.198583 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -335.598583 (E_RNA) where: Base-Base interactions energy: -230.177 where: short stacking energy: -100.896 Base-Backbone interact. energy: -0.632 local terms energy: -104.789635 where: bonds (distance) C4'-P energy: -23.252 bonds (distance) P-C4' energy: -12.206 flat angles C4'-P-C4' energy: -26.448 flat angles P-C4'-P energy: -14.540 tors. eta vs tors. theta energy: -28.343 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 50 Temperature: 1.129500 Total energy: -401.253337 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.253337 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.453337 (E_RNA) where: Base-Base interactions energy: -234.095 where: short stacking energy: -91.250 Base-Backbone interact. energy: -0.412 local terms energy: -110.946436 where: bonds (distance) C4'-P energy: -22.538 bonds (distance) P-C4' energy: -24.280 flat angles C4'-P-C4' energy: -22.703 flat angles P-C4'-P energy: -14.072 tors. eta vs tors. theta energy: -27.354 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 51 Temperature: 1.125000 Total energy: -413.798808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.798808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.398808 (E_RNA) where: Base-Base interactions energy: -239.271 where: short stacking energy: -106.037 Base-Backbone interact. energy: -0.852 local terms energy: -123.275916 where: bonds (distance) C4'-P energy: -23.321 bonds (distance) P-C4' energy: -21.896 flat angles C4'-P-C4' energy: -27.266 flat angles P-C4'-P energy: -18.440 tors. eta vs tors. theta energy: -32.354 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 52 Temperature: 1.120500 Total energy: -416.477216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.477216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.477216 (E_RNA) where: Base-Base interactions energy: -253.245 where: short stacking energy: -121.222 Base-Backbone interact. energy: -0.349 local terms energy: -108.883206 where: bonds (distance) C4'-P energy: -25.272 bonds (distance) P-C4' energy: -22.670 flat angles C4'-P-C4' energy: -21.592 flat angles P-C4'-P energy: -9.189 tors. eta vs tors. theta energy: -30.160 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 53 Temperature: 1.116000 Total energy: -400.832824 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.832824 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.832824 (E_RNA) where: Base-Base interactions energy: -232.825 where: short stacking energy: -113.227 Base-Backbone interact. energy: -0.003 local terms energy: -114.005026 where: bonds (distance) C4'-P energy: -22.837 bonds (distance) P-C4' energy: -20.608 flat angles C4'-P-C4' energy: -24.147 flat angles P-C4'-P energy: -16.455 tors. eta vs tors. theta energy: -29.959 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 54 Temperature: 1.111500 Total energy: -416.525622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.525622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.725622 (E_RNA) where: Base-Base interactions energy: -248.165 where: short stacking energy: -114.663 Base-Backbone interact. energy: -1.467 local terms energy: -111.093942 where: bonds (distance) C4'-P energy: -23.040 bonds (distance) P-C4' energy: -20.114 flat angles C4'-P-C4' energy: -21.697 flat angles P-C4'-P energy: -14.590 tors. eta vs tors. theta energy: -31.653 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 55 Temperature: 1.107000 Total energy: -433.697691 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.697691 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.297691 (E_RNA) where: Base-Base interactions energy: -268.100 where: short stacking energy: -129.843 Base-Backbone interact. energy: -1.013 local terms energy: -114.184498 where: bonds (distance) C4'-P energy: -22.170 bonds (distance) P-C4' energy: -22.523 flat angles C4'-P-C4' energy: -18.101 flat angles P-C4'-P energy: -18.871 tors. eta vs tors. theta energy: -32.519 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 56 Temperature: 1.102500 Total energy: -407.250466 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.250466 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.850466 (E_RNA) where: Base-Base interactions energy: -243.504 where: short stacking energy: -119.273 Base-Backbone interact. energy: -0.784 local terms energy: -112.562112 where: bonds (distance) C4'-P energy: -21.156 bonds (distance) P-C4' energy: -19.219 flat angles C4'-P-C4' energy: -17.977 flat angles P-C4'-P energy: -21.034 tors. eta vs tors. theta energy: -33.177 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 57 Temperature: 1.098000 Total energy: -409.263402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.263402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.263402 (E_RNA) where: Base-Base interactions energy: -236.862 where: short stacking energy: -110.361 Base-Backbone interact. energy: -1.304 local terms energy: -117.096579 where: bonds (distance) C4'-P energy: -24.268 bonds (distance) P-C4' energy: -24.587 flat angles C4'-P-C4' energy: -20.034 flat angles P-C4'-P energy: -15.733 tors. eta vs tors. theta energy: -32.474 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 58 Temperature: 1.093500 Total energy: -415.478557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.478557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.478557 (E_RNA) where: Base-Base interactions energy: -247.284 where: short stacking energy: -128.174 Base-Backbone interact. energy: -0.290 local terms energy: -113.904633 where: bonds (distance) C4'-P energy: -18.843 bonds (distance) P-C4' energy: -15.402 flat angles C4'-P-C4' energy: -23.556 flat angles P-C4'-P energy: -21.201 tors. eta vs tors. theta energy: -34.903 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 59 Temperature: 1.089000 Total energy: -412.573180 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.573180 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.373180 (E_RNA) where: Base-Base interactions energy: -248.395 where: short stacking energy: -129.005 Base-Backbone interact. energy: 0.437 local terms energy: -112.415165 where: bonds (distance) C4'-P energy: -15.815 bonds (distance) P-C4' energy: -12.907 flat angles C4'-P-C4' energy: -26.082 flat angles P-C4'-P energy: -21.873 tors. eta vs tors. theta energy: -35.738 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 60 Temperature: 1.084500 Total energy: -414.257256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.257256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.257256 (E_RNA) where: Base-Base interactions energy: -241.995 where: short stacking energy: -105.578 Base-Backbone interact. energy: -1.287 local terms energy: -116.974578 where: bonds (distance) C4'-P energy: -19.602 bonds (distance) P-C4' energy: -25.046 flat angles C4'-P-C4' energy: -26.504 flat angles P-C4'-P energy: -15.515 tors. eta vs tors. theta energy: -30.308 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 61 Temperature: 1.080000 Total energy: -423.315296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.315296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.115296 (E_RNA) where: Base-Base interactions energy: -246.543 where: short stacking energy: -125.473 Base-Backbone interact. energy: -1.170 local terms energy: -123.402169 where: bonds (distance) C4'-P energy: -21.653 bonds (distance) P-C4' energy: -21.736 flat angles C4'-P-C4' energy: -24.759 flat angles P-C4'-P energy: -19.239 tors. eta vs tors. theta energy: -36.016 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 62 Temperature: 1.075500 Total energy: -412.064701 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.064701 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.664701 (E_RNA) where: Base-Base interactions energy: -239.440 where: short stacking energy: -111.468 Base-Backbone interact. energy: -0.001 local terms energy: -122.223381 where: bonds (distance) C4'-P energy: -24.687 bonds (distance) P-C4' energy: -22.116 flat angles C4'-P-C4' energy: -27.063 flat angles P-C4'-P energy: -14.187 tors. eta vs tors. theta energy: -34.170 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 63 Temperature: 1.071000 Total energy: -437.856320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.856320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.656320 (E_RNA) where: Base-Base interactions energy: -258.774 where: short stacking energy: -127.050 Base-Backbone interact. energy: -1.173 local terms energy: -125.709098 where: bonds (distance) C4'-P energy: -16.912 bonds (distance) P-C4' energy: -24.999 flat angles C4'-P-C4' energy: -25.833 flat angles P-C4'-P energy: -19.562 tors. eta vs tors. theta energy: -38.404 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 64 Temperature: 1.066500 Total energy: -413.963717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.963717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.763717 (E_RNA) where: Base-Base interactions energy: -241.991 where: short stacking energy: -118.680 Base-Backbone interact. energy: -0.228 local terms energy: -119.544242 where: bonds (distance) C4'-P energy: -21.263 bonds (distance) P-C4' energy: -23.141 flat angles C4'-P-C4' energy: -25.828 flat angles P-C4'-P energy: -16.382 tors. eta vs tors. theta energy: -32.931 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 65 Temperature: 1.062000 Total energy: -403.027528 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.027528 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.227528 (E_RNA) where: Base-Base interactions energy: -236.267 where: short stacking energy: -115.768 Base-Backbone interact. energy: -0.293 local terms energy: -110.667434 where: bonds (distance) C4'-P energy: -14.312 bonds (distance) P-C4' energy: -25.119 flat angles C4'-P-C4' energy: -23.608 flat angles P-C4'-P energy: -17.316 tors. eta vs tors. theta energy: -30.312 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 66 Temperature: 1.057500 Total energy: -416.553490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.553490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.553490 (E_RNA) where: Base-Base interactions energy: -238.235 where: short stacking energy: -102.957 Base-Backbone interact. energy: 0.102 local terms energy: -124.420562 where: bonds (distance) C4'-P energy: -22.926 bonds (distance) P-C4' energy: -30.011 flat angles C4'-P-C4' energy: -22.238 flat angles P-C4'-P energy: -21.672 tors. eta vs tors. theta energy: -27.574 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 67 Temperature: 1.053000 Total energy: -411.456749 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.456749 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -357.456749 (E_RNA) where: Base-Base interactions energy: -239.791 where: short stacking energy: -120.572 Base-Backbone interact. energy: -0.595 local terms energy: -117.070054 where: bonds (distance) C4'-P energy: -22.688 bonds (distance) P-C4' energy: -21.295 flat angles C4'-P-C4' energy: -21.899 flat angles P-C4'-P energy: -18.807 tors. eta vs tors. theta energy: -32.381 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 68 Temperature: 1.048500 Total energy: -420.431639 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.431639 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.231639 (E_RNA) where: Base-Base interactions energy: -249.102 where: short stacking energy: -114.350 Base-Backbone interact. energy: -0.301 local terms energy: -118.828045 where: bonds (distance) C4'-P energy: -17.609 bonds (distance) P-C4' energy: -26.261 flat angles C4'-P-C4' energy: -24.836 flat angles P-C4'-P energy: -17.047 tors. eta vs tors. theta energy: -33.075 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 69 Temperature: 1.044000 Total energy: -416.820185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.820185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.620185 (E_RNA) where: Base-Base interactions energy: -247.170 where: short stacking energy: -114.391 Base-Backbone interact. energy: -0.282 local terms energy: -117.167974 where: bonds (distance) C4'-P energy: -15.117 bonds (distance) P-C4' energy: -27.819 flat angles C4'-P-C4' energy: -24.454 flat angles P-C4'-P energy: -15.732 tors. eta vs tors. theta energy: -34.046 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 70 Temperature: 1.039500 Total energy: -445.459033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.459033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.459033 (E_RNA) where: Base-Base interactions energy: -264.018 where: short stacking energy: -124.983 Base-Backbone interact. energy: -0.072 local terms energy: -127.368377 where: bonds (distance) C4'-P energy: -23.863 bonds (distance) P-C4' energy: -22.821 flat angles C4'-P-C4' energy: -23.700 flat angles P-C4'-P energy: -19.763 tors. eta vs tors. theta energy: -37.221 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 71 Temperature: 1.035000 Total energy: -439.966157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.966157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.966157 (E_RNA) where: Base-Base interactions energy: -266.770 where: short stacking energy: -126.865 Base-Backbone interact. energy: -0.011 local terms energy: -119.185286 where: bonds (distance) C4'-P energy: -14.457 bonds (distance) P-C4' energy: -28.281 flat angles C4'-P-C4' energy: -24.904 flat angles P-C4'-P energy: -14.493 tors. eta vs tors. theta energy: -37.050 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 72 Temperature: 1.030500 Total energy: -430.457723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.457723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.857723 (E_RNA) where: Base-Base interactions energy: -246.835 where: short stacking energy: -122.889 Base-Backbone interact. energy: -0.050 local terms energy: -125.972573 where: bonds (distance) C4'-P energy: -21.532 bonds (distance) P-C4' energy: -24.402 flat angles C4'-P-C4' energy: -25.634 flat angles P-C4'-P energy: -16.264 tors. eta vs tors. theta energy: -38.139 Dist. restrs. and SS energy: -57.600 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 73 Temperature: 1.026000 Total energy: -444.055430 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.055430 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.055430 (E_RNA) where: Base-Base interactions energy: -257.679 where: short stacking energy: -127.002 Base-Backbone interact. energy: -0.059 local terms energy: -132.318089 where: bonds (distance) C4'-P energy: -23.279 bonds (distance) P-C4' energy: -27.650 flat angles C4'-P-C4' energy: -27.730 flat angles P-C4'-P energy: -17.286 tors. eta vs tors. theta energy: -36.374 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 74 Temperature: 1.021500 Total energy: -448.382729 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.382729 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.182729 (E_RNA) where: Base-Base interactions energy: -267.990 where: short stacking energy: -134.280 Base-Backbone interact. energy: -0.431 local terms energy: -127.761744 where: bonds (distance) C4'-P energy: -23.284 bonds (distance) P-C4' energy: -21.834 flat angles C4'-P-C4' energy: -25.744 flat angles P-C4'-P energy: -19.809 tors. eta vs tors. theta energy: -37.091 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 75 Temperature: 1.017000 Total energy: -448.691673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.691673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.691673 (E_RNA) where: Base-Base interactions energy: -265.347 where: short stacking energy: -113.307 Base-Backbone interact. energy: -0.157 local terms energy: -129.187136 where: bonds (distance) C4'-P energy: -23.337 bonds (distance) P-C4' energy: -25.835 flat angles C4'-P-C4' energy: -28.230 flat angles P-C4'-P energy: -17.121 tors. eta vs tors. theta energy: -34.664 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 76 Temperature: 1.012500 Total energy: -451.279569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.279569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.279569 (E_RNA) where: Base-Base interactions energy: -269.782 where: short stacking energy: -130.108 Base-Backbone interact. energy: -0.165 local terms energy: -127.332569 where: bonds (distance) C4'-P energy: -23.850 bonds (distance) P-C4' energy: -25.897 flat angles C4'-P-C4' energy: -25.998 flat angles P-C4'-P energy: -11.354 tors. eta vs tors. theta energy: -40.233 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 77 Temperature: 1.008000 Total energy: -446.289183 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.289183 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.089183 (E_RNA) where: Base-Base interactions energy: -269.943 where: short stacking energy: -126.590 Base-Backbone interact. energy: -0.052 local terms energy: -124.094069 where: bonds (distance) C4'-P energy: -25.615 bonds (distance) P-C4' energy: -21.033 flat angles C4'-P-C4' energy: -26.868 flat angles P-C4'-P energy: -11.506 tors. eta vs tors. theta energy: -39.072 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 78 Temperature: 1.003500 Total energy: -446.111021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.111021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.911021 (E_RNA) where: Base-Base interactions energy: -262.777 where: short stacking energy: -129.308 Base-Backbone interact. energy: -1.046 local terms energy: -130.088565 where: bonds (distance) C4'-P energy: -19.891 bonds (distance) P-C4' energy: -27.204 flat angles C4'-P-C4' energy: -25.222 flat angles P-C4'-P energy: -15.905 tors. eta vs tors. theta energy: -41.866 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 79 Temperature: 0.999000 Total energy: -443.424560 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.424560 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.024560 (E_RNA) where: Base-Base interactions energy: -267.132 where: short stacking energy: -125.921 Base-Backbone interact. energy: -0.420 local terms energy: -125.473151 where: bonds (distance) C4'-P energy: -24.489 bonds (distance) P-C4' energy: -24.095 flat angles C4'-P-C4' energy: -20.960 flat angles P-C4'-P energy: -20.727 tors. eta vs tors. theta energy: -35.201 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 80 Temperature: 0.994500 Total energy: -450.784716 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.784716 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.784716 (E_RNA) where: Base-Base interactions energy: -264.242 where: short stacking energy: -128.980 Base-Backbone interact. energy: -0.057 local terms energy: -132.485275 where: bonds (distance) C4'-P energy: -26.807 bonds (distance) P-C4' energy: -24.585 flat angles C4'-P-C4' energy: -27.108 flat angles P-C4'-P energy: -18.738 tors. eta vs tors. theta energy: -35.248 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 81 Temperature: 0.990000 Total energy: -453.589181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.589181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.589181 (E_RNA) where: Base-Base interactions energy: -266.301 where: short stacking energy: -128.802 Base-Backbone interact. energy: -0.156 local terms energy: -133.132389 where: bonds (distance) C4'-P energy: -23.724 bonds (distance) P-C4' energy: -24.919 flat angles C4'-P-C4' energy: -27.949 flat angles P-C4'-P energy: -20.411 tors. eta vs tors. theta energy: -36.129 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 82 Temperature: 0.985500 Total energy: -448.879042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.879042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.479042 (E_RNA) where: Base-Base interactions energy: -266.118 where: short stacking energy: -129.184 Base-Backbone interact. energy: -0.734 local terms energy: -131.627093 where: bonds (distance) C4'-P energy: -24.852 bonds (distance) P-C4' energy: -21.573 flat angles C4'-P-C4' energy: -26.495 flat angles P-C4'-P energy: -20.150 tors. eta vs tors. theta energy: -38.557 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 83 Temperature: 0.981000 Total energy: -451.503689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.503689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.703689 (E_RNA) where: Base-Base interactions energy: -265.392 where: short stacking energy: -126.602 Base-Backbone interact. energy: -0.091 local terms energy: -130.219903 where: bonds (distance) C4'-P energy: -23.575 bonds (distance) P-C4' energy: -26.207 flat angles C4'-P-C4' energy: -28.453 flat angles P-C4'-P energy: -17.135 tors. eta vs tors. theta energy: -34.850 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 84 Temperature: 0.976500 Total energy: -454.953861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.953861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.953861 (E_RNA) where: Base-Base interactions energy: -267.773 where: short stacking energy: -129.109 Base-Backbone interact. energy: -0.367 local terms energy: -132.813884 where: bonds (distance) C4'-P energy: -25.154 bonds (distance) P-C4' energy: -24.763 flat angles C4'-P-C4' energy: -27.754 flat angles P-C4'-P energy: -17.119 tors. eta vs tors. theta energy: -38.024 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 85 Temperature: 0.972000 Total energy: -457.074867 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.074867 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.074867 (E_RNA) where: Base-Base interactions energy: -275.851 where: short stacking energy: -127.999 Base-Backbone interact. energy: -1.533 local terms energy: -125.690259 where: bonds (distance) C4'-P energy: -24.015 bonds (distance) P-C4' energy: -20.300 flat angles C4'-P-C4' energy: -26.962 flat angles P-C4'-P energy: -17.379 tors. eta vs tors. theta energy: -37.034 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 86 Temperature: 0.967500 Total energy: -458.568722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.568722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.568722 (E_RNA) where: Base-Base interactions energy: -268.654 where: short stacking energy: -130.162 Base-Backbone interact. energy: -0.427 local terms energy: -135.487589 where: bonds (distance) C4'-P energy: -24.572 bonds (distance) P-C4' energy: -22.828 flat angles C4'-P-C4' energy: -29.667 flat angles P-C4'-P energy: -18.914 tors. eta vs tors. theta energy: -39.506 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 87 Temperature: 0.963000 Total energy: -452.002614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.002614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.002614 (E_RNA) where: Base-Base interactions energy: -265.832 where: short stacking energy: -141.796 Base-Backbone interact. energy: -0.102 local terms energy: -132.067898 where: bonds (distance) C4'-P energy: -20.423 bonds (distance) P-C4' energy: -23.220 flat angles C4'-P-C4' energy: -29.340 flat angles P-C4'-P energy: -20.242 tors. eta vs tors. theta energy: -38.843 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 88 Temperature: 0.958500 Total energy: -457.594508 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.594508 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.794508 (E_RNA) where: Base-Base interactions energy: -265.798 where: short stacking energy: -125.907 Base-Backbone interact. energy: -0.290 local terms energy: -135.706532 where: bonds (distance) C4'-P energy: -23.594 bonds (distance) P-C4' energy: -25.541 flat angles C4'-P-C4' energy: -28.020 flat angles P-C4'-P energy: -21.138 tors. eta vs tors. theta energy: -37.413 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 89 Temperature: 0.954000 Total energy: -433.540955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.540955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.540955 (E_RNA) where: Base-Base interactions energy: -257.261 where: short stacking energy: -108.691 Base-Backbone interact. energy: 0.338 local terms energy: -122.617966 where: bonds (distance) C4'-P energy: -25.583 bonds (distance) P-C4' energy: -25.518 flat angles C4'-P-C4' energy: -29.104 flat angles P-C4'-P energy: -15.210 tors. eta vs tors. theta energy: -27.204 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 90 Temperature: 0.949500 Total energy: -443.934850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.934850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.534850 (E_RNA) where: Base-Base interactions energy: -259.308 where: short stacking energy: -121.196 Base-Backbone interact. energy: -0.708 local terms energy: -133.518712 where: bonds (distance) C4'-P energy: -26.542 bonds (distance) P-C4' energy: -23.711 flat angles C4'-P-C4' energy: -26.756 flat angles P-C4'-P energy: -22.911 tors. eta vs tors. theta energy: -33.599 Dist. restrs. and SS energy: -50.400 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 91 Temperature: 0.945000 Total energy: -462.133725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.133725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.333725 (E_RNA) where: Base-Base interactions energy: -271.628 where: short stacking energy: -134.017 Base-Backbone interact. energy: -0.002 local terms energy: -134.704359 where: bonds (distance) C4'-P energy: -23.771 bonds (distance) P-C4' energy: -26.980 flat angles C4'-P-C4' energy: -27.590 flat angles P-C4'-P energy: -20.669 tors. eta vs tors. theta energy: -35.693 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 92 Temperature: 0.940500 Total energy: -449.515747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.515747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.315747 (E_RNA) where: Base-Base interactions energy: -266.257 where: short stacking energy: -124.885 Base-Backbone interact. energy: -0.135 local terms energy: -130.923067 where: bonds (distance) C4'-P energy: -20.381 bonds (distance) P-C4' energy: -26.080 flat angles C4'-P-C4' energy: -29.776 flat angles P-C4'-P energy: -20.386 tors. eta vs tors. theta energy: -34.301 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 93 Temperature: 0.936000 Total energy: -464.617760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.617760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.817760 (E_RNA) where: Base-Base interactions energy: -279.740 where: short stacking energy: -131.786 Base-Backbone interact. energy: -0.115 local terms energy: -128.962133 where: bonds (distance) C4'-P energy: -20.714 bonds (distance) P-C4' energy: -25.928 flat angles C4'-P-C4' energy: -27.368 flat angles P-C4'-P energy: -19.703 tors. eta vs tors. theta energy: -35.248 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 94 Temperature: 0.931500 Total energy: -463.483596 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.483596 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.483596 (E_RNA) where: Base-Base interactions energy: -268.768 where: short stacking energy: -130.936 Base-Backbone interact. energy: -0.001 local terms energy: -140.714865 where: bonds (distance) C4'-P energy: -22.525 bonds (distance) P-C4' energy: -27.134 flat angles C4'-P-C4' energy: -29.092 flat angles P-C4'-P energy: -24.673 tors. eta vs tors. theta energy: -37.291 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 95 Temperature: 0.927000 Total energy: -454.875873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.875873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.675873 (E_RNA) where: Base-Base interactions energy: -273.077 where: short stacking energy: -123.754 Base-Backbone interact. energy: -0.504 local terms energy: -129.094511 where: bonds (distance) C4'-P energy: -20.959 bonds (distance) P-C4' energy: -26.593 flat angles C4'-P-C4' energy: -27.642 flat angles P-C4'-P energy: -18.426 tors. eta vs tors. theta energy: -35.475 Dist. restrs. and SS energy: -52.200 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 96 Temperature: 0.922500 Total energy: -464.447490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.447490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.647490 (E_RNA) where: Base-Base interactions energy: -276.722 where: short stacking energy: -133.012 Base-Backbone interact. energy: -1.063 local terms energy: -130.862074 where: bonds (distance) C4'-P energy: -23.681 bonds (distance) P-C4' energy: -20.728 flat angles C4'-P-C4' energy: -26.202 flat angles P-C4'-P energy: -19.712 tors. eta vs tors. theta energy: -40.539 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 97 Temperature: 0.918000 Total energy: -466.193949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.193949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.193949 (E_RNA) where: Base-Base interactions energy: -277.161 where: short stacking energy: -133.319 Base-Backbone interact. energy: -0.754 local terms energy: -134.278991 where: bonds (distance) C4'-P energy: -23.782 bonds (distance) P-C4' energy: -22.347 flat angles C4'-P-C4' energy: -25.917 flat angles P-C4'-P energy: -19.890 tors. eta vs tors. theta energy: -42.343 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 98 Temperature: 0.913500 Total energy: -460.529092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.529092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.529092 (E_RNA) where: Base-Base interactions energy: -268.049 where: short stacking energy: -128.917 Base-Backbone interact. energy: -0.650 local terms energy: -137.829398 where: bonds (distance) C4'-P energy: -23.788 bonds (distance) P-C4' energy: -22.430 flat angles C4'-P-C4' energy: -28.390 flat angles P-C4'-P energy: -23.089 tors. eta vs tors. theta energy: -40.131 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 99 Temperature: 0.909000 Total energy: -461.857913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.857913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.857913 (E_RNA) where: Base-Base interactions energy: -278.933 where: short stacking energy: -137.199 Base-Backbone interact. energy: 0.285 local terms energy: -129.210717 where: bonds (distance) C4'-P energy: -24.391 bonds (distance) P-C4' energy: -23.147 flat angles C4'-P-C4' energy: -23.892 flat angles P-C4'-P energy: -22.905 tors. eta vs tors. theta energy: -34.877 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 100 Temperature: 0.904500 Total energy: -457.060276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.060276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.260276 (E_RNA) where: Base-Base interactions energy: -270.966 where: short stacking energy: -129.137 Base-Backbone interact. energy: -0.127 local terms energy: -130.167094 where: bonds (distance) C4'-P energy: -26.506 bonds (distance) P-C4' energy: -24.020 flat angles C4'-P-C4' energy: -27.590 flat angles P-C4'-P energy: -17.017 tors. eta vs tors. theta energy: -35.034 Dist. restrs. and SS energy: -55.800 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 101 Temperature: 0.900000 Total energy: -464.249095 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.249095 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.249095 (E_RNA) where: Base-Base interactions energy: -280.159 where: short stacking energy: -141.547 Base-Backbone interact. energy: -0.151 local terms energy: -129.939335 where: bonds (distance) C4'-P energy: -19.513 bonds (distance) P-C4' energy: -23.936 flat angles C4'-P-C4' energy: -25.342 flat angles P-C4'-P energy: -21.276 tors. eta vs tors. theta energy: -39.873 Dist. restrs. and SS energy: -54.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) .writing output current total energy: -434.176206 recalc. total energy: -434.176206 numberOfNucleotides: 35 initial temperature kT: 1.350000 moves confirmed at first: 4079797 moves confirmed later: 4673048 all moves confirmed: 8752845 percent of confirmed moves: 5.470528 out arg RESULTS//1/G-quadruplex_test_B2-054554c2_01 Time of doing 1600000 iterations: 755.936 seconds