SimRNA (c) 2009-2024 Genesilico, ver. 3.33 .reading parameteres before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex-e6329cac/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/G-quadruplex-e6329cac/inputs/seq.fa: 1 curr_seq: _GACCUGUAUAGCUUGACCUUUAGAAUCUCUCGUGUUUGCUUCGCUUGGCCCACAAGCUCACGGGCCUACGAAGGAGGGGGGAUUUAGUGAGGCCCACUGGGCCGAAAAGGCCGUCGGCGCGGGAGCACAAACCUAGCGGAGUGGACAGGUCCGAACCGAGUUCCACCUCCCAAACCCCUCAACC_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: GACCUGUAUAGCUUGACCUUUAGAAUCUCUCGUGUUUGCUUCGCUUGGCCCACAAGCUCACGGGCCUACGAAGGAGGGGGGAUUUAGUGAGGCCCACUGGGCCGAAAAGGCCGUCGGCGCGGGAGCACAAACCUAGCGGAGUGGACAGGUCCGAACCGAGUUCCACCUCCCAAACCCCUCAACC RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 184 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 925 n_atoms_counter: 925 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 RNAStructure::secondStrcWeight = 1.000000 RNAStructure::tertiaryStrcWeight = 1.000000 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 2 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 3 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 0, chainIndex_2: 0, nuclIndex_2 : 9 , with interaction type: GG_HWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 4 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 1, chainIndex_2: 0, nuclIndex_2 : 10 , with interaction type: GG_HWc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 3, chainIndex_2: 0, nuclIndex_2 : 6 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 4, chainIndex_2: 0, nuclIndex_2 : 7 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 8 , with interaction type: GA_SHt 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 6, chainIndex_2: 0, nuclIndex_2 : 9 , with interaction type: GG_WHc 3D structure restraint added: chainIndex_1: 0, nuclIndex_1: 7, chainIndex_2: 0, nuclIndex_2 : 10 , with interaction type: GG_WHc EntireStructure::rnaStruct limitingSphereRadius : 184.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) random seed = 1 number of iterations = 1600000 trajectory write in every 16000 iterations initTemp = 1.350 finalTemp = 0.900 tempStep = -2.812500e-07 DONE .calculating ===================================== Write number: 1 Temperature: 1.350000 Total energy: 1838.959001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: 1838.959001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -750.855397 (E_RNA) where: Base-Base interactions energy: -34.648 where: short stacking energy: -34.648 Base-Backbone interact. energy: -0.000 local terms energy: -716.207608 where: bonds (distance) C4'-P energy: -178.770 bonds (distance) P-C4' energy: -165.511 flat angles C4'-P-C4' energy: -135.097 flat angles P-C4'-P energy: -154.537 tors. eta vs tors. theta energy: -82.292 Dist. restrs. and SS energy: 2589.814 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 2 Temperature: 1.345500 Total energy: -431.239027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.239027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -493.489493 (E_RNA) where: Base-Base interactions energy: -173.528 where: short stacking energy: -144.746 Base-Backbone interact. energy: 2.051 local terms energy: -322.012940 where: bonds (distance) C4'-P energy: -97.651 bonds (distance) P-C4' energy: -90.200 flat angles C4'-P-C4' energy: -77.240 flat angles P-C4'-P energy: -48.397 tors. eta vs tors. theta energy: -8.525 Dist. restrs. and SS energy: 62.250 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 3 Temperature: 1.341000 Total energy: -408.181307 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.181307 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.095302 (E_RNA) where: Base-Base interactions energy: -184.027 where: short stacking energy: -155.606 Base-Backbone interact. energy: 0.634 local terms energy: -274.702274 where: bonds (distance) C4'-P energy: -67.343 bonds (distance) P-C4' energy: -96.867 flat angles C4'-P-C4' energy: -76.571 flat angles P-C4'-P energy: -46.650 tors. eta vs tors. theta energy: 12.729 Dist. restrs. and SS energy: 49.914 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 4 Temperature: 1.336500 Total energy: -425.609947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.609947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -479.693236 (E_RNA) where: Base-Base interactions energy: -193.991 where: short stacking energy: -142.142 Base-Backbone interact. energy: -2.554 local terms energy: -283.148590 where: bonds (distance) C4'-P energy: -79.542 bonds (distance) P-C4' energy: -98.514 flat angles C4'-P-C4' energy: -55.032 flat angles P-C4'-P energy: -52.115 tors. eta vs tors. theta energy: 2.054 Dist. restrs. and SS energy: 54.083 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 5 Temperature: 1.332000 Total energy: -431.293404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.293404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -483.039662 (E_RNA) where: Base-Base interactions energy: -195.101 where: short stacking energy: -128.546 Base-Backbone interact. energy: -1.562 local terms energy: -286.376569 where: bonds (distance) C4'-P energy: -71.655 bonds (distance) P-C4' energy: -103.653 flat angles C4'-P-C4' energy: -85.555 flat angles P-C4'-P energy: -43.296 tors. eta vs tors. theta energy: 17.783 Dist. restrs. and SS energy: 51.746 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 6 Temperature: 1.327500 Total energy: -457.118472 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.118472 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -501.369782 (E_RNA) where: Base-Base interactions energy: -229.779 where: short stacking energy: -161.121 Base-Backbone interact. energy: 0.070 local terms energy: -271.660683 where: bonds (distance) C4'-P energy: -83.836 bonds (distance) P-C4' energy: -83.851 flat angles C4'-P-C4' energy: -76.066 flat angles P-C4'-P energy: -33.218 tors. eta vs tors. theta energy: 5.309 Dist. restrs. and SS energy: 44.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 7 Temperature: 1.323000 Total energy: -454.526170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.526170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -504.021143 (E_RNA) where: Base-Base interactions energy: -204.088 where: short stacking energy: -139.355 Base-Backbone interact. energy: -0.843 local terms energy: -299.089778 where: bonds (distance) C4'-P energy: -88.931 bonds (distance) P-C4' energy: -94.626 flat angles C4'-P-C4' energy: -73.201 flat angles P-C4'-P energy: -48.734 tors. eta vs tors. theta energy: 6.403 Dist. restrs. and SS energy: 49.495 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 8 Temperature: 1.318500 Total energy: -459.647981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.647981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -515.601396 (E_RNA) where: Base-Base interactions energy: -232.691 where: short stacking energy: -145.868 Base-Backbone interact. energy: -0.912 local terms energy: -281.998728 where: bonds (distance) C4'-P energy: -82.980 bonds (distance) P-C4' energy: -105.896 flat angles C4'-P-C4' energy: -76.185 flat angles P-C4'-P energy: -33.909 tors. eta vs tors. theta energy: 16.971 Dist. restrs. and SS energy: 55.953 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 9 Temperature: 1.314000 Total energy: -535.951774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -535.951774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -586.047219 (E_RNA) where: Base-Base interactions energy: -301.239 where: short stacking energy: -181.319 Base-Backbone interact. energy: -0.047 local terms energy: -284.760949 where: bonds (distance) C4'-P energy: -87.548 bonds (distance) P-C4' energy: -89.792 flat angles C4'-P-C4' energy: -88.087 flat angles P-C4'-P energy: -26.714 tors. eta vs tors. theta energy: 7.380 Dist. restrs. and SS energy: 50.095 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 10 Temperature: 1.309500 Total energy: -550.234601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -550.234601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.956454 (E_RNA) where: Base-Base interactions energy: -285.654 where: short stacking energy: -164.978 Base-Backbone interact. energy: 0.697 local terms energy: -312.998946 where: bonds (distance) C4'-P energy: -80.589 bonds (distance) P-C4' energy: -108.399 flat angles C4'-P-C4' energy: -79.075 flat angles P-C4'-P energy: -43.964 tors. eta vs tors. theta energy: -0.973 Dist. restrs. and SS energy: 47.722 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 11 Temperature: 1.305000 Total energy: -540.691198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -540.691198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -597.160510 (E_RNA) where: Base-Base interactions energy: -301.890 where: short stacking energy: -179.397 Base-Backbone interact. energy: 0.386 local terms energy: -295.657331 where: bonds (distance) C4'-P energy: -79.507 bonds (distance) P-C4' energy: -89.014 flat angles C4'-P-C4' energy: -79.564 flat angles P-C4'-P energy: -45.743 tors. eta vs tors. theta energy: -1.829 Dist. restrs. and SS energy: 56.469 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 12 Temperature: 1.300500 Total energy: -604.115252 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -604.115252 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -650.020879 (E_RNA) where: Base-Base interactions energy: -295.353 where: short stacking energy: -187.896 Base-Backbone interact. energy: -2.198 local terms energy: -352.469895 where: bonds (distance) C4'-P energy: -105.688 bonds (distance) P-C4' energy: -103.963 flat angles C4'-P-C4' energy: -85.238 flat angles P-C4'-P energy: -45.321 tors. eta vs tors. theta energy: -12.260 Dist. restrs. and SS energy: 45.906 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 13 Temperature: 1.296000 Total energy: -617.253196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -617.253196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -656.836323 (E_RNA) where: Base-Base interactions energy: -335.796 where: short stacking energy: -215.377 Base-Backbone interact. energy: 0.635 local terms energy: -321.675288 where: bonds (distance) C4'-P energy: -82.806 bonds (distance) P-C4' energy: -85.997 flat angles C4'-P-C4' energy: -88.287 flat angles P-C4'-P energy: -51.796 tors. eta vs tors. theta energy: -12.789 Dist. restrs. and SS energy: 39.583 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 14 Temperature: 1.291500 Total energy: -566.246380 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -566.246380 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -615.026155 (E_RNA) where: Base-Base interactions energy: -265.680 where: short stacking energy: -160.011 Base-Backbone interact. energy: -0.837 local terms energy: -348.509046 where: bonds (distance) C4'-P energy: -104.266 bonds (distance) P-C4' energy: -92.689 flat angles C4'-P-C4' energy: -88.271 flat angles P-C4'-P energy: -49.353 tors. eta vs tors. theta energy: -13.930 Dist. restrs. and SS energy: 48.780 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 15 Temperature: 1.287000 Total energy: -630.228734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -630.228734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -673.988790 (E_RNA) where: Base-Base interactions energy: -357.924 where: short stacking energy: -203.899 Base-Backbone interact. energy: 3.851 local terms energy: -319.916025 where: bonds (distance) C4'-P energy: -92.159 bonds (distance) P-C4' energy: -95.130 flat angles C4'-P-C4' energy: -81.478 flat angles P-C4'-P energy: -44.892 tors. eta vs tors. theta energy: -6.257 Dist. restrs. and SS energy: 43.760 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 16 Temperature: 1.282500 Total energy: -713.351570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -713.351570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -757.043426 (E_RNA) where: Base-Base interactions energy: -417.191 where: short stacking energy: -216.927 Base-Backbone interact. energy: 1.175 local terms energy: -341.027396 where: bonds (distance) C4'-P energy: -106.210 bonds (distance) P-C4' energy: -80.874 flat angles C4'-P-C4' energy: -76.240 flat angles P-C4'-P energy: -64.426 tors. eta vs tors. theta energy: -13.277 Dist. restrs. and SS energy: 43.692 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 17 Temperature: 1.278000 Total energy: -750.394646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -750.394646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -792.126333 (E_RNA) where: Base-Base interactions energy: -455.067 where: short stacking energy: -225.655 Base-Backbone interact. energy: -0.817 local terms energy: -336.242119 where: bonds (distance) C4'-P energy: -91.441 bonds (distance) P-C4' energy: -93.031 flat angles C4'-P-C4' energy: -91.174 flat angles P-C4'-P energy: -58.627 tors. eta vs tors. theta energy: -1.969 Dist. restrs. and SS energy: 41.732 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 18 Temperature: 1.273500 Total energy: -825.495994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -825.495994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -867.082681 (E_RNA) where: Base-Base interactions energy: -506.245 where: short stacking energy: -246.161 Base-Backbone interact. energy: -1.411 local terms energy: -359.426072 where: bonds (distance) C4'-P energy: -86.442 bonds (distance) P-C4' energy: -89.377 flat angles C4'-P-C4' energy: -100.955 flat angles P-C4'-P energy: -53.894 tors. eta vs tors. theta energy: -28.759 Dist. restrs. and SS energy: 41.587 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 19 Temperature: 1.269000 Total energy: -917.542807 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -917.542807 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -960.029913 (E_RNA) where: Base-Base interactions energy: -565.064 where: short stacking energy: -284.862 Base-Backbone interact. energy: -2.046 local terms energy: -392.920251 where: bonds (distance) C4'-P energy: -93.897 bonds (distance) P-C4' energy: -107.811 flat angles C4'-P-C4' energy: -90.914 flat angles P-C4'-P energy: -54.927 tors. eta vs tors. theta energy: -45.371 Dist. restrs. and SS energy: 42.487 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 20 Temperature: 1.264500 Total energy: -938.992001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -938.992001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -986.246817 (E_RNA) where: Base-Base interactions energy: -588.226 where: short stacking energy: -282.863 Base-Backbone interact. energy: -3.716 local terms energy: -394.304310 where: bonds (distance) C4'-P energy: -105.519 bonds (distance) P-C4' energy: -95.158 flat angles C4'-P-C4' energy: -86.622 flat angles P-C4'-P energy: -58.695 tors. eta vs tors. theta energy: -48.310 Dist. restrs. and SS energy: 47.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 21 Temperature: 1.260000 Total energy: -856.295964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -856.295964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -892.389438 (E_RNA) where: Base-Base interactions energy: -519.961 where: short stacking energy: -249.910 Base-Backbone interact. energy: 1.892 local terms energy: -374.320727 where: bonds (distance) C4'-P energy: -94.830 bonds (distance) P-C4' energy: -87.496 flat angles C4'-P-C4' energy: -94.671 flat angles P-C4'-P energy: -55.975 tors. eta vs tors. theta energy: -41.350 Dist. restrs. and SS energy: 36.093 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 22 Temperature: 1.255500 Total energy: -944.007342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -944.007342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -984.057206 (E_RNA) where: Base-Base interactions energy: -616.819 where: short stacking energy: -294.008 Base-Backbone interact. energy: 0.616 local terms energy: -367.853848 where: bonds (distance) C4'-P energy: -85.580 bonds (distance) P-C4' energy: -83.246 flat angles C4'-P-C4' energy: -91.537 flat angles P-C4'-P energy: -56.309 tors. eta vs tors. theta energy: -51.181 Dist. restrs. and SS energy: 40.050 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 23 Temperature: 1.251000 Total energy: -1001.004538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1001.004538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1051.137595 (E_RNA) where: Base-Base interactions energy: -652.027 where: short stacking energy: -304.677 Base-Backbone interact. energy: 0.059 local terms energy: -399.170227 where: bonds (distance) C4'-P energy: -95.859 bonds (distance) P-C4' energy: -97.547 flat angles C4'-P-C4' energy: -89.636 flat angles P-C4'-P energy: -59.781 tors. eta vs tors. theta energy: -56.348 Dist. restrs. and SS energy: 50.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 24 Temperature: 1.246500 Total energy: -1038.648343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1038.648343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1080.687986 (E_RNA) where: Base-Base interactions energy: -679.841 where: short stacking energy: -312.094 Base-Backbone interact. energy: -1.047 local terms energy: -399.800282 where: bonds (distance) C4'-P energy: -90.770 bonds (distance) P-C4' energy: -101.143 flat angles C4'-P-C4' energy: -94.423 flat angles P-C4'-P energy: -54.087 tors. eta vs tors. theta energy: -59.378 Dist. restrs. and SS energy: 42.040 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 25 Temperature: 1.242000 Total energy: -1015.433543 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1015.433543 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1058.346791 (E_RNA) where: Base-Base interactions energy: -654.704 where: short stacking energy: -329.318 Base-Backbone interact. energy: 1.057 local terms energy: -404.700506 where: bonds (distance) C4'-P energy: -107.581 bonds (distance) P-C4' energy: -90.694 flat angles C4'-P-C4' energy: -104.833 flat angles P-C4'-P energy: -46.708 tors. eta vs tors. theta energy: -54.885 Dist. restrs. and SS energy: 42.913 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 26 Temperature: 1.237500 Total energy: -1019.921245 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1019.921245 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1054.991207 (E_RNA) where: Base-Base interactions energy: -652.415 where: short stacking energy: -301.493 Base-Backbone interact. energy: -2.728 local terms energy: -399.848680 where: bonds (distance) C4'-P energy: -97.168 bonds (distance) P-C4' energy: -88.346 flat angles C4'-P-C4' energy: -104.271 flat angles P-C4'-P energy: -66.825 tors. eta vs tors. theta energy: -43.239 Dist. restrs. and SS energy: 35.070 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 27 Temperature: 1.233000 Total energy: -1112.562050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1112.562050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1153.624015 (E_RNA) where: Base-Base interactions energy: -757.288 where: short stacking energy: -339.075 Base-Backbone interact. energy: -0.939 local terms energy: -395.397788 where: bonds (distance) C4'-P energy: -87.010 bonds (distance) P-C4' energy: -94.990 flat angles C4'-P-C4' energy: -102.644 flat angles P-C4'-P energy: -47.386 tors. eta vs tors. theta energy: -63.368 Dist. restrs. and SS energy: 41.062 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 28 Temperature: 1.228500 Total energy: -978.426928 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -978.426928 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1021.526708 (E_RNA) where: Base-Base interactions energy: -640.970 where: short stacking energy: -320.945 Base-Backbone interact. energy: -0.652 local terms energy: -379.905092 where: bonds (distance) C4'-P energy: -80.263 bonds (distance) P-C4' energy: -105.205 flat angles C4'-P-C4' energy: -76.834 flat angles P-C4'-P energy: -59.882 tors. eta vs tors. theta energy: -57.721 Dist. restrs. and SS energy: 43.100 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 29 Temperature: 1.224000 Total energy: -1014.640342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1014.640342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1055.107644 (E_RNA) where: Base-Base interactions energy: -655.178 where: short stacking energy: -321.047 Base-Backbone interact. energy: 3.761 local terms energy: -403.691421 where: bonds (distance) C4'-P energy: -84.618 bonds (distance) P-C4' energy: -119.014 flat angles C4'-P-C4' energy: -90.873 flat angles P-C4'-P energy: -62.345 tors. eta vs tors. theta energy: -46.842 Dist. restrs. and SS energy: 40.467 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 30 Temperature: 1.219500 Total energy: -1012.063441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1012.063441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1050.910937 (E_RNA) where: Base-Base interactions energy: -653.396 where: short stacking energy: -289.257 Base-Backbone interact. energy: 4.262 local terms energy: -401.777116 where: bonds (distance) C4'-P energy: -84.243 bonds (distance) P-C4' energy: -98.949 flat angles C4'-P-C4' energy: -92.221 flat angles P-C4'-P energy: -80.238 tors. eta vs tors. theta energy: -46.127 Dist. restrs. and SS energy: 38.847 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 31 Temperature: 1.215000 Total energy: -1023.904081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1023.904081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1074.548791 (E_RNA) where: Base-Base interactions energy: -657.902 where: short stacking energy: -303.433 Base-Backbone interact. energy: 1.647 local terms energy: -418.294320 where: bonds (distance) C4'-P energy: -102.650 bonds (distance) P-C4' energy: -85.561 flat angles C4'-P-C4' energy: -103.282 flat angles P-C4'-P energy: -72.840 tors. eta vs tors. theta energy: -53.961 Dist. restrs. and SS energy: 50.645 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 32 Temperature: 1.210500 Total energy: -1052.649640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.649640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1095.879759 (E_RNA) where: Base-Base interactions energy: -714.889 where: short stacking energy: -314.607 Base-Backbone interact. energy: 1.458 local terms energy: -382.448388 where: bonds (distance) C4'-P energy: -76.800 bonds (distance) P-C4' energy: -96.969 flat angles C4'-P-C4' energy: -99.975 flat angles P-C4'-P energy: -56.285 tors. eta vs tors. theta energy: -52.420 Dist. restrs. and SS energy: 43.230 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 33 Temperature: 1.206000 Total energy: -1085.342470 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1085.342470 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1122.380207 (E_RNA) where: Base-Base interactions energy: -713.004 where: short stacking energy: -336.055 Base-Backbone interact. energy: -2.620 local terms energy: -406.756325 where: bonds (distance) C4'-P energy: -108.976 bonds (distance) P-C4' energy: -89.770 flat angles C4'-P-C4' energy: -87.131 flat angles P-C4'-P energy: -45.948 tors. eta vs tors. theta energy: -74.931 Dist. restrs. and SS energy: 37.038 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 34 Temperature: 1.201500 Total energy: -1093.790304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1093.790304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1134.235013 (E_RNA) where: Base-Base interactions energy: -745.910 where: short stacking energy: -355.240 Base-Backbone interact. energy: -0.815 local terms energy: -387.510129 where: bonds (distance) C4'-P energy: -77.708 bonds (distance) P-C4' energy: -88.419 flat angles C4'-P-C4' energy: -92.346 flat angles P-C4'-P energy: -62.610 tors. eta vs tors. theta energy: -66.428 Dist. restrs. and SS energy: 40.445 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 35 Temperature: 1.197000 Total energy: -1020.753361 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1020.753361 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1061.039416 (E_RNA) where: Base-Base interactions energy: -657.786 where: short stacking energy: -333.940 Base-Backbone interact. energy: -0.828 local terms energy: -402.425588 where: bonds (distance) C4'-P energy: -79.360 bonds (distance) P-C4' energy: -103.714 flat angles C4'-P-C4' energy: -82.498 flat angles P-C4'-P energy: -66.914 tors. eta vs tors. theta energy: -69.940 Dist. restrs. and SS energy: 40.286 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 36 Temperature: 1.192500 Total energy: -1090.625050 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1090.625050 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1138.777271 (E_RNA) where: Base-Base interactions energy: -701.172 where: short stacking energy: -352.321 Base-Backbone interact. energy: -0.564 local terms energy: -437.040799 where: bonds (distance) C4'-P energy: -111.812 bonds (distance) P-C4' energy: -94.083 flat angles C4'-P-C4' energy: -97.820 flat angles P-C4'-P energy: -60.585 tors. eta vs tors. theta energy: -72.741 Dist. restrs. and SS energy: 48.152 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 37 Temperature: 1.188000 Total energy: -1120.758227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1120.758227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1163.352777 (E_RNA) where: Base-Base interactions energy: -695.908 where: short stacking energy: -352.422 Base-Backbone interact. energy: -1.251 local terms energy: -466.194395 where: bonds (distance) C4'-P energy: -107.957 bonds (distance) P-C4' energy: -113.698 flat angles C4'-P-C4' energy: -106.082 flat angles P-C4'-P energy: -58.598 tors. eta vs tors. theta energy: -79.859 Dist. restrs. and SS energy: 42.595 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 38 Temperature: 1.183500 Total energy: -1069.052774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1069.052774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1109.824795 (E_RNA) where: Base-Base interactions energy: -678.924 where: short stacking energy: -315.902 Base-Backbone interact. energy: -0.710 local terms energy: -430.190418 where: bonds (distance) C4'-P energy: -108.661 bonds (distance) P-C4' energy: -106.778 flat angles C4'-P-C4' energy: -99.094 flat angles P-C4'-P energy: -50.302 tors. eta vs tors. theta energy: -65.356 Dist. restrs. and SS energy: 40.772 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 39 Temperature: 1.179000 Total energy: -1129.513175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1129.513175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1166.956859 (E_RNA) where: Base-Base interactions energy: -728.673 where: short stacking energy: -374.577 Base-Backbone interact. energy: -1.475 local terms energy: -436.808986 where: bonds (distance) C4'-P energy: -96.103 bonds (distance) P-C4' energy: -93.422 flat angles C4'-P-C4' energy: -100.075 flat angles P-C4'-P energy: -48.711 tors. eta vs tors. theta energy: -98.498 Dist. restrs. and SS energy: 37.444 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 40 Temperature: 1.174500 Total energy: -1052.567665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1052.567665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1090.467036 (E_RNA) where: Base-Base interactions energy: -661.835 where: short stacking energy: -339.181 Base-Backbone interact. energy: -0.723 local terms energy: -427.908190 where: bonds (distance) C4'-P energy: -83.186 bonds (distance) P-C4' energy: -98.813 flat angles C4'-P-C4' energy: -88.905 flat angles P-C4'-P energy: -74.204 tors. eta vs tors. theta energy: -82.801 Dist. restrs. and SS energy: 37.899 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 41 Temperature: 1.170000 Total energy: -1064.032743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1064.032743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1098.865913 (E_RNA) where: Base-Base interactions energy: -695.578 where: short stacking energy: -338.082 Base-Backbone interact. energy: 0.168 local terms energy: -403.455428 where: bonds (distance) C4'-P energy: -85.413 bonds (distance) P-C4' energy: -100.725 flat angles C4'-P-C4' energy: -82.657 flat angles P-C4'-P energy: -68.819 tors. eta vs tors. theta energy: -65.841 Dist. restrs. and SS energy: 34.833 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 42 Temperature: 1.165500 Total energy: -1135.596422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1135.596422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1176.680680 (E_RNA) where: Base-Base interactions energy: -723.717 where: short stacking energy: -352.848 Base-Backbone interact. energy: -2.224 local terms energy: -450.739458 where: bonds (distance) C4'-P energy: -94.889 bonds (distance) P-C4' energy: -98.215 flat angles C4'-P-C4' energy: -109.331 flat angles P-C4'-P energy: -66.016 tors. eta vs tors. theta energy: -82.289 Dist. restrs. and SS energy: 41.084 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 43 Temperature: 1.161000 Total energy: -1158.704991 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1158.704991 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1210.669434 (E_RNA) where: Base-Base interactions energy: -732.703 where: short stacking energy: -362.837 Base-Backbone interact. energy: -0.869 local terms energy: -477.097484 where: bonds (distance) C4'-P energy: -87.163 bonds (distance) P-C4' energy: -112.894 flat angles C4'-P-C4' energy: -118.947 flat angles P-C4'-P energy: -79.351 tors. eta vs tors. theta energy: -78.743 Dist. restrs. and SS energy: 51.964 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 44 Temperature: 1.156500 Total energy: -1126.438026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1126.438026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1161.094561 (E_RNA) where: Base-Base interactions energy: -729.264 where: short stacking energy: -369.701 Base-Backbone interact. energy: -2.057 local terms energy: -429.773606 where: bonds (distance) C4'-P energy: -96.994 bonds (distance) P-C4' energy: -86.727 flat angles C4'-P-C4' energy: -101.264 flat angles P-C4'-P energy: -67.534 tors. eta vs tors. theta energy: -77.253 Dist. restrs. and SS energy: 34.657 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 45 Temperature: 1.152000 Total energy: -1163.876870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1163.876870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1203.964604 (E_RNA) where: Base-Base interactions energy: -784.438 where: short stacking energy: -369.681 Base-Backbone interact. energy: 0.253 local terms energy: -419.780162 where: bonds (distance) C4'-P energy: -91.931 bonds (distance) P-C4' energy: -93.555 flat angles C4'-P-C4' energy: -105.846 flat angles P-C4'-P energy: -58.220 tors. eta vs tors. theta energy: -70.228 Dist. restrs. and SS energy: 40.088 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 46 Temperature: 1.147500 Total energy: -1234.779194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1234.779194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1277.028164 (E_RNA) where: Base-Base interactions energy: -826.505 where: short stacking energy: -398.026 Base-Backbone interact. energy: 1.234 local terms energy: -451.757233 where: bonds (distance) C4'-P energy: -105.815 bonds (distance) P-C4' energy: -86.588 flat angles C4'-P-C4' energy: -107.050 flat angles P-C4'-P energy: -65.612 tors. eta vs tors. theta energy: -86.691 Dist. restrs. and SS energy: 42.249 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 47 Temperature: 1.143000 Total energy: -1185.953652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.953652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1227.781022 (E_RNA) where: Base-Base interactions energy: -765.127 where: short stacking energy: -387.497 Base-Backbone interact. energy: 0.290 local terms energy: -462.944098 where: bonds (distance) C4'-P energy: -95.559 bonds (distance) P-C4' energy: -95.637 flat angles C4'-P-C4' energy: -107.062 flat angles P-C4'-P energy: -67.217 tors. eta vs tors. theta energy: -97.469 Dist. restrs. and SS energy: 41.827 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 48 Temperature: 1.138500 Total energy: -1185.155055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1185.155055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1228.406485 (E_RNA) where: Base-Base interactions energy: -747.792 where: short stacking energy: -361.302 Base-Backbone interact. energy: -2.852 local terms energy: -477.762293 where: bonds (distance) C4'-P energy: -115.991 bonds (distance) P-C4' energy: -104.041 flat angles C4'-P-C4' energy: -97.951 flat angles P-C4'-P energy: -75.879 tors. eta vs tors. theta energy: -83.900 Dist. restrs. and SS energy: 43.251 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 49 Temperature: 1.134000 Total energy: -1206.611221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1206.611221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1247.839624 (E_RNA) where: Base-Base interactions energy: -773.797 where: short stacking energy: -396.415 Base-Backbone interact. energy: 5.788 local terms energy: -479.830758 where: bonds (distance) C4'-P energy: -107.145 bonds (distance) P-C4' energy: -92.114 flat angles C4'-P-C4' energy: -119.275 flat angles P-C4'-P energy: -69.421 tors. eta vs tors. theta energy: -91.877 Dist. restrs. and SS energy: 41.228 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 50 Temperature: 1.129500 Total energy: -1203.722283 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1203.722283 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1240.470727 (E_RNA) where: Base-Base interactions energy: -802.103 where: short stacking energy: -369.266 Base-Backbone interact. energy: -2.914 local terms energy: -435.453652 where: bonds (distance) C4'-P energy: -89.153 bonds (distance) P-C4' energy: -103.977 flat angles C4'-P-C4' energy: -99.933 flat angles P-C4'-P energy: -56.345 tors. eta vs tors. theta energy: -86.046 Dist. restrs. and SS energy: 36.748 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 51 Temperature: 1.125000 Total energy: -1201.322336 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1201.322336 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1239.078528 (E_RNA) where: Base-Base interactions energy: -784.861 where: short stacking energy: -366.040 Base-Backbone interact. energy: -3.044 local terms energy: -451.173181 where: bonds (distance) C4'-P energy: -100.422 bonds (distance) P-C4' energy: -90.549 flat angles C4'-P-C4' energy: -103.178 flat angles P-C4'-P energy: -74.132 tors. eta vs tors. theta energy: -82.892 Dist. restrs. and SS energy: 37.756 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 52 Temperature: 1.120500 Total energy: -1174.467442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1174.467442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1216.569024 (E_RNA) where: Base-Base interactions energy: -780.102 where: short stacking energy: -352.895 Base-Backbone interact. energy: 0.964 local terms energy: -437.430920 where: bonds (distance) C4'-P energy: -95.749 bonds (distance) P-C4' energy: -118.256 flat angles C4'-P-C4' energy: -99.277 flat angles P-C4'-P energy: -57.992 tors. eta vs tors. theta energy: -66.157 Dist. restrs. and SS energy: 42.102 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 53 Temperature: 1.116000 Total energy: -1249.342996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1249.342996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1287.500847 (E_RNA) where: Base-Base interactions energy: -790.687 where: short stacking energy: -365.279 Base-Backbone interact. energy: -1.699 local terms energy: -495.115648 where: bonds (distance) C4'-P energy: -116.628 bonds (distance) P-C4' energy: -103.964 flat angles C4'-P-C4' energy: -107.955 flat angles P-C4'-P energy: -83.882 tors. eta vs tors. theta energy: -82.687 Dist. restrs. and SS energy: 38.158 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 54 Temperature: 1.111500 Total energy: -1290.049090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1290.049090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1327.465024 (E_RNA) where: Base-Base interactions energy: -846.621 where: short stacking energy: -412.182 Base-Backbone interact. energy: -2.848 local terms energy: -477.995417 where: bonds (distance) C4'-P energy: -95.746 bonds (distance) P-C4' energy: -104.378 flat angles C4'-P-C4' energy: -105.843 flat angles P-C4'-P energy: -75.006 tors. eta vs tors. theta energy: -97.023 Dist. restrs. and SS energy: 37.416 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 55 Temperature: 1.107000 Total energy: -1279.577162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1279.577162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1317.093030 (E_RNA) where: Base-Base interactions energy: -807.930 where: short stacking energy: -420.188 Base-Backbone interact. energy: 4.361 local terms energy: -513.523838 where: bonds (distance) C4'-P energy: -107.119 bonds (distance) P-C4' energy: -105.483 flat angles C4'-P-C4' energy: -119.123 flat angles P-C4'-P energy: -82.451 tors. eta vs tors. theta energy: -99.348 Dist. restrs. and SS energy: 37.516 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 56 Temperature: 1.102500 Total energy: -1258.924527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1258.924527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1294.505215 (E_RNA) where: Base-Base interactions energy: -840.138 where: short stacking energy: -411.214 Base-Backbone interact. energy: 0.771 local terms energy: -455.138160 where: bonds (distance) C4'-P energy: -86.346 bonds (distance) P-C4' energy: -107.964 flat angles C4'-P-C4' energy: -105.621 flat angles P-C4'-P energy: -62.107 tors. eta vs tors. theta energy: -93.100 Dist. restrs. and SS energy: 35.581 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 57 Temperature: 1.098000 Total energy: -1304.158322 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1304.158322 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1335.606454 (E_RNA) where: Base-Base interactions energy: -863.263 where: short stacking energy: -399.472 Base-Backbone interact. energy: -3.752 local terms energy: -468.591552 where: bonds (distance) C4'-P energy: -84.291 bonds (distance) P-C4' energy: -95.264 flat angles C4'-P-C4' energy: -116.896 flat angles P-C4'-P energy: -79.527 tors. eta vs tors. theta energy: -92.613 Dist. restrs. and SS energy: 31.448 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 58 Temperature: 1.093500 Total energy: -1337.206700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1337.206700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1380.805422 (E_RNA) where: Base-Base interactions energy: -896.973 where: short stacking energy: -443.281 Base-Backbone interact. energy: -0.999 local terms energy: -482.833424 where: bonds (distance) C4'-P energy: -101.280 bonds (distance) P-C4' energy: -103.490 flat angles C4'-P-C4' energy: -113.827 flat angles P-C4'-P energy: -65.859 tors. eta vs tors. theta energy: -98.378 Dist. restrs. and SS energy: 43.599 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 59 Temperature: 1.089000 Total energy: -1295.763628 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1295.763628 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1334.177885 (E_RNA) where: Base-Base interactions energy: -876.677 where: short stacking energy: -403.365 Base-Backbone interact. energy: 0.736 local terms energy: -458.237344 where: bonds (distance) C4'-P energy: -97.034 bonds (distance) P-C4' energy: -95.743 flat angles C4'-P-C4' energy: -109.474 flat angles P-C4'-P energy: -71.985 tors. eta vs tors. theta energy: -84.001 Dist. restrs. and SS energy: 38.414 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 60 Temperature: 1.084500 Total energy: -1309.544940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1309.544940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1345.897455 (E_RNA) where: Base-Base interactions energy: -874.952 where: short stacking energy: -395.906 Base-Backbone interact. energy: -0.384 local terms energy: -470.561427 where: bonds (distance) C4'-P energy: -96.202 bonds (distance) P-C4' energy: -106.638 flat angles C4'-P-C4' energy: -107.344 flat angles P-C4'-P energy: -74.172 tors. eta vs tors. theta energy: -86.205 Dist. restrs. and SS energy: 36.353 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 61 Temperature: 1.080000 Total energy: -1324.950286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1324.950286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1364.969948 (E_RNA) where: Base-Base interactions energy: -862.322 where: short stacking energy: -427.594 Base-Backbone interact. energy: -3.058 local terms energy: -499.589933 where: bonds (distance) C4'-P energy: -106.054 bonds (distance) P-C4' energy: -108.649 flat angles C4'-P-C4' energy: -96.782 flat angles P-C4'-P energy: -79.912 tors. eta vs tors. theta energy: -108.193 Dist. restrs. and SS energy: 40.020 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 62 Temperature: 1.075500 Total energy: -1326.620933 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1326.620933 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1367.858367 (E_RNA) where: Base-Base interactions energy: -890.543 where: short stacking energy: -427.844 Base-Backbone interact. energy: -2.870 local terms energy: -474.445801 where: bonds (distance) C4'-P energy: -94.504 bonds (distance) P-C4' energy: -107.527 flat angles C4'-P-C4' energy: -116.362 flat angles P-C4'-P energy: -61.450 tors. eta vs tors. theta energy: -94.604 Dist. restrs. and SS energy: 41.237 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 63 Temperature: 1.071000 Total energy: -1378.461550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1378.461550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1417.148597 (E_RNA) where: Base-Base interactions energy: -924.330 where: short stacking energy: -452.424 Base-Backbone interact. energy: -1.426 local terms energy: -491.392439 where: bonds (distance) C4'-P energy: -85.541 bonds (distance) P-C4' energy: -100.468 flat angles C4'-P-C4' energy: -123.878 flat angles P-C4'-P energy: -77.114 tors. eta vs tors. theta energy: -104.391 Dist. restrs. and SS energy: 38.687 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 64 Temperature: 1.066500 Total energy: -1447.263023 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1447.263023 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1490.147591 (E_RNA) where: Base-Base interactions energy: -971.815 where: short stacking energy: -485.648 Base-Backbone interact. energy: -0.203 local terms energy: -518.129475 where: bonds (distance) C4'-P energy: -102.591 bonds (distance) P-C4' energy: -97.298 flat angles C4'-P-C4' energy: -113.645 flat angles P-C4'-P energy: -73.388 tors. eta vs tors. theta energy: -131.208 Dist. restrs. and SS energy: 42.885 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 65 Temperature: 1.062000 Total energy: -1367.710759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1367.710759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1407.233509 (E_RNA) where: Base-Base interactions energy: -902.249 where: short stacking energy: -432.725 Base-Backbone interact. energy: -3.971 local terms energy: -501.012773 where: bonds (distance) C4'-P energy: -98.383 bonds (distance) P-C4' energy: -113.276 flat angles C4'-P-C4' energy: -109.680 flat angles P-C4'-P energy: -66.974 tors. eta vs tors. theta energy: -112.700 Dist. restrs. and SS energy: 39.523 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 66 Temperature: 1.057500 Total energy: -1409.524108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1409.524108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1454.990446 (E_RNA) where: Base-Base interactions energy: -938.844 where: short stacking energy: -439.946 Base-Backbone interact. energy: -3.252 local terms energy: -512.894293 where: bonds (distance) C4'-P energy: -113.402 bonds (distance) P-C4' energy: -103.936 flat angles C4'-P-C4' energy: -105.519 flat angles P-C4'-P energy: -85.141 tors. eta vs tors. theta energy: -104.896 Dist. restrs. and SS energy: 45.466 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 67 Temperature: 1.053000 Total energy: -1446.768529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1446.768529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1485.403908 (E_RNA) where: Base-Base interactions energy: -982.134 where: short stacking energy: -453.302 Base-Backbone interact. energy: -2.826 local terms energy: -500.443528 where: bonds (distance) C4'-P energy: -98.218 bonds (distance) P-C4' energy: -111.581 flat angles C4'-P-C4' energy: -104.041 flat angles P-C4'-P energy: -67.088 tors. eta vs tors. theta energy: -119.516 Dist. restrs. and SS energy: 38.635 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 68 Temperature: 1.048500 Total energy: -1437.201897 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1437.201897 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1473.454413 (E_RNA) where: Base-Base interactions energy: -972.132 where: short stacking energy: -433.611 Base-Backbone interact. energy: 2.486 local terms energy: -503.808476 where: bonds (distance) C4'-P energy: -111.857 bonds (distance) P-C4' energy: -109.079 flat angles C4'-P-C4' energy: -100.486 flat angles P-C4'-P energy: -82.829 tors. eta vs tors. theta energy: -99.557 Dist. restrs. and SS energy: 36.253 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 69 Temperature: 1.044000 Total energy: -1474.344235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1474.344235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1506.825018 (E_RNA) where: Base-Base interactions energy: -1003.613 where: short stacking energy: -465.140 Base-Backbone interact. energy: -0.681 local terms energy: -502.531040 where: bonds (distance) C4'-P energy: -104.951 bonds (distance) P-C4' energy: -103.014 flat angles C4'-P-C4' energy: -115.914 flat angles P-C4'-P energy: -58.442 tors. eta vs tors. theta energy: -120.211 Dist. restrs. and SS energy: 32.481 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 70 Temperature: 1.039500 Total energy: -1470.679935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1470.679935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1509.301648 (E_RNA) where: Base-Base interactions energy: -994.820 where: short stacking energy: -444.882 Base-Backbone interact. energy: -3.745 local terms energy: -510.736767 where: bonds (distance) C4'-P energy: -109.976 bonds (distance) P-C4' energy: -100.667 flat angles C4'-P-C4' energy: -115.244 flat angles P-C4'-P energy: -71.818 tors. eta vs tors. theta energy: -113.031 Dist. restrs. and SS energy: 38.622 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 71 Temperature: 1.035000 Total energy: -1429.327280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1429.327280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1466.254459 (E_RNA) where: Base-Base interactions energy: -960.440 where: short stacking energy: -445.984 Base-Backbone interact. energy: -2.860 local terms energy: -502.954692 where: bonds (distance) C4'-P energy: -109.034 bonds (distance) P-C4' energy: -117.677 flat angles C4'-P-C4' energy: -99.391 flat angles P-C4'-P energy: -70.896 tors. eta vs tors. theta energy: -105.958 Dist. restrs. and SS energy: 36.927 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 72 Temperature: 1.030500 Total energy: -1469.984373 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1469.984373 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1521.082543 (E_RNA) where: Base-Base interactions energy: -995.219 where: short stacking energy: -462.487 Base-Backbone interact. energy: -3.093 local terms energy: -522.770192 where: bonds (distance) C4'-P energy: -108.035 bonds (distance) P-C4' energy: -111.366 flat angles C4'-P-C4' energy: -117.511 flat angles P-C4'-P energy: -82.633 tors. eta vs tors. theta energy: -103.225 Dist. restrs. and SS energy: 51.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 73 Temperature: 1.026000 Total energy: -1462.881989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1462.881989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1504.320525 (E_RNA) where: Base-Base interactions energy: -973.442 where: short stacking energy: -450.247 Base-Backbone interact. energy: -3.822 local terms energy: -527.056213 where: bonds (distance) C4'-P energy: -93.879 bonds (distance) P-C4' energy: -107.777 flat angles C4'-P-C4' energy: -129.725 flat angles P-C4'-P energy: -76.532 tors. eta vs tors. theta energy: -119.144 Dist. restrs. and SS energy: 41.439 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 74 Temperature: 1.021500 Total energy: -1497.951844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1497.951844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1536.790496 (E_RNA) where: Base-Base interactions energy: -997.339 where: short stacking energy: -444.696 Base-Backbone interact. energy: 2.235 local terms energy: -541.686755 where: bonds (distance) C4'-P energy: -114.171 bonds (distance) P-C4' energy: -102.488 flat angles C4'-P-C4' energy: -126.220 flat angles P-C4'-P energy: -83.079 tors. eta vs tors. theta energy: -115.729 Dist. restrs. and SS energy: 38.839 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 75 Temperature: 1.017000 Total energy: -1441.012820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1441.012820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1480.977991 (E_RNA) where: Base-Base interactions energy: -964.353 where: short stacking energy: -479.277 Base-Backbone interact. energy: -2.400 local terms energy: -514.224836 where: bonds (distance) C4'-P energy: -88.292 bonds (distance) P-C4' energy: -109.552 flat angles C4'-P-C4' energy: -117.601 flat angles P-C4'-P energy: -83.435 tors. eta vs tors. theta energy: -115.344 Dist. restrs. and SS energy: 39.965 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 76 Temperature: 1.012500 Total energy: -1502.490873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1502.490873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1539.757486 (E_RNA) where: Base-Base interactions energy: -998.944 where: short stacking energy: -453.194 Base-Backbone interact. energy: -0.939 local terms energy: -539.875324 where: bonds (distance) C4'-P energy: -122.533 bonds (distance) P-C4' energy: -103.075 flat angles C4'-P-C4' energy: -111.521 flat angles P-C4'-P energy: -81.951 tors. eta vs tors. theta energy: -120.796 Dist. restrs. and SS energy: 37.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 77 Temperature: 1.008000 Total energy: -1455.729108 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1455.729108 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1487.735103 (E_RNA) where: Base-Base interactions energy: -979.567 where: short stacking energy: -452.374 Base-Backbone interact. energy: -4.250 local terms energy: -503.917262 where: bonds (distance) C4'-P energy: -91.741 bonds (distance) P-C4' energy: -101.796 flat angles C4'-P-C4' energy: -112.709 flat angles P-C4'-P energy: -81.584 tors. eta vs tors. theta energy: -116.089 Dist. restrs. and SS energy: 32.006 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 78 Temperature: 1.003500 Total energy: -1508.715700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1508.715700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1546.198907 (E_RNA) where: Base-Base interactions energy: -1012.922 where: short stacking energy: -488.455 Base-Backbone interact. energy: -4.773 local terms energy: -528.504352 where: bonds (distance) C4'-P energy: -102.725 bonds (distance) P-C4' energy: -109.512 flat angles C4'-P-C4' energy: -110.514 flat angles P-C4'-P energy: -78.446 tors. eta vs tors. theta energy: -127.308 Dist. restrs. and SS energy: 37.483 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 79 Temperature: 0.999000 Total energy: -1504.001309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1504.001309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1538.888433 (E_RNA) where: Base-Base interactions energy: -1005.953 where: short stacking energy: -489.576 Base-Backbone interact. energy: -0.893 local terms energy: -532.042512 where: bonds (distance) C4'-P energy: -95.308 bonds (distance) P-C4' energy: -108.335 flat angles C4'-P-C4' energy: -117.408 flat angles P-C4'-P energy: -83.971 tors. eta vs tors. theta energy: -127.019 Dist. restrs. and SS energy: 34.887 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 80 Temperature: 0.994500 Total energy: -1545.198248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1545.198248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1583.021960 (E_RNA) where: Base-Base interactions energy: -1031.086 where: short stacking energy: -508.414 Base-Backbone interact. energy: -3.985 local terms energy: -547.951156 where: bonds (distance) C4'-P energy: -112.708 bonds (distance) P-C4' energy: -117.388 flat angles C4'-P-C4' energy: -108.484 flat angles P-C4'-P energy: -85.745 tors. eta vs tors. theta energy: -123.626 Dist. restrs. and SS energy: 37.824 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 81 Temperature: 0.990000 Total energy: -1573.457835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1573.457835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1607.555481 (E_RNA) where: Base-Base interactions energy: -1040.293 where: short stacking energy: -498.204 Base-Backbone interact. energy: 2.598 local terms energy: -569.861082 where: bonds (distance) C4'-P energy: -108.600 bonds (distance) P-C4' energy: -115.605 flat angles C4'-P-C4' energy: -125.524 flat angles P-C4'-P energy: -84.406 tors. eta vs tors. theta energy: -135.727 Dist. restrs. and SS energy: 34.098 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 82 Temperature: 0.985500 Total energy: -1555.215746 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1555.215746 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1593.903906 (E_RNA) where: Base-Base interactions energy: -1029.126 where: short stacking energy: -506.309 Base-Backbone interact. energy: -1.296 local terms energy: -563.482668 where: bonds (distance) C4'-P energy: -117.009 bonds (distance) P-C4' energy: -111.409 flat angles C4'-P-C4' energy: -120.068 flat angles P-C4'-P energy: -79.136 tors. eta vs tors. theta energy: -135.861 Dist. restrs. and SS energy: 38.688 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 83 Temperature: 0.981000 Total energy: -1559.665396 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1559.665396 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1598.349764 (E_RNA) where: Base-Base interactions energy: -1038.412 where: short stacking energy: -506.328 Base-Backbone interact. energy: -2.826 local terms energy: -557.111642 where: bonds (distance) C4'-P energy: -111.110 bonds (distance) P-C4' energy: -106.320 flat angles C4'-P-C4' energy: -120.415 flat angles P-C4'-P energy: -87.764 tors. eta vs tors. theta energy: -131.502 Dist. restrs. and SS energy: 38.684 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 84 Temperature: 0.976500 Total energy: -1556.773561 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1556.773561 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1591.350130 (E_RNA) where: Base-Base interactions energy: -1046.618 where: short stacking energy: -484.836 Base-Backbone interact. energy: -0.860 local terms energy: -543.872120 where: bonds (distance) C4'-P energy: -112.910 bonds (distance) P-C4' energy: -117.042 flat angles C4'-P-C4' energy: -111.004 flat angles P-C4'-P energy: -69.473 tors. eta vs tors. theta energy: -133.443 Dist. restrs. and SS energy: 34.577 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 85 Temperature: 0.972000 Total energy: -1578.296462 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1578.296462 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1613.869453 (E_RNA) where: Base-Base interactions energy: -1042.827 where: short stacking energy: -484.661 Base-Backbone interact. energy: -4.534 local terms energy: -566.508091 where: bonds (distance) C4'-P energy: -109.850 bonds (distance) P-C4' energy: -127.117 flat angles C4'-P-C4' energy: -120.896 flat angles P-C4'-P energy: -78.319 tors. eta vs tors. theta energy: -130.326 Dist. restrs. and SS energy: 35.573 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 86 Temperature: 0.967500 Total energy: -1592.361473 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1592.361473 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1630.494500 (E_RNA) where: Base-Base interactions energy: -1084.765 where: short stacking energy: -503.678 Base-Backbone interact. energy: 1.595 local terms energy: -547.324772 where: bonds (distance) C4'-P energy: -104.982 bonds (distance) P-C4' energy: -114.665 flat angles C4'-P-C4' energy: -119.705 flat angles P-C4'-P energy: -73.768 tors. eta vs tors. theta energy: -134.205 Dist. restrs. and SS energy: 38.133 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 87 Temperature: 0.963000 Total energy: -1619.357370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1619.357370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1665.612681 (E_RNA) where: Base-Base interactions energy: -1106.647 where: short stacking energy: -514.084 Base-Backbone interact. energy: -1.957 local terms energy: -557.008497 where: bonds (distance) C4'-P energy: -115.644 bonds (distance) P-C4' energy: -104.828 flat angles C4'-P-C4' energy: -122.417 flat angles P-C4'-P energy: -78.896 tors. eta vs tors. theta energy: -135.223 Dist. restrs. and SS energy: 46.255 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 88 Temperature: 0.958500 Total energy: -1633.469856 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1633.469856 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1675.275244 (E_RNA) where: Base-Base interactions energy: -1134.016 where: short stacking energy: -514.362 Base-Backbone interact. energy: -1.195 local terms energy: -540.064244 where: bonds (distance) C4'-P energy: -101.800 bonds (distance) P-C4' energy: -119.094 flat angles C4'-P-C4' energy: -110.443 flat angles P-C4'-P energy: -72.819 tors. eta vs tors. theta energy: -135.908 Dist. restrs. and SS energy: 41.805 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 89 Temperature: 0.954000 Total energy: -1630.334378 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1630.334378 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1672.053124 (E_RNA) where: Base-Base interactions energy: -1094.525 where: short stacking energy: -493.509 Base-Backbone interact. energy: -1.463 local terms energy: -576.065476 where: bonds (distance) C4'-P energy: -115.565 bonds (distance) P-C4' energy: -119.131 flat angles C4'-P-C4' energy: -127.636 flat angles P-C4'-P energy: -80.604 tors. eta vs tors. theta energy: -133.130 Dist. restrs. and SS energy: 41.719 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 90 Temperature: 0.949500 Total energy: -1651.855459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1651.855459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1695.118124 (E_RNA) where: Base-Base interactions energy: -1122.982 where: short stacking energy: -539.366 Base-Backbone interact. energy: -2.418 local terms energy: -569.718233 where: bonds (distance) C4'-P energy: -110.928 bonds (distance) P-C4' energy: -109.714 flat angles C4'-P-C4' energy: -123.667 flat angles P-C4'-P energy: -81.030 tors. eta vs tors. theta energy: -144.379 Dist. restrs. and SS energy: 43.263 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 91 Temperature: 0.945000 Total energy: -1665.700636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1665.700636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1709.660697 (E_RNA) where: Base-Base interactions energy: -1120.804 where: short stacking energy: -528.937 Base-Backbone interact. energy: -2.429 local terms energy: -586.427885 where: bonds (distance) C4'-P energy: -120.951 bonds (distance) P-C4' energy: -122.772 flat angles C4'-P-C4' energy: -117.521 flat angles P-C4'-P energy: -75.740 tors. eta vs tors. theta energy: -149.443 Dist. restrs. and SS energy: 43.960 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 92 Temperature: 0.940500 Total energy: -1670.986493 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1670.986493 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1707.161009 (E_RNA) where: Base-Base interactions energy: -1137.286 where: short stacking energy: -495.966 Base-Backbone interact. energy: -2.800 local terms energy: -567.075394 where: bonds (distance) C4'-P energy: -117.144 bonds (distance) P-C4' energy: -110.890 flat angles C4'-P-C4' energy: -121.512 flat angles P-C4'-P energy: -80.284 tors. eta vs tors. theta energy: -137.245 Dist. restrs. and SS energy: 36.175 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 93 Temperature: 0.936000 Total energy: -1690.392120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1690.392120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1728.056196 (E_RNA) where: Base-Base interactions energy: -1159.971 where: short stacking energy: -536.054 Base-Backbone interact. energy: -4.141 local terms energy: -563.944118 where: bonds (distance) C4'-P energy: -109.661 bonds (distance) P-C4' energy: -115.800 flat angles C4'-P-C4' energy: -118.336 flat angles P-C4'-P energy: -83.481 tors. eta vs tors. theta energy: -136.667 Dist. restrs. and SS energy: 37.664 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 94 Temperature: 0.931500 Total energy: -1667.579677 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1667.579677 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1701.847420 (E_RNA) where: Base-Base interactions energy: -1135.499 where: short stacking energy: -528.476 Base-Backbone interact. energy: 0.233 local terms energy: -566.581137 where: bonds (distance) C4'-P energy: -101.296 bonds (distance) P-C4' energy: -122.352 flat angles C4'-P-C4' energy: -120.161 flat angles P-C4'-P energy: -84.210 tors. eta vs tors. theta energy: -138.562 Dist. restrs. and SS energy: 34.268 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 95 Temperature: 0.927000 Total energy: -1709.750979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1709.750979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1754.468669 (E_RNA) where: Base-Base interactions energy: -1186.613 where: short stacking energy: -529.378 Base-Backbone interact. energy: 0.898 local terms energy: -568.753708 where: bonds (distance) C4'-P energy: -110.032 bonds (distance) P-C4' energy: -114.987 flat angles C4'-P-C4' energy: -119.379 flat angles P-C4'-P energy: -79.726 tors. eta vs tors. theta energy: -144.631 Dist. restrs. and SS energy: 44.718 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 96 Temperature: 0.922500 Total energy: -1717.036209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1717.036209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1756.400572 (E_RNA) where: Base-Base interactions energy: -1202.288 where: short stacking energy: -507.349 Base-Backbone interact. energy: 0.969 local terms energy: -555.082167 where: bonds (distance) C4'-P energy: -114.462 bonds (distance) P-C4' energy: -113.071 flat angles C4'-P-C4' energy: -117.977 flat angles P-C4'-P energy: -71.716 tors. eta vs tors. theta energy: -137.856 Dist. restrs. and SS energy: 39.364 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 97 Temperature: 0.918000 Total energy: -1710.141605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1710.141605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1747.495575 (E_RNA) where: Base-Base interactions energy: -1174.788 where: short stacking energy: -533.657 Base-Backbone interact. energy: 1.566 local terms energy: -574.273104 where: bonds (distance) C4'-P energy: -102.493 bonds (distance) P-C4' energy: -114.423 flat angles C4'-P-C4' energy: -129.395 flat angles P-C4'-P energy: -86.437 tors. eta vs tors. theta energy: -141.526 Dist. restrs. and SS energy: 37.354 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 98 Temperature: 0.913500 Total energy: -1732.201710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1732.201710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1766.468352 (E_RNA) where: Base-Base interactions energy: -1205.971 where: short stacking energy: -561.618 Base-Backbone interact. energy: -3.076 local terms energy: -557.422040 where: bonds (distance) C4'-P energy: -109.503 bonds (distance) P-C4' energy: -116.697 flat angles C4'-P-C4' energy: -108.325 flat angles P-C4'-P energy: -82.655 tors. eta vs tors. theta energy: -140.242 Dist. restrs. and SS energy: 34.267 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 99 Temperature: 0.909000 Total energy: -1763.752498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1763.752498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1799.770746 (E_RNA) where: Base-Base interactions energy: -1225.741 where: short stacking energy: -551.529 Base-Backbone interact. energy: -4.113 local terms energy: -569.915967 where: bonds (distance) C4'-P energy: -126.727 bonds (distance) P-C4' energy: -105.368 flat angles C4'-P-C4' energy: -123.595 flat angles P-C4'-P energy: -80.054 tors. eta vs tors. theta energy: -134.172 Dist. restrs. and SS energy: 36.018 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 100 Temperature: 0.904500 Total energy: -1744.334704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1744.334704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1780.641809 (E_RNA) where: Base-Base interactions energy: -1206.166 where: short stacking energy: -561.554 Base-Backbone interact. energy: -1.775 local terms energy: -572.700468 where: bonds (distance) C4'-P energy: -115.057 bonds (distance) P-C4' energy: -116.524 flat angles C4'-P-C4' energy: -117.727 flat angles P-C4'-P energy: -79.805 tors. eta vs tors. theta energy: -143.587 Dist. restrs. and SS energy: 36.307 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ===================================== Write number: 101 Temperature: 0.900000 Total energy: -1754.305531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -1754.305531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -1792.983013 (E_RNA) where: Base-Base interactions energy: -1224.759 where: short stacking energy: -540.362 Base-Backbone interact. energy: -3.094 local terms energy: -565.129979 where: bonds (distance) C4'-P energy: -116.313 bonds (distance) P-C4' energy: -106.847 flat angles C4'-P-C4' energy: -121.277 flat angles P-C4'-P energy: -72.388 tors. eta vs tors. theta energy: -148.305 Dist. restrs. and SS energy: 38.677 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) .writing output current total energy: -1659.090501 recalc. total energy: -1659.090501 numberOfNucleotides: 184 initial temperature kT: 1.350000 moves confirmed at first: 27890381 moves confirmed later: 32452973 all moves confirmed: 60343354 percent of confirmed moves: 37.714596 out arg RESULTS//1/G-quadruplex-e6329cac_01 nucl1: 0, chain1: A, <---> nucl2: 2, chain2: A type of interaction: GA_SHt nucl1: 0, chain1: A, <---> nucl2: 3, chain2: A type of interaction: GG_WHc nucl1: 0, chain1: A, <---> nucl2: 9, chain2: A type of interaction: GG_HWc nucl1: 1, chain1: A, <---> nucl2: 4, chain2: A type of interaction: GG_WHc nucl1: 1, chain1: A, <---> nucl2: 10, chain2: A type of interaction: GG_HWc nucl1: 3, chain1: A, <---> nucl2: 6, chain2: A type of interaction: GG_WHc nucl1: 4, chain1: A, <---> nucl2: 7, chain2: A type of interaction: GG_WHc nucl1: 6, chain1: A, <---> nucl2: 8, chain2: A type of interaction: GA_SHt nucl1: 6, chain1: A, <---> nucl2: 9, chain2: A type of interaction: GG_WHc nucl1: 7, chain1: A, <---> nucl2: 10, chain2: A type of interaction: GG_WHc Time of doing 1600000 iterations: 2842.728 seconds